>Feature sequence001 347 1309 gene locus_tag LOCUS_00010 347 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1647 1573 gene locus_tag LOCUS_t00010 1647 1573 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3247 1706 gene locus_tag LOCUS_00020 3247 1706 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_00020 4107 3274 gene locus_tag LOCUS_00030 4107 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4253 4837 gene locus_tag LOCUS_00040 gene coaE 4253 4837 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056742.1 protein_id gnl|my_center|LOCUS_00040 5569 5312 gene locus_tag LOCUS_00050 5569 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5645 6946 gene locus_tag LOCUS_00060 gene rho 5645 6946 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083462.1 protein_id gnl|my_center|LOCUS_00060 6956 8692 gene locus_tag LOCUS_00070 gene xcpR 6956 8692 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_00070 8712 9794 gene locus_tag LOCUS_00080 8712 9794 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_00080 9965 11500 gene locus_tag LOCUS_00090 9965 11500 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_00090 11503 12780 gene locus_tag LOCUS_00100 11503 12780 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_00100 13839 12844 gene locus_tag LOCUS_00110 gene yhaM 13839 12844 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 protein_id gnl|my_center|LOCUS_00110 14657 13995 gene locus_tag LOCUS_00120 14657 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14714 15244 gene locus_tag LOCUS_00130 14714 15244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17421 15265 gene locus_tag LOCUS_00140 gene ppk1 17421 15265 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206067.1 protein_id gnl|my_center|LOCUS_00140 18366 17605 gene locus_tag LOCUS_00150 gene hisF 18366 17605 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501998.1 protein_id gnl|my_center|LOCUS_00150 20265 18511 gene locus_tag LOCUS_00160 20265 18511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21565 20351 gene locus_tag LOCUS_00170 gene rho 21565 20351 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_00170 21666 23615 gene locus_tag LOCUS_00180 gene acs 21666 23615 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_00180 23722 24321 gene locus_tag LOCUS_00190 23722 24321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24399 24971 gene locus_tag LOCUS_00200 24399 24971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24971 25633 gene locus_tag LOCUS_00210 24971 25633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25650 26237 gene locus_tag LOCUS_00220 25650 26237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26234 27199 gene locus_tag LOCUS_00230 26234 27199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27203 30247 gene locus_tag LOCUS_00240 27203 30247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30250 30960 gene locus_tag LOCUS_00250 30250 30960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30984 31658 gene locus_tag LOCUS_00260 30984 31658 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140815.1 protein_id gnl|my_center|LOCUS_00260 31743 31668 gene locus_tag LOCUS_t00020 31743 31668 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 32005 35628 gene locus_tag LOCUS_00270 gene nifJ 32005 35628 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257946.1 protein_id gnl|my_center|LOCUS_00270 35640 36632 gene locus_tag LOCUS_00280 35640 36632 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_00280 37001 38428 gene locus_tag LOCUS_00290 37001 38428 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_00290 40056 38590 gene locus_tag LOCUS_00300 40056 38590 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257845.1 protein_id gnl|my_center|LOCUS_00300 41552 40053 gene locus_tag LOCUS_00310 41552 40053 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_00310 43072 41549 gene locus_tag LOCUS_00320 43072 41549 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719680.1 protein_id gnl|my_center|LOCUS_00320 45099 43069 gene locus_tag LOCUS_00330 gene nuoL 45099 43069 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_00330 45412 45104 gene locus_tag LOCUS_00340 gene nuoK 45412 45104 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_00340 45927 45409 gene locus_tag LOCUS_00350 45927 45409 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_00350 47135 45924 gene locus_tag LOCUS_00360 gene nuoH 47135 45924 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257851.1 protein_id gnl|my_center|LOCUS_00360 47746 47132 gene locus_tag LOCUS_00370 47746 47132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00370 48954 47782 gene locus_tag LOCUS_00380 48954 47782 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_00380 49601 48951 gene locus_tag LOCUS_00390 49601 48951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 50301 49612 gene locus_tag LOCUS_00400 50301 49612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 50674 50303 gene locus_tag LOCUS_00410 gene ndhC 50674 50303 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_00410 53322 50827 gene locus_tag LOCUS_00420 53322 50827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 53520 54083 gene locus_tag LOCUS_00430 53520 54083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 55117 54104 gene locus_tag LOCUS_00440 55117 54104 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_00440 55235 56353 gene locus_tag LOCUS_00450 gene prfA 55235 56353 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_00450 56355 57203 gene locus_tag LOCUS_00460 gene prmC 56355 57203 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_00460 59458 57236 gene locus_tag LOCUS_00470 59458 57236 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_00470 60513 59596 gene locus_tag LOCUS_00480 60513 59596 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921963.1 protein_id gnl|my_center|LOCUS_00480 60659 60895 gene locus_tag LOCUS_00490 60659 60895 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_00490 61044 62891 gene locus_tag LOCUS_00500 61044 62891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 63022 63468 gene locus_tag LOCUS_00510 63022 63468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 63568 64716 gene locus_tag LOCUS_00520 63568 64716 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257480.1 protein_id gnl|my_center|LOCUS_00520 64938 65597 gene locus_tag LOCUS_00530 64938 65597 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_00530 66632 65682 gene locus_tag LOCUS_00540 66632 65682 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_00540 66935 68470 gene locus_tag LOCUS_00550 66935 68470 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403783.1 protein_id gnl|my_center|LOCUS_00550 68558 69895 gene locus_tag LOCUS_00560 68558 69895 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 protein_id gnl|my_center|LOCUS_00560 69892 70761 gene locus_tag LOCUS_00570 69892 70761 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920453.1 protein_id gnl|my_center|LOCUS_00570 70758 72080 gene locus_tag LOCUS_00580 70758 72080 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480406.1 protein_id gnl|my_center|LOCUS_00580 72102 72497 gene locus_tag LOCUS_00590 72102 72497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 72673 72586 gene locus_tag LOCUS_t00030 72673 72586 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 72914 73912 gene locus_tag LOCUS_00600 72914 73912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 73917 74504 gene locus_tag LOCUS_00610 73917 74504 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083090.1 protein_id gnl|my_center|LOCUS_00610 74680 75438 gene locus_tag LOCUS_00620 74680 75438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 75468 76700 gene locus_tag LOCUS_00630 75468 76700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 76826 78052 gene locus_tag LOCUS_00640 gene nusA 76826 78052 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_00640 78083 80482 gene locus_tag LOCUS_00650 78083 80482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 80556 80918 gene locus_tag LOCUS_00660 80556 80918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 80915 81934 gene locus_tag LOCUS_00670 80915 81934 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_00670 81931 82656 gene locus_tag LOCUS_00680 81931 82656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 82653 83600 gene locus_tag LOCUS_00690 82653 83600 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532363.1 protein_id gnl|my_center|LOCUS_00690 83638 83714 gene locus_tag LOCUS_t00040 83638 83714 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 86900 84501 gene locus_tag LOCUS_00700 86900 84501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 87021 87329 gene locus_tag LOCUS_00710 87021 87329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 88946 87381 gene locus_tag LOCUS_00720 88946 87381 CDS product POT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070418.1 protein_id gnl|my_center|LOCUS_00720 89369 89037 gene locus_tag LOCUS_00730 89369 89037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 89529 91193 gene locus_tag LOCUS_00740 gene recN 89529 91193 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_00740 91256 91954 gene locus_tag LOCUS_00750 gene pxpB 91256 91954 CDS product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 protein_id gnl|my_center|LOCUS_00750 91945 92871 gene locus_tag LOCUS_00760 91945 92871 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382227.1 protein_id gnl|my_center|LOCUS_00760 92937 93692 gene locus_tag LOCUS_00770 gene pxpA 92937 93692 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097547.1 protein_id gnl|my_center|LOCUS_00770 93689 94384 gene locus_tag LOCUS_00780 93689 94384 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593392.1 protein_id gnl|my_center|LOCUS_00780 94381 95346 gene locus_tag LOCUS_00790 94381 95346 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021671.1 protein_id gnl|my_center|LOCUS_00790 95378 96016 gene locus_tag LOCUS_00800 gene pcp 95378 96016 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704765.1 protein_id gnl|my_center|LOCUS_00800 97719 96055 gene locus_tag LOCUS_00810 97719 96055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 98967 97864 gene locus_tag LOCUS_00820 gene ychF 98967 97864 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_00820 99071 99328 gene locus_tag LOCUS_00830 99071 99328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 99443 100120 gene locus_tag LOCUS_00840 gene trmD 99443 100120 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_00840 100127 100498 gene locus_tag LOCUS_00850 gene rplS 100127 100498 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068669.1 protein_id gnl|my_center|LOCUS_00850 100734 102728 gene locus_tag LOCUS_00860 gene tkt 100734 102728 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_00860 102846 103421 gene locus_tag LOCUS_00870 gene yetL 102846 103421 CDS product transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233796.1 protein_id gnl|my_center|LOCUS_00870 103460 104599 gene locus_tag LOCUS_00880 103460 104599 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_00880 104610 107696 gene locus_tag LOCUS_00890 104610 107696 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_00890 107693 109027 gene locus_tag LOCUS_00900 107693 109027 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870126.1 protein_id gnl|my_center|LOCUS_00900 109121 112111 gene locus_tag LOCUS_00910 109121 112111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 112177 113043 gene locus_tag LOCUS_00920 112177 113043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00920 113069 114097 gene locus_tag LOCUS_00930 113069 114097 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_00930 114201 115079 gene locus_tag LOCUS_00940 114201 115079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_00940 115076 116176 gene locus_tag LOCUS_00950 115076 116176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443464.1 protein_id gnl|my_center|LOCUS_00950 116240 117241 gene locus_tag LOCUS_00960 116240 117241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 117238 117882 gene locus_tag LOCUS_00970 117238 117882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 117924 120158 gene locus_tag LOCUS_00980 117924 120158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 120227 121663 gene locus_tag LOCUS_00990 120227 121663 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_00990 121660 122118 gene locus_tag LOCUS_01000 121660 122118 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208525.1 protein_id gnl|my_center|LOCUS_01000 122219 126022 gene locus_tag LOCUS_01010 gene smc 122219 126022 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899542.1 protein_id gnl|my_center|LOCUS_01010 128323 126143 gene locus_tag LOCUS_01020 128323 126143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 128424 128864 gene locus_tag LOCUS_01030 128424 128864 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404560.1 protein_id gnl|my_center|LOCUS_01030 128917 130455 gene locus_tag LOCUS_01040 gene zwf 128917 130455 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_01040 130479 131465 gene locus_tag LOCUS_01050 130479 131465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 132767 131496 gene locus_tag LOCUS_01060 132767 131496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 133992 132841 gene locus_tag LOCUS_01070 133992 132841 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941150.1 protein_id gnl|my_center|LOCUS_01070 135302 134025 gene locus_tag LOCUS_01080 gene tyrS 135302 134025 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_01080 135531 136004 gene locus_tag LOCUS_01090 135531 136004 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_01090 136045 138750 gene locus_tag LOCUS_01100 gene acnA 136045 138750 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_01100 138822 139331 gene locus_tag LOCUS_01110 138822 139331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 139461 140900 gene locus_tag LOCUS_01120 139461 140900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 140975 142201 gene locus_tag LOCUS_01130 gene trpB 140975 142201 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_01130 142248 143111 gene locus_tag LOCUS_01140 142248 143111 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_01140 143666 143130 gene locus_tag LOCUS_01150 gene lspA 143666 143130 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256792.1 protein_id gnl|my_center|LOCUS_01150 144576 143674 gene locus_tag LOCUS_01160 144576 143674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 147451 144602 gene locus_tag LOCUS_01170 gene ileS 147451 144602 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_01170 148594 147566 gene locus_tag LOCUS_01180 gene hemE 148594 147566 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210686.1 protein_id gnl|my_center|LOCUS_01180 148683 149465 gene locus_tag LOCUS_01190 148683 149465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918209.1 protein_id gnl|my_center|LOCUS_01190 150514 149489 gene locus_tag LOCUS_01200 150514 149489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 <151353 150606 gene locus_tag LOCUS_01210 <151353 150606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143151.1:peptide chain release factor 3 >Feature sequence002 2756 1794 gene locus_tag LOCUS_01220 2756 1794 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_01220 3784 2798 gene locus_tag LOCUS_01230 3784 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 4024 5130 gene locus_tag LOCUS_01240 4024 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 5162 5593 gene locus_tag LOCUS_01250 5162 5593 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038200.1 protein_id gnl|my_center|LOCUS_01250 6707 5637 gene locus_tag LOCUS_01260 6707 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 7370 9298 gene locus_tag LOCUS_01270 7370 9298 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114310.1 protein_id gnl|my_center|LOCUS_01270 10306 9374 gene locus_tag LOCUS_01280 10306 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 11139 10342 gene locus_tag LOCUS_01290 11139 10342 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_01290 11322 12611 gene locus_tag LOCUS_01300 11322 12611 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_01300 12916 12731 gene locus_tag LOCUS_01310 12916 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 14231 13278 gene locus_tag LOCUS_01320 14231 13278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 14446 14820 gene locus_tag LOCUS_01330 14446 14820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 15743 14814 gene locus_tag LOCUS_01340 gene ppk2 15743 14814 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524222.1 protein_id gnl|my_center|LOCUS_01340 15937 17412 gene locus_tag LOCUS_01350 gene pap 15937 17412 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_01350 17422 17961 gene locus_tag LOCUS_01360 17422 17961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 18609 18085 gene locus_tag LOCUS_01370 18609 18085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 19525 18935 gene locus_tag LOCUS_01380 19525 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 20010 20234 gene locus_tag LOCUS_01390 20010 20234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 20550 20951 gene locus_tag LOCUS_01400 20550 20951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 21014 21349 gene locus_tag LOCUS_01410 21014 21349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 21589 21504 gene locus_tag LOCUS_t00050 21589 21504 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21733 22491 gene locus_tag LOCUS_01420 21733 22491 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809442.1 protein_id gnl|my_center|LOCUS_01420 23097 22627 gene locus_tag LOCUS_01430 23097 22627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 24087 23290 gene locus_tag LOCUS_01440 gene kdsA 24087 23290 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879994.1 protein_id gnl|my_center|LOCUS_01440 25784 24135 gene locus_tag LOCUS_01450 25784 24135 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_01450 26101 25904 gene locus_tag LOCUS_01460 26101 25904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 26236 26622 gene locus_tag LOCUS_01470 26236 26622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 26658 27662 gene locus_tag LOCUS_01480 26658 27662 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_01480 27734 28651 gene locus_tag LOCUS_01490 27734 28651 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 protein_id gnl|my_center|LOCUS_01490 28720 30120 gene locus_tag LOCUS_01500 28720 30120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 30308 31579 gene locus_tag LOCUS_01510 30308 31579 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_01510 31590 31745 gene locus_tag LOCUS_01520 31590 31745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 31844 32617 gene locus_tag LOCUS_01530 31844 32617 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328197.1 protein_id gnl|my_center|LOCUS_01530 32621 33454 gene locus_tag LOCUS_01540 32621 33454 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869681.1 protein_id gnl|my_center|LOCUS_01540 34064 35308 gene locus_tag LOCUS_01550 gene dxr 34064 35308 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_01550 35314 36753 gene locus_tag LOCUS_01560 gene rseP 35314 36753 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816967.1 protein_id gnl|my_center|LOCUS_01560 36764 38791 gene locus_tag LOCUS_01570 36764 38791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 39349 40692 gene locus_tag LOCUS_01580 gene dnaA 39349 40692 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_01580 40885 41415 gene locus_tag LOCUS_01590 40885 41415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 43675 41471 gene locus_tag LOCUS_01600 gene ligA 43675 41471 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 protein_id gnl|my_center|LOCUS_01600 44115 43672 gene locus_tag LOCUS_01610 44115 43672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 44339 44415 gene locus_tag LOCUS_t00060 44339 44415 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44971 44537 gene locus_tag LOCUS_01620 44971 44537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 45991 45737 gene locus_tag LOCUS_01630 45991 45737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 46400 47473 gene locus_tag LOCUS_01640 46400 47473 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_01640 49012 47885 gene locus_tag LOCUS_01650 49012 47885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 49249 50196 gene locus_tag LOCUS_01660 49249 50196 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_01660 50193 51041 gene locus_tag LOCUS_01670 50193 51041 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112888.1 protein_id gnl|my_center|LOCUS_01670 51119 54418 gene locus_tag LOCUS_01680 51119 54418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 54660 55415 gene locus_tag LOCUS_01690 54660 55415 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_01690 56357 55437 gene locus_tag LOCUS_01700 56357 55437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 57599 56382 gene locus_tag LOCUS_01710 57599 56382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 58919 57672 gene locus_tag LOCUS_01720 58919 57672 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466255.1 protein_id gnl|my_center|LOCUS_01720 59186 59010 gene locus_tag LOCUS_01730 59186 59010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 59307 60959 gene locus_tag LOCUS_01740 59307 60959 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_01740 60986 62500 gene locus_tag LOCUS_01750 gene araA 60986 62500 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776919.1 protein_id gnl|my_center|LOCUS_01750 62522 63526 gene locus_tag LOCUS_01760 gene araF 62522 63526 CDS product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027935.1 protein_id gnl|my_center|LOCUS_01760 63544 65067 gene locus_tag LOCUS_01770 gene araG 63544 65067 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267630.1 protein_id gnl|my_center|LOCUS_01770 65074 66030 gene locus_tag LOCUS_01780 gene araH 65074 66030 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096046.1 protein_id gnl|my_center|LOCUS_01780 66086 66799 gene locus_tag LOCUS_01790 gene araD 66086 66799 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888654.1 protein_id gnl|my_center|LOCUS_01790 66886 68538 gene locus_tag LOCUS_01800 66886 68538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 68653 70488 gene locus_tag LOCUS_01810 gene recQ 68653 70488 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_01810 72442 70526 gene locus_tag LOCUS_01820 72442 70526 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_01820 73980 72469 gene locus_tag LOCUS_01830 gene ilvA 73980 72469 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815155.1 protein_id gnl|my_center|LOCUS_01830 74285 73977 gene locus_tag LOCUS_01840 74285 73977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 74188 75261 gene locus_tag LOCUS_01850 74188 75261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01850 75267 78017 gene locus_tag LOCUS_01860 75267 78017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01860 78133 80283 gene locus_tag LOCUS_01870 78133 80283 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994073.1 protein_id gnl|my_center|LOCUS_01870 80300 80758 gene locus_tag LOCUS_01880 80300 80758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 80832 81713 gene locus_tag LOCUS_01890 80832 81713 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_01890 >Feature sequence003 <1 1331 gene locus_tag LOCUS_01900 <1 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257071.1:NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein 1347 2063 gene locus_tag LOCUS_01910 gene hoxU 1347 2063 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_01910 2051 2599 gene locus_tag LOCUS_01920 2051 2599 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_01920 2612 4036 gene locus_tag LOCUS_01930 2612 4036 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_01930 4046 4525 gene locus_tag LOCUS_01940 4046 4525 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_01940 5632 4646 gene locus_tag LOCUS_01950 gene cysK 5632 4646 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528637.1 protein_id gnl|my_center|LOCUS_01950 6719 5685 gene locus_tag LOCUS_01960 6719 5685 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942002.1 protein_id gnl|my_center|LOCUS_01960 7608 6727 gene locus_tag LOCUS_01970 gene cysW 7608 6727 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_01970 8456 7611 gene locus_tag LOCUS_01980 gene cysT 8456 7611 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942000.1 protein_id gnl|my_center|LOCUS_01980 9259 8453 gene locus_tag LOCUS_01990 9259 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 10129 9353 gene locus_tag LOCUS_02000 10129 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11202 10240 gene locus_tag LOCUS_02010 11202 10240 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_02010 11532 11341 gene locus_tag LOCUS_02020 11532 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 12142 11543 gene locus_tag LOCUS_02030 12142 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 13103 12261 gene locus_tag LOCUS_02040 13103 12261 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_02040 15122 13167 gene locus_tag LOCUS_02050 gene ligA 15122 13167 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_02050 16953 15313 gene locus_tag LOCUS_02060 gene groL 16953 15313 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_02060 17294 16998 gene locus_tag LOCUS_02070 gene groES 17294 16998 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_02070 19349 17388 gene locus_tag LOCUS_02080 gene dnaK 19349 17388 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_02080 19631 20314 gene locus_tag LOCUS_02090 19631 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 20504 20429 gene locus_tag LOCUS_t00070 20504 20429 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20856 21209 gene locus_tag LOCUS_02100 20856 21209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 22154 21213 gene locus_tag LOCUS_02110 22154 21213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 22773 22288 gene locus_tag LOCUS_02120 22773 22288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 25642 22913 gene locus_tag LOCUS_02130 25642 22913 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256996.1 protein_id gnl|my_center|LOCUS_02130 26231 25680 gene locus_tag LOCUS_02140 26231 25680 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583077.1 protein_id gnl|my_center|LOCUS_02140 27373 26357 gene locus_tag LOCUS_02150 27373 26357 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_02150 28447 27428 gene locus_tag LOCUS_02160 28447 27428 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_02160 31071 28444 gene locus_tag LOCUS_02170 31071 28444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 34433 31068 gene locus_tag LOCUS_02180 34433 31068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 35638 34439 gene locus_tag LOCUS_02190 35638 34439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 36717 35680 gene locus_tag LOCUS_02200 36717 35680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 38775 36763 gene locus_tag LOCUS_02210 38775 36763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 39773 38817 gene locus_tag LOCUS_02220 39773 38817 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211128.1 protein_id gnl|my_center|LOCUS_02220 40664 39777 gene locus_tag LOCUS_02230 40664 39777 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_02230 41463 40654 gene locus_tag LOCUS_02240 41463 40654 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_02240 41598 42368 gene locus_tag LOCUS_02250 gene pyrH 41598 42368 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_02250 42471 43016 gene locus_tag LOCUS_02260 gene frr 42471 43016 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389464.1 protein_id gnl|my_center|LOCUS_02260 43017 44204 gene locus_tag LOCUS_02270 gene proB 43017 44204 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_02270 44326 46335 gene locus_tag LOCUS_02280 44326 46335 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080037.1 protein_id gnl|my_center|LOCUS_02280 46332 47282 gene locus_tag LOCUS_02290 46332 47282 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 protein_id gnl|my_center|LOCUS_02290 48506 47331 gene locus_tag LOCUS_02300 48506 47331 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 protein_id gnl|my_center|LOCUS_02300 48633 49577 gene locus_tag LOCUS_02310 gene trxB 48633 49577 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_02310 50181 49741 gene locus_tag LOCUS_02320 50181 49741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 50337 50867 gene locus_tag LOCUS_02330 50337 50867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02330 50965 51411 gene locus_tag LOCUS_02340 50965 51411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 51438 52193 gene locus_tag LOCUS_02350 gene sufC 51438 52193 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831944.1 protein_id gnl|my_center|LOCUS_02350 52230 53687 gene locus_tag LOCUS_02360 gene sufB 52230 53687 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_02360 53742 55058 gene locus_tag LOCUS_02370 gene sufD 53742 55058 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_02370 55129 55671 gene locus_tag LOCUS_02380 gene sufT 55129 55671 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_02380 57356 55686 gene locus_tag LOCUS_02390 57356 55686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 59085 57439 gene locus_tag LOCUS_02400 gene ade 59085 57439 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118829317.1 protein_id gnl|my_center|LOCUS_02400 59179 59832 gene locus_tag LOCUS_02410 59179 59832 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115288.1 protein_id gnl|my_center|LOCUS_02410 61528 59882 gene locus_tag LOCUS_02420 61528 59882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 61686 62078 gene locus_tag LOCUS_02430 gene crcB 61686 62078 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_02430 62096 62524 gene locus_tag LOCUS_02440 62096 62524 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_02440 63610 62534 gene locus_tag LOCUS_02450 63610 62534 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035558.1 protein_id gnl|my_center|LOCUS_02450 64707 63607 gene locus_tag LOCUS_02460 64707 63607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 65421 64762 gene locus_tag LOCUS_02470 gene infC 65421 64762 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 protein_id gnl|my_center|LOCUS_02470 65910 65530 gene locus_tag LOCUS_02480 65910 65530 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144365.1 protein_id gnl|my_center|LOCUS_02480 66845 65922 gene locus_tag LOCUS_02490 gene pdxA 66845 65922 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532510.1 protein_id gnl|my_center|LOCUS_02490 67596 66835 gene locus_tag LOCUS_02500 gene lpxA 67596 66835 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971577.1 protein_id gnl|my_center|LOCUS_02500 68234 67602 gene locus_tag LOCUS_02510 68234 67602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 69364 68279 gene locus_tag LOCUS_02520 gene aroB 69364 68279 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439825.1 protein_id gnl|my_center|LOCUS_02520 69508 70836 gene locus_tag LOCUS_02530 gene xylA 69508 70836 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_02530 70852 71262 gene locus_tag LOCUS_02540 70852 71262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 71292 72863 gene locus_tag LOCUS_02550 71292 72863 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816066.1 protein_id gnl|my_center|LOCUS_02550 73066 72779 gene locus_tag LOCUS_02560 73066 72779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 74591 73086 gene locus_tag LOCUS_02570 74591 73086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 74763 75380 gene locus_tag LOCUS_02580 74763 75380 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_02580 75449 76075 gene locus_tag LOCUS_02590 75449 76075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 76165 76575 gene locus_tag LOCUS_02600 76165 76575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02600 76581 77336 gene locus_tag LOCUS_02610 76581 77336 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401354.1 protein_id gnl|my_center|LOCUS_02610 78470 77358 gene locus_tag LOCUS_02620 gene lptG 78470 77358 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_02620 78626 79759 gene locus_tag LOCUS_02630 78626 79759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_02630 80042 80932 gene locus_tag LOCUS_02640 80042 80932 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_02640 80939 81880 gene locus_tag LOCUS_02650 80939 81880 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583299.1 protein_id gnl|my_center|LOCUS_02650 81900 82691 gene locus_tag LOCUS_02660 81900 82691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence004 2368 3030 gene locus_tag LOCUS_02670 2368 3030 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_02670 3027 3476 gene locus_tag LOCUS_02680 3027 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 3539 4201 gene locus_tag LOCUS_02690 3539 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 4296 4371 gene locus_tag LOCUS_t00080 4296 4371 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4449 5639 gene locus_tag LOCUS_02700 gene tuf 4449 5639 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_02700 5722 5797 gene locus_tag LOCUS_t00090 5722 5797 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 5809 6012 gene locus_tag LOCUS_02710 5809 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 6022 6600 gene locus_tag LOCUS_02720 gene nusG 6022 6600 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940183.1 protein_id gnl|my_center|LOCUS_02720 6669 7094 gene locus_tag LOCUS_02730 gene rplK 6669 7094 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_02730 7167 7865 gene locus_tag LOCUS_02740 gene rplA 7167 7865 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_02740 7880 8383 gene locus_tag LOCUS_02750 gene rplJ 7880 8383 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273085.1 protein_id gnl|my_center|LOCUS_02750 8533 8919 gene locus_tag LOCUS_02760 gene rplL 8533 8919 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940187.1 protein_id gnl|my_center|LOCUS_02760 9091 12870 gene locus_tag LOCUS_02770 gene rpoB 9091 12870 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882731.1 protein_id gnl|my_center|LOCUS_02770 12924 17063 gene locus_tag LOCUS_02780 gene rpoC 12924 17063 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_02780 17780 18160 gene locus_tag LOCUS_02790 gene rpsL 17780 18160 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118744.1 protein_id gnl|my_center|LOCUS_02790 18278 18661 gene locus_tag LOCUS_02800 gene rpsG 18278 18661 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_02800 18674 20857 gene locus_tag LOCUS_02810 gene fusA 18674 20857 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_02810 20877 21185 gene locus_tag LOCUS_02820 gene rpsJ 20877 21185 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_02820 21292 21945 gene locus_tag LOCUS_02830 gene rplC 21292 21945 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886956.1 protein_id gnl|my_center|LOCUS_02830 21964 22599 gene locus_tag LOCUS_02840 gene rplD 21964 22599 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_02840 22599 22880 gene locus_tag LOCUS_02850 22599 22880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 22913 23779 gene locus_tag LOCUS_02860 gene rplB 22913 23779 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_02860 23798 24073 gene locus_tag LOCUS_02870 gene rpsS 23798 24073 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_02870 24163 24504 gene locus_tag LOCUS_02880 gene rplV 24163 24504 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393932.1 protein_id gnl|my_center|LOCUS_02880 24512 25144 gene locus_tag LOCUS_02890 gene rpsC 24512 25144 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_02890 25184 25606 gene locus_tag LOCUS_02900 gene rplP 25184 25606 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215430.1 protein_id gnl|my_center|LOCUS_02900 25635 25838 gene locus_tag LOCUS_02910 gene rpmC 25635 25838 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919135.1 protein_id gnl|my_center|LOCUS_02910 25866 26207 gene locus_tag LOCUS_02920 25866 26207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 26245 26610 gene locus_tag LOCUS_02930 gene rplN 26245 26610 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_02930 26612 26878 gene locus_tag LOCUS_02940 26612 26878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 26992 27570 gene locus_tag LOCUS_02950 gene rplE 26992 27570 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_02950 27585 27890 gene locus_tag LOCUS_02960 gene rpsN 27585 27890 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536519.1 protein_id gnl|my_center|LOCUS_02960 27950 28342 gene locus_tag LOCUS_02970 gene rpsH 27950 28342 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_02970 28356 28892 gene locus_tag LOCUS_02980 gene rplF 28356 28892 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088138.1 protein_id gnl|my_center|LOCUS_02980 28922 29284 gene locus_tag LOCUS_02990 gene rplR 28922 29284 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_02990 29294 29947 gene locus_tag LOCUS_03000 29294 29947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 30021 30467 gene locus_tag LOCUS_03010 gene rplO 30021 30467 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869910.1 protein_id gnl|my_center|LOCUS_03010 30522 32027 gene locus_tag LOCUS_03020 gene secY 30522 32027 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_03020 32055 32486 gene locus_tag LOCUS_03030 32055 32486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 32483 33262 gene locus_tag LOCUS_03040 gene map 32483 33262 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_03040 33318 33698 gene locus_tag LOCUS_03050 gene rpsM 33318 33698 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_03050 33711 34343 gene locus_tag LOCUS_03060 33711 34343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 34380 34991 gene locus_tag LOCUS_03070 gene rpsD 34380 34991 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_03070 35041 36042 gene locus_tag LOCUS_03080 gene rpoA 35041 36042 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_03080 36183 36632 gene locus_tag LOCUS_03090 36183 36632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 36706 36933 gene locus_tag LOCUS_03100 36706 36933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 37022 38560 gene locus_tag LOCUS_03110 gene guaA 37022 38560 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_03110 38613 39365 gene locus_tag LOCUS_03120 38613 39365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 39434 40732 gene locus_tag LOCUS_03130 gene hisD 39434 40732 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968703.1 protein_id gnl|my_center|LOCUS_03130 40740 41852 gene locus_tag LOCUS_03140 gene hisC 40740 41852 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_03140 41828 42430 gene locus_tag LOCUS_03150 gene hisB 41828 42430 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_03150 42580 43212 gene locus_tag LOCUS_03160 gene hisH 42580 43212 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207858.1 protein_id gnl|my_center|LOCUS_03160 43334 44629 gene locus_tag LOCUS_03170 43334 44629 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_03170 45388 44645 gene locus_tag LOCUS_03180 45388 44645 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_03180 45443 46186 gene locus_tag LOCUS_03190 gene pdxJ 45443 46186 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482574.1 protein_id gnl|my_center|LOCUS_03190 46183 46602 gene locus_tag LOCUS_03200 gene acpS 46183 46602 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873555.1 protein_id gnl|my_center|LOCUS_03200 46619 47101 gene locus_tag LOCUS_03210 46619 47101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 47098 48615 gene locus_tag LOCUS_03220 47098 48615 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_03220 48605 49729 gene locus_tag LOCUS_03230 gene dprA 48605 49729 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_03230 49735 51828 gene locus_tag LOCUS_03240 49735 51828 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_03240 51874 52953 gene locus_tag LOCUS_03250 51874 52953 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_03250 53787 52966 gene locus_tag LOCUS_03260 53787 52966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 54183 53842 gene locus_tag LOCUS_03270 54183 53842 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_03270 54760 54257 gene locus_tag LOCUS_03280 54760 54257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 55215 54757 gene locus_tag LOCUS_03290 gene nrdR 55215 54757 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203672.1 protein_id gnl|my_center|LOCUS_03290 55788 55222 gene locus_tag LOCUS_03300 55788 55222 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_03300 55969 57117 gene locus_tag LOCUS_03310 gene tgt 55969 57117 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_03310 57214 58140 gene locus_tag LOCUS_03320 57214 58140 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_03320 58255 61239 gene locus_tag LOCUS_03330 gene secA 58255 61239 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873306.1 protein_id gnl|my_center|LOCUS_03330 61248 62888 gene locus_tag LOCUS_03340 gene lnt 61248 62888 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_03340 63093 62902 gene locus_tag LOCUS_03350 63093 62902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 63135 64334 gene locus_tag LOCUS_03360 gene rhaI 63135 64334 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_03360 65304 64501 gene locus_tag LOCUS_03370 65304 64501 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_03370 65661 66713 gene locus_tag LOCUS_03380 65661 66713 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_03380 67634 66771 gene locus_tag LOCUS_03390 67634 66771 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974931.1 protein_id gnl|my_center|LOCUS_03390 67775 68596 gene locus_tag LOCUS_03400 67775 68596 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_03400 68683 70968 gene locus_tag LOCUS_03410 68683 70968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 71464 70991 gene locus_tag LOCUS_03420 71464 70991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 71551 72198 gene locus_tag LOCUS_03430 71551 72198 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_03430 73882 72212 gene locus_tag LOCUS_03440 73882 72212 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921318.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence005 2572 791 gene locus_tag LOCUS_03450 2572 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 4575 2560 gene locus_tag LOCUS_03460 4575 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5756 4554 gene locus_tag LOCUS_03470 gene fabF 5756 4554 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_03470 6903 5764 gene locus_tag LOCUS_03480 6903 5764 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085770.1 protein_id gnl|my_center|LOCUS_03480 7047 8339 gene locus_tag LOCUS_03490 7047 8339 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137617.1 protein_id gnl|my_center|LOCUS_03490 8368 8742 gene locus_tag LOCUS_03500 8368 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 8822 9631 gene locus_tag LOCUS_03510 8822 9631 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_03510 10510 9725 gene locus_tag LOCUS_03520 10510 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 11687 11421 gene locus_tag LOCUS_03530 11687 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 11700 12662 gene locus_tag LOCUS_03540 11700 12662 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_03540 12721 13620 gene locus_tag LOCUS_03550 12721 13620 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_03550 13643 14701 gene locus_tag LOCUS_03560 13643 14701 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_03560 14698 16554 gene locus_tag LOCUS_03570 14698 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 16560 19007 gene locus_tag LOCUS_03580 16560 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 20823 19039 gene locus_tag LOCUS_03590 20823 19039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 21474 20926 gene locus_tag LOCUS_03600 21474 20926 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_03600 22074 21493 gene locus_tag LOCUS_03610 22074 21493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 22157 23029 gene locus_tag LOCUS_03620 gene gluQRS 22157 23029 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_03620 23126 23470 gene locus_tag LOCUS_03630 23126 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 23509 23955 gene locus_tag LOCUS_03640 23509 23955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 24390 24025 gene locus_tag LOCUS_03650 24390 24025 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_03650 24716 25117 gene locus_tag LOCUS_03660 24716 25117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 25208 25411 gene locus_tag LOCUS_03670 25208 25411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 26293 25421 gene locus_tag LOCUS_03680 26293 25421 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388937.1 protein_id gnl|my_center|LOCUS_03680 26824 26306 gene locus_tag LOCUS_03690 26824 26306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 26933 27769 gene locus_tag LOCUS_03700 26933 27769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 27826 28125 gene locus_tag LOCUS_03710 27826 28125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 28701 28144 gene locus_tag LOCUS_03720 28701 28144 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886727.1 protein_id gnl|my_center|LOCUS_03720 28738 29172 gene locus_tag LOCUS_03730 28738 29172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 29715 29188 gene locus_tag LOCUS_03740 29715 29188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 29767 30906 gene locus_tag LOCUS_03750 29767 30906 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_03750 30891 31880 gene locus_tag LOCUS_03760 30891 31880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 31877 32407 gene locus_tag LOCUS_03770 gene gmhB 31877 32407 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095387.1 protein_id gnl|my_center|LOCUS_03770 32449 33273 gene locus_tag LOCUS_03780 gene mutM 32449 33273 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941662.1 protein_id gnl|my_center|LOCUS_03780 33317 34090 gene locus_tag LOCUS_03790 33317 34090 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_03790 35099 34107 gene locus_tag LOCUS_03800 35099 34107 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_03800 35229 35876 gene locus_tag LOCUS_03810 35229 35876 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_03810 35883 36635 gene locus_tag LOCUS_03820 35883 36635 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143173.1 protein_id gnl|my_center|LOCUS_03820 36701 37552 gene locus_tag LOCUS_03830 36701 37552 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_03830 37894 37607 gene locus_tag LOCUS_03840 37894 37607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 38726 37941 gene locus_tag LOCUS_03850 38726 37941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 41284 38723 gene locus_tag LOCUS_03860 41284 38723 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_03860 41746 41309 gene locus_tag LOCUS_03870 41746 41309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_03870 41890 42432 gene locus_tag LOCUS_03880 41890 42432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 43105 42461 gene locus_tag LOCUS_03890 43105 42461 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_03890 44771 43311 gene locus_tag LOCUS_03900 gene gatB 44771 43311 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_03900 46234 44771 gene locus_tag LOCUS_03910 gene gatA 46234 44771 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_03910 46532 46242 gene locus_tag LOCUS_03920 gene gatC 46532 46242 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_03920 48991 46535 gene locus_tag LOCUS_03930 gene pheT 48991 46535 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_03930 50098 49055 gene locus_tag LOCUS_03940 gene pheS 50098 49055 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_03940 50621 50232 gene locus_tag LOCUS_03950 gene rplT 50621 50232 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 protein_id gnl|my_center|LOCUS_03950 50905 50711 gene locus_tag LOCUS_03960 gene rpmI 50905 50711 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583669.1 protein_id gnl|my_center|LOCUS_03960 51240 51314 gene locus_tag LOCUS_t00100 51240 51314 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 51366 51440 gene locus_tag LOCUS_t00110 51366 51440 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 51582 51655 gene locus_tag LOCUS_t00120 51582 51655 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 51996 52664 gene locus_tag LOCUS_03970 51996 52664 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_03970 52717 53151 gene locus_tag LOCUS_03980 52717 53151 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142398.1 protein_id gnl|my_center|LOCUS_03980 53206 53634 gene locus_tag LOCUS_03990 53206 53634 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142398.1 protein_id gnl|my_center|LOCUS_03990 53656 54309 gene locus_tag LOCUS_04000 53656 54309 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179862255.1 protein_id gnl|my_center|LOCUS_04000 54316 55716 gene locus_tag LOCUS_04010 54316 55716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 55739 56287 gene locus_tag LOCUS_04020 55739 56287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 56319 56858 gene locus_tag LOCUS_04030 56319 56858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 57002 57078 gene locus_tag LOCUS_t00130 57002 57078 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 57944 57099 gene locus_tag LOCUS_04040 57944 57099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 58023 58592 gene locus_tag LOCUS_04050 gene pyrE 58023 58592 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393616.1 protein_id gnl|my_center|LOCUS_04050 58820 59899 gene locus_tag LOCUS_04060 58820 59899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 61339 59924 gene locus_tag LOCUS_04070 61339 59924 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_04070 62420 61470 gene locus_tag LOCUS_04080 62420 61470 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_04080 63501 62464 gene locus_tag LOCUS_04090 gene lpxD 63501 62464 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_04090 64304 63627 gene locus_tag LOCUS_04100 64304 63627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 66716 64344 gene locus_tag LOCUS_04110 gene bamA 66716 64344 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_04110 68088 66697 gene locus_tag LOCUS_04120 gene dnaB 68088 66697 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_04120 68697 68212 gene locus_tag LOCUS_04130 gene rplI 68697 68212 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_04130 69267 68788 gene locus_tag LOCUS_04140 69267 68788 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_04140 69590 69294 gene locus_tag LOCUS_04150 69590 69294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 70171 69587 gene locus_tag LOCUS_04160 gene pth 70171 69587 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 protein_id gnl|my_center|LOCUS_04160 71019 70231 gene locus_tag LOCUS_04170 71019 70231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 71230 71304 gene locus_tag LOCUS_t00140 71230 71304 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 <73693 71667 gene locus_tag LOCUS_04180 <73693 71667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein >Feature sequence006 113 853 gene locus_tag LOCUS_04190 113 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 934 1755 gene locus_tag LOCUS_04200 934 1755 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_04200 1752 1946 gene locus_tag LOCUS_04210 1752 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 2007 2204 gene locus_tag LOCUS_04220 2007 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 2450 2226 gene locus_tag LOCUS_04230 2450 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 4649 2556 gene locus_tag LOCUS_04240 gene fusA 4649 2556 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_04240 4913 5362 gene locus_tag LOCUS_04250 4913 5362 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_04250 6455 5373 gene locus_tag LOCUS_04260 6455 5373 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_04260 7470 6538 gene locus_tag LOCUS_04270 7470 6538 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_04270 7629 11168 gene locus_tag LOCUS_04280 7629 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 11799 11218 gene locus_tag LOCUS_04290 11799 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 12029 12667 gene locus_tag LOCUS_04300 12029 12667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 13336 12689 gene locus_tag LOCUS_04310 13336 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 15122 13455 gene locus_tag LOCUS_04320 15122 13455 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_04320 15308 15526 gene locus_tag LOCUS_04330 15308 15526 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082243.1 protein_id gnl|my_center|LOCUS_04330 16234 15548 gene locus_tag LOCUS_04340 16234 15548 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_04340 16703 16305 gene locus_tag LOCUS_04350 16703 16305 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141140.1 protein_id gnl|my_center|LOCUS_04350 17272 16700 gene locus_tag LOCUS_04360 17272 16700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 17929 17318 gene locus_tag LOCUS_04370 gene leuD 17929 17318 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_04370 19417 18005 gene locus_tag LOCUS_04380 gene leuC 19417 18005 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_04380 22157 19635 gene locus_tag LOCUS_04390 22157 19635 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_04390 23267 22176 gene locus_tag LOCUS_04400 23267 22176 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810224.1 protein_id gnl|my_center|LOCUS_04400 23778 23272 gene locus_tag LOCUS_04410 23778 23272 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_04410 24744 23878 gene locus_tag LOCUS_04420 gene ilvE 24744 23878 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_04420 24851 25597 gene locus_tag LOCUS_04430 24851 25597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 25691 27436 gene locus_tag LOCUS_04440 25691 27436 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_04440 27507 29303 gene locus_tag LOCUS_04450 27507 29303 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193654.1 protein_id gnl|my_center|LOCUS_04450 29316 30074 gene locus_tag LOCUS_04460 29316 30074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 31460 30084 gene locus_tag LOCUS_04470 gene gltX 31460 30084 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_04470 31484 32272 gene locus_tag LOCUS_04480 31484 32272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 33113 32292 gene locus_tag LOCUS_04490 33113 32292 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_04490 33760 33110 gene locus_tag LOCUS_04500 33760 33110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 34005 34379 gene locus_tag LOCUS_04510 gene raiA 34005 34379 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 protein_id gnl|my_center|LOCUS_04510 34470 36656 gene locus_tag LOCUS_04520 34470 36656 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_04520 36704 37951 gene locus_tag LOCUS_04530 36704 37951 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_04530 38768 37977 gene locus_tag LOCUS_04540 gene fabG 38768 37977 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_04540 40102 38786 gene locus_tag LOCUS_04550 gene hemL 40102 38786 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045315.1 protein_id gnl|my_center|LOCUS_04550 41630 40122 gene locus_tag LOCUS_04560 41630 40122 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836208.1 protein_id gnl|my_center|LOCUS_04560 43075 41660 gene locus_tag LOCUS_04570 gene araE 43075 41660 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_04570 44086 43094 gene locus_tag LOCUS_04580 44086 43094 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727141.1 protein_id gnl|my_center|LOCUS_04580 45288 44275 gene locus_tag LOCUS_04590 45288 44275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 45528 46598 gene locus_tag LOCUS_04600 45528 46598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 46638 47897 gene locus_tag LOCUS_04610 46638 47897 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_04610 48016 49824 gene locus_tag LOCUS_04620 48016 49824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 50841 49921 gene locus_tag LOCUS_04630 50841 49921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 51334 50828 gene locus_tag LOCUS_04640 51334 50828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 54063 51646 gene locus_tag LOCUS_04650 54063 51646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 56853 54598 gene locus_tag LOCUS_04660 56853 54598 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928501.1 protein_id gnl|my_center|LOCUS_04660 59545 57386 gene locus_tag LOCUS_04670 59545 57386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 59686 60618 gene locus_tag LOCUS_04680 59686 60618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 <62086 60631 gene locus_tag LOCUS_04690 <62086 60631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227769.1:Na+:solute symporter >Feature sequence007 2579 1419 gene locus_tag LOCUS_04700 gene ilvA 2579 1419 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259722.1 protein_id gnl|my_center|LOCUS_04700 2957 3310 gene locus_tag LOCUS_04710 2957 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 3307 4191 gene locus_tag LOCUS_04720 gene pssA 3307 4191 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_04720 4433 5557 gene locus_tag LOCUS_04730 gene dnaN 4433 5557 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_04730 5662 6540 gene locus_tag LOCUS_04740 5662 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 6616 8598 gene locus_tag LOCUS_04750 6616 8598 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114310.1 protein_id gnl|my_center|LOCUS_04750 8625 9833 gene locus_tag LOCUS_04760 8625 9833 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_04760 9886 10197 gene locus_tag LOCUS_04770 9886 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 10780 10199 gene locus_tag LOCUS_04780 gene gmk 10780 10199 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938199.1 protein_id gnl|my_center|LOCUS_04780 11355 10816 gene locus_tag LOCUS_04790 11355 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 12884 11454 gene locus_tag LOCUS_04800 gene miaB 12884 11454 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_04800 12976 13932 gene locus_tag LOCUS_04810 12976 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 14194 15375 gene locus_tag LOCUS_04820 14194 15375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 15438 16502 gene locus_tag LOCUS_04830 15438 16502 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038671.1 protein_id gnl|my_center|LOCUS_04830 17582 16527 gene locus_tag LOCUS_04840 gene rlmN 17582 16527 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392423.1 protein_id gnl|my_center|LOCUS_04840 18467 17649 gene locus_tag LOCUS_04850 18467 17649 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_04850 19846 18476 gene locus_tag LOCUS_04860 19846 18476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 19973 20554 gene locus_tag LOCUS_04870 19973 20554 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_04870 21817 20576 gene locus_tag LOCUS_04880 21817 20576 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_04880 22625 21867 gene locus_tag LOCUS_04890 22625 21867 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209713.1 protein_id gnl|my_center|LOCUS_04890 22730 23233 gene locus_tag LOCUS_04900 22730 23233 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_04900 23277 23915 gene locus_tag LOCUS_04910 gene pdxH 23277 23915 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_04910 23912 25462 gene locus_tag LOCUS_04920 23912 25462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 25534 26205 gene locus_tag LOCUS_04930 25534 26205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 28441 26246 gene locus_tag LOCUS_04940 28441 26246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 29727 28438 gene locus_tag LOCUS_04950 29727 28438 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_04950 29862 30659 gene locus_tag LOCUS_04960 29862 30659 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227823.1 protein_id gnl|my_center|LOCUS_04960 31187 30672 gene locus_tag LOCUS_04970 31187 30672 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389951.1 protein_id gnl|my_center|LOCUS_04970 32218 31184 gene locus_tag LOCUS_04980 32218 31184 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 protein_id gnl|my_center|LOCUS_04980 33912 32215 gene locus_tag LOCUS_04990 33912 32215 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_04990 35108 33930 gene locus_tag LOCUS_05000 35108 33930 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224510.1 protein_id gnl|my_center|LOCUS_05000 35250 35939 gene locus_tag LOCUS_05010 gene queC 35250 35939 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242065.1 protein_id gnl|my_center|LOCUS_05010 35956 36648 gene locus_tag LOCUS_05020 35956 36648 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921555.1 protein_id gnl|my_center|LOCUS_05020 36665 37318 gene locus_tag LOCUS_05030 36665 37318 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819224.1 protein_id gnl|my_center|LOCUS_05030 38141 37356 gene locus_tag LOCUS_05040 gene nagB 38141 37356 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_05040 39397 38150 gene locus_tag LOCUS_05050 39397 38150 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838600.1 protein_id gnl|my_center|LOCUS_05050 40707 39394 gene locus_tag LOCUS_05060 40707 39394 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403883.1 protein_id gnl|my_center|LOCUS_05060 43063 40955 gene locus_tag LOCUS_05070 gene feoB 43063 40955 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510008.1 protein_id gnl|my_center|LOCUS_05070 43307 43065 gene locus_tag LOCUS_05080 43307 43065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 43579 43316 gene locus_tag LOCUS_05090 43579 43316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 44077 43670 gene locus_tag LOCUS_05100 44077 43670 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_05100 45578 44160 gene locus_tag LOCUS_05110 gene atpD 45578 44160 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056375.1 protein_id gnl|my_center|LOCUS_05110 46498 45617 gene locus_tag LOCUS_05120 gene atpG 46498 45617 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817813.1 protein_id gnl|my_center|LOCUS_05120 48108 46582 gene locus_tag LOCUS_05130 gene atpA 48108 46582 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389785.1 protein_id gnl|my_center|LOCUS_05130 48544 48149 gene locus_tag LOCUS_05140 48544 48149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 49168 48581 gene locus_tag LOCUS_05150 49168 48581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 49496 49236 gene locus_tag LOCUS_05160 49496 49236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 50406 49516 gene locus_tag LOCUS_05170 gene atpB 50406 49516 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768272.1 protein_id gnl|my_center|LOCUS_05170 51146 50541 gene locus_tag LOCUS_05180 51146 50541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 53039 51162 gene locus_tag LOCUS_05190 gene mnmG 53039 51162 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873860.1 protein_id gnl|my_center|LOCUS_05190 54457 53093 gene locus_tag LOCUS_05200 gene mnmE 54457 53093 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_05200 54580 55161 gene locus_tag LOCUS_05210 gene pdxH 54580 55161 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918802.1 protein_id gnl|my_center|LOCUS_05210 56445 55198 gene locus_tag LOCUS_05220 56445 55198 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_05220 58825 56459 gene locus_tag LOCUS_05230 58825 56459 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932893.1 protein_id gnl|my_center|LOCUS_05230 59587 58841 gene locus_tag LOCUS_05240 59587 58841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_05240 60767 59697 gene locus_tag LOCUS_05250 gene recA 60767 59697 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969478.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence008 2344 1775 gene locus_tag LOCUS_05260 gene def 2344 1775 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933121.1 protein_id gnl|my_center|LOCUS_05260 2406 4067 gene locus_tag LOCUS_05270 2406 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 4064 5455 gene locus_tag LOCUS_05280 4064 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 5541 6785 gene locus_tag LOCUS_05290 5541 6785 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_05290 10662 6796 gene locus_tag LOCUS_05300 10662 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 13605 10828 gene locus_tag LOCUS_05310 13605 10828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 15558 13624 gene locus_tag LOCUS_05320 15558 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 17127 15631 gene locus_tag LOCUS_05330 17127 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 17978 17217 gene locus_tag LOCUS_05340 17978 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 18982 17996 gene locus_tag LOCUS_05350 18982 17996 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_05350 20039 19047 gene locus_tag LOCUS_05360 20039 19047 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_05360 20800 20174 gene locus_tag LOCUS_05370 20800 20174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 21128 20877 gene locus_tag LOCUS_05380 21128 20877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 22451 21174 gene locus_tag LOCUS_05390 22451 21174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 22348 23046 gene locus_tag LOCUS_05400 gene mtnP 22348 23046 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_05400 23124 23954 gene locus_tag LOCUS_05410 23124 23954 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229064.1 protein_id gnl|my_center|LOCUS_05410 24065 25036 gene locus_tag LOCUS_05420 24065 25036 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_05420 25077 26327 gene locus_tag LOCUS_05430 25077 26327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 26302 28524 gene locus_tag LOCUS_05440 26302 28524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 30487 28511 gene locus_tag LOCUS_05450 gene mrdA 30487 28511 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_05450 31006 30497 gene locus_tag LOCUS_05460 31006 30497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 31888 31058 gene locus_tag LOCUS_05470 31888 31058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 32972 31959 gene locus_tag LOCUS_05480 32972 31959 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_05480 33113 35431 gene locus_tag LOCUS_05490 33113 35431 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099684.1 protein_id gnl|my_center|LOCUS_05490 35726 35493 gene locus_tag LOCUS_05500 35726 35493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 37633 35786 gene locus_tag LOCUS_05510 37633 35786 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883393.1 protein_id gnl|my_center|LOCUS_05510 39519 37660 gene locus_tag LOCUS_05520 39519 37660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 39632 40681 gene locus_tag LOCUS_05530 39632 40681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 40727 41101 gene locus_tag LOCUS_05540 40727 41101 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_05540 41224 42567 gene locus_tag LOCUS_05550 41224 42567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 42635 42799 gene locus_tag LOCUS_05560 gene rpmG 42635 42799 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_05560 43137 42889 gene locus_tag LOCUS_05570 43137 42889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 44274 43210 gene locus_tag LOCUS_05580 44274 43210 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_05580 44380 45570 gene locus_tag LOCUS_05590 44380 45570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 46278 45646 gene locus_tag LOCUS_05600 46278 45646 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_05600 46921 46400 gene locus_tag LOCUS_05610 gene tadA 46921 46400 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_05610 47045 47308 gene locus_tag LOCUS_05620 gene infA 47045 47308 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 protein_id gnl|my_center|LOCUS_05620 47348 48274 gene locus_tag LOCUS_05630 gene xerD 47348 48274 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_05630 48736 48278 gene locus_tag LOCUS_05640 48736 48278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 50627 48756 gene locus_tag LOCUS_05650 50627 48756 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615668.1 protein_id gnl|my_center|LOCUS_05650 51420 50839 gene locus_tag LOCUS_05660 51420 50839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 51529 51771 gene locus_tag LOCUS_05670 51529 51771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 52006 53145 gene locus_tag LOCUS_05680 52006 53145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 53165 54133 gene locus_tag LOCUS_05690 53165 54133 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072167.1 protein_id gnl|my_center|LOCUS_05690 54117 54617 gene locus_tag LOCUS_05700 54117 54617 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931087.1 protein_id gnl|my_center|LOCUS_05700 54614 54841 gene locus_tag LOCUS_05710 54614 54841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence009 155 334 gene locus_tag LOCUS_05720 155 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 902 432 gene locus_tag LOCUS_05730 902 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2035 917 gene locus_tag LOCUS_05740 2035 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2163 3170 gene locus_tag LOCUS_05750 gene rnhC 2163 3170 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871354.1 protein_id gnl|my_center|LOCUS_05750 3187 3939 gene locus_tag LOCUS_05760 3187 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 4020 7187 gene locus_tag LOCUS_05770 4020 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7221 8402 gene locus_tag LOCUS_05780 gene gnfL 7221 8402 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_05780 8501 10459 gene locus_tag LOCUS_05790 8501 10459 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_05790 10539 11918 gene locus_tag LOCUS_05800 10539 11918 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_05800 11915 13699 gene locus_tag LOCUS_05810 11915 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 13764 14939 gene locus_tag LOCUS_05820 13764 14939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 15031 17181 gene locus_tag LOCUS_05830 15031 17181 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389244.1 protein_id gnl|my_center|LOCUS_05830 17260 17335 gene locus_tag LOCUS_t00150 17260 17335 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18336 19772 gene locus_tag LOCUS_05840 18336 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 20166 19810 gene locus_tag LOCUS_05850 20166 19810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 20444 20902 gene locus_tag LOCUS_05860 20444 20902 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919370.1 protein_id gnl|my_center|LOCUS_05860 22199 20943 gene locus_tag LOCUS_05870 22199 20943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_05870 24702 22324 gene locus_tag LOCUS_05880 24702 22324 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_05880 25399 24704 gene locus_tag LOCUS_05890 25399 24704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 25571 25401 gene locus_tag LOCUS_05900 25571 25401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 27033 25546 gene locus_tag LOCUS_05910 gene ccoG 27033 25546 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_05910 27621 27037 gene locus_tag LOCUS_05920 27621 27037 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120870.1 protein_id gnl|my_center|LOCUS_05920 27793 27605 gene locus_tag LOCUS_05930 27793 27605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 30111 27802 gene locus_tag LOCUS_05940 30111 27802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 30384 30151 gene locus_tag LOCUS_05950 30384 30151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 30638 30396 gene locus_tag LOCUS_05960 30638 30396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 30819 31268 gene locus_tag LOCUS_05970 30819 31268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 32214 31306 gene locus_tag LOCUS_05980 32214 31306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 32462 32680 gene locus_tag LOCUS_05990 32462 32680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 32876 34543 gene locus_tag LOCUS_06000 32876 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 34559 35599 gene locus_tag LOCUS_06010 34559 35599 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_06010 35649 36497 gene locus_tag LOCUS_06020 35649 36497 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083078.1 protein_id gnl|my_center|LOCUS_06020 36494 37339 gene locus_tag LOCUS_06030 36494 37339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 37348 37992 gene locus_tag LOCUS_06040 37348 37992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 38034 39170 gene locus_tag LOCUS_06050 38034 39170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528388.1 protein_id gnl|my_center|LOCUS_06050 39213 39914 gene locus_tag LOCUS_06060 39213 39914 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_06060 39951 40916 gene locus_tag LOCUS_06070 gene trpS 39951 40916 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_06070 41583 40924 gene locus_tag LOCUS_06080 41583 40924 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_06080 42251 41580 gene locus_tag LOCUS_06090 gene cmk 42251 41580 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_06090 43543 42251 gene locus_tag LOCUS_06100 gene aroA 43543 42251 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262299.1 protein_id gnl|my_center|LOCUS_06100 44484 43636 gene locus_tag LOCUS_06110 44484 43636 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 protein_id gnl|my_center|LOCUS_06110 44941 44525 gene locus_tag LOCUS_06120 44941 44525 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336801.1 protein_id gnl|my_center|LOCUS_06120 45102 46106 gene locus_tag LOCUS_06130 45102 46106 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_06130 46224 46299 gene locus_tag LOCUS_t00160 46224 46299 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 47470 46580 gene locus_tag LOCUS_06140 47470 46580 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928785.1 protein_id gnl|my_center|LOCUS_06140 47718 47467 gene locus_tag LOCUS_06150 47718 47467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 49792 47708 gene locus_tag LOCUS_06160 49792 47708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 50027 50392 gene locus_tag LOCUS_06170 50027 50392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 51173 50544 gene locus_tag LOCUS_06180 51173 50544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 51324 51896 gene locus_tag LOCUS_06190 51324 51896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 53428 51914 gene locus_tag LOCUS_06200 53428 51914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 53595 53519 gene locus_tag LOCUS_t00170 53595 53519 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 2455 1307 gene locus_tag LOCUS_06210 2455 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3221 4213 gene locus_tag LOCUS_06220 3221 4213 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027278.1 protein_id gnl|my_center|LOCUS_06220 5269 4265 gene locus_tag LOCUS_06230 5269 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 6201 5341 gene locus_tag LOCUS_06240 6201 5341 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_06240 6315 7190 gene locus_tag LOCUS_06250 6315 7190 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_06250 9485 7275 gene locus_tag LOCUS_06260 gene pnp 9485 7275 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_06260 10046 9783 gene locus_tag LOCUS_06270 gene rpsO 10046 9783 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229392.1 protein_id gnl|my_center|LOCUS_06270 10659 10276 gene locus_tag LOCUS_06280 10659 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 11434 10652 gene locus_tag LOCUS_06290 11434 10652 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_06290 12473 11517 gene locus_tag LOCUS_06300 12473 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 13555 12491 gene locus_tag LOCUS_06310 13555 12491 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532743.1 protein_id gnl|my_center|LOCUS_06310 15305 13560 gene locus_tag LOCUS_06320 gene msbA 15305 13560 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_06320 16392 15427 gene locus_tag LOCUS_06330 16392 15427 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_06330 17337 16420 gene locus_tag LOCUS_06340 gene oppB 17337 16420 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706429.1 protein_id gnl|my_center|LOCUS_06340 17562 19352 gene locus_tag LOCUS_06350 17562 19352 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989525.1 protein_id gnl|my_center|LOCUS_06350 19349 19996 gene locus_tag LOCUS_06360 gene plsY 19349 19996 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_06360 21685 19997 gene locus_tag LOCUS_06370 21685 19997 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275546.1 protein_id gnl|my_center|LOCUS_06370 23291 21657 gene locus_tag LOCUS_06380 23291 21657 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140950.1 protein_id gnl|my_center|LOCUS_06380 24912 23275 gene locus_tag LOCUS_06390 24912 23275 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_06390 25402 24920 gene locus_tag LOCUS_06400 gene ispF 25402 24920 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_06400 26098 25418 gene locus_tag LOCUS_06410 gene ispD 26098 25418 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_06410 26846 26151 gene locus_tag LOCUS_06420 gene pyrF 26846 26151 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 protein_id gnl|my_center|LOCUS_06420 26905 27792 gene locus_tag LOCUS_06430 gene ispE 26905 27792 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678892.1 protein_id gnl|my_center|LOCUS_06430 27878 29641 gene locus_tag LOCUS_06440 gene ptsP 27878 29641 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_06440 30602 29655 gene locus_tag LOCUS_06450 30602 29655 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_06450 32646 30724 gene locus_tag LOCUS_06460 32646 30724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 32645 33994 gene locus_tag LOCUS_06470 gene rsmB 32645 33994 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_06470 35240 34014 gene locus_tag LOCUS_06480 35240 34014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 36601 35336 gene locus_tag LOCUS_06490 36601 35336 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_06490 37132 36689 gene locus_tag LOCUS_06500 37132 36689 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108222449.1 protein_id gnl|my_center|LOCUS_06500 37014 37247 gene locus_tag LOCUS_06510 37014 37247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 37952 37275 gene locus_tag LOCUS_06520 37952 37275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 39214 37949 gene locus_tag LOCUS_06530 gene purD 39214 37949 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_06530 41198 39291 gene locus_tag LOCUS_06540 41198 39291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 41347 42126 gene locus_tag LOCUS_06550 gene fkpA 41347 42126 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838272.1 protein_id gnl|my_center|LOCUS_06550 43246 42197 gene locus_tag LOCUS_06560 43246 42197 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 protein_id gnl|my_center|LOCUS_06560 43303 43857 gene locus_tag LOCUS_06570 43303 43857 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_06570 43860 45008 gene locus_tag LOCUS_06580 gene queG 43860 45008 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968507.1 protein_id gnl|my_center|LOCUS_06580 45452 45051 gene locus_tag LOCUS_06590 45452 45051 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_06590 46606 45449 gene locus_tag LOCUS_06600 46606 45449 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_06600 46785 47762 gene locus_tag LOCUS_06610 46785 47762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 48133 49332 gene locus_tag LOCUS_06620 gene fabB 48133 49332 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_06620 49335 50177 gene locus_tag LOCUS_06630 49335 50177 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113772.1 protein_id gnl|my_center|LOCUS_06630 50181 51437 gene locus_tag LOCUS_06640 50181 51437 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_06640 51514 52728 gene locus_tag LOCUS_06650 51514 52728 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061530.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence011 60 1397 gene locus_tag LOCUS_06660 60 1397 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986831.1 protein_id gnl|my_center|LOCUS_06660 2711 1437 gene locus_tag LOCUS_06670 2711 1437 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332063.1 protein_id gnl|my_center|LOCUS_06670 2891 4285 gene locus_tag LOCUS_06680 2891 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4288 6321 gene locus_tag LOCUS_06690 gene uvrB 4288 6321 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_06690 6382 7644 gene locus_tag LOCUS_06700 6382 7644 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_06700 9401 7668 gene locus_tag LOCUS_06710 9401 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 10557 9460 gene locus_tag LOCUS_06720 10557 9460 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 protein_id gnl|my_center|LOCUS_06720 13251 10564 gene locus_tag LOCUS_06730 gene alaS 13251 10564 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_06730 14435 13335 gene locus_tag LOCUS_06740 gene leuB 14435 13335 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_06740 14510 15160 gene locus_tag LOCUS_06750 14510 15160 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_06750 15174 16307 gene locus_tag LOCUS_06760 gene ribD 15174 16307 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_06760 16282 16884 gene locus_tag LOCUS_06770 gene rdgB 16282 16884 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_06770 19008 16900 gene locus_tag LOCUS_06780 19008 16900 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_06780 20173 19028 gene locus_tag LOCUS_06790 20173 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 21990 20170 gene locus_tag LOCUS_06800 21990 20170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 23738 21987 gene locus_tag LOCUS_06810 23738 21987 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225490.1 protein_id gnl|my_center|LOCUS_06810 24571 23735 gene locus_tag LOCUS_06820 24571 23735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 26505 24658 gene locus_tag LOCUS_06830 26505 24658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 26555 27589 gene locus_tag LOCUS_06840 26555 27589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 27860 28048 gene locus_tag LOCUS_06850 27860 28048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 29090 28479 gene locus_tag LOCUS_06860 29090 28479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 29139 29330 gene locus_tag LOCUS_06870 29139 29330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 30025 29354 gene locus_tag LOCUS_06880 30025 29354 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_06880 31278 30022 gene locus_tag LOCUS_06890 31278 30022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 31374 32918 gene locus_tag LOCUS_06900 31374 32918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 32915 34363 gene locus_tag LOCUS_06910 32915 34363 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_06910 34360 36096 gene locus_tag LOCUS_06920 gene menD 34360 36096 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_06920 38009 36117 gene locus_tag LOCUS_06930 38009 36117 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927144.1 protein_id gnl|my_center|LOCUS_06930 38134 38970 gene locus_tag LOCUS_06940 gene menB 38134 38970 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_06940 39946 38996 gene locus_tag LOCUS_06950 gene fba 39946 38996 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_06950 41066 40017 gene locus_tag LOCUS_06960 41066 40017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 43934 41142 gene locus_tag LOCUS_06970 43934 41142 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_06970 45157 44072 gene locus_tag LOCUS_06980 45157 44072 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_06980 45224 46432 gene locus_tag LOCUS_06990 gene lpxK 45224 46432 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_06990 46491 47615 gene locus_tag LOCUS_07000 46491 47615 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_07000 47679 48683 gene locus_tag LOCUS_07010 47679 48683 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_07010 48708 49739 gene locus_tag LOCUS_07020 48708 49739 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_07020 49754 51427 gene locus_tag LOCUS_07030 49754 51427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 52374 51439 gene locus_tag LOCUS_07040 52374 51439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 <52987 52424 gene locus_tag LOCUS_07050 <52987 52424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035951.1:16S rRNA (cytidine(1402)-2'-O)-methyltransferase >Feature sequence012 <1 1462 gene locus_tag LOCUS_07060 <1 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227769.1:Na+:solute symporter 1496 2326 gene locus_tag LOCUS_07070 1496 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 3423 2323 gene locus_tag LOCUS_07080 3423 2323 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061916.1 protein_id gnl|my_center|LOCUS_07080 5488 3539 gene locus_tag LOCUS_07090 5488 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 7579 5579 gene locus_tag LOCUS_07100 7579 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 9698 7662 gene locus_tag LOCUS_07110 9698 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 9798 11051 gene locus_tag LOCUS_07120 9798 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 11101 12252 gene locus_tag LOCUS_07130 11101 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 14423 12270 gene locus_tag LOCUS_07140 14423 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 15245 14490 gene locus_tag LOCUS_07150 15245 14490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 16032 15256 gene locus_tag LOCUS_07160 16032 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 16132 17160 gene locus_tag LOCUS_07170 16132 17160 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_07170 17163 18209 gene locus_tag LOCUS_07180 17163 18209 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_07180 18271 19437 gene locus_tag LOCUS_07190 18271 19437 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_07190 20180 19434 gene locus_tag LOCUS_07200 20180 19434 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 protein_id gnl|my_center|LOCUS_07200 21280 20276 gene locus_tag LOCUS_07210 gene hprK 21280 20276 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127250.1 protein_id gnl|my_center|LOCUS_07210 22121 21384 gene locus_tag LOCUS_07220 gene lptB 22121 21384 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_07220 22660 22118 gene locus_tag LOCUS_07230 22660 22118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 23088 22657 gene locus_tag LOCUS_07240 23088 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 23614 23093 gene locus_tag LOCUS_07250 23614 23093 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689546.1 protein_id gnl|my_center|LOCUS_07250 25669 23639 gene locus_tag LOCUS_07260 25669 23639 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_07260 26743 25754 gene locus_tag LOCUS_07270 26743 25754 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_07270 27384 26938 gene locus_tag LOCUS_07280 gene rpiB 27384 26938 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_07280 28205 27528 gene locus_tag LOCUS_07290 28205 27528 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_07290 28289 28750 gene locus_tag LOCUS_07300 28289 28750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 28840 29670 gene locus_tag LOCUS_07310 28840 29670 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_07310 29747 29995 gene locus_tag LOCUS_07320 29747 29995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 29998 30396 gene locus_tag LOCUS_07330 29998 30396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 31552 30434 gene locus_tag LOCUS_07340 gene rlmN 31552 30434 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_07340 33235 31571 gene locus_tag LOCUS_07350 gene leuA 33235 31571 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 protein_id gnl|my_center|LOCUS_07350 33605 33330 gene locus_tag LOCUS_07360 33605 33330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 33516 34106 gene locus_tag LOCUS_07370 33516 34106 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405461.1 protein_id gnl|my_center|LOCUS_07370 34103 34396 gene locus_tag LOCUS_07380 34103 34396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 34399 34842 gene locus_tag LOCUS_07390 34399 34842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 35117 36271 gene locus_tag LOCUS_07400 35117 36271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 36310 36669 gene locus_tag LOCUS_07410 36310 36669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 37051 36695 gene locus_tag LOCUS_07420 37051 36695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 37926 37072 gene locus_tag LOCUS_07430 gene prpC 37926 37072 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_07430 38342 37932 gene locus_tag LOCUS_07440 38342 37932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 38592 39626 gene locus_tag LOCUS_07450 38592 39626 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530581.1 protein_id gnl|my_center|LOCUS_07450 39788 41683 gene locus_tag LOCUS_07460 39788 41683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 41721 42581 gene locus_tag LOCUS_07470 41721 42581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 42715 44973 gene locus_tag LOCUS_07480 42715 44973 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_07480 46758 45043 gene locus_tag LOCUS_07490 gene ilvB 46758 45043 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_07490 46953 47735 gene locus_tag LOCUS_07500 46953 47735 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_07500 48757 47777 gene locus_tag LOCUS_07510 48757 47777 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883648.1 protein_id gnl|my_center|LOCUS_07510 49170 48808 gene locus_tag LOCUS_07520 49170 48808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 49814 49194 gene locus_tag LOCUS_07530 49814 49194 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112465.1 protein_id gnl|my_center|LOCUS_07530 50942 49863 gene locus_tag LOCUS_07540 gene queA 50942 49863 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143576.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence013 241 38 gene locus_tag LOCUS_07550 241 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1637 330 gene locus_tag LOCUS_07560 1637 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2649 1729 gene locus_tag LOCUS_07570 2649 1729 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803678.1 protein_id gnl|my_center|LOCUS_07570 2712 3575 gene locus_tag LOCUS_07580 2712 3575 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526198.1 protein_id gnl|my_center|LOCUS_07580 5937 3658 gene locus_tag LOCUS_07590 5937 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 6125 7315 gene locus_tag LOCUS_07600 6125 7315 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_07600 7342 8169 gene locus_tag LOCUS_07610 7342 8169 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206710.1 protein_id gnl|my_center|LOCUS_07610 8213 9064 gene locus_tag LOCUS_07620 8213 9064 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_07620 9283 9080 gene locus_tag LOCUS_07630 9283 9080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 12681 9418 gene locus_tag LOCUS_07640 12681 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 12855 13382 gene locus_tag LOCUS_07650 12855 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 16218 13396 gene locus_tag LOCUS_07660 16218 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 16695 16240 gene locus_tag LOCUS_07670 16695 16240 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_07670 16781 17692 gene locus_tag LOCUS_07680 16781 17692 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409725.1 protein_id gnl|my_center|LOCUS_07680 18389 17712 gene locus_tag LOCUS_07690 18389 17712 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212344658.1 protein_id gnl|my_center|LOCUS_07690 18538 19971 gene locus_tag LOCUS_07700 gene nhaC 18538 19971 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261868.1 protein_id gnl|my_center|LOCUS_07700 19975 20937 gene locus_tag LOCUS_07710 gene iaaA 19975 20937 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513802.1 protein_id gnl|my_center|LOCUS_07710 20934 21830 gene locus_tag LOCUS_07720 20934 21830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 21784 25020 gene locus_tag LOCUS_07730 21784 25020 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_07730 25098 26357 gene locus_tag LOCUS_07740 25098 26357 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766635.1 protein_id gnl|my_center|LOCUS_07740 26432 28111 gene locus_tag LOCUS_07750 gene ggt 26432 28111 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969826.1 protein_id gnl|my_center|LOCUS_07750 28291 28127 gene locus_tag LOCUS_07760 28291 28127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 28460 30286 gene locus_tag LOCUS_07770 28460 30286 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_07770 30339 31154 gene locus_tag LOCUS_07780 30339 31154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 31232 32086 gene locus_tag LOCUS_07790 31232 32086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 35103 32107 gene locus_tag LOCUS_07800 gene pruA 35103 32107 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940575.1 protein_id gnl|my_center|LOCUS_07800 35341 35874 gene locus_tag LOCUS_07810 35341 35874 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_07810 35880 36341 gene locus_tag LOCUS_07820 35880 36341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 36369 38081 gene locus_tag LOCUS_07830 36369 38081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 38193 38651 gene locus_tag LOCUS_07840 gene purE 38193 38651 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529209.1 protein_id gnl|my_center|LOCUS_07840 39165 38671 gene locus_tag LOCUS_07850 39165 38671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 39763 39236 gene locus_tag LOCUS_07860 39763 39236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 40172 42835 gene locus_tag LOCUS_07870 40172 42835 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275339.1 protein_id gnl|my_center|LOCUS_07870 45222 43132 gene locus_tag LOCUS_07880 45222 43132 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_07880 45445 48423 gene locus_tag LOCUS_07890 45445 48423 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_07890 48519 50525 gene locus_tag LOCUS_07900 48519 50525 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence014 798 79 gene locus_tag LOCUS_07910 798 79 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958400.1 protein_id gnl|my_center|LOCUS_07910 1063 809 gene locus_tag LOCUS_07920 1063 809 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_07920 1863 1312 gene locus_tag LOCUS_07930 1863 1312 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_07930 2387 1911 gene locus_tag LOCUS_07940 2387 1911 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 protein_id gnl|my_center|LOCUS_07940 2531 3283 gene locus_tag LOCUS_07950 2531 3283 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_07950 3280 3711 gene locus_tag LOCUS_07960 gene aroQ 3280 3711 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814953.1 protein_id gnl|my_center|LOCUS_07960 3716 4234 gene locus_tag LOCUS_07970 3716 4234 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_07970 4243 5175 gene locus_tag LOCUS_07980 4243 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 5731 5207 gene locus_tag LOCUS_07990 5731 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 6336 5734 gene locus_tag LOCUS_08000 gene pgsA 6336 5734 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965120.1 protein_id gnl|my_center|LOCUS_08000 6471 6959 gene locus_tag LOCUS_08010 gene coaD 6471 6959 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171888.1 protein_id gnl|my_center|LOCUS_08010 7118 8536 gene locus_tag LOCUS_08020 7118 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 8562 9329 gene locus_tag LOCUS_08030 8562 9329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_08030 9332 10540 gene locus_tag LOCUS_08040 9332 10540 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_08040 10537 11400 gene locus_tag LOCUS_08050 10537 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 11443 12213 gene locus_tag LOCUS_08060 11443 12213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082922.1 protein_id gnl|my_center|LOCUS_08060 12252 13043 gene locus_tag LOCUS_08070 12252 13043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082921.1 protein_id gnl|my_center|LOCUS_08070 13052 14023 gene locus_tag LOCUS_08080 13052 14023 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_08080 14025 15212 gene locus_tag LOCUS_08090 14025 15212 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_08090 15209 16192 gene locus_tag LOCUS_08100 15209 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 16176 16340 gene locus_tag LOCUS_08110 16176 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 16482 17897 gene locus_tag LOCUS_08120 gene rimO 16482 17897 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_08120 19347 17920 gene locus_tag LOCUS_08130 gene mpl 19347 17920 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_08130 21664 19430 gene locus_tag LOCUS_08140 gene priA 21664 19430 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_08140 21679 22260 gene locus_tag LOCUS_08150 21679 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 22266 22634 gene locus_tag LOCUS_08160 22266 22634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 22658 23275 gene locus_tag LOCUS_08170 22658 23275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 24314 23307 gene locus_tag LOCUS_08180 24314 23307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 25447 24311 gene locus_tag LOCUS_08190 gene hemW 25447 24311 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_08190 25540 26463 gene locus_tag LOCUS_08200 25540 26463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 27525 26536 gene locus_tag LOCUS_08210 27525 26536 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838507.1 protein_id gnl|my_center|LOCUS_08210 28793 27543 gene locus_tag LOCUS_08220 28793 27543 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_08220 28846 29118 gene locus_tag LOCUS_08230 28846 29118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 29134 31071 gene locus_tag LOCUS_08240 gene dxs 29134 31071 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_08240 31153 31758 gene locus_tag LOCUS_08250 gene lexA 31153 31758 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091196.1 protein_id gnl|my_center|LOCUS_08250 31871 32287 gene locus_tag LOCUS_08260 31871 32287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 33391 32324 gene locus_tag LOCUS_08270 gene rhaT 33391 32324 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209111.1 protein_id gnl|my_center|LOCUS_08270 34617 33415 gene locus_tag LOCUS_08280 34617 33415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 35877 34630 gene locus_tag LOCUS_08290 35877 34630 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_08290 36242 35904 gene locus_tag LOCUS_08300 36242 35904 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_08300 36589 37587 gene locus_tag LOCUS_08310 36589 37587 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_08310 37606 39828 gene locus_tag LOCUS_08320 37606 39828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 40013 39825 gene locus_tag LOCUS_08330 40013 39825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 40299 39994 gene locus_tag LOCUS_08340 40299 39994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 41402 40962 gene locus_tag LOCUS_08350 41402 40962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 41709 41636 gene locus_tag LOCUS_t00180 41709 41636 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 42351 41752 gene locus_tag LOCUS_08360 gene recR 42351 41752 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309918.1 protein_id gnl|my_center|LOCUS_08360 42736 42428 gene locus_tag LOCUS_08370 42736 42428 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_08370 43766 42834 gene locus_tag LOCUS_08380 43766 42834 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_08380 43728 44333 gene locus_tag LOCUS_08390 43728 44333 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_08390 44636 47647 gene locus_tag LOCUS_08400 44636 47647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 47644 48492 gene locus_tag LOCUS_08410 47644 48492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence015 2172 2672 gene locus_tag LOCUS_08420 2172 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2866 4107 gene locus_tag LOCUS_08430 gene accC 2866 4107 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142010.1 protein_id gnl|my_center|LOCUS_08430 5064 4174 gene locus_tag LOCUS_08440 5064 4174 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_08440 5749 5168 gene locus_tag LOCUS_08450 gene purN 5749 5168 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244322.1 protein_id gnl|my_center|LOCUS_08450 6243 5746 gene locus_tag LOCUS_08460 gene rfaE2 6243 5746 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_08460 6473 6303 gene locus_tag LOCUS_08470 6473 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 6441 7355 gene locus_tag LOCUS_08480 gene xylF 6441 7355 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_08480 7358 8881 gene locus_tag LOCUS_08490 7358 8881 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_08490 8884 10011 gene locus_tag LOCUS_08500 gene gguB 8884 10011 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974840.1 protein_id gnl|my_center|LOCUS_08500 11160 10015 gene locus_tag LOCUS_08510 gene dnaJ 11160 10015 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 protein_id gnl|my_center|LOCUS_08510 11721 11167 gene locus_tag LOCUS_08520 gene grpE 11721 11167 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706782.1 protein_id gnl|my_center|LOCUS_08520 12548 11739 gene locus_tag LOCUS_08530 12548 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 13504 12554 gene locus_tag LOCUS_08540 13504 12554 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_08540 13707 16124 gene locus_tag LOCUS_08550 13707 16124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 16175 16996 gene locus_tag LOCUS_08560 16175 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 17575 17030 gene locus_tag LOCUS_08570 17575 17030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 18589 17588 gene locus_tag LOCUS_08580 gene floA 18589 17588 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_08580 19056 18586 gene locus_tag LOCUS_08590 19056 18586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 19209 20132 gene locus_tag LOCUS_08600 19209 20132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526695.1 protein_id gnl|my_center|LOCUS_08600 20995 20165 gene locus_tag LOCUS_08610 20995 20165 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_08610 21075 21965 gene locus_tag LOCUS_08620 21075 21965 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776878.1 protein_id gnl|my_center|LOCUS_08620 22031 22351 gene locus_tag LOCUS_08630 22031 22351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 22348 22632 gene locus_tag LOCUS_08640 22348 22632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 22632 23873 gene locus_tag LOCUS_08650 22632 23873 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098062761.1 protein_id gnl|my_center|LOCUS_08650 23978 24214 gene locus_tag LOCUS_08660 23978 24214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 24310 24849 gene locus_tag LOCUS_08670 24310 24849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 25943 24930 gene locus_tag LOCUS_08680 25943 24930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 26419 25982 gene locus_tag LOCUS_08690 26419 25982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 26927 26412 gene locus_tag LOCUS_08700 26927 26412 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224412.1 protein_id gnl|my_center|LOCUS_08700 27268 27083 gene locus_tag LOCUS_08710 27268 27083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 27383 28285 gene locus_tag LOCUS_08720 27383 28285 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249854.1 protein_id gnl|my_center|LOCUS_08720 28327 29601 gene locus_tag LOCUS_08730 28327 29601 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_08730 29603 32152 gene locus_tag LOCUS_08740 29603 32152 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_08740 33958 32162 gene locus_tag LOCUS_08750 33958 32162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 35304 33970 gene locus_tag LOCUS_08760 gene algB 35304 33970 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_08760 35469 36701 gene locus_tag LOCUS_08770 35469 36701 CDS product nucleoside monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615753.1 protein_id gnl|my_center|LOCUS_08770 37969 36728 gene locus_tag LOCUS_08780 37969 36728 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_08780 39230 37980 gene locus_tag LOCUS_08790 39230 37980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933018.1 protein_id gnl|my_center|LOCUS_08790 39981 39244 gene locus_tag LOCUS_08800 39981 39244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_08800 41395 40016 gene locus_tag LOCUS_08810 41395 40016 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933016.1 protein_id gnl|my_center|LOCUS_08810 42514 41750 gene locus_tag LOCUS_08820 42514 41750 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_08820 43019 42543 gene locus_tag LOCUS_08830 43019 42543 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842388.1 protein_id gnl|my_center|LOCUS_08830 45600 43075 gene locus_tag LOCUS_08840 45600 43075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_08840 46298 45597 gene locus_tag LOCUS_08850 46298 45597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_08850 46365 47069 gene locus_tag LOCUS_08860 46365 47069 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_08860 47099 47491 gene locus_tag LOCUS_08870 47099 47491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence016 1539 1913 gene locus_tag LOCUS_08880 1539 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1951 3156 gene locus_tag LOCUS_08890 1951 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3196 5634 gene locus_tag LOCUS_08900 3196 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5766 7856 gene locus_tag LOCUS_08910 5766 7856 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767105.1 protein_id gnl|my_center|LOCUS_08910 8077 9300 gene locus_tag LOCUS_08920 8077 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 9330 10556 gene locus_tag LOCUS_08930 9330 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 10651 11904 gene locus_tag LOCUS_08940 10651 11904 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766061.1 protein_id gnl|my_center|LOCUS_08940 13075 11918 gene locus_tag LOCUS_08950 13075 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 13198 13998 gene locus_tag LOCUS_08960 13198 13998 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_08960 14093 15376 gene locus_tag LOCUS_08970 14093 15376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_08970 16451 15396 gene locus_tag LOCUS_08980 16451 15396 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391963.1 protein_id gnl|my_center|LOCUS_08980 17571 16498 gene locus_tag LOCUS_08990 gene uxuA 17571 16498 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705361.1 protein_id gnl|my_center|LOCUS_08990 17749 19272 gene locus_tag LOCUS_09000 17749 19272 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_09000 19581 20042 gene locus_tag LOCUS_09010 19581 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 20108 21289 gene locus_tag LOCUS_09020 20108 21289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 21402 22415 gene locus_tag LOCUS_09030 21402 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 22520 23887 gene locus_tag LOCUS_09040 22520 23887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 23884 24771 gene locus_tag LOCUS_09050 23884 24771 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976373.1 protein_id gnl|my_center|LOCUS_09050 24775 25623 gene locus_tag LOCUS_09060 24775 25623 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_09060 25704 26489 gene locus_tag LOCUS_09070 25704 26489 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_09070 26528 27340 gene locus_tag LOCUS_09080 26528 27340 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_09080 27375 28163 gene locus_tag LOCUS_09090 27375 28163 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861932.1 protein_id gnl|my_center|LOCUS_09090 28160 28858 gene locus_tag LOCUS_09100 gene rnc 28160 28858 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085565.1 protein_id gnl|my_center|LOCUS_09100 28926 32327 gene locus_tag LOCUS_09110 28926 32327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 32327 33313 gene locus_tag LOCUS_09120 32327 33313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 34163 33423 gene locus_tag LOCUS_09130 34163 33423 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972957.1 protein_id gnl|my_center|LOCUS_09130 34217 34942 gene locus_tag LOCUS_09140 gene radC 34217 34942 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_09140 36324 35005 gene locus_tag LOCUS_09150 36324 35005 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_09150 36658 36573 gene locus_tag LOCUS_t00190 36658 36573 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 37872 36757 gene locus_tag LOCUS_09160 37872 36757 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957890.1 protein_id gnl|my_center|LOCUS_09160 39307 37949 gene locus_tag LOCUS_09170 gene thrC 39307 37949 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337015.1 protein_id gnl|my_center|LOCUS_09170 40570 39353 gene locus_tag LOCUS_09180 40570 39353 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_09180 41917 40586 gene locus_tag LOCUS_09190 41917 40586 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813074.1 protein_id gnl|my_center|LOCUS_09190 42594 41914 gene locus_tag LOCUS_09200 gene plsY 42594 41914 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811145.1 protein_id gnl|my_center|LOCUS_09200 44188 42599 gene locus_tag LOCUS_09210 gene serA 44188 42599 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_09210 46411 44309 gene locus_tag LOCUS_09220 46411 44309 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence017 1675 863 gene locus_tag LOCUS_09230 1675 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3249 1678 gene locus_tag LOCUS_09240 3249 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3838 3332 gene locus_tag LOCUS_09250 3838 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 4964 3975 gene locus_tag LOCUS_09260 4964 3975 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 protein_id gnl|my_center|LOCUS_09260 7272 5092 gene locus_tag LOCUS_09270 7272 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 8237 7338 gene locus_tag LOCUS_09280 8237 7338 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326973.1 protein_id gnl|my_center|LOCUS_09280 9544 8285 gene locus_tag LOCUS_09290 9544 8285 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_09290 10085 9654 gene locus_tag LOCUS_09300 10085 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 10254 10625 gene locus_tag LOCUS_09310 10254 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 10674 11399 gene locus_tag LOCUS_09320 10674 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 11410 11832 gene locus_tag LOCUS_09330 11410 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 12348 11860 gene locus_tag LOCUS_09340 12348 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 13151 12390 gene locus_tag LOCUS_09350 13151 12390 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_09350 13278 14777 gene locus_tag LOCUS_09360 13278 14777 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 protein_id gnl|my_center|LOCUS_09360 14780 15052 gene locus_tag LOCUS_09370 14780 15052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 16430 15057 gene locus_tag LOCUS_09380 16430 15057 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839967.1 protein_id gnl|my_center|LOCUS_09380 16528 17901 gene locus_tag LOCUS_09390 16528 17901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 17933 18253 gene locus_tag LOCUS_09400 17933 18253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 19217 18264 gene locus_tag LOCUS_09410 19217 18264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 19652 19230 gene locus_tag LOCUS_09420 19652 19230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 20903 19677 gene locus_tag LOCUS_09430 20903 19677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 21588 20956 gene locus_tag LOCUS_09440 21588 20956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 22252 21617 gene locus_tag LOCUS_09450 22252 21617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 25511 22338 gene locus_tag LOCUS_09460 25511 22338 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942256.1 protein_id gnl|my_center|LOCUS_09460 26680 25523 gene locus_tag LOCUS_09470 26680 25523 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546440.1 protein_id gnl|my_center|LOCUS_09470 27143 26670 gene locus_tag LOCUS_09480 27143 26670 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532372.1 protein_id gnl|my_center|LOCUS_09480 27325 27975 gene locus_tag LOCUS_09490 27325 27975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 28046 31384 gene locus_tag LOCUS_09500 28046 31384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 31455 32186 gene locus_tag LOCUS_09510 31455 32186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 32900 32190 gene locus_tag LOCUS_09520 32900 32190 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083962.1 protein_id gnl|my_center|LOCUS_09520 33014 34153 gene locus_tag LOCUS_09530 33014 34153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 34158 35504 gene locus_tag LOCUS_09540 34158 35504 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029435.1 protein_id gnl|my_center|LOCUS_09540 35732 36079 gene locus_tag LOCUS_09550 35732 36079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 36220 36753 gene locus_tag LOCUS_09560 36220 36753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 38402 36810 gene locus_tag LOCUS_09570 38402 36810 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_09570 39285 38503 gene locus_tag LOCUS_09580 39285 38503 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968304.1 protein_id gnl|my_center|LOCUS_09580 39808 39374 gene locus_tag LOCUS_09590 39808 39374 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941889.1 protein_id gnl|my_center|LOCUS_09590 39947 41251 gene locus_tag LOCUS_09600 gene dinB 39947 41251 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_09600 41396 43207 gene locus_tag LOCUS_09610 41396 43207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 43261 44988 gene locus_tag LOCUS_09620 gene ggt 43261 44988 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_09620 45026 46015 gene locus_tag LOCUS_09630 45026 46015 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256322.1 protein_id gnl|my_center|LOCUS_09630 46140 46277 gene locus_tag LOCUS_09640 gene rpmH 46140 46277 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100258.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence018 <1 2740 gene locus_tag LOCUS_09650 <1 2740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140250.1:aminomethyl-transferring glycine dehydrogenase 3488 2775 gene locus_tag LOCUS_09660 3488 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4963 3611 gene locus_tag LOCUS_09670 4963 3611 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971610.1 protein_id gnl|my_center|LOCUS_09670 6570 4984 gene locus_tag LOCUS_09680 6570 4984 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942559.1 protein_id gnl|my_center|LOCUS_09680 7636 6578 gene locus_tag LOCUS_09690 gene mtaA 7636 6578 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589539.1 protein_id gnl|my_center|LOCUS_09690 7749 8579 gene locus_tag LOCUS_09700 7749 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8644 9447 gene locus_tag LOCUS_09710 8644 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 9496 11970 gene locus_tag LOCUS_09720 9496 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 14310 12004 gene locus_tag LOCUS_09730 14310 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 14999 14388 gene locus_tag LOCUS_09740 14999 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 16390 14996 gene locus_tag LOCUS_09750 16390 14996 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023919.1 protein_id gnl|my_center|LOCUS_09750 17155 16397 gene locus_tag LOCUS_09760 17155 16397 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_09760 17211 18638 gene locus_tag LOCUS_09770 gene rhaB 17211 18638 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099337.1 protein_id gnl|my_center|LOCUS_09770 20176 19331 gene locus_tag LOCUS_09780 20176 19331 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967715.1 protein_id gnl|my_center|LOCUS_09780 22435 20243 gene locus_tag LOCUS_09790 22435 20243 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258146.1 protein_id gnl|my_center|LOCUS_09790 23408 22479 gene locus_tag LOCUS_09800 23408 22479 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_09800 24634 23582 gene locus_tag LOCUS_09810 24634 23582 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_09810 24945 24646 gene locus_tag LOCUS_09820 24945 24646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 25223 24948 gene locus_tag LOCUS_09830 25223 24948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 26711 25227 gene locus_tag LOCUS_09840 26711 25227 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_09840 27048 26737 gene locus_tag LOCUS_09850 27048 26737 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_09850 27371 27072 gene locus_tag LOCUS_09860 gene pduA 27371 27072 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183614.1 protein_id gnl|my_center|LOCUS_09860 28621 27431 gene locus_tag LOCUS_09870 28621 27431 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_09870 28994 28698 gene locus_tag LOCUS_09880 gene pduA 28994 28698 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_09880 29288 29019 gene locus_tag LOCUS_09890 29288 29019 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719393.1 protein_id gnl|my_center|LOCUS_09890 29897 29337 gene locus_tag LOCUS_09900 29897 29337 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_09900 30117 30914 gene locus_tag LOCUS_09910 30117 30914 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09910 30911 32227 gene locus_tag LOCUS_09920 30911 32227 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847383.1 protein_id gnl|my_center|LOCUS_09920 32242 32793 gene locus_tag LOCUS_09930 32242 32793 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810294.1 protein_id gnl|my_center|LOCUS_09930 33664 32822 gene locus_tag LOCUS_09940 gene panC 33664 32822 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_09940 33825 35048 gene locus_tag LOCUS_09950 33825 35048 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_09950 35674 35045 gene locus_tag LOCUS_09960 35674 35045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 36704 35706 gene locus_tag LOCUS_09970 36704 35706 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_09970 37511 36744 gene locus_tag LOCUS_09980 37511 36744 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_09980 38644 37517 gene locus_tag LOCUS_09990 38644 37517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_09990 38698 39339 gene locus_tag LOCUS_10000 gene gph 38698 39339 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532061.1 protein_id gnl|my_center|LOCUS_10000 40052 39336 gene locus_tag LOCUS_10010 40052 39336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 40212 41711 gene locus_tag LOCUS_10020 40212 41711 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017626175.1 protein_id gnl|my_center|LOCUS_10020 41712 41885 gene locus_tag LOCUS_10030 41712 41885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 42248 41886 gene locus_tag LOCUS_10040 42248 41886 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 protein_id gnl|my_center|LOCUS_10040 42350 44593 gene locus_tag LOCUS_10050 42350 44593 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_10050 46111 44597 gene locus_tag LOCUS_10060 46111 44597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence019 1993 689 gene locus_tag LOCUS_10070 1993 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 3802 2003 gene locus_tag LOCUS_10080 gene lepA 3802 2003 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871412.1 protein_id gnl|my_center|LOCUS_10080 4716 3805 gene locus_tag LOCUS_10090 gene fabD 4716 3805 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392463.1 protein_id gnl|my_center|LOCUS_10090 5691 4762 gene locus_tag LOCUS_10100 5691 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 6791 5700 gene locus_tag LOCUS_10110 6791 5700 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_10110 6859 7746 gene locus_tag LOCUS_10120 gene dapA 6859 7746 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_10120 7751 8482 gene locus_tag LOCUS_10130 7751 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 8491 9093 gene locus_tag LOCUS_10140 gene ruvA 8491 9093 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_10140 9770 9117 gene locus_tag LOCUS_10150 9770 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10383 9814 gene locus_tag LOCUS_10160 gene rpoE 10383 9814 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_10160 10700 11476 gene locus_tag LOCUS_10170 10700 11476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 11771 11845 gene locus_tag LOCUS_t00200 11771 11845 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11941 12543 gene locus_tag LOCUS_10180 11941 12543 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_10180 12605 13162 gene locus_tag LOCUS_10190 gene pal 12605 13162 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546782.1 protein_id gnl|my_center|LOCUS_10190 14625 13252 gene locus_tag LOCUS_10200 14625 13252 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227990.1 protein_id gnl|my_center|LOCUS_10200 16245 14698 gene locus_tag LOCUS_10210 gene purH 16245 14698 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_10210 16335 16718 gene locus_tag LOCUS_10220 gene apaG 16335 16718 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886874.1 protein_id gnl|my_center|LOCUS_10220 16768 18126 gene locus_tag LOCUS_10230 16768 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 18913 18083 gene locus_tag LOCUS_10240 18913 18083 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809990.1 protein_id gnl|my_center|LOCUS_10240 20145 18967 gene locus_tag LOCUS_10250 gene dinB 20145 18967 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_10250 23065 20195 gene locus_tag LOCUS_10260 gene uvrA 23065 20195 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036348.1 protein_id gnl|my_center|LOCUS_10260 23275 25260 gene locus_tag LOCUS_10270 23275 25260 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266754.1 protein_id gnl|my_center|LOCUS_10270 25284 26630 gene locus_tag LOCUS_10280 25284 26630 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_10280 26725 27648 gene locus_tag LOCUS_10290 26725 27648 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 protein_id gnl|my_center|LOCUS_10290 27654 29993 gene locus_tag LOCUS_10300 27654 29993 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_10300 30020 31003 gene locus_tag LOCUS_10310 30020 31003 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250104.1 protein_id gnl|my_center|LOCUS_10310 31015 31791 gene locus_tag LOCUS_10320 31015 31791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 31772 32641 gene locus_tag LOCUS_10330 31772 32641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 32737 34158 gene locus_tag LOCUS_10340 32737 34158 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584110.1 protein_id gnl|my_center|LOCUS_10340 34161 35060 gene locus_tag LOCUS_10350 34161 35060 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258521.1 protein_id gnl|my_center|LOCUS_10350 35152 35802 gene locus_tag LOCUS_10360 35152 35802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 35881 36195 gene locus_tag LOCUS_10370 gene rplU 35881 36195 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943851.1 protein_id gnl|my_center|LOCUS_10370 36211 36456 gene locus_tag LOCUS_10380 gene rpmA 36211 36456 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_10380 36541 36930 gene locus_tag LOCUS_10390 36541 36930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 38022 36943 gene locus_tag LOCUS_10400 gene pheA 38022 36943 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_10400 38887 38024 gene locus_tag LOCUS_10410 38887 38024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 39104 40807 gene locus_tag LOCUS_10420 gene ilvD 39104 40807 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_10420 40820 42433 gene locus_tag LOCUS_10430 40820 42433 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_10430 42553 42711 gene locus_tag LOCUS_10440 42553 42711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 42761 43441 gene locus_tag LOCUS_10450 42761 43441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence020 164 1705 gene locus_tag LOCUS_10460 164 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1754 2722 gene locus_tag LOCUS_10470 1754 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2949 3410 gene locus_tag LOCUS_10480 2949 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 3434 6526 gene locus_tag LOCUS_10490 3434 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6600 7508 gene locus_tag LOCUS_10500 6600 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 7775 8260 gene locus_tag LOCUS_10510 7775 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 8286 11426 gene locus_tag LOCUS_10520 8286 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 11423 11938 gene locus_tag LOCUS_10530 11423 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 11931 16046 gene locus_tag LOCUS_10540 11931 16046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 16178 18445 gene locus_tag LOCUS_10550 16178 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 18442 18939 gene locus_tag LOCUS_10560 18442 18939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 19067 19699 gene locus_tag LOCUS_10570 19067 19699 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140947.1 protein_id gnl|my_center|LOCUS_10570 19941 19865 gene locus_tag LOCUS_t00210 19941 19865 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20988 20020 gene locus_tag LOCUS_10580 20988 20020 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_10580 21062 21598 gene locus_tag LOCUS_10590 21062 21598 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_10590 23832 21622 gene locus_tag LOCUS_10600 23832 21622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 23947 26019 gene locus_tag LOCUS_10610 23947 26019 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_10610 26048 26767 gene locus_tag LOCUS_10620 26048 26767 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883040.1 protein_id gnl|my_center|LOCUS_10620 26771 27079 gene locus_tag LOCUS_10630 26771 27079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 27508 29103 gene locus_tag LOCUS_10640 27508 29103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 31035 29386 gene locus_tag LOCUS_10650 31035 29386 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_10650 32474 31077 gene locus_tag LOCUS_10660 gene lpdA 32474 31077 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919599.1 protein_id gnl|my_center|LOCUS_10660 32924 32535 gene locus_tag LOCUS_10670 32924 32535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 32978 34072 gene locus_tag LOCUS_10680 32978 34072 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468451.1 protein_id gnl|my_center|LOCUS_10680 34069 34833 gene locus_tag LOCUS_10690 34069 34833 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_10690 34883 40720 gene locus_tag LOCUS_10700 gene uvrA 34883 40720 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939035.1 protein_id gnl|my_center|LOCUS_10700 41118 40717 gene locus_tag LOCUS_10710 41118 40717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 41240 42265 gene locus_tag LOCUS_10720 41240 42265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence021 <1 888 gene locus_tag LOCUS_10730 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000205134.1:aminopeptidase P N-terminal domain-containing protein 931 1167 gene locus_tag LOCUS_10740 931 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1407 4190 gene locus_tag LOCUS_10750 gene ppdK 1407 4190 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_10750 4360 4749 gene locus_tag LOCUS_10760 4360 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 4848 5810 gene locus_tag LOCUS_10770 4848 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5911 6618 gene locus_tag LOCUS_10780 5911 6618 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921987.1 protein_id gnl|my_center|LOCUS_10780 7135 6698 gene locus_tag LOCUS_10790 7135 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8503 7286 gene locus_tag LOCUS_10800 8503 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 8702 9619 gene locus_tag LOCUS_10810 8702 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 9915 11330 gene locus_tag LOCUS_10820 9915 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 11537 13669 gene locus_tag LOCUS_10830 11537 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 13811 15682 gene locus_tag LOCUS_10840 13811 15682 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_10840 15731 16672 gene locus_tag LOCUS_10850 15731 16672 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190154.1 protein_id gnl|my_center|LOCUS_10850 18079 16748 gene locus_tag LOCUS_10860 18079 16748 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083386.1 protein_id gnl|my_center|LOCUS_10860 18219 19553 gene locus_tag LOCUS_10870 18219 19553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 19758 19669 gene locus_tag LOCUS_t00220 19758 19669 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20013 20387 gene locus_tag LOCUS_10880 20013 20387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 20867 20490 gene locus_tag LOCUS_10890 20867 20490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 21053 21565 gene locus_tag LOCUS_10900 21053 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 22615 21581 gene locus_tag LOCUS_10910 22615 21581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 22955 22740 gene locus_tag LOCUS_10920 22955 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 23107 23889 gene locus_tag LOCUS_10930 23107 23889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 24318 23911 gene locus_tag LOCUS_10940 24318 23911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 25057 24464 gene locus_tag LOCUS_10950 gene tsf 25057 24464 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_10950 25978 25094 gene locus_tag LOCUS_10960 gene rpsB 25978 25094 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899528.1 protein_id gnl|my_center|LOCUS_10960 26177 26253 gene locus_tag LOCUS_t00230 26177 26253 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26433 26684 gene locus_tag LOCUS_10970 26433 26684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 27479 26745 gene locus_tag LOCUS_10980 27479 26745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 27672 28091 gene locus_tag LOCUS_10990 27672 28091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 28618 30639 gene locus_tag LOCUS_11000 28618 30639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 34629 30676 gene locus_tag LOCUS_11010 34629 30676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 35192 37105 gene locus_tag LOCUS_11020 35192 37105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 37297 37896 gene locus_tag LOCUS_11030 gene rqpR 37297 37896 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_11030 38135 38503 gene locus_tag LOCUS_11040 38135 38503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence022 350 2023 gene locus_tag LOCUS_11050 gene guaB 350 2023 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583116.1 protein_id gnl|my_center|LOCUS_11050 2908 2057 gene locus_tag LOCUS_11060 2908 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4335 2905 gene locus_tag LOCUS_11070 4335 2905 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_11070 5728 4349 gene locus_tag LOCUS_11080 5728 4349 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039147.1 protein_id gnl|my_center|LOCUS_11080 8846 5883 gene locus_tag LOCUS_11090 8846 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 9258 10313 gene locus_tag LOCUS_11100 9258 10313 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047175.1 protein_id gnl|my_center|LOCUS_11100 10511 13984 gene locus_tag LOCUS_11110 10511 13984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 14106 15650 gene locus_tag LOCUS_11120 14106 15650 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114149.1 protein_id gnl|my_center|LOCUS_11120 16949 15672 gene locus_tag LOCUS_11130 16949 15672 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391178.1 protein_id gnl|my_center|LOCUS_11130 17840 16965 gene locus_tag LOCUS_11140 gene accD 17840 16965 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528321.1 protein_id gnl|my_center|LOCUS_11140 18539 17847 gene locus_tag LOCUS_11150 18539 17847 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_11150 19351 18593 gene locus_tag LOCUS_11160 gene truA 19351 18593 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_11160 19817 19383 gene locus_tag LOCUS_11170 gene ruvX 19817 19383 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_11170 19928 20266 gene locus_tag LOCUS_11180 19928 20266 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329766.1 protein_id gnl|my_center|LOCUS_11180 21211 20294 gene locus_tag LOCUS_11190 21211 20294 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057878.1 protein_id gnl|my_center|LOCUS_11190 21735 21367 gene locus_tag LOCUS_11200 21735 21367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 22659 21808 gene locus_tag LOCUS_11210 22659 21808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 22765 24201 gene locus_tag LOCUS_11220 22765 24201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 24366 25193 gene locus_tag LOCUS_11230 24366 25193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 25249 26097 gene locus_tag LOCUS_11240 25249 26097 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 protein_id gnl|my_center|LOCUS_11240 26332 26078 gene locus_tag LOCUS_11250 26332 26078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 26214 27059 gene locus_tag LOCUS_11260 26214 27059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 27065 27970 gene locus_tag LOCUS_11270 27065 27970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 29107 28073 gene locus_tag LOCUS_11280 29107 28073 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_11280 29326 29400 gene locus_tag LOCUS_t00240 29326 29400 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 29576 30631 gene locus_tag LOCUS_11290 29576 30631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 30978 30643 gene locus_tag LOCUS_11300 30978 30643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 31441 30980 gene locus_tag LOCUS_11310 31441 30980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 31910 31572 gene locus_tag LOCUS_11320 31910 31572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 33031 32132 gene locus_tag LOCUS_11330 33031 32132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 34020 33082 gene locus_tag LOCUS_11340 34020 33082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 34984 34040 gene locus_tag LOCUS_11350 34984 34040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 35588 35238 gene locus_tag LOCUS_11360 35588 35238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 36254 36739 gene locus_tag LOCUS_11370 36254 36739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 36828 37370 gene locus_tag LOCUS_11380 36828 37370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 37802 37491 gene locus_tag LOCUS_11390 37802 37491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 <40358 38048 gene locus_tag LOCUS_11400 <40358 38048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein >Feature sequence023 1433 1927 gene locus_tag LOCUS_11410 1433 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3310 1901 gene locus_tag LOCUS_11420 3310 1901 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_11420 3758 3345 gene locus_tag LOCUS_11430 3758 3345 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261343.1 protein_id gnl|my_center|LOCUS_11430 3904 4332 gene locus_tag LOCUS_11440 gene rplM 3904 4332 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_11440 4343 4741 gene locus_tag LOCUS_11450 gene rpsI 4343 4741 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_11450 4937 5731 gene locus_tag LOCUS_11460 4937 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5789 6868 gene locus_tag LOCUS_11470 gene argC 5789 6868 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390174.1 protein_id gnl|my_center|LOCUS_11470 7010 8461 gene locus_tag LOCUS_11480 7010 8461 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066243.1 protein_id gnl|my_center|LOCUS_11480 8473 9612 gene locus_tag LOCUS_11490 8473 9612 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329265.1 protein_id gnl|my_center|LOCUS_11490 10957 9641 gene locus_tag LOCUS_11500 gene argJ 10957 9641 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338759.1 protein_id gnl|my_center|LOCUS_11500 11160 12041 gene locus_tag LOCUS_11510 gene argB 11160 12041 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878775.1 protein_id gnl|my_center|LOCUS_11510 12152 13366 gene locus_tag LOCUS_11520 12152 13366 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_11520 13439 14386 gene locus_tag LOCUS_11530 gene argF 13439 14386 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_11530 14497 15723 gene locus_tag LOCUS_11540 14497 15723 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_11540 16759 15767 gene locus_tag LOCUS_11550 16759 15767 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_11550 17566 16763 gene locus_tag LOCUS_11560 17566 16763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914047.1 protein_id gnl|my_center|LOCUS_11560 18327 17575 gene locus_tag LOCUS_11570 18327 17575 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_11570 19726 18329 gene locus_tag LOCUS_11580 19726 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_11580 20163 20744 gene locus_tag LOCUS_11590 gene rsmD 20163 20744 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_11590 21509 20769 gene locus_tag LOCUS_11600 21509 20769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 21603 22154 gene locus_tag LOCUS_11610 21603 22154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 22151 22558 gene locus_tag LOCUS_11620 22151 22558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 23668 22574 gene locus_tag LOCUS_11630 23668 22574 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_11630 24841 23747 gene locus_tag LOCUS_11640 24841 23747 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229212.1 protein_id gnl|my_center|LOCUS_11640 26322 24865 gene locus_tag LOCUS_11650 gene gnd 26322 24865 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225759.1 protein_id gnl|my_center|LOCUS_11650 27318 26359 gene locus_tag LOCUS_11660 27318 26359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 27488 28276 gene locus_tag LOCUS_11670 27488 28276 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_11670 29338 28322 gene locus_tag LOCUS_11680 29338 28322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 31287 29335 gene locus_tag LOCUS_11690 31287 29335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 31504 31431 gene locus_tag LOCUS_t00250 31504 31431 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31763 32839 gene locus_tag LOCUS_11700 31763 32839 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_11700 32897 34153 gene locus_tag LOCUS_11710 gene zraR 32897 34153 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_11710 34248 37484 gene locus_tag LOCUS_11720 gene carB 34248 37484 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_11720 37501 38475 gene locus_tag LOCUS_11730 37501 38475 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_11730 38575 39426 gene locus_tag LOCUS_11740 gene purU 38575 39426 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933485.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence024 1779 2663 gene locus_tag LOCUS_11750 1779 2663 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_11750 2679 5285 gene locus_tag LOCUS_11760 2679 5285 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_11760 5282 6406 gene locus_tag LOCUS_11770 5282 6406 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_11770 6462 7316 gene locus_tag LOCUS_11780 6462 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 7369 8700 gene locus_tag LOCUS_11790 7369 8700 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_11790 9223 8735 gene locus_tag LOCUS_11800 gene bcp 9223 8735 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142372.1 protein_id gnl|my_center|LOCUS_11800 11016 9355 gene locus_tag LOCUS_11810 gene muiA 11016 9355 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_11810 11579 17488 gene locus_tag LOCUS_11820 11579 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 19128 17617 gene locus_tag LOCUS_11830 19128 17617 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_11830 20684 19179 gene locus_tag LOCUS_11840 20684 19179 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_11840 20829 22166 gene locus_tag LOCUS_11850 20829 22166 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_11850 22286 24001 gene locus_tag LOCUS_11860 22286 24001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 25969 24047 gene locus_tag LOCUS_11870 25969 24047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 27006 26095 gene locus_tag LOCUS_11880 27006 26095 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_11880 29503 27083 gene locus_tag LOCUS_11890 29503 27083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 29815 29891 gene locus_tag LOCUS_t00260 29815 29891 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 30919 30215 gene locus_tag LOCUS_11900 30919 30215 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461616.1 protein_id gnl|my_center|LOCUS_11900 31272 30916 gene locus_tag LOCUS_11910 31272 30916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 31694 31293 gene locus_tag LOCUS_11920 31694 31293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 31948 31715 gene locus_tag LOCUS_11930 31948 31715 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_11930 33033 31978 gene locus_tag LOCUS_11940 33033 31978 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_11940 33313 33044 gene locus_tag LOCUS_11950 33313 33044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 33203 33502 gene locus_tag LOCUS_11960 33203 33502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence025 <1 2104 gene locus_tag LOCUS_11970 <1 2104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814731.1:efflux RND transporter permease subunit 4057 2243 gene locus_tag LOCUS_11980 gene typA 4057 2243 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_11980 4184 4999 gene locus_tag LOCUS_11990 4184 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 6109 8736 gene locus_tag LOCUS_12000 gene hrpB 6109 8736 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_12000 10989 8782 gene locus_tag LOCUS_12010 10989 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 13085 11037 gene locus_tag LOCUS_12020 13085 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 15117 13174 gene locus_tag LOCUS_12030 gene speA 15117 13174 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_12030 15220 15555 gene locus_tag LOCUS_12040 gene yajC 15220 15555 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_12040 15623 18181 gene locus_tag LOCUS_12050 gene secD 15623 18181 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172795.1 protein_id gnl|my_center|LOCUS_12050 18300 20024 gene locus_tag LOCUS_12060 gene recJ 18300 20024 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_12060 20073 20149 gene locus_tag LOCUS_t00270 20073 20149 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21084 20305 gene locus_tag LOCUS_12070 21084 20305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 21379 21570 gene locus_tag LOCUS_12080 21379 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 21768 24209 gene locus_tag LOCUS_12090 21768 24209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 24304 24942 gene locus_tag LOCUS_12100 24304 24942 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_12100 25042 26952 gene locus_tag LOCUS_12110 25042 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 26978 27793 gene locus_tag LOCUS_12120 gene fabG 26978 27793 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_12120 27956 29080 gene locus_tag LOCUS_12130 27956 29080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 29178 30452 gene locus_tag LOCUS_12140 29178 30452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 31888 30500 gene locus_tag LOCUS_12150 31888 30500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 33960 31930 gene locus_tag LOCUS_12160 33960 31930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence026 4491 1282 gene locus_tag LOCUS_12170 4491 1282 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941986.1 protein_id gnl|my_center|LOCUS_12170 6150 4507 gene locus_tag LOCUS_12180 6150 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 6637 6272 gene locus_tag LOCUS_12190 6637 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 7622 6699 gene locus_tag LOCUS_12200 7622 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 8249 7746 gene locus_tag LOCUS_12210 8249 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 9667 8246 gene locus_tag LOCUS_12220 9667 8246 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_12220 12844 9677 gene locus_tag LOCUS_12230 12844 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 14389 12956 gene locus_tag LOCUS_12240 gene pyk 14389 12956 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122699.1 protein_id gnl|my_center|LOCUS_12240 14557 16026 gene locus_tag LOCUS_12250 14557 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 16110 17450 gene locus_tag LOCUS_12260 gene glpT 16110 17450 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948741.1 protein_id gnl|my_center|LOCUS_12260 18273 17470 gene locus_tag LOCUS_12270 18273 17470 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883514.1 protein_id gnl|my_center|LOCUS_12270 21661 18344 gene locus_tag LOCUS_12280 21661 18344 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616068.1 protein_id gnl|my_center|LOCUS_12280 22507 21665 gene locus_tag LOCUS_12290 22507 21665 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259049.1 protein_id gnl|my_center|LOCUS_12290 22631 23116 gene locus_tag LOCUS_12300 22631 23116 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_12300 23200 24177 gene locus_tag LOCUS_12310 gene folE2 23200 24177 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722743.1 protein_id gnl|my_center|LOCUS_12310 24233 24985 gene locus_tag LOCUS_12320 24233 24985 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_12320 25085 26137 gene locus_tag LOCUS_12330 25085 26137 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_12330 27202 26162 gene locus_tag LOCUS_12340 gene ruvB 27202 26162 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_12340 28536 27247 gene locus_tag LOCUS_12350 28536 27247 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198657.1 protein_id gnl|my_center|LOCUS_12350 29839 28700 gene locus_tag LOCUS_12360 29839 28700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 30032 30403 gene locus_tag LOCUS_12370 30032 30403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 30902 30441 gene locus_tag LOCUS_12380 30902 30441 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932147.1 protein_id gnl|my_center|LOCUS_12380 31255 31464 gene locus_tag LOCUS_12390 31255 31464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 32254 31430 gene locus_tag LOCUS_12400 32254 31430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 32311 33999 gene locus_tag LOCUS_12410 gene ettA 32311 33999 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence027 264 899 gene locus_tag LOCUS_12420 264 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1863 913 gene locus_tag LOCUS_12430 1863 913 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_12430 2001 3305 gene locus_tag LOCUS_12440 2001 3305 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_12440 4435 3302 gene locus_tag LOCUS_12450 4435 3302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_12450 5381 4446 gene locus_tag LOCUS_12460 5381 4446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_12460 6363 5413 gene locus_tag LOCUS_12470 6363 5413 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 protein_id gnl|my_center|LOCUS_12470 6471 7853 gene locus_tag LOCUS_12480 gene mgtE 6471 7853 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_12480 7907 8443 gene locus_tag LOCUS_12490 7907 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 8508 10376 gene locus_tag LOCUS_12500 8508 10376 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_12500 10373 12205 gene locus_tag LOCUS_12510 10373 12205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_12510 12312 12596 gene locus_tag LOCUS_12520 12312 12596 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 protein_id gnl|my_center|LOCUS_12520 12738 15308 gene locus_tag LOCUS_12530 12738 15308 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965129.1 protein_id gnl|my_center|LOCUS_12530 15424 16362 gene locus_tag LOCUS_12540 15424 16362 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_12540 16359 17321 gene locus_tag LOCUS_12550 16359 17321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 17985 17290 gene locus_tag LOCUS_12560 17985 17290 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_12560 18830 17982 gene locus_tag LOCUS_12570 18830 17982 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_12570 20408 18936 gene locus_tag LOCUS_12580 20408 18936 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933561.1 protein_id gnl|my_center|LOCUS_12580 20670 21008 gene locus_tag LOCUS_12590 20670 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 22457 21081 gene locus_tag LOCUS_12600 22457 21081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 24685 22541 gene locus_tag LOCUS_12610 24685 22541 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839960.1 protein_id gnl|my_center|LOCUS_12610 25517 24816 gene locus_tag LOCUS_12620 25517 24816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 26307 25588 gene locus_tag LOCUS_12630 26307 25588 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948381.1 protein_id gnl|my_center|LOCUS_12630 26470 27198 gene locus_tag LOCUS_12640 gene ric 26470 27198 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_12640 28096 27212 gene locus_tag LOCUS_12650 gene cyoE 28096 27212 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_12650 28222 29700 gene locus_tag LOCUS_12660 28222 29700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 29705 29854 gene locus_tag LOCUS_12670 29705 29854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 29867 30418 gene locus_tag LOCUS_12680 29867 30418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 30431 32134 gene locus_tag LOCUS_12690 30431 32134 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_12690 32154 33167 gene locus_tag LOCUS_12700 32154 33167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence028 3253 3011 gene locus_tag LOCUS_12710 3253 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3141 3350 gene locus_tag LOCUS_12720 3141 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3364 4962 gene locus_tag LOCUS_12730 3364 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 5118 6158 gene locus_tag LOCUS_12740 5118 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 6279 8618 gene locus_tag LOCUS_12750 6279 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 8885 8670 gene locus_tag LOCUS_12760 8885 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 9020 10879 gene locus_tag LOCUS_12770 9020 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 11168 10911 gene locus_tag LOCUS_12780 11168 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 11296 12849 gene locus_tag LOCUS_12790 11296 12849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 12941 15337 gene locus_tag LOCUS_12800 12941 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 15352 16422 gene locus_tag LOCUS_12810 15352 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 17540 16419 gene locus_tag LOCUS_12820 17540 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 18660 17554 gene locus_tag LOCUS_12830 18660 17554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 19740 18691 gene locus_tag LOCUS_12840 19740 18691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 20844 19783 gene locus_tag LOCUS_12850 20844 19783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 22430 20841 gene locus_tag LOCUS_12860 22430 20841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 22755 23951 gene locus_tag LOCUS_12870 22755 23951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 24504 23965 gene locus_tag LOCUS_12880 24504 23965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 24591 25091 gene locus_tag LOCUS_12890 24591 25091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 25244 25951 gene locus_tag LOCUS_12900 25244 25951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 26289 26020 gene locus_tag LOCUS_12910 26289 26020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 26549 26791 gene locus_tag LOCUS_12920 26549 26791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 27119 26754 gene locus_tag LOCUS_12930 27119 26754 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_12930 27662 27243 gene locus_tag LOCUS_12940 gene ndk 27662 27243 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123449.1 protein_id gnl|my_center|LOCUS_12940 29011 27764 gene locus_tag LOCUS_12950 29011 27764 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 protein_id gnl|my_center|LOCUS_12950 30483 29008 gene locus_tag LOCUS_12960 30483 29008 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 protein_id gnl|my_center|LOCUS_12960 31978 30536 gene locus_tag LOCUS_12970 gene glgA 31978 30536 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence029 2367 1255 gene locus_tag LOCUS_12980 2367 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 5525 2394 gene locus_tag LOCUS_12990 5525 2394 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707763.1 protein_id gnl|my_center|LOCUS_12990 6308 5535 gene locus_tag LOCUS_13000 6308 5535 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_13000 6402 8957 gene locus_tag LOCUS_13010 gene mutS 6402 8957 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_13010 10045 8999 gene locus_tag LOCUS_13020 gene aroF 10045 8999 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_13020 10871 10107 gene locus_tag LOCUS_13030 10871 10107 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705830.1 protein_id gnl|my_center|LOCUS_13030 11983 10868 gene locus_tag LOCUS_13040 11983 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 12590 12009 gene locus_tag LOCUS_13050 12590 12009 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_13050 12692 14362 gene locus_tag LOCUS_13060 12692 14362 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_13060 14412 15695 gene locus_tag LOCUS_13070 gene hemL 14412 15695 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 protein_id gnl|my_center|LOCUS_13070 16614 15709 gene locus_tag LOCUS_13080 gene xerC 16614 15709 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_13080 17266 16628 gene locus_tag LOCUS_13090 17266 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 17384 18184 gene locus_tag LOCUS_13100 gene trpC 17384 18184 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_13100 18181 19011 gene locus_tag LOCUS_13110 gene rsmA 18181 19011 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_13110 19065 19727 gene locus_tag LOCUS_13120 19065 19727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 19789 20055 gene locus_tag LOCUS_13130 19789 20055 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435988.1 protein_id gnl|my_center|LOCUS_13130 20061 20567 gene locus_tag LOCUS_13140 20061 20567 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193331.1 protein_id gnl|my_center|LOCUS_13140 20564 21616 gene locus_tag LOCUS_13150 20564 21616 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813722.1 protein_id gnl|my_center|LOCUS_13150 23096 21624 gene locus_tag LOCUS_13160 23096 21624 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_13160 24740 23223 gene locus_tag LOCUS_13170 gene xylB 24740 23223 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267678.1 protein_id gnl|my_center|LOCUS_13170 25319 24813 gene locus_tag LOCUS_13180 gene greB 25319 24813 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_13180 25482 27746 gene locus_tag LOCUS_13190 25482 27746 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706412.1 protein_id gnl|my_center|LOCUS_13190 27793 28875 gene locus_tag LOCUS_13200 gene rsmH 27793 28875 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_13200 <29810 28872 gene locus_tag LOCUS_13210 <29810 28872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977662.1:xylose isomerase >Feature sequence030 1977 562 gene locus_tag LOCUS_13220 1977 562 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968366.1 protein_id gnl|my_center|LOCUS_13220 3166 2093 gene locus_tag LOCUS_13230 3166 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4193 3234 gene locus_tag LOCUS_13240 4193 3234 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083943.1 protein_id gnl|my_center|LOCUS_13240 4383 5471 gene locus_tag LOCUS_13250 4383 5471 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 protein_id gnl|my_center|LOCUS_13250 5535 6470 gene locus_tag LOCUS_13260 5535 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 6547 7023 gene locus_tag LOCUS_13270 6547 7023 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_13270 8173 7049 gene locus_tag LOCUS_13280 8173 7049 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068619877.1 protein_id gnl|my_center|LOCUS_13280 8172 8345 gene locus_tag LOCUS_13290 8172 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 9382 8264 gene locus_tag LOCUS_13300 9382 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 10498 9452 gene locus_tag LOCUS_13310 10498 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 11609 10512 gene locus_tag LOCUS_13320 11609 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 12844 11681 gene locus_tag LOCUS_13330 12844 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 12916 13959 gene locus_tag LOCUS_13340 12916 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 15254 13992 gene locus_tag LOCUS_13350 15254 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 16285 15251 gene locus_tag LOCUS_13360 16285 15251 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_13360 17956 16325 gene locus_tag LOCUS_13370 17956 16325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 18693 17953 gene locus_tag LOCUS_13380 18693 17953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 18866 19504 gene locus_tag LOCUS_13390 18866 19504 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_13390 19583 20626 gene locus_tag LOCUS_13400 19583 20626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 20633 21763 gene locus_tag LOCUS_13410 20633 21763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 21810 23069 gene locus_tag LOCUS_13420 21810 23069 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_13420 23083 24168 gene locus_tag LOCUS_13430 23083 24168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 24165 25061 gene locus_tag LOCUS_13440 24165 25061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 25058 26152 gene locus_tag LOCUS_13450 25058 26152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 28087 26165 gene locus_tag LOCUS_13460 28087 26165 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 protein_id gnl|my_center|LOCUS_13460 <29255 28080 gene locus_tag LOCUS_13470 <29255 28080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674204.1:OFA family MFS transporter >Feature sequence031 1838 309 gene locus_tag LOCUS_13480 1838 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3699 1846 gene locus_tag LOCUS_13490 gene nuoL 3699 1846 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_13490 4018 3710 gene locus_tag LOCUS_13500 gene nuoK 4018 3710 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_13500 4530 4015 gene locus_tag LOCUS_13510 4530 4015 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967808.1 protein_id gnl|my_center|LOCUS_13510 5095 4553 gene locus_tag LOCUS_13520 gene nuoI 5095 4553 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312705.1 protein_id gnl|my_center|LOCUS_13520 6335 5151 gene locus_tag LOCUS_13530 gene nuoH 6335 5151 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104353.1 protein_id gnl|my_center|LOCUS_13530 8038 6353 gene locus_tag LOCUS_13540 8038 6353 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_13540 9436 8075 gene locus_tag LOCUS_13550 gene nuoF 9436 8075 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_13550 9943 9455 gene locus_tag LOCUS_13560 9943 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13560 11213 9981 gene locus_tag LOCUS_13570 gene nuoD 11213 9981 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_13570 11849 11226 gene locus_tag LOCUS_13580 11849 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 12391 11876 gene locus_tag LOCUS_13590 12391 11876 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_13590 12616 12705 gene locus_tag LOCUS_t00280 12616 12705 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13047 14063 gene locus_tag LOCUS_13600 13047 14063 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_13600 14195 14557 gene locus_tag LOCUS_13610 14195 14557 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_13610 14947 15996 gene locus_tag LOCUS_13620 14947 15996 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_13620 17392 16025 gene locus_tag LOCUS_13630 17392 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 18744 17389 gene locus_tag LOCUS_13640 18744 17389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 19647 18805 gene locus_tag LOCUS_13650 19647 18805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 20979 19762 gene locus_tag LOCUS_13660 gene hutI 20979 19762 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889408.1 protein_id gnl|my_center|LOCUS_13660 21139 21594 gene locus_tag LOCUS_13670 21139 21594 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_13670 21607 22833 gene locus_tag LOCUS_13680 gene sufS 21607 22833 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_13680 22975 27720 gene locus_tag LOCUS_13690 22975 27720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 28932 27772 gene locus_tag LOCUS_13700 28932 27772 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence032 78 2882 gene locus_tag LOCUS_13710 gene glnD 78 2882 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_13710 2950 4674 gene locus_tag LOCUS_13720 2950 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5243 4710 gene locus_tag LOCUS_13730 5243 4710 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_13730 5876 5259 gene locus_tag LOCUS_13740 5876 5259 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_13740 7732 5939 gene locus_tag LOCUS_13750 7732 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 8694 7813 gene locus_tag LOCUS_13760 8694 7813 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_13760 9467 8697 gene locus_tag LOCUS_13770 9467 8697 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_13770 10507 9482 gene locus_tag LOCUS_13780 10507 9482 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921854.1 protein_id gnl|my_center|LOCUS_13780 11256 10504 gene locus_tag LOCUS_13790 11256 10504 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_13790 11534 12547 gene locus_tag LOCUS_13800 11534 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 12735 13391 gene locus_tag LOCUS_13810 12735 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 14627 13521 gene locus_tag LOCUS_13820 gene purM 14627 13521 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532445.1 protein_id gnl|my_center|LOCUS_13820 16628 14721 gene locus_tag LOCUS_13830 16628 14721 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765068.1 protein_id gnl|my_center|LOCUS_13830 16990 16625 gene locus_tag LOCUS_13840 16990 16625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 16877 20854 gene locus_tag LOCUS_13850 gene purL 16877 20854 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 protein_id gnl|my_center|LOCUS_13850 21799 20930 gene locus_tag LOCUS_13860 21799 20930 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199327.1 protein_id gnl|my_center|LOCUS_13860 24440 21897 gene locus_tag LOCUS_13870 24440 21897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143193.1 protein_id gnl|my_center|LOCUS_13870 25176 24511 gene locus_tag LOCUS_13880 25176 24511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 26103 25192 gene locus_tag LOCUS_13890 26103 25192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 26210 26899 gene locus_tag LOCUS_13900 26210 26899 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921342.1 protein_id gnl|my_center|LOCUS_13900 <28804 26969 gene locus_tag LOCUS_13910 <28804 26969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein >Feature sequence033 <1 534 gene locus_tag LOCUS_13920 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941981.1:homocysteine S-methyltransferase family protein 606 1007 gene locus_tag LOCUS_13930 606 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2006 1062 gene locus_tag LOCUS_13940 gene prmB 2006 1062 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192731.1 protein_id gnl|my_center|LOCUS_13940 2814 1987 gene locus_tag LOCUS_13950 2814 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3679 2834 gene locus_tag LOCUS_13960 3679 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 4634 3699 gene locus_tag LOCUS_13970 gene fdhD 4634 3699 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896043.1 protein_id gnl|my_center|LOCUS_13970 4633 5328 gene locus_tag LOCUS_13980 4633 5328 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_13980 5332 6060 gene locus_tag LOCUS_13990 5332 6060 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_13990 6150 7295 gene locus_tag LOCUS_14000 gene lptF 6150 7295 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_14000 8220 7273 gene locus_tag LOCUS_14010 8220 7273 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539670.1 protein_id gnl|my_center|LOCUS_14010 9357 8320 gene locus_tag LOCUS_14020 9357 8320 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193921.1 protein_id gnl|my_center|LOCUS_14020 10361 9456 gene locus_tag LOCUS_14030 10361 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 11399 10452 gene locus_tag LOCUS_14040 11399 10452 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_14040 12565 11396 gene locus_tag LOCUS_14050 12565 11396 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527179.1 protein_id gnl|my_center|LOCUS_14050 14267 12567 gene locus_tag LOCUS_14060 14267 12567 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 protein_id gnl|my_center|LOCUS_14060 14330 15481 gene locus_tag LOCUS_14070 14330 15481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 15541 15867 gene locus_tag LOCUS_14080 15541 15867 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_14080 15941 17380 gene locus_tag LOCUS_14090 gene purB 15941 17380 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_14090 17540 18772 gene locus_tag LOCUS_14100 17540 18772 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_14100 19597 18848 gene locus_tag LOCUS_14110 19597 18848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 21786 19639 gene locus_tag LOCUS_14120 gene cstA 21786 19639 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047792095.1 protein_id gnl|my_center|LOCUS_14120 23510 22488 gene locus_tag LOCUS_14130 23510 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 23791 26856 gene locus_tag LOCUS_14140 23791 26856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence034 1241 498 gene locus_tag LOCUS_14150 gene fabG 1241 498 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_14150 1993 1238 gene locus_tag LOCUS_14160 1993 1238 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_14160 2191 3027 gene locus_tag LOCUS_14170 2191 3027 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_14170 3398 3625 gene locus_tag LOCUS_14180 3398 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 5052 3814 gene locus_tag LOCUS_14190 gene trpB 5052 3814 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_14190 5331 6812 gene locus_tag LOCUS_14200 5331 6812 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_14200 7679 6846 gene locus_tag LOCUS_14210 7679 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 8157 10166 gene locus_tag LOCUS_14220 8157 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 11262 10186 gene locus_tag LOCUS_14230 11262 10186 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225281.1 protein_id gnl|my_center|LOCUS_14230 11350 13281 gene locus_tag LOCUS_14240 11350 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 13389 14105 gene locus_tag LOCUS_14250 13389 14105 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_14250 15017 14127 gene locus_tag LOCUS_14260 15017 14127 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_14260 15098 15817 gene locus_tag LOCUS_14270 15098 15817 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_14270 15971 16432 gene locus_tag LOCUS_14280 15971 16432 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_14280 16470 16997 gene locus_tag LOCUS_14290 16470 16997 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_14290 17103 18662 gene locus_tag LOCUS_14300 17103 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 18829 20610 gene locus_tag LOCUS_14310 18829 20610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 21920 20754 gene locus_tag LOCUS_14320 21920 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 22308 21954 gene locus_tag LOCUS_tm00010 22308 21954 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 23276 22416 gene locus_tag LOCUS_14330 23276 22416 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_14330 24177 23278 gene locus_tag LOCUS_14340 24177 23278 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_14340 25478 24174 gene locus_tag LOCUS_14350 25478 24174 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 protein_id gnl|my_center|LOCUS_14350 25625 26530 gene locus_tag LOCUS_14360 25625 26530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence035 279 388 gene locus_tag LOCUS_r00010 279 388 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1025 4264 gene locus_tag LOCUS_14370 1025 4264 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_14370 6548 4383 gene locus_tag LOCUS_14380 6548 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 9022 6683 gene locus_tag LOCUS_14390 9022 6683 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_14390 9341 10426 gene locus_tag LOCUS_14400 9341 10426 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 protein_id gnl|my_center|LOCUS_14400 10590 13937 gene locus_tag LOCUS_14410 10590 13937 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194230.1 protein_id gnl|my_center|LOCUS_14410 14086 15669 gene locus_tag LOCUS_14420 14086 15669 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893142.1 protein_id gnl|my_center|LOCUS_14420 15679 16695 gene locus_tag LOCUS_14430 15679 16695 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044977758.1 protein_id gnl|my_center|LOCUS_14430 17990 16746 gene locus_tag LOCUS_14440 17990 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 18938 18054 gene locus_tag LOCUS_14450 18938 18054 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975103.1 protein_id gnl|my_center|LOCUS_14450 19646 19125 gene locus_tag LOCUS_14460 19646 19125 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307143.1 protein_id gnl|my_center|LOCUS_14460 21784 19754 gene locus_tag LOCUS_14470 21784 19754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 23372 21882 gene locus_tag LOCUS_14480 23372 21882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 24489 23395 gene locus_tag LOCUS_14490 24489 23395 CDS product DUF4434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762555.1 protein_id gnl|my_center|LOCUS_14490 24619 24861 gene locus_tag LOCUS_14500 24619 24861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 25004 25849 gene locus_tag LOCUS_14510 25004 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 27037 25877 gene locus_tag LOCUS_14520 27037 25877 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence036 2 1063 gene locus_tag LOCUS_14530 2 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1524 4979 gene locus_tag LOCUS_14540 1524 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 4991 6121 gene locus_tag LOCUS_14550 4991 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 9079 6155 gene locus_tag LOCUS_14560 9079 6155 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080241138.1 protein_id gnl|my_center|LOCUS_14560 9949 9098 gene locus_tag LOCUS_14570 9949 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 11358 9955 gene locus_tag LOCUS_14580 11358 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 12257 11448 gene locus_tag LOCUS_14590 12257 11448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 13280 12276 gene locus_tag LOCUS_14600 13280 12276 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_14600 14450 13350 gene locus_tag LOCUS_14610 14450 13350 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_14610 15635 14523 gene locus_tag LOCUS_14620 15635 14523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 15748 17709 gene locus_tag LOCUS_14630 15748 17709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 17888 19096 gene locus_tag LOCUS_14640 17888 19096 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713291.1 protein_id gnl|my_center|LOCUS_14640 19093 19692 gene locus_tag LOCUS_14650 19093 19692 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_14650 20227 19715 gene locus_tag LOCUS_14660 20227 19715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 20338 24408 gene locus_tag LOCUS_14670 gene hrpA 20338 24408 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_14670 24461 24880 gene locus_tag LOCUS_14680 24461 24880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 24990 25223 gene locus_tag LOCUS_14690 24990 25223 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_14690 26431 25229 gene locus_tag LOCUS_14700 26431 25229 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_14700 27357 26482 gene locus_tag LOCUS_14710 27357 26482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence037 102 2648 gene locus_tag LOCUS_14720 102 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2688 6188 gene locus_tag LOCUS_14730 2688 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6273 8711 gene locus_tag LOCUS_14740 6273 8711 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100176370.1 protein_id gnl|my_center|LOCUS_14740 9309 9109 gene locus_tag LOCUS_14750 9309 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 9302 10555 gene locus_tag LOCUS_14760 gene glgC 9302 10555 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_14760 10743 11051 gene locus_tag LOCUS_14770 10743 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 11125 11367 gene locus_tag LOCUS_14780 11125 11367 CDS product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377223.1 protein_id gnl|my_center|LOCUS_14780 11560 12156 gene locus_tag LOCUS_14790 11560 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 12245 12481 gene locus_tag LOCUS_14800 12245 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 13389 12508 gene locus_tag LOCUS_14810 13389 12508 CDS product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268449.1 protein_id gnl|my_center|LOCUS_14810 13662 13411 gene locus_tag LOCUS_14820 13662 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 14134 13670 gene locus_tag LOCUS_14830 gene fliW 14134 13670 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156273801.1 protein_id gnl|my_center|LOCUS_14830 15043 14147 gene locus_tag LOCUS_14840 15043 14147 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721827.1 protein_id gnl|my_center|LOCUS_14840 16491 15079 gene locus_tag LOCUS_14850 gene flgK 16491 15079 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_14850 17001 16504 gene locus_tag LOCUS_14860 17001 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 17357 16998 gene locus_tag LOCUS_14870 17357 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 18440 17361 gene locus_tag LOCUS_14880 18440 17361 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_14880 19077 18472 gene locus_tag LOCUS_14890 19077 18472 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545249.1 protein_id gnl|my_center|LOCUS_14890 19801 19058 gene locus_tag LOCUS_14900 19801 19058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 20589 19804 gene locus_tag LOCUS_14910 gene flgG 20589 19804 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_14910 21457 20708 gene locus_tag LOCUS_14920 gene flgG 21457 20708 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880505.1 protein_id gnl|my_center|LOCUS_14920 21891 21655 gene locus_tag LOCUS_14930 21891 21655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 22706 21888 gene locus_tag LOCUS_14940 gene motB 22706 21888 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795656.1 protein_id gnl|my_center|LOCUS_14940 23582 22719 gene locus_tag LOCUS_14950 gene motA 23582 22719 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_14950 24397 23603 gene locus_tag LOCUS_14960 24397 23603 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883005.1 protein_id gnl|my_center|LOCUS_14960 24640 24416 gene locus_tag LOCUS_14970 24640 24416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 25701 24652 gene locus_tag LOCUS_14980 25701 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 <26794 25708 gene locus_tag LOCUS_14990 <26794 25708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392311.1:flagellar biosynthesis protein FlhA >Feature sequence038 1864 281 gene locus_tag LOCUS_15000 1864 281 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_15000 2478 2167 gene locus_tag LOCUS_15010 2478 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2536 3402 gene locus_tag LOCUS_15020 2536 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4120 3464 gene locus_tag LOCUS_15030 4120 3464 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028026.1 protein_id gnl|my_center|LOCUS_15030 4396 5418 gene locus_tag LOCUS_15040 4396 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15040 5411 6265 gene locus_tag LOCUS_15050 5411 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15050 6402 6839 gene locus_tag LOCUS_15060 6402 6839 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974879.1 protein_id gnl|my_center|LOCUS_15060 6836 7435 gene locus_tag LOCUS_15070 6836 7435 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_15070 9624 7477 gene locus_tag LOCUS_15080 9624 7477 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_15080 11606 9759 gene locus_tag LOCUS_15090 11606 9759 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_15090 11790 12446 gene locus_tag LOCUS_15100 11790 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 13330 12452 gene locus_tag LOCUS_15110 13330 12452 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036722.1 protein_id gnl|my_center|LOCUS_15110 13475 14467 gene locus_tag LOCUS_15120 13475 14467 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_15120 15730 14480 gene locus_tag LOCUS_15130 15730 14480 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_15130 15823 16377 gene locus_tag LOCUS_15140 15823 16377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 16555 17382 gene locus_tag LOCUS_15150 16555 17382 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_15150 19525 17393 gene locus_tag LOCUS_15160 19525 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 19691 20326 gene locus_tag LOCUS_15170 19691 20326 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_15170 21467 20451 gene locus_tag LOCUS_15180 21467 20451 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090585.1 protein_id gnl|my_center|LOCUS_15180 22388 21708 gene locus_tag LOCUS_15190 22388 21708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 22567 22857 gene locus_tag LOCUS_15200 22567 22857 CDS product DUF3892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090958.1 protein_id gnl|my_center|LOCUS_15200 24273 22879 gene locus_tag LOCUS_15210 24273 22879 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_15210 24492 26459 gene locus_tag LOCUS_15220 24492 26459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence039 542 213 gene locus_tag LOCUS_15230 542 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 771 3332 gene locus_tag LOCUS_15240 771 3332 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_15240 3825 3346 gene locus_tag LOCUS_15250 gene dtd 3825 3346 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_15250 5113 3926 gene locus_tag LOCUS_15260 5113 3926 CDS product CBU_0270 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957471.1 protein_id gnl|my_center|LOCUS_15260 6915 5317 gene locus_tag LOCUS_15270 6915 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 8423 6912 gene locus_tag LOCUS_15280 8423 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 9427 8573 gene locus_tag LOCUS_15290 gene dapF 9427 8573 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_15290 9561 11357 gene locus_tag LOCUS_15300 gene sppA 9561 11357 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_15300 11365 11892 gene locus_tag LOCUS_15310 gene sufT 11365 11892 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_15310 13210 11918 gene locus_tag LOCUS_15320 gene larA 13210 11918 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_15320 14259 13177 gene locus_tag LOCUS_15330 14259 13177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 14716 14249 gene locus_tag LOCUS_15340 14716 14249 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392625.1 protein_id gnl|my_center|LOCUS_15340 15655 14807 gene locus_tag LOCUS_15350 15655 14807 CDS product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_15350 17917 15761 gene locus_tag LOCUS_15360 gene vpsO 17917 15761 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_15360 18570 17929 gene locus_tag LOCUS_15370 18570 17929 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185660149.1 protein_id gnl|my_center|LOCUS_15370 19714 18575 gene locus_tag LOCUS_15380 19714 18575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 20573 19743 gene locus_tag LOCUS_15390 20573 19743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 23229 20656 gene locus_tag LOCUS_15400 gene leuS 23229 20656 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_15400 23275 24594 gene locus_tag LOCUS_15410 23275 24594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 24591 25976 gene locus_tag LOCUS_15420 24591 25976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 25982 26584 gene locus_tag LOCUS_15430 25982 26584 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803670.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence040 612 2114 gene locus_tag LOCUS_15440 612 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2130 3077 gene locus_tag LOCUS_15450 2130 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 3074 4318 gene locus_tag LOCUS_15460 3074 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 4323 5186 gene locus_tag LOCUS_15470 4323 5186 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889392.1 protein_id gnl|my_center|LOCUS_15470 5190 6557 gene locus_tag LOCUS_15480 5190 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 6554 8101 gene locus_tag LOCUS_15490 6554 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 8098 9288 gene locus_tag LOCUS_15500 8098 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 9285 10424 gene locus_tag LOCUS_15510 9285 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 10458 11021 gene locus_tag LOCUS_15520 gene wcaF 10458 11021 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_15520 11018 12115 gene locus_tag LOCUS_15530 11018 12115 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967531.1 protein_id gnl|my_center|LOCUS_15530 12134 13258 gene locus_tag LOCUS_15540 12134 13258 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331373.1 protein_id gnl|my_center|LOCUS_15540 13255 14697 gene locus_tag LOCUS_15550 13255 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 14701 15507 gene locus_tag LOCUS_15560 14701 15507 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_15560 15515 16705 gene locus_tag LOCUS_15570 15515 16705 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974189.1 protein_id gnl|my_center|LOCUS_15570 16747 18123 gene locus_tag LOCUS_15580 16747 18123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 18132 18728 gene locus_tag LOCUS_15590 18132 18728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 18839 19225 gene locus_tag LOCUS_15600 18839 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 19222 20622 gene locus_tag LOCUS_15610 gene merA 19222 20622 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228473.1 protein_id gnl|my_center|LOCUS_15610 21384 20644 gene locus_tag LOCUS_15620 gene hisA 21384 20644 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461460.1 protein_id gnl|my_center|LOCUS_15620 21453 22538 gene locus_tag LOCUS_15630 21453 22538 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_15630 23887 22592 gene locus_tag LOCUS_15640 gene clpX 23887 22592 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_15640 24569 23949 gene locus_tag LOCUS_15650 gene clpP 24569 23949 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_15650 25958 24591 gene locus_tag LOCUS_15660 gene tig 25958 24591 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957768.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence041 251 2677 gene locus_tag LOCUS_15670 251 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2694 3068 gene locus_tag LOCUS_15680 2694 3068 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_15680 3065 4663 gene locus_tag LOCUS_15690 3065 4663 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085076.1 protein_id gnl|my_center|LOCUS_15690 6889 4682 gene locus_tag LOCUS_15700 gene glgB 6889 4682 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_15700 6943 9102 gene locus_tag LOCUS_15710 6943 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 9114 10313 gene locus_tag LOCUS_15720 9114 10313 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 protein_id gnl|my_center|LOCUS_15720 10355 11137 gene locus_tag LOCUS_15730 10355 11137 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_15730 11134 11385 gene locus_tag LOCUS_15740 11134 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 11457 11783 gene locus_tag LOCUS_15750 gene trxA 11457 11783 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_15750 12733 11840 gene locus_tag LOCUS_15760 12733 11840 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404105.1 protein_id gnl|my_center|LOCUS_15760 13618 12803 gene locus_tag LOCUS_15770 13618 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 14426 13599 gene locus_tag LOCUS_15780 14426 13599 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_15780 15299 14451 gene locus_tag LOCUS_15790 15299 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 15571 15296 gene locus_tag LOCUS_15800 15571 15296 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583748.1 protein_id gnl|my_center|LOCUS_15800 15686 16372 gene locus_tag LOCUS_15810 15686 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 16438 16531 gene locus_tag LOCUS_t00290 16438 16531 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16582 17706 gene locus_tag LOCUS_15820 16582 17706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 19718 17745 gene locus_tag LOCUS_15830 19718 17745 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_15830 19971 20924 gene locus_tag LOCUS_15840 19971 20924 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_15840 21322 20921 gene locus_tag LOCUS_15850 21322 20921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 21236 21466 gene locus_tag LOCUS_15860 21236 21466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 24842 21672 gene locus_tag LOCUS_15870 24842 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 <26596 25095 gene locus_tag LOCUS_15880 <26596 25095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein >Feature sequence042 <1 2161 gene locus_tag LOCUS_15890 <1 2161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein 2293 2991 gene locus_tag LOCUS_15900 2293 2991 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194706.1 protein_id gnl|my_center|LOCUS_15900 3442 3366 gene locus_tag LOCUS_t00300 3442 3366 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3660 4148 gene locus_tag LOCUS_15910 3660 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4212 4796 gene locus_tag LOCUS_15920 4212 4796 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_15920 4869 6128 gene locus_tag LOCUS_15930 4869 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 6358 7077 gene locus_tag LOCUS_15940 6358 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_15940 7089 9011 gene locus_tag LOCUS_15950 7089 9011 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_15950 9080 9892 gene locus_tag LOCUS_15960 9080 9892 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_15960 9975 10193 gene locus_tag LOCUS_15970 9975 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 10756 10274 gene locus_tag LOCUS_15980 10756 10274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 11087 10824 gene locus_tag LOCUS_15990 11087 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 11164 12468 gene locus_tag LOCUS_16000 gene lysA 11164 12468 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383406.1 protein_id gnl|my_center|LOCUS_16000 12587 13603 gene locus_tag LOCUS_16010 12587 13603 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847058.1 protein_id gnl|my_center|LOCUS_16010 13673 15304 gene locus_tag LOCUS_16020 13673 15304 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064062.1 protein_id gnl|my_center|LOCUS_16020 15288 15887 gene locus_tag LOCUS_16030 15288 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 15989 18103 gene locus_tag LOCUS_16040 15989 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 18160 18936 gene locus_tag LOCUS_16050 18160 18936 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 protein_id gnl|my_center|LOCUS_16050 19875 18949 gene locus_tag LOCUS_16060 gene yedA 19875 18949 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_16060 20022 20717 gene locus_tag LOCUS_16070 20022 20717 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_16070 21090 20746 gene locus_tag LOCUS_16080 21090 20746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 22071 21163 gene locus_tag LOCUS_16090 22071 21163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 22831 22088 gene locus_tag LOCUS_16100 22831 22088 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_16100 23989 22913 gene locus_tag LOCUS_16110 23989 22913 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_16110 25413 23992 gene locus_tag LOCUS_16120 25413 23992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 25529 25927 gene locus_tag LOCUS_16130 25529 25927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence043 <1 907 gene locus_tag LOCUS_16140 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228683.1:sugar ABC transporter permease 942 1778 gene locus_tag LOCUS_16150 942 1778 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027191.1 protein_id gnl|my_center|LOCUS_16150 2229 2041 gene locus_tag LOCUS_16160 2229 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2141 3451 gene locus_tag LOCUS_16170 2141 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3521 4420 gene locus_tag LOCUS_16180 3521 4420 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_16180 4482 5588 gene locus_tag LOCUS_16190 4482 5588 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_16190 5596 6243 gene locus_tag LOCUS_16200 5596 6243 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970384.1 protein_id gnl|my_center|LOCUS_16200 7321 6254 gene locus_tag LOCUS_16210 7321 6254 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941859.1 protein_id gnl|my_center|LOCUS_16210 7434 10130 gene locus_tag LOCUS_16220 7434 10130 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227576.1 protein_id gnl|my_center|LOCUS_16220 11172 10180 gene locus_tag LOCUS_16230 11172 10180 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644533.1 protein_id gnl|my_center|LOCUS_16230 11276 11845 gene locus_tag LOCUS_16240 11276 11845 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 protein_id gnl|my_center|LOCUS_16240 12492 11842 gene locus_tag LOCUS_16250 12492 11842 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_16250 13582 12512 gene locus_tag LOCUS_16260 13582 12512 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143817.1 protein_id gnl|my_center|LOCUS_16260 15203 13647 gene locus_tag LOCUS_16270 gene murJ 15203 13647 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_16270 15963 15277 gene locus_tag LOCUS_16280 15963 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 16249 15971 gene locus_tag LOCUS_16290 16249 15971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 16353 17246 gene locus_tag LOCUS_16300 16353 17246 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125281.1 protein_id gnl|my_center|LOCUS_16300 17313 17534 gene locus_tag LOCUS_16310 17313 17534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 18325 17555 gene locus_tag LOCUS_16320 gene tpiA 18325 17555 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_16320 19583 18339 gene locus_tag LOCUS_16330 19583 18339 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_16330 20715 19669 gene locus_tag LOCUS_16340 gene gap 20715 19669 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668968.1 protein_id gnl|my_center|LOCUS_16340 23288 20832 gene locus_tag LOCUS_16350 23288 20832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 24278 23352 gene locus_tag LOCUS_16360 24278 23352 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203438.1 protein_id gnl|my_center|LOCUS_16360 24377 25459 gene locus_tag LOCUS_16370 gene mnmA 24377 25459 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence044 58 1140 gene locus_tag LOCUS_16380 58 1140 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_16380 1212 1730 gene locus_tag LOCUS_16390 1212 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1841 2389 gene locus_tag LOCUS_16400 1841 2389 CDS product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958464.1 protein_id gnl|my_center|LOCUS_16400 2386 2913 gene locus_tag LOCUS_16410 2386 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3013 4005 gene locus_tag LOCUS_16420 3013 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5647 4019 gene locus_tag LOCUS_16430 5647 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6555 5782 gene locus_tag LOCUS_16440 6555 5782 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_16440 6663 7613 gene locus_tag LOCUS_16450 6663 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 10133 7713 gene locus_tag LOCUS_16460 10133 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 10348 11571 gene locus_tag LOCUS_16470 10348 11571 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_16470 12838 11588 gene locus_tag LOCUS_16480 12838 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 14625 12835 gene locus_tag LOCUS_16490 14625 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 15266 14622 gene locus_tag LOCUS_16500 15266 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 15940 15263 gene locus_tag LOCUS_16510 15940 15263 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528748.1 protein_id gnl|my_center|LOCUS_16510 16244 16014 gene locus_tag LOCUS_16520 16244 16014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 17409 16255 gene locus_tag LOCUS_16530 17409 16255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 18039 17509 gene locus_tag LOCUS_16540 18039 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 19181 18036 gene locus_tag LOCUS_16550 19181 18036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 20239 19178 gene locus_tag LOCUS_16560 20239 19178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 20985 20326 gene locus_tag LOCUS_16570 20985 20326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 21428 20982 gene locus_tag LOCUS_16580 21428 20982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 21969 21430 gene locus_tag LOCUS_16590 21969 21430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 22435 21980 gene locus_tag LOCUS_16600 gene xcpT 22435 21980 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_16600 22621 22546 gene locus_tag LOCUS_t00310 22621 22546 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22790 24448 gene locus_tag LOCUS_16610 22790 24448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 24526 24720 gene locus_tag LOCUS_16620 24526 24720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence045 <1 1016 gene locus_tag LOCUS_16630 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121410.1:NAD-dependent epimerase/dehydratase family protein 1083 2255 gene locus_tag LOCUS_16640 1083 2255 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084677518.1 protein_id gnl|my_center|LOCUS_16640 2349 2906 gene locus_tag LOCUS_16650 2349 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 3233 4306 gene locus_tag LOCUS_16660 3233 4306 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615432.1 protein_id gnl|my_center|LOCUS_16660 4321 5091 gene locus_tag LOCUS_16670 4321 5091 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_16670 5162 6031 gene locus_tag LOCUS_16680 5162 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 6065 6433 gene locus_tag LOCUS_16690 6065 6433 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_16690 6485 7552 gene locus_tag LOCUS_16700 gene rfbB 6485 7552 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_16700 7638 8504 gene locus_tag LOCUS_16710 gene rfbA 7638 8504 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_16710 8595 9542 gene locus_tag LOCUS_16720 8595 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 10493 9549 gene locus_tag LOCUS_16730 10493 9549 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_16730 11599 10490 gene locus_tag LOCUS_16740 11599 10490 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388688.1 protein_id gnl|my_center|LOCUS_16740 12593 11592 gene locus_tag LOCUS_16750 12593 11592 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_16750 14850 12643 gene locus_tag LOCUS_16760 14850 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 15664 14921 gene locus_tag LOCUS_16770 15664 14921 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206409.1 protein_id gnl|my_center|LOCUS_16770 15722 17353 gene locus_tag LOCUS_16780 15722 17353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 18310 17366 gene locus_tag LOCUS_16790 18310 17366 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793191.1 protein_id gnl|my_center|LOCUS_16790 19958 18333 gene locus_tag LOCUS_16800 19958 18333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 20000 21526 gene locus_tag LOCUS_16810 20000 21526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 21608 22768 gene locus_tag LOCUS_16820 21608 22768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 22865 24061 gene locus_tag LOCUS_16830 22865 24061 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_16830 24692 24078 gene locus_tag LOCUS_16840 24692 24078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence046 1252 398 gene locus_tag LOCUS_16850 gene hemC 1252 398 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258453.1 protein_id gnl|my_center|LOCUS_16850 2343 1315 gene locus_tag LOCUS_16860 gene ilvC 2343 1315 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880791.1 protein_id gnl|my_center|LOCUS_16860 2887 2417 gene locus_tag LOCUS_16870 gene ilvN 2887 2417 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_16870 3933 3136 gene locus_tag LOCUS_16880 3933 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 4159 4842 gene locus_tag LOCUS_16890 gene degU 4159 4842 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722647.1 protein_id gnl|my_center|LOCUS_16890 4996 5865 gene locus_tag LOCUS_16900 4996 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16900 5872 6147 gene locus_tag LOCUS_16910 5872 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 6144 6524 gene locus_tag LOCUS_16920 6144 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 6521 6922 gene locus_tag LOCUS_16930 6521 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 6919 7281 gene locus_tag LOCUS_16940 6919 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 7278 9368 gene locus_tag LOCUS_16950 gene lcrD 7278 9368 CDS product SctV family type III secretion system export apparatus subunit LcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117635.1 protein_id gnl|my_center|LOCUS_16950 9377 9811 gene locus_tag LOCUS_16960 9377 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 9847 11697 gene locus_tag LOCUS_16970 gene sctC 9847 11697 CDS product type III secretion system outer membrane ring subunit SctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176690.1 protein_id gnl|my_center|LOCUS_16970 11713 13029 gene locus_tag LOCUS_16980 11713 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 13121 13351 gene locus_tag LOCUS_16990 13121 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 13366 13644 gene locus_tag LOCUS_17000 13366 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 13693 13965 gene locus_tag LOCUS_17010 13693 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 13982 14383 gene locus_tag LOCUS_17020 13982 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 14380 14817 gene locus_tag LOCUS_17030 14380 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 14876 15655 gene locus_tag LOCUS_17040 gene sctJ 14876 15655 CDS product type III secretion inner membrane ring lipoprotein SctJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551931.1 protein_id gnl|my_center|LOCUS_17040 15652 16332 gene locus_tag LOCUS_17050 15652 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 16320 16925 gene locus_tag LOCUS_17060 gene vscL 16320 16925 CDS product SctL family type III secretion system stator protein VscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464499.1 protein_id gnl|my_center|LOCUS_17060 16922 18253 gene locus_tag LOCUS_17070 gene sctN 16922 18253 CDS product type III secretion system ATPase SctN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176697.1 protein_id gnl|my_center|LOCUS_17070 18250 18765 gene locus_tag LOCUS_17080 gene pscO 18250 18765 CDS product type III secretion system central stalk protein PscO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087688.1 protein_id gnl|my_center|LOCUS_17080 18752 20551 gene locus_tag LOCUS_17090 18752 20551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17090 20548 21564 gene locus_tag LOCUS_17100 gene pscQ 20548 21564 CDS product SctQ family type III secretion system cytoplasmic ring protein PscQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114622.1 protein_id gnl|my_center|LOCUS_17100 21561 22226 gene locus_tag LOCUS_17110 gene vscR 21561 22226 CDS product SctR family type III secretion system export apparatus subunit VscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377232.1 protein_id gnl|my_center|LOCUS_17110 22238 22519 gene locus_tag LOCUS_17120 gene vscS 22238 22519 CDS product SctS family type III secretion system export apparatus subunit VscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464497.1 protein_id gnl|my_center|LOCUS_17120 22614 23402 gene locus_tag LOCUS_17130 gene vscT 22614 23402 CDS product SctT family type III secretion system export apparatus subunit VscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464642.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence047 1430 2827 gene locus_tag LOCUS_17140 1430 2827 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421521.1 protein_id gnl|my_center|LOCUS_17140 2847 4214 gene locus_tag LOCUS_17150 2847 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17150 5924 4239 gene locus_tag LOCUS_17160 5924 4239 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205766.1 protein_id gnl|my_center|LOCUS_17160 6244 6017 gene locus_tag LOCUS_17170 6244 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 7022 6429 gene locus_tag LOCUS_17180 7022 6429 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020479965.1 protein_id gnl|my_center|LOCUS_17180 9477 7114 gene locus_tag LOCUS_17190 9477 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 10151 10894 gene locus_tag LOCUS_17200 10151 10894 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_17200 12136 10916 gene locus_tag LOCUS_17210 12136 10916 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479718.1 protein_id gnl|my_center|LOCUS_17210 12307 13479 gene locus_tag LOCUS_17220 gene carA 12307 13479 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_17220 13540 14130 gene locus_tag LOCUS_17230 13540 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 14826 14167 gene locus_tag LOCUS_17240 gene kdsB 14826 14167 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672371.1 protein_id gnl|my_center|LOCUS_17240 14944 15297 gene locus_tag LOCUS_17250 14944 15297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 16137 15337 gene locus_tag LOCUS_17260 16137 15337 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_17260 17637 16141 gene locus_tag LOCUS_17270 17637 16141 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889049.1 protein_id gnl|my_center|LOCUS_17270 17814 18881 gene locus_tag LOCUS_17280 17814 18881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 19849 18908 gene locus_tag LOCUS_17290 19849 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 20172 19921 gene locus_tag LOCUS_17300 20172 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 20540 20169 gene locus_tag LOCUS_17310 20540 20169 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_17310 22045 20537 gene locus_tag LOCUS_17320 22045 20537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 22213 22998 gene locus_tag LOCUS_17330 22213 22998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_17330 22995 24011 gene locus_tag LOCUS_17340 22995 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence048 <1 1149 gene locus_tag LOCUS_17350 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:FAD-binding and (Fe-S)-binding domain-containing protein 1785 1168 gene locus_tag LOCUS_17360 gene upp 1785 1168 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_17360 4258 1841 gene locus_tag LOCUS_17370 4258 1841 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535630.1 protein_id gnl|my_center|LOCUS_17370 4740 4255 gene locus_tag LOCUS_17380 4740 4255 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_17380 5202 4753 gene locus_tag LOCUS_17390 5202 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5387 6895 gene locus_tag LOCUS_17400 5387 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 6883 9585 gene locus_tag LOCUS_17410 gene fdhF 6883 9585 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 protein_id gnl|my_center|LOCUS_17410 9635 10183 gene locus_tag LOCUS_17420 9635 10183 CDS product DUF3016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921578.1 protein_id gnl|my_center|LOCUS_17420 10315 11046 gene locus_tag LOCUS_17430 10315 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 11056 11424 gene locus_tag LOCUS_17440 11056 11424 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190696.1 protein_id gnl|my_center|LOCUS_17440 11444 11857 gene locus_tag LOCUS_17450 gene fadM 11444 11857 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194543.1 protein_id gnl|my_center|LOCUS_17450 12058 12411 gene locus_tag LOCUS_17460 12058 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 12518 13753 gene locus_tag LOCUS_17470 12518 13753 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17470 13805 14425 gene locus_tag LOCUS_17480 13805 14425 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_17480 14448 14918 gene locus_tag LOCUS_17490 14448 14918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 15798 14905 gene locus_tag LOCUS_17500 gene rarD 15798 14905 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791842.1 protein_id gnl|my_center|LOCUS_17500 16043 15795 gene locus_tag LOCUS_17510 16043 15795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 16145 17254 gene locus_tag LOCUS_17520 16145 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 19278 17248 gene locus_tag LOCUS_17530 19278 17248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 21783 19420 gene locus_tag LOCUS_17540 21783 19420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 22533 21856 gene locus_tag LOCUS_17550 22533 21856 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017302344.1 protein_id gnl|my_center|LOCUS_17550 <23670 22574 gene locus_tag LOCUS_17560 <23670 22574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942604.1:tRNA dihydrouridine synthase DusB >Feature sequence049 55 672 gene locus_tag LOCUS_17570 55 672 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_17570 1938 673 gene locus_tag LOCUS_17580 1938 673 CDS product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262236.1 protein_id gnl|my_center|LOCUS_17580 1975 4212 gene locus_tag LOCUS_17590 1975 4212 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256956.1 protein_id gnl|my_center|LOCUS_17590 4330 5355 gene locus_tag LOCUS_17600 gene tdh 4330 5355 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 protein_id gnl|my_center|LOCUS_17600 5359 6549 gene locus_tag LOCUS_17610 5359 6549 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242757.1 protein_id gnl|my_center|LOCUS_17610 6552 6980 gene locus_tag LOCUS_17620 6552 6980 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816436.1 protein_id gnl|my_center|LOCUS_17620 8309 6996 gene locus_tag LOCUS_17630 gene hisS 8309 6996 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_17630 8750 8418 gene locus_tag LOCUS_17640 8750 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 8829 9569 gene locus_tag LOCUS_17650 gene ubiE 8829 9569 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_17650 9917 9585 gene locus_tag LOCUS_17660 gene erpA 9917 9585 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095643.1 protein_id gnl|my_center|LOCUS_17660 9995 11017 gene locus_tag LOCUS_17670 9995 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 11042 12517 gene locus_tag LOCUS_17680 gene rpoN 11042 12517 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_17680 13576 12533 gene locus_tag LOCUS_17690 gene tsaD 13576 12533 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068344.1 protein_id gnl|my_center|LOCUS_17690 14914 13580 gene locus_tag LOCUS_17700 14914 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 14913 15890 gene locus_tag LOCUS_17710 14913 15890 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530006.1 protein_id gnl|my_center|LOCUS_17710 16046 16276 gene locus_tag LOCUS_17720 gene rpmB 16046 16276 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124776.1 protein_id gnl|my_center|LOCUS_17720 16406 18226 gene locus_tag LOCUS_17730 16406 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 19473 18223 gene locus_tag LOCUS_17740 gene fabF 19473 18223 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_17740 19839 19576 gene locus_tag LOCUS_17750 gene acpP 19839 19576 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_17750 20707 19868 gene locus_tag LOCUS_17760 gene fabG 20707 19868 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_17760 21923 20721 gene locus_tag LOCUS_17770 21923 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 21994 22794 gene locus_tag LOCUS_17780 21994 22794 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053851.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence050 442 2472 gene locus_tag LOCUS_17790 gene ladS 442 2472 CDS product hybrid sensor histidine kinase/response regulator LadS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_17790 2469 3200 gene locus_tag LOCUS_17800 2469 3200 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_17800 3415 4251 gene locus_tag LOCUS_17810 3415 4251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201271903.1 protein_id gnl|my_center|LOCUS_17810 4248 5129 gene locus_tag LOCUS_17820 4248 5129 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082545.1 protein_id gnl|my_center|LOCUS_17820 5225 5443 gene locus_tag LOCUS_17830 5225 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 5496 5795 gene locus_tag LOCUS_17840 5496 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 7118 5832 gene locus_tag LOCUS_17850 gene hflX 7118 5832 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_17850 8031 7219 gene locus_tag LOCUS_17860 8031 7219 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_17860 8408 8121 gene locus_tag LOCUS_17870 8408 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 8337 8690 gene locus_tag LOCUS_17880 8337 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 9683 8589 gene locus_tag LOCUS_17890 gene ppgL 9683 8589 CDS product gluconolactonase PpgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114725.1 protein_id gnl|my_center|LOCUS_17890 10278 9697 gene locus_tag LOCUS_17900 10278 9697 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334933.1 protein_id gnl|my_center|LOCUS_17900 11297 10335 gene locus_tag LOCUS_17910 11297 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 11549 13819 gene locus_tag LOCUS_17920 11549 13819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 13824 14654 gene locus_tag LOCUS_17930 13824 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 16711 14687 gene locus_tag LOCUS_17940 16711 14687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 20283 16891 gene locus_tag LOCUS_17950 20283 16891 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_17950 20819 20427 gene locus_tag LOCUS_17960 20819 20427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 21093 20797 gene locus_tag LOCUS_17970 21093 20797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 22986 21145 gene locus_tag LOCUS_17980 gene htpG 22986 21145 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence051 926 2308 gene locus_tag LOCUS_17990 926 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2606 3199 gene locus_tag LOCUS_18000 2606 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 3203 3787 gene locus_tag LOCUS_18010 3203 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3838 5439 gene locus_tag LOCUS_18020 3838 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 5532 5897 gene locus_tag LOCUS_18030 5532 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 5919 6944 gene locus_tag LOCUS_18040 5919 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 7390 6941 gene locus_tag LOCUS_18050 7390 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 7502 8902 gene locus_tag LOCUS_18060 gene argH 7502 8902 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338440.1 protein_id gnl|my_center|LOCUS_18060 8994 10790 gene locus_tag LOCUS_18070 gene mutL 8994 10790 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139982.1 protein_id gnl|my_center|LOCUS_18070 10843 13365 gene locus_tag LOCUS_18080 10843 13365 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706264.1 protein_id gnl|my_center|LOCUS_18080 13482 14393 gene locus_tag LOCUS_18090 13482 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 14449 14664 gene locus_tag LOCUS_18100 14449 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 14669 15043 gene locus_tag LOCUS_18110 14669 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 16447 15098 gene locus_tag LOCUS_18120 16447 15098 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_18120 16403 16987 gene locus_tag LOCUS_18130 16403 16987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 17521 17003 gene locus_tag LOCUS_18140 17521 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 17646 19481 gene locus_tag LOCUS_18150 17646 19481 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_18150 20068 19550 gene locus_tag LOCUS_18160 20068 19550 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_18160 20685 20128 gene locus_tag LOCUS_18170 20685 20128 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256187.1 protein_id gnl|my_center|LOCUS_18170 20797 21888 gene locus_tag LOCUS_18180 gene recF 20797 21888 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391554.1 protein_id gnl|my_center|LOCUS_18180 21885 22619 gene locus_tag LOCUS_18190 21885 22619 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence052 2702 924 gene locus_tag LOCUS_18200 2702 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 4599 2728 gene locus_tag LOCUS_18210 4599 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5092 4742 gene locus_tag LOCUS_18220 5092 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 5972 5499 gene locus_tag LOCUS_18230 5972 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 6556 5969 gene locus_tag LOCUS_18240 gene nadD 6556 5969 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_18240 6848 6933 gene locus_tag LOCUS_t00320 6848 6933 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9087 7096 gene locus_tag LOCUS_18250 9087 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 9236 11710 gene locus_tag LOCUS_18260 9236 11710 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_18260 11961 11668 gene locus_tag LOCUS_18270 11961 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 11944 13605 gene locus_tag LOCUS_18280 gene ggt 11944 13605 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_18280 13676 14665 gene locus_tag LOCUS_18290 13676 14665 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123535.1 protein_id gnl|my_center|LOCUS_18290 14686 15054 gene locus_tag LOCUS_18300 14686 15054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 15073 15564 gene locus_tag LOCUS_18310 15073 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 15615 17009 gene locus_tag LOCUS_18320 15615 17009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 17230 17027 gene locus_tag LOCUS_18330 17230 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 17775 17227 gene locus_tag LOCUS_18340 17775 17227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 20094 17938 gene locus_tag LOCUS_18350 20094 17938 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932948.1 protein_id gnl|my_center|LOCUS_18350 21218 20172 gene locus_tag LOCUS_18360 21218 20172 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_18360 21398 22309 gene locus_tag LOCUS_18370 21398 22309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence053 444 1550 gene locus_tag LOCUS_18380 444 1550 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_18380 4174 1682 gene locus_tag LOCUS_18390 4174 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 4807 4460 gene locus_tag LOCUS_18400 4807 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5242 5853 gene locus_tag LOCUS_18410 5242 5853 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140815.1 protein_id gnl|my_center|LOCUS_18410 5861 8068 gene locus_tag LOCUS_18420 5861 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 8155 11655 gene locus_tag LOCUS_18430 8155 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 11677 14223 gene locus_tag LOCUS_18440 11677 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 14198 15280 gene locus_tag LOCUS_18450 14198 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 15270 16703 gene locus_tag LOCUS_18460 15270 16703 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525350.1 protein_id gnl|my_center|LOCUS_18460 17702 16734 gene locus_tag LOCUS_18470 17702 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 18558 17875 gene locus_tag LOCUS_18480 18558 17875 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037101.1 protein_id gnl|my_center|LOCUS_18480 19317 18835 gene locus_tag LOCUS_18490 19317 18835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 19645 19328 gene locus_tag LOCUS_18500 19645 19328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 22436 19830 gene locus_tag LOCUS_18510 22436 19830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence054 1326 349 gene locus_tag LOCUS_18520 1326 349 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088661.1 protein_id gnl|my_center|LOCUS_18520 2254 1388 gene locus_tag LOCUS_18530 2254 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2372 3169 gene locus_tag LOCUS_18540 2372 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 3221 3589 gene locus_tag LOCUS_18550 3221 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3746 8389 gene locus_tag LOCUS_18560 gene gltB 3746 8389 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_18560 8468 9949 gene locus_tag LOCUS_18570 8468 9949 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_18570 10006 10467 gene locus_tag LOCUS_18580 10006 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 11820 10735 gene locus_tag LOCUS_18590 11820 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 13087 11906 gene locus_tag LOCUS_18600 13087 11906 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026981.1 protein_id gnl|my_center|LOCUS_18600 13947 13084 gene locus_tag LOCUS_18610 13947 13084 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972799.1 protein_id gnl|my_center|LOCUS_18610 14034 14945 gene locus_tag LOCUS_18620 14034 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 15830 14958 gene locus_tag LOCUS_18630 15830 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_18630 16795 15866 gene locus_tag LOCUS_18640 16795 15866 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198203.1 protein_id gnl|my_center|LOCUS_18640 17537 16809 gene locus_tag LOCUS_18650 17537 16809 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804151.1 protein_id gnl|my_center|LOCUS_18650 18532 17621 gene locus_tag LOCUS_18660 18532 17621 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_18660 18678 19739 gene locus_tag LOCUS_18670 18678 19739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence055 327 1427 gene locus_tag LOCUS_18680 327 1427 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_18680 1424 2089 gene locus_tag LOCUS_18690 1424 2089 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_18690 2580 2086 gene locus_tag LOCUS_18700 2580 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2760 3209 gene locus_tag LOCUS_18710 2760 3209 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392728.1 protein_id gnl|my_center|LOCUS_18710 3226 3462 gene locus_tag LOCUS_18720 3226 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 4227 3511 gene locus_tag LOCUS_18730 4227 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 5671 4334 gene locus_tag LOCUS_18740 gene ffh 5671 4334 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938141.1 protein_id gnl|my_center|LOCUS_18740 5822 7009 gene locus_tag LOCUS_18750 5822 7009 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_18750 7018 8511 gene locus_tag LOCUS_18760 gene der 7018 8511 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_18760 8492 9409 gene locus_tag LOCUS_18770 8492 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_18770 9406 10389 gene locus_tag LOCUS_18780 gene fmt 9406 10389 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_18780 10433 11002 gene locus_tag LOCUS_18790 10433 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 11007 11915 gene locus_tag LOCUS_18800 11007 11915 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_18800 12039 12380 gene locus_tag LOCUS_18810 12039 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 12385 13272 gene locus_tag LOCUS_18820 12385 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 13355 14506 gene locus_tag LOCUS_18830 13355 14506 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767192.1 protein_id gnl|my_center|LOCUS_18830 15647 14517 gene locus_tag LOCUS_18840 gene ugpC 15647 14517 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_18840 15774 16097 gene locus_tag LOCUS_18850 15774 16097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 16177 17370 gene locus_tag LOCUS_18860 16177 17370 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_18860 17399 18235 gene locus_tag LOCUS_18870 17399 18235 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820280.1 protein_id gnl|my_center|LOCUS_18870 18955 18335 gene locus_tag LOCUS_18880 18955 18335 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 protein_id gnl|my_center|LOCUS_18880 21018 19126 gene locus_tag LOCUS_18890 gene pepF 21018 19126 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence056 589 1260 gene locus_tag LOCUS_18900 gene nth 589 1260 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_18900 1331 1407 gene locus_tag LOCUS_t00330 1331 1407 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5262 1750 gene locus_tag LOCUS_18910 5262 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 6475 5834 gene locus_tag LOCUS_18920 6475 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 6865 9267 gene locus_tag LOCUS_18930 6865 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 9386 10561 gene locus_tag LOCUS_18940 9386 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 10754 11962 gene locus_tag LOCUS_18950 10754 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 12485 15769 gene locus_tag LOCUS_18960 12485 15769 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_18960 15766 17904 gene locus_tag LOCUS_18970 15766 17904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 19100 17916 gene locus_tag LOCUS_18980 19100 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 19284 20366 gene locus_tag LOCUS_18990 19284 20366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_18990 21140 20391 gene locus_tag LOCUS_19000 21140 20391 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009567369.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence057 <1 2056 gene locus_tag LOCUS_19010 <1 2056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942131.1:ribonuclease R 2074 2598 gene locus_tag LOCUS_19020 2074 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4781 2595 gene locus_tag LOCUS_19030 4781 2595 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_19030 5141 4797 gene locus_tag LOCUS_19040 5141 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 5900 5418 gene locus_tag LOCUS_19050 5900 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 6192 5887 gene locus_tag LOCUS_19060 6192 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 7955 6189 gene locus_tag LOCUS_19070 7955 6189 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_19070 8042 8650 gene locus_tag LOCUS_19080 8042 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 8698 10041 gene locus_tag LOCUS_19090 gene argA 8698 10041 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702691.1 protein_id gnl|my_center|LOCUS_19090 11007 10054 gene locus_tag LOCUS_19100 11007 10054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_19100 12642 11149 gene locus_tag LOCUS_19110 12642 11149 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_19110 13663 12689 gene locus_tag LOCUS_19120 13663 12689 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_19120 14276 13815 gene locus_tag LOCUS_19130 14276 13815 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419733.1 protein_id gnl|my_center|LOCUS_19130 15313 14318 gene locus_tag LOCUS_19140 15313 14318 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_19140 15446 16693 gene locus_tag LOCUS_19150 15446 16693 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930606.1 protein_id gnl|my_center|LOCUS_19150 17159 16716 gene locus_tag LOCUS_19160 17159 16716 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530565.1 protein_id gnl|my_center|LOCUS_19160 18529 17162 gene locus_tag LOCUS_19170 18529 17162 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087805.1 protein_id gnl|my_center|LOCUS_19170 18751 20433 gene locus_tag LOCUS_19180 18751 20433 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence058 2632 1817 gene locus_tag LOCUS_19190 2632 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2774 5779 gene locus_tag LOCUS_19200 2774 5779 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085775.1 protein_id gnl|my_center|LOCUS_19200 8137 5780 gene locus_tag LOCUS_19210 8137 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 8353 9258 gene locus_tag LOCUS_19220 8353 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 9237 10379 gene locus_tag LOCUS_19230 9237 10379 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226897.1 protein_id gnl|my_center|LOCUS_19230 10402 13725 gene locus_tag LOCUS_19240 10402 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 13722 14852 gene locus_tag LOCUS_19250 13722 14852 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 protein_id gnl|my_center|LOCUS_19250 15779 14868 gene locus_tag LOCUS_19260 15779 14868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 15851 16669 gene locus_tag LOCUS_19270 15851 16669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 19082 16677 gene locus_tag LOCUS_19280 19082 16677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 20162 19143 gene locus_tag LOCUS_19290 20162 19143 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence059 1054 38 gene locus_tag LOCUS_19300 1054 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1905 1015 gene locus_tag LOCUS_19310 1905 1015 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_19310 1991 2974 gene locus_tag LOCUS_19320 1991 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2971 3861 gene locus_tag LOCUS_19330 gene cyoE 2971 3861 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_19330 3858 4292 gene locus_tag LOCUS_19340 3858 4292 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_19340 4864 4376 gene locus_tag LOCUS_19350 gene azu 4864 4376 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813974.1 protein_id gnl|my_center|LOCUS_19350 5072 6319 gene locus_tag LOCUS_19360 gene coxB 5072 6319 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745271.1 protein_id gnl|my_center|LOCUS_19360 6326 8260 gene locus_tag LOCUS_19370 gene ctaD 6326 8260 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 protein_id gnl|my_center|LOCUS_19370 8274 9119 gene locus_tag LOCUS_19380 8274 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 9127 9501 gene locus_tag LOCUS_19390 9127 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 9575 10360 gene locus_tag LOCUS_19400 gene ctaG 9575 10360 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069023.1 protein_id gnl|my_center|LOCUS_19400 10700 12070 gene locus_tag LOCUS_19410 gene hemN 10700 12070 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057557.1 protein_id gnl|my_center|LOCUS_19410 12083 13447 gene locus_tag LOCUS_19420 gene hemG 12083 13447 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_19420 15425 13572 gene locus_tag LOCUS_19430 15425 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 16614 15454 gene locus_tag LOCUS_19440 16614 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 17826 16621 gene locus_tag LOCUS_19450 17826 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 17995 19059 gene locus_tag LOCUS_19460 gene hypE 17995 19059 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728538.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence060 2976 1249 gene locus_tag LOCUS_19470 2976 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 3960 3202 gene locus_tag LOCUS_19480 3960 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 5018 3960 gene locus_tag LOCUS_19490 5018 3960 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_19490 5158 6327 gene locus_tag LOCUS_19500 5158 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 6442 7875 gene locus_tag LOCUS_19510 6442 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 8031 10535 gene locus_tag LOCUS_19520 8031 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 10565 12919 gene locus_tag LOCUS_19530 10565 12919 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_19530 13003 14130 gene locus_tag LOCUS_19540 13003 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 16432 14153 gene locus_tag LOCUS_19550 16432 14153 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_19550 16670 18700 gene locus_tag LOCUS_19560 16670 18700 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109364.1 protein_id gnl|my_center|LOCUS_19560 18927 18843 gene locus_tag LOCUS_t00340 18927 18843 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence061 744 1733 gene locus_tag LOCUS_19570 744 1733 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_19570 1730 2980 gene locus_tag LOCUS_19580 1730 2980 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083303.1 protein_id gnl|my_center|LOCUS_19580 3016 4689 gene locus_tag LOCUS_19590 gene fumA 3016 4689 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209418.1 protein_id gnl|my_center|LOCUS_19590 5601 4777 gene locus_tag LOCUS_19600 5601 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 6233 5598 gene locus_tag LOCUS_19610 gene rpoE 6233 5598 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 protein_id gnl|my_center|LOCUS_19610 7322 6294 gene locus_tag LOCUS_19620 7322 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 9110 7497 gene locus_tag LOCUS_19630 9110 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 9637 9107 gene locus_tag LOCUS_19640 9637 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 10212 9634 gene locus_tag LOCUS_19650 10212 9634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 10850 10209 gene locus_tag LOCUS_19660 10850 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 11877 10822 gene locus_tag LOCUS_19670 11877 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 15628 12431 gene locus_tag LOCUS_19680 15628 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 <17857 15625 gene locus_tag LOCUS_19690 <17857 15625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120395.1:PD-(D/E)XK nuclease family protein >Feature sequence062 2062 632 gene locus_tag LOCUS_19700 2062 632 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066425.1 protein_id gnl|my_center|LOCUS_19700 3465 2059 gene locus_tag LOCUS_19710 3465 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 5534 3591 gene locus_tag LOCUS_19720 5534 3591 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902316.1 protein_id gnl|my_center|LOCUS_19720 6795 5611 gene locus_tag LOCUS_19730 6795 5611 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036490.1 protein_id gnl|my_center|LOCUS_19730 7550 6942 gene locus_tag LOCUS_19740 7550 6942 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_19740 7683 8291 gene locus_tag LOCUS_19750 7683 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 8355 8795 gene locus_tag LOCUS_19760 8355 8795 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_19760 8859 10124 gene locus_tag LOCUS_19770 8859 10124 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_19770 10208 10990 gene locus_tag LOCUS_19780 10208 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 12024 11254 gene locus_tag LOCUS_19790 12024 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 12764 12021 gene locus_tag LOCUS_19800 12764 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 13366 12794 gene locus_tag LOCUS_19810 13366 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 14658 13426 gene locus_tag LOCUS_19820 14658 13426 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 protein_id gnl|my_center|LOCUS_19820 15124 14666 gene locus_tag LOCUS_19830 15124 14666 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458975.1 protein_id gnl|my_center|LOCUS_19830 15756 15124 gene locus_tag LOCUS_19840 15756 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_19840 17789 15801 gene locus_tag LOCUS_19850 gene nosZ 17789 15801 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence063 <1 1390 gene locus_tag LOCUS_19860 <1 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704165.1:fatty acid oxidation complex subunit alpha FadB 2202 1387 gene locus_tag LOCUS_19870 2202 1387 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_19870 2744 2199 gene locus_tag LOCUS_19880 2744 2199 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009543.1 protein_id gnl|my_center|LOCUS_19880 4056 2824 gene locus_tag LOCUS_19890 4056 2824 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_19890 5235 4432 gene locus_tag LOCUS_19900 5235 4432 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_19900 6401 5241 gene locus_tag LOCUS_19910 6401 5241 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061900.1 protein_id gnl|my_center|LOCUS_19910 7552 6404 gene locus_tag LOCUS_19920 7552 6404 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_19920 8655 7549 gene locus_tag LOCUS_19930 8655 7549 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_19930 9149 8733 gene locus_tag LOCUS_19940 9149 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 10180 9146 gene locus_tag LOCUS_19950 10180 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 10321 10563 gene locus_tag LOCUS_19960 10321 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 11332 10583 gene locus_tag LOCUS_19970 11332 10583 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_19970 11451 13460 gene locus_tag LOCUS_19980 11451 13460 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095484810.1 protein_id gnl|my_center|LOCUS_19980 13549 14775 gene locus_tag LOCUS_19990 13549 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 14784 15350 gene locus_tag LOCUS_20000 14784 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 16679 15360 gene locus_tag LOCUS_20010 16679 15360 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence064 1718 4300 gene locus_tag LOCUS_20020 gene clpB 1718 4300 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939160.1 protein_id gnl|my_center|LOCUS_20020 4393 5295 gene locus_tag LOCUS_20030 4393 5295 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_20030 5407 5491 gene locus_tag LOCUS_t00350 5407 5491 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5588 6571 gene locus_tag LOCUS_20040 5588 6571 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_20040 7703 6621 gene locus_tag LOCUS_20050 7703 6621 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_20050 7957 9168 gene locus_tag LOCUS_20060 7957 9168 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_20060 9227 9610 gene locus_tag LOCUS_20070 gene gloA 9227 9610 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688980.1 protein_id gnl|my_center|LOCUS_20070 9607 10338 gene locus_tag LOCUS_20080 9607 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 11279 10335 gene locus_tag LOCUS_20090 11279 10335 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_20090 11728 11258 gene locus_tag LOCUS_20100 11728 11258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 13399 11777 gene locus_tag LOCUS_20110 13399 11777 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705871.1 protein_id gnl|my_center|LOCUS_20110 14844 13426 gene locus_tag LOCUS_20120 14844 13426 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140537.1 protein_id gnl|my_center|LOCUS_20120 15377 14904 gene locus_tag LOCUS_20130 15377 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 16711 15386 gene locus_tag LOCUS_20140 16711 15386 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_20140 <17450 16766 gene locus_tag LOCUS_20150 <17450 16766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162471698.1:copper-translocating P-type ATPase >Feature sequence065 <1 904 gene locus_tag LOCUS_20160 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392360.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 938 1831 gene locus_tag LOCUS_20170 938 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1844 3007 gene locus_tag LOCUS_20180 gene ftsW 1844 3007 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216490.1 protein_id gnl|my_center|LOCUS_20180 3054 4184 gene locus_tag LOCUS_20190 gene murG 3054 4184 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969747.1 protein_id gnl|my_center|LOCUS_20190 4181 6490 gene locus_tag LOCUS_20200 4181 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 6487 7422 gene locus_tag LOCUS_20210 6487 7422 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_20210 7419 8387 gene locus_tag LOCUS_20220 7419 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 8404 9618 gene locus_tag LOCUS_20230 gene ftsA 8404 9618 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094115.1 protein_id gnl|my_center|LOCUS_20230 9626 10903 gene locus_tag LOCUS_20240 9626 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 10955 13000 gene locus_tag LOCUS_20250 10955 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 13068 14108 gene locus_tag LOCUS_20260 gene obgE 13068 14108 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_20260 14157 14777 gene locus_tag LOCUS_20270 14157 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 14782 16491 gene locus_tag LOCUS_20280 gene pilB 14782 16491 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_20280 16506 17036 gene locus_tag LOCUS_20290 16506 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence066 1361 4234 gene locus_tag LOCUS_20300 1361 4234 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_20300 5353 4469 gene locus_tag LOCUS_20310 5353 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 6749 5424 gene locus_tag LOCUS_20320 gene fabF 6749 5424 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_20320 7335 6742 gene locus_tag LOCUS_20330 7335 6742 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_20330 7595 8131 gene locus_tag LOCUS_20340 7595 8131 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_20340 8128 9183 gene locus_tag LOCUS_20350 8128 9183 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816443.1 protein_id gnl|my_center|LOCUS_20350 9205 11574 gene locus_tag LOCUS_20360 9205 11574 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_20360 11592 12140 gene locus_tag LOCUS_20370 11592 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 12197 12880 gene locus_tag LOCUS_20380 12197 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 12885 13520 gene locus_tag LOCUS_20390 12885 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 13529 16066 gene locus_tag LOCUS_20400 13529 16066 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523967.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence067 695 2638 gene locus_tag LOCUS_20410 gene fliD 695 2638 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080294.1 protein_id gnl|my_center|LOCUS_20410 2755 3462 gene locus_tag LOCUS_20420 2755 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3569 3853 gene locus_tag LOCUS_20430 3569 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 3859 4284 gene locus_tag LOCUS_20440 gene fliS 3859 4284 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392287.1 protein_id gnl|my_center|LOCUS_20440 4287 4658 gene locus_tag LOCUS_20450 4287 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4835 7033 gene locus_tag LOCUS_20460 4835 7033 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_20460 7511 7053 gene locus_tag LOCUS_20470 7511 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 7716 9170 gene locus_tag LOCUS_20480 7716 9170 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883224.1 protein_id gnl|my_center|LOCUS_20480 9353 9886 gene locus_tag LOCUS_20490 9353 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 9903 11060 gene locus_tag LOCUS_20500 9903 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 12588 11395 gene locus_tag LOCUS_20510 12588 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 12863 13387 gene locus_tag LOCUS_20520 12863 13387 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816201.1 protein_id gnl|my_center|LOCUS_20520 14294 13413 gene locus_tag LOCUS_20530 14294 13413 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_20530 <16163 14308 gene locus_tag LOCUS_20540 <16163 14308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940968.1:chemotaxis protein CheA >Feature sequence068 196 4770 gene locus_tag LOCUS_20550 196 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 6552 4822 gene locus_tag LOCUS_20560 6552 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 7457 6549 gene locus_tag LOCUS_20570 7457 6549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121967.1 protein_id gnl|my_center|LOCUS_20570 7855 7472 gene locus_tag LOCUS_20580 7855 7472 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583004.1 protein_id gnl|my_center|LOCUS_20580 7948 8496 gene locus_tag LOCUS_20590 gene pyrR 7948 8496 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805074.1 protein_id gnl|my_center|LOCUS_20590 8525 9478 gene locus_tag LOCUS_20600 8525 9478 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_20600 9619 10917 gene locus_tag LOCUS_20610 9619 10917 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_20610 10941 13028 gene locus_tag LOCUS_20620 10941 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 13088 13906 gene locus_tag LOCUS_20630 13088 13906 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393413.1 protein_id gnl|my_center|LOCUS_20630 13958 14905 gene locus_tag LOCUS_20640 gene thiL 13958 14905 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808600.1 protein_id gnl|my_center|LOCUS_20640 14902 15348 gene locus_tag LOCUS_20650 gene tsaE 14902 15348 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_20650 15421 15621 gene locus_tag LOCUS_20660 15421 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence069 3045 1996 gene locus_tag LOCUS_20670 3045 1996 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_20670 3924 3049 gene locus_tag LOCUS_20680 3924 3049 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_20680 4843 3944 gene locus_tag LOCUS_20690 gene hisG 4843 3944 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_20690 4932 5705 gene locus_tag LOCUS_20700 4932 5705 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166475.1 protein_id gnl|my_center|LOCUS_20700 5958 5749 gene locus_tag LOCUS_20710 5958 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 6968 6087 gene locus_tag LOCUS_20720 6968 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 8942 6999 gene locus_tag LOCUS_20730 8942 6999 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038331.1 protein_id gnl|my_center|LOCUS_20730 9852 8977 gene locus_tag LOCUS_20740 9852 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 10788 9856 gene locus_tag LOCUS_20750 10788 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 12380 10785 gene locus_tag LOCUS_20760 12380 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 12642 13148 gene locus_tag LOCUS_20770 12642 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 13351 14322 gene locus_tag LOCUS_20780 gene pdhA 13351 14322 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_20780 14374 15351 gene locus_tag LOCUS_20790 14374 15351 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence070 1846 4170 gene locus_tag LOCUS_20800 1846 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 4225 7701 gene locus_tag LOCUS_20810 4225 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 8488 7724 gene locus_tag LOCUS_20820 gene mmsR 8488 7724 CDS product MmsAB operon transcriptional regulator MmsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122160.1 protein_id gnl|my_center|LOCUS_20820 8605 9618 gene locus_tag LOCUS_20830 8605 9618 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487216.1 protein_id gnl|my_center|LOCUS_20830 9621 10703 gene locus_tag LOCUS_20840 9621 10703 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_20840 10787 12217 gene locus_tag LOCUS_20850 10787 12217 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_20850 12241 13002 gene locus_tag LOCUS_20860 12241 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence071 359 1702 gene locus_tag LOCUS_20870 359 1702 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_20870 4156 1823 gene locus_tag LOCUS_20880 4156 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 4276 5799 gene locus_tag LOCUS_20890 4276 5799 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 protein_id gnl|my_center|LOCUS_20890 6573 5842 gene locus_tag LOCUS_20900 6573 5842 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364547.1 protein_id gnl|my_center|LOCUS_20900 6729 7379 gene locus_tag LOCUS_20910 gene can 6729 7379 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_20910 7959 7402 gene locus_tag LOCUS_20920 gene efp 7959 7402 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258741.1 protein_id gnl|my_center|LOCUS_20920 8095 9420 gene locus_tag LOCUS_20930 8095 9420 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_20930 9425 10213 gene locus_tag LOCUS_20940 gene lpxA 9425 10213 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_20940 10691 10233 gene locus_tag LOCUS_20950 gene hisI 10691 10233 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_20950 11018 10722 gene locus_tag LOCUS_20960 11018 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 13594 11087 gene locus_tag LOCUS_20970 13594 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence072 544 2739 gene locus_tag LOCUS_20980 544 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 3043 5136 gene locus_tag LOCUS_20990 3043 5136 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_20990 5360 5686 gene locus_tag LOCUS_21000 5360 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 5750 6376 gene locus_tag LOCUS_21010 5750 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 6378 7328 gene locus_tag LOCUS_21020 6378 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 7325 8605 gene locus_tag LOCUS_21030 gene nrfD 7325 8605 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_21030 8619 9068 gene locus_tag LOCUS_21040 8619 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 9175 10854 gene locus_tag LOCUS_21050 9175 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 11054 11854 gene locus_tag LOCUS_21060 11054 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 11874 14039 gene locus_tag LOCUS_21070 11874 14039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 14448 14975 gene locus_tag LOCUS_21080 gene hoxE 14448 14975 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence073 1206 2411 gene locus_tag LOCUS_21090 1206 2411 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_21090 2528 2968 gene locus_tag LOCUS_21100 2528 2968 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926892.1 protein_id gnl|my_center|LOCUS_21100 4522 2996 gene locus_tag LOCUS_21110 4522 2996 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_21110 5234 4599 gene locus_tag LOCUS_21120 5234 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 6762 5284 gene locus_tag LOCUS_21130 6762 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484298.1 protein_id gnl|my_center|LOCUS_21130 6895 8775 gene locus_tag LOCUS_21140 6895 8775 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 protein_id gnl|my_center|LOCUS_21140 9266 8772 gene locus_tag LOCUS_21150 9266 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 9506 10330 gene locus_tag LOCUS_21160 9506 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 10585 12201 gene locus_tag LOCUS_21170 10585 12201 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942559.1 protein_id gnl|my_center|LOCUS_21170 12263 13126 gene locus_tag LOCUS_21180 12263 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 13159 14844 gene locus_tag LOCUS_21190 13159 14844 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396100.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence074 <1 573 gene locus_tag LOCUS_21200 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324371.1:30S ribosomal protein S1 1801 743 gene locus_tag LOCUS_21210 1801 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3491 2010 gene locus_tag LOCUS_21220 gene trpE 3491 2010 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_21220 3814 4542 gene locus_tag LOCUS_21230 3814 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 5233 4670 gene locus_tag LOCUS_21240 5233 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 7401 5545 gene locus_tag LOCUS_21250 gene glmS 7401 5545 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_21250 7491 8780 gene locus_tag LOCUS_21260 7491 8780 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124994.1 protein_id gnl|my_center|LOCUS_21260 9655 8849 gene locus_tag LOCUS_21270 gene lgt 9655 8849 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967285.1 protein_id gnl|my_center|LOCUS_21270 10750 9677 gene locus_tag LOCUS_21280 10750 9677 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_21280 10858 11961 gene locus_tag LOCUS_21290 gene gcvT 10858 11961 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393443.1 protein_id gnl|my_center|LOCUS_21290 11958 12341 gene locus_tag LOCUS_21300 gene gcvH 11958 12341 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307993.1 protein_id gnl|my_center|LOCUS_21300 12552 13619 gene locus_tag LOCUS_21310 12552 13619 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence075 256 1314 gene locus_tag LOCUS_21320 256 1314 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057409.1 protein_id gnl|my_center|LOCUS_21320 1414 2397 gene locus_tag LOCUS_21330 1414 2397 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_21330 4861 2450 gene locus_tag LOCUS_21340 4861 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 5620 4925 gene locus_tag LOCUS_21350 5620 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 5992 5702 gene locus_tag LOCUS_21360 5992 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 6162 6662 gene locus_tag LOCUS_21370 6162 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 6700 7164 gene locus_tag LOCUS_21380 6700 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 8786 7182 gene locus_tag LOCUS_21390 8786 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 9613 8783 gene locus_tag LOCUS_21400 9613 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 11282 9681 gene locus_tag LOCUS_21410 11282 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 12136 11279 gene locus_tag LOCUS_21420 12136 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 13360 12209 gene locus_tag LOCUS_21430 13360 12209 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_21430 <14808 13405 gene locus_tag LOCUS_21440 <14808 13405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108456.1:DUF4091 domain-containing protein >Feature sequence076 <1 941 gene locus_tag LOCUS_21450 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537612.1:pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase 1965 952 gene locus_tag LOCUS_21460 1965 952 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053022.1 protein_id gnl|my_center|LOCUS_21460 3255 1981 gene locus_tag LOCUS_21470 3255 1981 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_21470 5254 3305 gene locus_tag LOCUS_21480 5254 3305 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_21480 6687 5251 gene locus_tag LOCUS_21490 6687 5251 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_21490 6988 6707 gene locus_tag LOCUS_21500 6988 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 7176 7991 gene locus_tag LOCUS_21510 7176 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 8003 8605 gene locus_tag LOCUS_21520 8003 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 8621 10006 gene locus_tag LOCUS_21530 8621 10006 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_21530 11782 10028 gene locus_tag LOCUS_21540 gene polX 11782 10028 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_21540 11912 12319 gene locus_tag LOCUS_21550 11912 12319 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_21550 13483 12332 gene locus_tag LOCUS_21560 13483 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 <14287 13465 gene locus_tag LOCUS_21570 <14287 13465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057016.1:o-succinylbenzoate synthase >Feature sequence077 2264 1002 gene locus_tag LOCUS_21580 2264 1002 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_21580 2801 2463 gene locus_tag LOCUS_21590 2801 2463 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_21590 4277 2820 gene locus_tag LOCUS_21600 4277 2820 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_21600 4740 4402 gene locus_tag LOCUS_21610 gene glnB 4740 4402 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_21610 6603 4816 gene locus_tag LOCUS_21620 gene aspS 6603 4816 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_21620 8252 6672 gene locus_tag LOCUS_21630 gene gpmI 8252 6672 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435040.1 protein_id gnl|my_center|LOCUS_21630 8413 9447 gene locus_tag LOCUS_21640 gene hemH 8413 9447 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099324.1 protein_id gnl|my_center|LOCUS_21640 9444 12113 gene locus_tag LOCUS_21650 9444 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 12117 13862 gene locus_tag LOCUS_21660 gene sulP 12117 13862 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence078 <1 937 gene locus_tag LOCUS_21670 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003530241.1:sugar ABC transporter permease 940 1791 gene locus_tag LOCUS_21680 940 1791 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_21680 1907 2995 gene locus_tag LOCUS_21690 1907 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 4078 3002 gene locus_tag LOCUS_21700 4078 3002 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_21700 4602 4126 gene locus_tag LOCUS_21710 4602 4126 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_21710 5390 4614 gene locus_tag LOCUS_21720 5390 4614 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546256.1 protein_id gnl|my_center|LOCUS_21720 5881 5387 gene locus_tag LOCUS_21730 5881 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 7926 5881 gene locus_tag LOCUS_21740 7926 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 8040 8423 gene locus_tag LOCUS_21750 8040 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 8433 12002 gene locus_tag LOCUS_21760 8433 12002 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943065.1 protein_id gnl|my_center|LOCUS_21760 12082 13425 gene locus_tag LOCUS_21770 gene ywaD 12082 13425 CDS product aminopeptidase YwaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242515.1 protein_id gnl|my_center|LOCUS_21770 <14069 13401 gene locus_tag LOCUS_21780 <14069 13401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258343.1:nitronate monooxygenase >Feature sequence079 1907 414 gene locus_tag LOCUS_21790 1907 414 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_21790 2337 1999 gene locus_tag LOCUS_21800 2337 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2999 2472 gene locus_tag LOCUS_21810 2999 2472 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_21810 3774 3007 gene locus_tag LOCUS_21820 gene cybH 3774 3007 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388918.1 protein_id gnl|my_center|LOCUS_21820 5511 3784 gene locus_tag LOCUS_21830 5511 3784 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_21830 6680 5532 gene locus_tag LOCUS_21840 6680 5532 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388916.1 protein_id gnl|my_center|LOCUS_21840 6908 7252 gene locus_tag LOCUS_21850 gene hypA 6908 7252 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_21850 7259 8062 gene locus_tag LOCUS_21860 gene hypB 7259 8062 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889574.1 protein_id gnl|my_center|LOCUS_21860 8076 10397 gene locus_tag LOCUS_21870 gene hypF 8076 10397 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_21870 10431 10700 gene locus_tag LOCUS_21880 10431 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21880 10697 11797 gene locus_tag LOCUS_21890 gene hypD 10697 11797 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_21890 11855 12814 gene locus_tag LOCUS_21900 11855 12814 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259515.1 protein_id gnl|my_center|LOCUS_21900 12811 13434 gene locus_tag LOCUS_21910 12811 13434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence080 90 2798 gene locus_tag LOCUS_21920 90 2798 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933216.1 protein_id gnl|my_center|LOCUS_21920 2809 3798 gene locus_tag LOCUS_21930 2809 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3969 5006 gene locus_tag LOCUS_21940 gene prfB 3969 5006 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_21940 5034 6467 gene locus_tag LOCUS_21950 5034 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 6460 10329 gene locus_tag LOCUS_21960 6460 10329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 10644 10348 gene locus_tag LOCUS_21970 10644 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 10895 10641 gene locus_tag LOCUS_21980 10895 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 12329 11202 gene locus_tag LOCUS_21990 gene mtnA 12329 11202 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_21990 13360 12437 gene locus_tag LOCUS_22000 gene sucD 13360 12437 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence081 1034 318 gene locus_tag LOCUS_22010 1034 318 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392692.1 protein_id gnl|my_center|LOCUS_22010 1074 2069 gene locus_tag LOCUS_22020 1074 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2044 2802 gene locus_tag LOCUS_22030 2044 2802 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336382.1 protein_id gnl|my_center|LOCUS_22030 2808 3896 gene locus_tag LOCUS_22040 2808 3896 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_22040 3908 5143 gene locus_tag LOCUS_22050 3908 5143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_22050 6101 5175 gene locus_tag LOCUS_22060 6101 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 6233 7243 gene locus_tag LOCUS_22070 6233 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 7255 8214 gene locus_tag LOCUS_22080 7255 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 8249 9070 gene locus_tag LOCUS_22090 8249 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 9111 9854 gene locus_tag LOCUS_22100 9111 9854 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_22100 9879 11147 gene locus_tag LOCUS_22110 gene hisD 9879 11147 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012931617.1 protein_id gnl|my_center|LOCUS_22110 11174 11959 gene locus_tag LOCUS_22120 11174 11959 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_22120 11956 12735 gene locus_tag LOCUS_22130 11956 12735 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211232185.1 protein_id gnl|my_center|LOCUS_22130 13626 12745 gene locus_tag LOCUS_22140 13626 12745 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence082 2179 1652 gene locus_tag LOCUS_22150 2179 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2568 3347 gene locus_tag LOCUS_22160 2568 3347 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056168.1 protein_id gnl|my_center|LOCUS_22160 3532 4353 gene locus_tag LOCUS_22170 3532 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 4591 5496 gene locus_tag LOCUS_22180 4591 5496 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_22180 5593 6720 gene locus_tag LOCUS_22190 5593 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 6755 7972 gene locus_tag LOCUS_22200 6755 7972 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_22200 8026 9342 gene locus_tag LOCUS_22210 8026 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_22210 9853 9458 gene locus_tag LOCUS_22220 9853 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_22220 9854 10078 gene locus_tag LOCUS_22230 9854 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 10398 11351 gene locus_tag LOCUS_22240 10398 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 11388 12116 gene locus_tag LOCUS_22250 11388 12116 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_22250 12120 12860 gene locus_tag LOCUS_22260 12120 12860 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence083 788 2230 gene locus_tag LOCUS_22270 788 2230 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_22270 3648 2224 gene locus_tag LOCUS_22280 3648 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 4625 3645 gene locus_tag LOCUS_22290 4625 3645 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_22290 4519 5343 gene locus_tag LOCUS_22300 4519 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 5336 6070 gene locus_tag LOCUS_22310 5336 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 6907 6089 gene locus_tag LOCUS_22320 6907 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 7936 6938 gene locus_tag LOCUS_22330 7936 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 8780 8004 gene locus_tag LOCUS_22340 8780 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 9586 8777 gene locus_tag LOCUS_22350 9586 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 10464 9583 gene locus_tag LOCUS_22360 10464 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 11182 10469 gene locus_tag LOCUS_22370 11182 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 12468 11179 gene locus_tag LOCUS_22380 12468 11179 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_22380 12522 13307 gene locus_tag LOCUS_22390 12522 13307 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence084 784 1425 gene locus_tag LOCUS_22400 784 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1615 2796 gene locus_tag LOCUS_22410 1615 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3388 2822 gene locus_tag LOCUS_22420 gene hpt 3388 2822 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_22420 3579 4649 gene locus_tag LOCUS_22430 3579 4649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_22430 4659 6284 gene locus_tag LOCUS_22440 4659 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 6949 6293 gene locus_tag LOCUS_22450 gene rpe 6949 6293 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 protein_id gnl|my_center|LOCUS_22450 7467 6955 gene locus_tag LOCUS_22460 7467 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 8569 7529 gene locus_tag LOCUS_22470 8569 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 9575 8583 gene locus_tag LOCUS_22480 9575 8583 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_22480 10661 9603 gene locus_tag LOCUS_22490 gene plsX 10661 9603 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_22490 10872 10693 gene locus_tag LOCUS_22500 gene rpmF 10872 10693 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008834724.1 protein_id gnl|my_center|LOCUS_22500 11882 10989 gene locus_tag LOCUS_22510 11882 10989 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357212.1 protein_id gnl|my_center|LOCUS_22510 12060 13106 gene locus_tag LOCUS_22520 gene trpD 12060 13106 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480347.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence085 1177 173 gene locus_tag LOCUS_22530 gene deoC 1177 173 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_22530 1219 1617 gene locus_tag LOCUS_22540 1219 1617 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085217.1 protein_id gnl|my_center|LOCUS_22540 1623 2081 gene locus_tag LOCUS_22550 1623 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 3413 2094 gene locus_tag LOCUS_22560 3413 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 4178 3417 gene locus_tag LOCUS_22570 4178 3417 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_22570 4974 4303 gene locus_tag LOCUS_22580 4974 4303 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311533.1 protein_id gnl|my_center|LOCUS_22580 5095 6966 gene locus_tag LOCUS_22590 5095 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 8082 7105 gene locus_tag LOCUS_22600 8082 7105 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_22600 9316 8198 gene locus_tag LOCUS_22610 9316 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 10390 9359 gene locus_tag LOCUS_22620 10390 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 11480 10401 gene locus_tag LOCUS_22630 11480 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 12510 11497 gene locus_tag LOCUS_22640 12510 11497 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808171.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence086 3406 419 gene locus_tag LOCUS_22650 3406 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 3512 4459 gene locus_tag LOCUS_22660 3512 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 4940 4557 gene locus_tag LOCUS_22670 4940 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 6202 4937 gene locus_tag LOCUS_22680 6202 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 6795 6202 gene locus_tag LOCUS_22690 6795 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 8842 6902 gene locus_tag LOCUS_22700 8842 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 9817 8888 gene locus_tag LOCUS_22710 9817 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 9987 10826 gene locus_tag LOCUS_22720 9987 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence087 1101 271 gene locus_tag LOCUS_22730 1101 271 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_22730 1156 2016 gene locus_tag LOCUS_22740 1156 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2811 2041 gene locus_tag LOCUS_22750 2811 2041 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_22750 3787 2891 gene locus_tag LOCUS_22760 gene lipA 3787 2891 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_22760 4014 5120 gene locus_tag LOCUS_22770 4014 5120 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_22770 5163 6119 gene locus_tag LOCUS_22780 5163 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 6200 7687 gene locus_tag LOCUS_22790 gene lysS 6200 7687 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_22790 7731 8957 gene locus_tag LOCUS_22800 7731 8957 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_22800 8950 9606 gene locus_tag LOCUS_22810 8950 9606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_22810 10482 9709 gene locus_tag LOCUS_22820 10482 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 10735 11718 gene locus_tag LOCUS_22830 10735 11718 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence088 <1 1741 gene locus_tag LOCUS_22840 <1 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919497.1:TonB-dependent receptor 1822 5988 gene locus_tag LOCUS_22850 1822 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 6056 7549 gene locus_tag LOCUS_22860 6056 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 8356 7574 gene locus_tag LOCUS_22870 8356 7574 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975968.1 protein_id gnl|my_center|LOCUS_22870 9398 8379 gene locus_tag LOCUS_22880 9398 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 9494 10480 gene locus_tag LOCUS_22890 9494 10480 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210390905.1 protein_id gnl|my_center|LOCUS_22890 11332 10499 gene locus_tag LOCUS_22900 11332 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 11725 11396 gene locus_tag LOCUS_22910 gene yhbY 11725 11396 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941918.1 protein_id gnl|my_center|LOCUS_22910 12503 11784 gene locus_tag LOCUS_22920 12503 11784 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640345.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence089 218 1396 gene locus_tag LOCUS_22930 218 1396 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028527.1 protein_id gnl|my_center|LOCUS_22930 1393 2844 gene locus_tag LOCUS_22940 1393 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3837 2860 gene locus_tag LOCUS_22950 3837 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3924 5171 gene locus_tag LOCUS_22960 gene rodA 3924 5171 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920901.1 protein_id gnl|my_center|LOCUS_22960 5268 7016 gene locus_tag LOCUS_22970 gene rng 5268 7016 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_22970 7306 7959 gene locus_tag LOCUS_22980 7306 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 7968 8858 gene locus_tag LOCUS_22990 7968 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 10334 9327 gene locus_tag LOCUS_23000 10334 9327 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082568.1 protein_id gnl|my_center|LOCUS_23000 11200 10799 gene locus_tag LOCUS_23010 11200 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 11490 12017 gene locus_tag LOCUS_23020 11490 12017 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 protein_id gnl|my_center|LOCUS_23020 <12797 12114 gene locus_tag LOCUS_23030 <12797 12114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328056.1:sugar phosphate isomerase/epimerase >Feature sequence090 <1 582 gene locus_tag LOCUS_23040 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036446.1:alpha-L-fucosidase 807 604 gene locus_tag LOCUS_23050 807 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1339 2745 gene locus_tag LOCUS_23060 1339 2745 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228462.1 protein_id gnl|my_center|LOCUS_23060 2863 5328 gene locus_tag LOCUS_23070 2863 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 5404 8283 gene locus_tag LOCUS_23080 5404 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence091 2896 998 gene locus_tag LOCUS_23090 2896 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2993 3958 gene locus_tag LOCUS_23100 gene waaC 2993 3958 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_23100 3970 5241 gene locus_tag LOCUS_23110 gene serS 3970 5241 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404592.1 protein_id gnl|my_center|LOCUS_23110 5238 6296 gene locus_tag LOCUS_23120 5238 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 6335 8353 gene locus_tag LOCUS_23130 gene ftsH 6335 8353 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_23130 8527 9840 gene locus_tag LOCUS_23140 8527 9840 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_23140 10963 9854 gene locus_tag LOCUS_23150 10963 9854 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550279.1 protein_id gnl|my_center|LOCUS_23150 12328 11174 gene locus_tag LOCUS_23160 gene alr 12328 11174 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence092 268 1074 gene locus_tag LOCUS_23170 gene trpA 268 1074 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338525.1 protein_id gnl|my_center|LOCUS_23170 1140 2093 gene locus_tag LOCUS_23180 1140 2093 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400349.1 protein_id gnl|my_center|LOCUS_23180 2090 2992 gene locus_tag LOCUS_23190 2090 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3048 3950 gene locus_tag LOCUS_23200 gene miaA 3048 3950 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_23200 4580 3966 gene locus_tag LOCUS_23210 4580 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 6056 4581 gene locus_tag LOCUS_23220 6056 4581 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948610.1 protein_id gnl|my_center|LOCUS_23220 7916 6249 gene locus_tag LOCUS_23230 7916 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 9485 8019 gene locus_tag LOCUS_23240 9485 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 10250 9501 gene locus_tag LOCUS_23250 10250 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 12075 10318 gene locus_tag LOCUS_23260 gene argS 12075 10318 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence093 503 1975 gene locus_tag LOCUS_23270 503 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1972 3456 gene locus_tag LOCUS_23280 1972 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3473 4318 gene locus_tag LOCUS_23290 3473 4318 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_23290 5782 4361 gene locus_tag LOCUS_23300 5782 4361 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 protein_id gnl|my_center|LOCUS_23300 6643 5900 gene locus_tag LOCUS_23310 6643 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 7670 6741 gene locus_tag LOCUS_23320 7670 6741 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296600.1 protein_id gnl|my_center|LOCUS_23320 12091 7703 gene locus_tag LOCUS_23330 12091 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence094 1153 284 gene locus_tag LOCUS_23340 1153 284 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228146.1 protein_id gnl|my_center|LOCUS_23340 1866 1150 gene locus_tag LOCUS_23350 1866 1150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383524.1 protein_id gnl|my_center|LOCUS_23350 2840 1863 gene locus_tag LOCUS_23360 2840 1863 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388249.1 protein_id gnl|my_center|LOCUS_23360 3703 2837 gene locus_tag LOCUS_23370 3703 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 5583 3724 gene locus_tag LOCUS_23380 5583 3724 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_23380 6095 7195 gene locus_tag LOCUS_23390 6095 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_23390 7506 8813 gene locus_tag LOCUS_23400 7506 8813 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_23400 8834 9781 gene locus_tag LOCUS_23410 8834 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 11622 10048 gene locus_tag LOCUS_23420 11622 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence095 146 1651 gene locus_tag LOCUS_23430 146 1651 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275414.1 protein_id gnl|my_center|LOCUS_23430 1667 3592 gene locus_tag LOCUS_23440 1667 3592 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026882.1 protein_id gnl|my_center|LOCUS_23440 3661 5058 gene locus_tag LOCUS_23450 3661 5058 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902386.1 protein_id gnl|my_center|LOCUS_23450 5055 5909 gene locus_tag LOCUS_23460 5055 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 6780 5917 gene locus_tag LOCUS_23470 6780 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 7357 6812 gene locus_tag LOCUS_23480 7357 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 9176 7413 gene locus_tag LOCUS_23490 9176 7413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870027.1 protein_id gnl|my_center|LOCUS_23490 10327 9230 gene locus_tag LOCUS_23500 10327 9230 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027544.1 protein_id gnl|my_center|LOCUS_23500 <12162 10352 gene locus_tag LOCUS_23510 <12162 10352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119311.1:sodium/solute symporter >Feature sequence096 1 150 gene locus_tag LOCUS_23520 1 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 203 877 gene locus_tag LOCUS_23530 203 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2973 928 gene locus_tag LOCUS_23540 2973 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 3428 3877 gene locus_tag LOCUS_23550 3428 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 4091 6130 gene locus_tag LOCUS_23560 4091 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 6127 7248 gene locus_tag LOCUS_23570 6127 7248 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_23570 7270 11163 gene locus_tag LOCUS_23580 7270 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence097 895 95 gene locus_tag LOCUS_23590 895 95 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_23590 1878 892 gene locus_tag LOCUS_23600 1878 892 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_23600 2993 1875 gene locus_tag LOCUS_23610 2993 1875 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816897.1 protein_id gnl|my_center|LOCUS_23610 4123 2990 gene locus_tag LOCUS_23620 4123 2990 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_23620 4420 7158 gene locus_tag LOCUS_23630 4420 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 7392 7856 gene locus_tag LOCUS_23640 7392 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 7853 9628 gene locus_tag LOCUS_23650 7853 9628 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_23650 9779 11092 gene locus_tag LOCUS_23660 9779 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 11120 11932 gene locus_tag LOCUS_23670 11120 11932 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803239.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence098 <1 742 gene locus_tag LOCUS_23680 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957298.1:RNA methyltransferase 1231 782 gene locus_tag LOCUS_23690 1231 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2264 1296 gene locus_tag LOCUS_23700 2264 1296 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_23700 2501 2298 gene locus_tag LOCUS_23710 2501 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2696 3682 gene locus_tag LOCUS_23720 2696 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 4933 3707 gene locus_tag LOCUS_23730 4933 3707 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_23730 6702 4984 gene locus_tag LOCUS_23740 6702 4984 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_23740 8689 6719 gene locus_tag LOCUS_23750 gene gspD 8689 6719 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533584.1 protein_id gnl|my_center|LOCUS_23750 8909 10006 gene locus_tag LOCUS_23760 gene aroC 8909 10006 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_23760 10120 10902 gene locus_tag LOCUS_23770 10120 10902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 11617 10979 gene locus_tag LOCUS_23780 gene eda 11617 10979 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_23780 11861 11945 gene locus_tag LOCUS_t00360 11861 11945 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence099 1353 2024 gene locus_tag LOCUS_23790 1353 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2014 3297 gene locus_tag LOCUS_23800 gene xseA 2014 3297 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_23800 3402 3959 gene locus_tag LOCUS_23810 3402 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 5106 3973 gene locus_tag LOCUS_23820 5106 3973 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 protein_id gnl|my_center|LOCUS_23820 6353 5310 gene locus_tag LOCUS_23830 6353 5310 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_23830 6559 7353 gene locus_tag LOCUS_23840 6559 7353 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972698.1 protein_id gnl|my_center|LOCUS_23840 8359 7361 gene locus_tag LOCUS_23850 8359 7361 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_23850 9897 8524 gene locus_tag LOCUS_23860 9897 8524 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_23860 11157 9985 gene locus_tag LOCUS_23870 11157 9985 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039287.1 protein_id gnl|my_center|LOCUS_23870 11444 11205 gene locus_tag LOCUS_23880 11444 11205 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence100 1235 288 gene locus_tag LOCUS_23890 1235 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1537 1340 gene locus_tag LOCUS_23900 gene rpsU 1537 1340 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882681.1 protein_id gnl|my_center|LOCUS_23900 1754 5335 gene locus_tag LOCUS_23910 1754 5335 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_23910 5438 6595 gene locus_tag LOCUS_23920 5438 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 6646 7410 gene locus_tag LOCUS_23930 6646 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 8221 7430 gene locus_tag LOCUS_23940 8221 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 9243 8296 gene locus_tag LOCUS_23950 9243 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 9402 10223 gene locus_tag LOCUS_23960 9402 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 10220 11299 gene locus_tag LOCUS_23970 gene hemA 10220 11299 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689254.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence101 655 1644 gene locus_tag LOCUS_23980 gene galE 655 1644 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_23980 3207 1681 gene locus_tag LOCUS_23990 3207 1681 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_23990 3382 4770 gene locus_tag LOCUS_24000 3382 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 5410 4814 gene locus_tag LOCUS_24010 5410 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 5525 5450 gene locus_tag LOCUS_t00370 5525 5450 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6502 5585 gene locus_tag LOCUS_24020 6502 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 6970 6536 gene locus_tag LOCUS_24030 gene tolR 6970 6536 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 protein_id gnl|my_center|LOCUS_24030 7689 6988 gene locus_tag LOCUS_24040 gene tolQ 7689 6988 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597405.1 protein_id gnl|my_center|LOCUS_24040 7802 8914 gene locus_tag LOCUS_24050 7802 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 8932 9579 gene locus_tag LOCUS_24060 gene tmk 8932 9579 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_24060 9598 10554 gene locus_tag LOCUS_24070 9598 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence102 773 159 gene locus_tag LOCUS_24080 773 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 1222 767 gene locus_tag LOCUS_24090 1222 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2553 1219 gene locus_tag LOCUS_24100 gene fliI 2553 1219 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_24100 3131 2550 gene locus_tag LOCUS_24110 3131 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 4156 3134 gene locus_tag LOCUS_24120 gene fliG 4156 3134 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_24120 5778 4174 gene locus_tag LOCUS_24130 gene fliF 5778 4174 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546552.1 protein_id gnl|my_center|LOCUS_24130 6136 5804 gene locus_tag LOCUS_24140 6136 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 6570 6151 gene locus_tag LOCUS_24150 gene flgC 6570 6151 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_24150 6997 6611 gene locus_tag LOCUS_24160 gene flgB 6997 6611 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081560.1 protein_id gnl|my_center|LOCUS_24160 7218 8039 gene locus_tag LOCUS_24170 7218 8039 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266627.1 protein_id gnl|my_center|LOCUS_24170 8048 9142 gene locus_tag LOCUS_24180 8048 9142 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_24180 9196 10410 gene locus_tag LOCUS_24190 9196 10410 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence103 1501 665 gene locus_tag LOCUS_24200 1501 665 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_24200 1582 3213 gene locus_tag LOCUS_24210 1582 3213 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_24210 3722 3228 gene locus_tag LOCUS_24220 3722 3228 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933886.1 protein_id gnl|my_center|LOCUS_24220 4657 3758 gene locus_tag LOCUS_24230 4657 3758 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_24230 4660 5436 gene locus_tag LOCUS_24240 4660 5436 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_24240 5504 6364 gene locus_tag LOCUS_24250 5504 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 6416 7327 gene locus_tag LOCUS_24260 6416 7327 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_24260 7331 8233 gene locus_tag LOCUS_24270 7331 8233 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_24270 9367 8225 gene locus_tag LOCUS_24280 gene galK 9367 8225 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707767.1 protein_id gnl|my_center|LOCUS_24280 9689 9408 gene locus_tag LOCUS_24290 9689 9408 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_24290 10667 9792 gene locus_tag LOCUS_24300 10667 9792 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479587.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence104 <1 661 gene locus_tag LOCUS_24310 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404833.1:polysulfide reductase NrfD 674 1207 gene locus_tag LOCUS_24320 674 1207 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_24320 1211 1846 gene locus_tag LOCUS_24330 1211 1846 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_24330 1843 3117 gene locus_tag LOCUS_24340 1843 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_24340 3110 3406 gene locus_tag LOCUS_24350 3110 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3422 4846 gene locus_tag LOCUS_24360 3422 4846 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_24360 4843 5469 gene locus_tag LOCUS_24370 4843 5469 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403102.1 protein_id gnl|my_center|LOCUS_24370 5466 6131 gene locus_tag LOCUS_24380 5466 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 7162 6164 gene locus_tag LOCUS_24390 gene rfaD 7162 6164 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_24390 7971 7159 gene locus_tag LOCUS_24400 gene proC 7971 7159 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_24400 9116 7983 gene locus_tag LOCUS_24410 9116 7983 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_24410 10032 9157 gene locus_tag LOCUS_24420 gene folD 10032 9157 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence105 2113 1073 gene locus_tag LOCUS_24430 2113 1073 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815913.1 protein_id gnl|my_center|LOCUS_24430 3084 2221 gene locus_tag LOCUS_24440 3084 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 3206 5101 gene locus_tag LOCUS_24450 3206 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 5098 6102 gene locus_tag LOCUS_24460 5098 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 6127 8562 gene locus_tag LOCUS_24470 6127 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 8559 9419 gene locus_tag LOCUS_24480 8559 9419 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226278.1 protein_id gnl|my_center|LOCUS_24480 9416 10711 gene locus_tag LOCUS_24490 9416 10711 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence106 995 2203 gene locus_tag LOCUS_24500 995 2203 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_24500 2200 4428 gene locus_tag LOCUS_24510 2200 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 5653 4448 gene locus_tag LOCUS_24520 5653 4448 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864646.1 protein_id gnl|my_center|LOCUS_24520 6444 5650 gene locus_tag LOCUS_24530 6444 5650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_24530 6510 7352 gene locus_tag LOCUS_24540 gene prpB 6510 7352 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070710.1 protein_id gnl|my_center|LOCUS_24540 6624 6544 gene locus_tag LOCUS_t00380 6624 6544 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7425 8582 gene locus_tag LOCUS_24550 gene prpC 7425 8582 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036232.1 protein_id gnl|my_center|LOCUS_24550 8612 10090 gene locus_tag LOCUS_24560 8612 10090 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 protein_id gnl|my_center|LOCUS_24560 <10716 10114 gene locus_tag LOCUS_24570 <10716 10114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765637.1:4Fe-4S binding protein >Feature sequence107 3541 1235 gene locus_tag LOCUS_24580 3541 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3670 4290 gene locus_tag LOCUS_24590 gene msrA 3670 4290 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931268.1 protein_id gnl|my_center|LOCUS_24590 4345 5169 gene locus_tag LOCUS_24600 4345 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 5169 5783 gene locus_tag LOCUS_24610 gene pnuC 5169 5783 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766257.1 protein_id gnl|my_center|LOCUS_24610 5824 6348 gene locus_tag LOCUS_24620 5824 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 8052 6409 gene locus_tag LOCUS_24630 8052 6409 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_24630 8284 9081 gene locus_tag LOCUS_24640 gene tcdA 8284 9081 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 protein_id gnl|my_center|LOCUS_24640 9942 9103 gene locus_tag LOCUS_24650 9942 9103 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_24650 10358 9948 gene locus_tag LOCUS_24660 10358 9948 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092439.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence108 2745 1912 gene locus_tag LOCUS_24670 2745 1912 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_24670 3333 2773 gene locus_tag LOCUS_24680 3333 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 3842 3330 gene locus_tag LOCUS_24690 3842 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 4905 3874 gene locus_tag LOCUS_24700 4905 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 5806 4931 gene locus_tag LOCUS_24710 5806 4931 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 protein_id gnl|my_center|LOCUS_24710 6633 5818 gene locus_tag LOCUS_24720 6633 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 7022 6630 gene locus_tag LOCUS_24730 7022 6630 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_24730 8527 7019 gene locus_tag LOCUS_24740 8527 7019 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063719.1 protein_id gnl|my_center|LOCUS_24740 9902 8550 gene locus_tag LOCUS_24750 gene hemL 9902 8550 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258457.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence109 <1 1587 gene locus_tag LOCUS_24760 <1 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140102.1:ABC-F family ATP-binding cassette domain-containing protein 2973 1642 gene locus_tag LOCUS_24770 2973 1642 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_24770 3586 3035 gene locus_tag LOCUS_24780 3586 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 4985 3747 gene locus_tag LOCUS_24790 4985 3747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229018.1 protein_id gnl|my_center|LOCUS_24790 5725 4982 gene locus_tag LOCUS_24800 5725 4982 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_24800 6485 5763 gene locus_tag LOCUS_24810 6485 5763 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_24810 7624 6482 gene locus_tag LOCUS_24820 7624 6482 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_24820 8594 7716 gene locus_tag LOCUS_24830 8594 7716 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_24830 10167 8671 gene locus_tag LOCUS_24840 10167 8671 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence110 1773 151 gene locus_tag LOCUS_24850 1773 151 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_24850 1857 2759 gene locus_tag LOCUS_24860 1857 2759 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921650.1 protein_id gnl|my_center|LOCUS_24860 2843 3625 gene locus_tag LOCUS_24870 2843 3625 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067370.1 protein_id gnl|my_center|LOCUS_24870 3875 6406 gene locus_tag LOCUS_24880 3875 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 6471 7514 gene locus_tag LOCUS_24890 gene rlmM 6471 7514 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036052.1 protein_id gnl|my_center|LOCUS_24890 7577 8110 gene locus_tag LOCUS_24900 7577 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 8115 9776 gene locus_tag LOCUS_24910 8115 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence111 4665 1249 gene locus_tag LOCUS_24920 4665 1249 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922552.1 protein_id gnl|my_center|LOCUS_24920 5315 4662 gene locus_tag LOCUS_24930 5315 4662 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_24930 5531 5343 gene locus_tag LOCUS_24940 5531 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 6488 5763 gene locus_tag LOCUS_24950 6488 5763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312688.1 protein_id gnl|my_center|LOCUS_24950 6902 6543 gene locus_tag LOCUS_24960 6902 6543 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_24960 8283 7003 gene locus_tag LOCUS_24970 8283 7003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975247.1 protein_id gnl|my_center|LOCUS_24970 9506 8409 gene locus_tag LOCUS_24980 9506 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence112 <1 1029 gene locus_tag LOCUS_24990 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094267720.1:4-alpha-glucanotransferase 1935 1045 gene locus_tag LOCUS_25000 1935 1045 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_25000 2963 1929 gene locus_tag LOCUS_25010 2963 1929 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_25010 3783 2971 gene locus_tag LOCUS_25020 3783 2971 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_25020 4232 3780 gene locus_tag LOCUS_25030 4232 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 5677 4229 gene locus_tag LOCUS_25040 5677 4229 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_25040 7125 5758 gene locus_tag LOCUS_25050 7125 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 8613 7180 gene locus_tag LOCUS_25060 8613 7180 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_25060 8949 8686 gene locus_tag LOCUS_25070 8949 8686 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_25070 <9956 8967 gene locus_tag LOCUS_25080 <9956 8967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325817.1:beta-ketoacyl-[acyl-carrier-protein] synthase family protein >Feature sequence113 1486 482 gene locus_tag LOCUS_25090 gene cbiB 1486 482 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_25090 2702 1509 gene locus_tag LOCUS_25100 2702 1509 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_25100 2962 3441 gene locus_tag LOCUS_25110 2962 3441 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_25110 5220 3463 gene locus_tag LOCUS_25120 5220 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 5949 5281 gene locus_tag LOCUS_25130 5949 5281 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311804.1 protein_id gnl|my_center|LOCUS_25130 7228 5999 gene locus_tag LOCUS_25140 7228 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 7402 8817 gene locus_tag LOCUS_25150 gene uxaC 7402 8817 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_25150 9546 8923 gene locus_tag LOCUS_25160 9546 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence114 6086 906 gene locus_tag LOCUS_25170 6086 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 6447 6713 gene locus_tag LOCUS_25180 6447 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 6775 7122 gene locus_tag LOCUS_25190 6775 7122 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790218.1 protein_id gnl|my_center|LOCUS_25190 7119 7673 gene locus_tag LOCUS_25200 7119 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 <9724 7658 gene locus_tag LOCUS_25210 <9724 7658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878733.1:CoB-CoM heterodisulfide reductase HdrA2 >Feature sequence115 1203 940 gene locus_tag LOCUS_25220 1203 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 1312 1941 gene locus_tag LOCUS_25230 1312 1941 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_25230 1938 2327 gene locus_tag LOCUS_25240 1938 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2335 2793 gene locus_tag LOCUS_25250 2335 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 3401 2799 gene locus_tag LOCUS_25260 3401 2799 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_25260 4125 3475 gene locus_tag LOCUS_25270 4125 3475 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_25270 4416 4171 gene locus_tag LOCUS_25280 4416 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 5409 4453 gene locus_tag LOCUS_25290 5409 4453 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938933.1 protein_id gnl|my_center|LOCUS_25290 6462 5461 gene locus_tag LOCUS_25300 6462 5461 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943444.1 protein_id gnl|my_center|LOCUS_25300 7746 6472 gene locus_tag LOCUS_25310 7746 6472 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_25310 8698 7811 gene locus_tag LOCUS_25320 8698 7811 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_25320 9038 8841 gene locus_tag LOCUS_25330 9038 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence116 192 551 gene locus_tag LOCUS_25340 gene queF 192 551 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_25340 1335 571 gene locus_tag LOCUS_25350 gene hisN 1335 571 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_25350 1451 2116 gene locus_tag LOCUS_25360 1451 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2905 2129 gene locus_tag LOCUS_25370 2905 2129 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_25370 3041 4840 gene locus_tag LOCUS_25380 3041 4840 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_25380 5526 4837 gene locus_tag LOCUS_25390 5526 4837 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_25390 7019 5625 gene locus_tag LOCUS_25400 7019 5625 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_25400 8059 7085 gene locus_tag LOCUS_25410 gene corA 8059 7085 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_25410 8537 8118 gene locus_tag LOCUS_25420 8537 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 8731 9123 gene locus_tag LOCUS_25430 8731 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence117 1641 523 gene locus_tag LOCUS_25440 gene mraY 1641 523 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707583.1 protein_id gnl|my_center|LOCUS_25440 3037 1634 gene locus_tag LOCUS_25450 gene murF 3037 1634 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337237.1 protein_id gnl|my_center|LOCUS_25450 4623 3037 gene locus_tag LOCUS_25460 4623 3037 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_25460 6614 4620 gene locus_tag LOCUS_25470 6614 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 7018 6620 gene locus_tag LOCUS_25480 7018 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 7997 7041 gene locus_tag LOCUS_25490 gene rsmH 7997 7041 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_25490 8205 7978 gene locus_tag LOCUS_25500 8205 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 8660 8208 gene locus_tag LOCUS_25510 gene mraZ 8660 8208 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence118 3674 1134 gene locus_tag LOCUS_25520 3674 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 5632 3671 gene locus_tag LOCUS_25530 5632 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 8481 5629 gene locus_tag LOCUS_25540 8481 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence119 277 1203 gene locus_tag LOCUS_25550 gene ftsY 277 1203 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443981.1 protein_id gnl|my_center|LOCUS_25550 3363 1303 gene locus_tag LOCUS_25560 3363 1303 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_25560 3796 3470 gene locus_tag LOCUS_25570 3796 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 5660 3831 gene locus_tag LOCUS_25580 5660 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 7756 5684 gene locus_tag LOCUS_25590 7756 5684 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence120 1585 467 gene locus_tag LOCUS_25600 1585 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 1772 2563 gene locus_tag LOCUS_25610 gene elyC 1772 2563 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899546.1 protein_id gnl|my_center|LOCUS_25610 2634 3272 gene locus_tag LOCUS_25620 2634 3272 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036867.1 protein_id gnl|my_center|LOCUS_25620 3294 4358 gene locus_tag LOCUS_25630 3294 4358 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036868.1 protein_id gnl|my_center|LOCUS_25630 5680 4511 gene locus_tag LOCUS_25640 5680 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 6395 5706 gene locus_tag LOCUS_25650 6395 5706 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_25650 7053 6370 gene locus_tag LOCUS_25660 gene phoU 7053 6370 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_25660 7927 7094 gene locus_tag LOCUS_25670 gene pstB 7927 7094 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286625.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence121 1030 716 gene locus_tag LOCUS_25680 gene rpsT 1030 716 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_25680 2358 1645 gene locus_tag LOCUS_25690 2358 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 2522 5074 gene locus_tag LOCUS_25700 gene gyrB 2522 5074 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070020.1 protein_id gnl|my_center|LOCUS_25700 5091 5600 gene locus_tag LOCUS_25710 5091 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 5614 8100 gene locus_tag LOCUS_25720 gene gyrA 5614 8100 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545423.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence122 1823 36 gene locus_tag LOCUS_25730 1823 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2619 6983 gene locus_tag LOCUS_25740 2619 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence123 <1 2810 gene locus_tag LOCUS_25750 <1 2810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225763.1:PQQ-dependent sugar dehydrogenase 2807 7366 gene locus_tag LOCUS_25760 2807 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 7378 7638 gene locus_tag LOCUS_25770 7378 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 7804 7877 gene locus_tag LOCUS_t00390 7804 7877 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence124 <1 1240 gene locus_tag LOCUS_25780 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058160.1:aminotransferase class V-fold PLP-dependent enzyme 1798 1256 gene locus_tag LOCUS_25790 1798 1256 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_25790 1859 2884 gene locus_tag LOCUS_25800 1859 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 2904 4811 gene locus_tag LOCUS_25810 2904 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 4833 5846 gene locus_tag LOCUS_25820 4833 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 5867 7759 gene locus_tag LOCUS_25830 5867 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence125 329 147 gene locus_tag LOCUS_25840 329 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 580 350 gene locus_tag LOCUS_25850 580 350 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151363.1 protein_id gnl|my_center|LOCUS_25850 655 987 gene locus_tag LOCUS_25860 655 987 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_25860 2527 1001 gene locus_tag LOCUS_25870 2527 1001 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_25870 3232 2627 gene locus_tag LOCUS_25880 gene metW 3232 2627 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_25880 4419 3235 gene locus_tag LOCUS_25890 4419 3235 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_25890 5270 4518 gene locus_tag LOCUS_25900 5270 4518 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_25900 7139 5379 gene locus_tag LOCUS_25910 7139 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 7493 7170 gene locus_tag LOCUS_25920 gene yidD 7493 7170 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence126 <1 604 gene locus_tag LOCUS_25930 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066113.1:PAS domain S-box protein 651 5000 gene locus_tag LOCUS_25940 651 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 6449 5127 gene locus_tag LOCUS_25950 6449 5127 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189302.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence127 1411 320 gene locus_tag LOCUS_25960 gene hisC 1411 320 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_25960 2065 1475 gene locus_tag LOCUS_25970 2065 1475 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818863.1 protein_id gnl|my_center|LOCUS_25970 3212 2157 gene locus_tag LOCUS_25980 gene arsB 3212 2157 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_25980 3751 3239 gene locus_tag LOCUS_25990 3751 3239 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 protein_id gnl|my_center|LOCUS_25990 4127 3759 gene locus_tag LOCUS_26000 4127 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 5680 4214 gene locus_tag LOCUS_26010 5680 4214 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 protein_id gnl|my_center|LOCUS_26010 5634 5825 gene locus_tag LOCUS_26020 5634 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 <7193 5785 gene locus_tag LOCUS_26030 <7193 5785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941582.1:DEAD/DEAH box helicase >Feature sequence128 129 2105 gene locus_tag LOCUS_26040 129 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2115 3020 gene locus_tag LOCUS_26050 2115 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3067 5130 gene locus_tag LOCUS_26060 3067 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence129 <1 683 gene locus_tag LOCUS_26070 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682335.1:TRAP transporter large permease subunit 1532 705 gene locus_tag LOCUS_26080 1532 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 1771 3858 gene locus_tag LOCUS_26090 1771 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 4061 5911 gene locus_tag LOCUS_26100 4061 5911 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817980.1 protein_id gnl|my_center|LOCUS_26100 6391 6083 gene locus_tag LOCUS_26110 6391 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 6705 6417 gene locus_tag LOCUS_tm00020 6705 6417 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6492 6417 gene locus_tag LOCUS_t00400 6492 6417 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence130 2120 1803 gene locus_tag LOCUS_26120 2120 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2598 2092 gene locus_tag LOCUS_26130 2598 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 4279 2645 gene locus_tag LOCUS_26140 4279 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 5115 4276 gene locus_tag LOCUS_26150 5115 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 6068 5181 gene locus_tag LOCUS_26160 6068 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence131 2491 1439 gene locus_tag LOCUS_26170 2491 1439 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_26170 3578 2526 gene locus_tag LOCUS_26180 3578 2526 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_26180 4593 3616 gene locus_tag LOCUS_26190 4593 3616 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_26190 4787 5854 gene locus_tag LOCUS_26200 4787 5854 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence132 133 1146 gene locus_tag LOCUS_26210 gene hemB 133 1146 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_26210 2617 1136 gene locus_tag LOCUS_26220 2617 1136 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_26220 3230 2640 gene locus_tag LOCUS_26230 3230 2640 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368052.1 protein_id gnl|my_center|LOCUS_26230 4050 3271 gene locus_tag LOCUS_26240 4050 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 4199 5299 gene locus_tag LOCUS_26250 4199 5299 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 protein_id gnl|my_center|LOCUS_26250 5387 5471 gene locus_tag LOCUS_t00410 5387 5471 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence133 1524 3353 gene locus_tag LOCUS_26260 1524 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 4515 3502 gene locus_tag LOCUS_26270 4515 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 5731 4517 gene locus_tag LOCUS_26280 gene araD 5731 4517 CDS product arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 protein_id gnl|my_center|LOCUS_26280 6197 5742 gene locus_tag LOCUS_26290 6197 5742 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence134 385 720 gene locus_tag LOCUS_26300 385 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 909 1388 gene locus_tag LOCUS_26310 909 1388 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_26310 1566 3131 gene locus_tag LOCUS_26320 1566 3131 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_26320 3309 4256 gene locus_tag LOCUS_26330 3309 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 4253 5272 gene locus_tag LOCUS_26340 4253 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence135 435 1037 gene locus_tag LOCUS_26350 435 1037 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_26350 1111 3078 gene locus_tag LOCUS_26360 1111 3078 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_26360 3132 4898 gene locus_tag LOCUS_26370 3132 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 4959 5549 gene locus_tag LOCUS_26380 4959 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 5604 6467 gene locus_tag LOCUS_26390 5604 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence136 3789 4577 gene locus_tag LOCUS_26400 3789 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence137 34 264 gene locus_tag LOCUS_26410 34 264 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151363.1 protein_id gnl|my_center|LOCUS_26410 285 467 gene locus_tag LOCUS_26420 285 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 512 1828 gene locus_tag LOCUS_26430 512 1828 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_26430 1857 2888 gene locus_tag LOCUS_26440 1857 2888 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence138 2804 1716 gene locus_tag LOCUS_26450 2804 1716 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920554.1 protein_id gnl|my_center|LOCUS_26450 3337 2810 gene locus_tag LOCUS_26460 3337 2810 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626366.1 protein_id gnl|my_center|LOCUS_26460 5525 3489 gene locus_tag LOCUS_26470 5525 3489 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819543.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence139 <1 1361 gene locus_tag LOCUS_26480 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108613.1:putative Ig domain-containing protein 2434 1358 gene locus_tag LOCUS_26490 2434 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 2634 4964 gene locus_tag LOCUS_26500 2634 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 <5973 4977 gene locus_tag LOCUS_26510 <5973 4977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368114.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit F >Feature sequence140 973 50 gene locus_tag LOCUS_26520 973 50 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056480.1 protein_id gnl|my_center|LOCUS_26520 2181 979 gene locus_tag LOCUS_26530 2181 979 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_26530 2891 2178 gene locus_tag LOCUS_26540 2891 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 3834 2902 gene locus_tag LOCUS_26550 3834 2902 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_26550 3963 5081 gene locus_tag LOCUS_26560 3963 5081 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence141 2325 4046 gene locus_tag LOCUS_26570 2325 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 4115 5695 gene locus_tag LOCUS_26580 gene rny 4115 5695 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870004.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence142 3284 1206 gene locus_tag LOCUS_26590 3284 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 <5659 3298 gene locus_tag LOCUS_26600 <5659 3298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103411.1:glycosyltransferase >Feature sequence143 447 953 gene locus_tag LOCUS_26610 447 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 1012 2631 gene locus_tag LOCUS_26620 1012 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3787 2651 gene locus_tag LOCUS_26630 3787 2651 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_26630 <5571 3895 gene locus_tag LOCUS_26640 <5571 3895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615720.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence144 <1 1441 gene locus_tag LOCUS_26650 <1 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037249708.1:ComEC/Rec2 family competence protein 1523 1807 gene locus_tag LOCUS_26660 1523 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2611 1838 gene locus_tag LOCUS_26670 2611 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 4115 2757 gene locus_tag LOCUS_26680 4115 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 <5543 4185 gene locus_tag LOCUS_26690 <5543 4185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460435.1:NADH-quinone oxidoreductase subunit N >Feature sequence145 1444 1193 gene locus_tag LOCUS_26700 1444 1193 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036202.1 protein_id gnl|my_center|LOCUS_26700 2695 1451 gene locus_tag LOCUS_26710 gene moeA 2695 1451 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097438.1 protein_id gnl|my_center|LOCUS_26710 3602 2682 gene locus_tag LOCUS_26720 gene moaCB 3602 2682 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932998.1 protein_id gnl|my_center|LOCUS_26720 4632 3613 gene locus_tag LOCUS_26730 gene moaA 4632 3613 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_26730 <5368 4771 gene locus_tag LOCUS_26740 <5368 4771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102176.1:alpha-L-rhamnosidase >Feature sequence146 1862 483 gene locus_tag LOCUS_26750 1862 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 3187 1859 gene locus_tag LOCUS_26760 3187 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 4044 3184 gene locus_tag LOCUS_26770 4044 3184 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_26770 4937 4041 gene locus_tag LOCUS_26780 4937 4041 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence147 >Feature sequence148 1759 2475 gene locus_tag LOCUS_26790 gene metW 1759 2475 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316724.1 protein_id gnl|my_center|LOCUS_26790 2576 3589 gene locus_tag LOCUS_26800 2576 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence149 277 2073 gene locus_tag LOCUS_26810 277 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2094 3281 gene locus_tag LOCUS_26820 2094 3281 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_26820 3278 4963 gene locus_tag LOCUS_26830 3278 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence150 521 919 gene locus_tag LOCUS_26840 521 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 932 1312 gene locus_tag LOCUS_26850 932 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1325 4486 gene locus_tag LOCUS_26860 1325 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 4530 5081 gene locus_tag LOCUS_26870 4530 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence151 2491 524 gene locus_tag LOCUS_26880 2491 524 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_26880 2635 3378 gene locus_tag LOCUS_26890 2635 3378 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence152 1841 2356 gene locus_tag LOCUS_26900 1841 2356 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806996.1 protein_id gnl|my_center|LOCUS_26900 2401 2949 gene locus_tag LOCUS_26910 gene msrA 2401 2949 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434146.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence153 234 1415 gene locus_tag LOCUS_26920 234 1415 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_26920 2019 1660 gene locus_tag LOCUS_26930 2019 1660 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185161.1 protein_id gnl|my_center|LOCUS_26930 2142 2315 gene locus_tag LOCUS_26940 2142 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 2406 4361 gene locus_tag LOCUS_26950 2406 4361 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence154 2691 1522 gene locus_tag LOCUS_26960 2691 1522 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence155 894 1976 gene locus_tag LOCUS_26970 gene glpX 894 1976 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869760.1 protein_id gnl|my_center|LOCUS_26970 2122 4134 gene locus_tag LOCUS_26980 2122 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence156 1946 441 gene locus_tag LOCUS_26990 gene ahcY 1946 441 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_26990 3064 1898 gene locus_tag LOCUS_27000 gene metK 3064 1898 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_27000 3224 3586 gene locus_tag LOCUS_27010 3224 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 4302 3583 gene locus_tag LOCUS_27020 4302 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence157 2340 943 gene locus_tag LOCUS_27030 gene asnS 2340 943 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_27030 2543 3472 gene locus_tag LOCUS_27040 2543 3472 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence158 51 1418 gene locus_tag LOCUS_27050 gene cysS 51 1418 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275351.1 protein_id gnl|my_center|LOCUS_27050 1484 3388 gene locus_tag LOCUS_27060 gene thrS 1484 3388 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888712.1 protein_id gnl|my_center|LOCUS_27060 <4241 3444 gene locus_tag LOCUS_27070 <4241 3444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004539579.1:aldehyde dehydrogenase (NADP(+)) >Feature sequence159 2196 1072 gene locus_tag LOCUS_27080 2196 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3115 2363 gene locus_tag LOCUS_27090 gene fliR 3115 2363 CDS product flagellar biosynthesis protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089589.1 protein_id gnl|my_center|LOCUS_27090 3411 3142 gene locus_tag LOCUS_27100 gene fliQ 3411 3142 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_27100 <4142 3416 gene locus_tag LOCUS_27110 <4142 3416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000831828.1:flagellar type III secretion system pore protein FliP >Feature sequence160 2061 613 gene locus_tag LOCUS_27120 2061 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence161 461 3160 gene locus_tag LOCUS_27130 gene fdhF 461 3160 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_27130 3224 3997 gene locus_tag LOCUS_27140 3224 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence162 532 945 gene locus_tag LOCUS_27150 532 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 1046 1672 gene locus_tag LOCUS_27160 1046 1672 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967488.1 protein_id gnl|my_center|LOCUS_27160 3131 1689 gene locus_tag LOCUS_27170 3131 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484298.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence163 1090 173 gene locus_tag LOCUS_27180 1090 173 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 protein_id gnl|my_center|LOCUS_27180 2475 1087 gene locus_tag LOCUS_27190 2475 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 <3852 2501 gene locus_tag LOCUS_27200 <3852 2501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227203.1:MFS transporter >Feature sequence164 <1 619 gene locus_tag LOCUS_27210 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015819.1:phosphopyruvate hydratase 795 1388 gene locus_tag LOCUS_27220 795 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 2586 1420 gene locus_tag LOCUS_27230 2586 1420 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929520.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence165 130 54 gene locus_tag LOCUS_t00420 130 54 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 539 2542 gene locus_tag LOCUS_27240 539 2542 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27240 2565 3563 gene locus_tag LOCUS_27250 2565 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence166 195 704 gene locus_tag LOCUS_27260 195 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence167 859 245 gene locus_tag LOCUS_27270 859 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1461 862 gene locus_tag LOCUS_27280 1461 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 2131 1649 gene locus_tag LOCUS_27290 2131 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2417 3319 gene locus_tag LOCUS_27300 2417 3319 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence168 2624 255 gene locus_tag LOCUS_27310 2624 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence169 1831 887 gene locus_tag LOCUS_27320 1831 887 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085896.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence170 266 1783 gene locus_tag LOCUS_27330 gene nirK 266 1783 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200986.1 protein_id gnl|my_center|LOCUS_27330 1853 2653 gene locus_tag LOCUS_27340 1853 2653 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533161.1 protein_id gnl|my_center|LOCUS_27340 2650 3255 gene locus_tag LOCUS_27350 2650 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 >Feature sequence171 340 1857 gene locus_tag LOCUS_27360 340 1857 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275414.1 protein_id gnl|my_center|LOCUS_27360 2358 1867 gene locus_tag LOCUS_27370 2358 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence172 >Feature sequence173 893 189 gene locus_tag LOCUS_27380 893 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1672 890 gene locus_tag LOCUS_27390 1672 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2858 1800 gene locus_tag LOCUS_27400 2858 1800 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence174 1377 274 gene locus_tag LOCUS_27410 1377 274 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_27410 2396 1380 gene locus_tag LOCUS_27420 2396 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2555 3298 gene locus_tag LOCUS_27430 2555 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence175 <1 2289 gene locus_tag LOCUS_27440 <1 2289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946359.1:membrane protein >Feature sequence176 2142 262 gene locus_tag LOCUS_27450 2142 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3054 2323 gene locus_tag LOCUS_27460 3054 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence177 276 1871 gene locus_tag LOCUS_27470 276 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 1875 2921 gene locus_tag LOCUS_27480 gene pstA 1875 2921 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence178 228 1235 gene locus_tag LOCUS_27490 228 1235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_27490 2611 1382 gene locus_tag LOCUS_27500 2611 1382 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence179 3040 929 gene locus_tag LOCUS_27510 3040 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence180 175 1158 gene locus_tag LOCUS_27520 175 1158 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_27520 1655 1188 gene locus_tag LOCUS_27530 gene trmL 1655 1188 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703791.1 protein_id gnl|my_center|LOCUS_27530 1755 2183 gene locus_tag LOCUS_27540 1755 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3083 2175 gene locus_tag LOCUS_27550 gene thrB 3083 2175 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence181 130 906 gene locus_tag LOCUS_27560 130 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 917 1672 gene locus_tag LOCUS_27570 917 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1714 2931 gene locus_tag LOCUS_27580 1714 2931 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_27580 >Feature sequence182 447 1532 gene locus_tag LOCUS_27590 447 1532 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257960.1 protein_id gnl|my_center|LOCUS_27590 2312 2617 gene locus_tag LOCUS_27600 2312 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence183 1280 255 gene locus_tag LOCUS_27610 1280 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2012 1446 gene locus_tag LOCUS_27620 2012 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence184 <1 2471 gene locus_tag LOCUS_27630 <1 2471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103411.1:glycosyltransferase >Feature sequence185 900 67 gene locus_tag LOCUS_27640 gene flgG 900 67 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 protein_id gnl|my_center|LOCUS_27640 1385 921 gene locus_tag LOCUS_27650 1385 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence186 2302 950 gene locus_tag LOCUS_27660 2302 950 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence187 <1 1493 gene locus_tag LOCUS_27670 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243455.1:ABC transporter substrate-binding protein >Feature sequence188 >Feature sequence189 >Feature sequence190 >Feature sequence191 2238 1726 gene locus_tag LOCUS_27680 2238 1726 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence192 1236 2285 gene locus_tag LOCUS_27690 1236 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence193 2040 2205 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgccccaccggcggactcggatttcg >Feature sequence194 <1 2064 gene locus_tag LOCUS_27700 <1 2064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085445.1:tetratricopeptide repeat protein >Feature sequence195 <1 511 gene locus_tag LOCUS_27710 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957729.1:SIS domain-containing protein 525 1943 gene locus_tag LOCUS_27720 525 1943 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence196 921 1946 gene locus_tag LOCUS_27730 921 1946 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969520.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence197 697 2130 gene locus_tag LOCUS_27740 697 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 >Feature sequence198 <2089 1022 gene locus_tag LOCUS_27750 <2089 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792925.1:acetate--CoA ligase family protein >Feature sequence199 1655 210 gene locus_tag LOCUS_27760 1655 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence200 <1 558 gene locus_tag LOCUS_27770 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941088.1:flagellar basal body-associated FliL family protein 571 1623 gene locus_tag LOCUS_27780 gene fliM 571 1623 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_27780 1592 1855 gene locus_tag LOCUS_27790 1592 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence201 >Feature sequence202 1 867 gene locus_tag LOCUS_27800 1 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence203 670 2 gene locus_tag LOCUS_27810 670 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1058 1134 gene locus_tag LOCUS_t00430 1058 1134 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence204 53 985 gene locus_tag LOCUS_27820 53 985 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence205 1603 929 gene locus_tag LOCUS_27830 1603 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence206 1291 434 gene locus_tag LOCUS_27840 1291 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840