>Feature sequence001 1826 1446 gene locus_tag LOCUS_00010 1826 1446 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881606.1 protein_id gnl|my_center|LOCUS_00010 5756 2064 gene locus_tag LOCUS_00020 5756 2064 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_00020 7076 6006 gene locus_tag LOCUS_00030 gene ftsZ 7076 6006 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948309.1 protein_id gnl|my_center|LOCUS_00030 8424 7198 gene locus_tag LOCUS_00040 gene ftsA 8424 7198 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094115.1 protein_id gnl|my_center|LOCUS_00040 9223 8456 gene locus_tag LOCUS_00050 9223 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 11034 9223 gene locus_tag LOCUS_00060 11034 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 12482 11040 gene locus_tag LOCUS_00070 gene murC 12482 11040 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_00070 13555 12479 gene locus_tag LOCUS_00080 gene murG 13555 12479 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073900.1 protein_id gnl|my_center|LOCUS_00080 14715 13540 gene locus_tag LOCUS_00090 gene ftsW 14715 13540 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_00090 16133 14712 gene locus_tag LOCUS_00100 gene murD 16133 14712 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_00100 17231 16149 gene locus_tag LOCUS_00110 gene mraY 17231 16149 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_00110 18616 17234 gene locus_tag LOCUS_00120 18616 17234 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_00120 20130 18622 gene locus_tag LOCUS_00130 20130 18622 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769454.1 protein_id gnl|my_center|LOCUS_00130 21859 20111 gene locus_tag LOCUS_00140 gene ftsI 21859 20111 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_00140 22126 21860 gene locus_tag LOCUS_00150 22126 21860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 23053 22127 gene locus_tag LOCUS_00160 gene rsmH 23053 22127 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970469.1 protein_id gnl|my_center|LOCUS_00160 23537 23070 gene locus_tag LOCUS_00170 gene mraZ 23537 23070 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103101.1 protein_id gnl|my_center|LOCUS_00170 23765 23941 gene locus_tag LOCUS_00180 23765 23941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 25119 24232 gene locus_tag LOCUS_00190 gene rsmI 25119 24232 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534198.1 protein_id gnl|my_center|LOCUS_00190 25255 25620 gene locus_tag LOCUS_00200 25255 25620 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001893625.1 protein_id gnl|my_center|LOCUS_00200 25636 26220 gene locus_tag LOCUS_00210 25636 26220 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620308.1 protein_id gnl|my_center|LOCUS_00210 26249 26833 gene locus_tag LOCUS_00220 26249 26833 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_00220 28646 27030 gene locus_tag LOCUS_00230 28646 27030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 29311 28643 gene locus_tag LOCUS_00240 gene pmrA 29311 28643 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_00240 31190 29361 gene locus_tag LOCUS_00250 gene glmS 31190 29361 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269442.1 protein_id gnl|my_center|LOCUS_00250 32562 31192 gene locus_tag LOCUS_00260 gene glmU 32562 31192 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074328.1 protein_id gnl|my_center|LOCUS_00260 33129 32689 gene locus_tag LOCUS_00270 33129 32689 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948665.1 protein_id gnl|my_center|LOCUS_00270 34545 33163 gene locus_tag LOCUS_00280 gene atpD 34545 33163 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649402.1 protein_id gnl|my_center|LOCUS_00280 35466 34603 gene locus_tag LOCUS_00290 gene atpG 35466 34603 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_00290 37020 35479 gene locus_tag LOCUS_00300 gene atpA 37020 35479 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_00300 37570 37037 gene locus_tag LOCUS_00310 37570 37037 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105592.1 protein_id gnl|my_center|LOCUS_00310 38049 37576 gene locus_tag LOCUS_00320 38049 37576 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_00320 38378 38091 gene locus_tag LOCUS_00330 gene atpE 38378 38091 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948671.1 protein_id gnl|my_center|LOCUS_00330 39204 38428 gene locus_tag LOCUS_00340 gene atpB 39204 38428 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 protein_id gnl|my_center|LOCUS_00340 39591 39232 gene locus_tag LOCUS_00350 39591 39232 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097239.1 protein_id gnl|my_center|LOCUS_00350 40698 39802 gene locus_tag LOCUS_00360 40698 39802 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_00360 41437 40934 gene locus_tag LOCUS_00370 41437 40934 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_00370 41721 41434 gene locus_tag LOCUS_00380 41721 41434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 42013 42198 gene locus_tag LOCUS_00390 42013 42198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 42301 42519 gene locus_tag LOCUS_00400 42301 42519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42583 42825 gene locus_tag LOCUS_00410 42583 42825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 44081 42903 gene locus_tag LOCUS_00420 44081 42903 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_00420 44437 45828 gene locus_tag LOCUS_00430 44437 45828 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036845.1 protein_id gnl|my_center|LOCUS_00430 45843 46307 gene locus_tag LOCUS_00440 45843 46307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 46322 46675 gene locus_tag LOCUS_00450 46322 46675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 46785 47387 gene locus_tag LOCUS_00460 46785 47387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47496 48386 gene locus_tag LOCUS_00470 gene xrt 47496 48386 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_00470 48397 49119 gene locus_tag LOCUS_00480 48397 49119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 49123 50019 gene locus_tag LOCUS_00490 49123 50019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 50110 50772 gene locus_tag LOCUS_00500 gene yjgA 50110 50772 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210099.1 protein_id gnl|my_center|LOCUS_00500 51118 50819 gene locus_tag LOCUS_00510 51118 50819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 52224 51127 gene locus_tag LOCUS_00520 52224 51127 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_00520 53244 52336 gene locus_tag LOCUS_00530 gene xerC 53244 52336 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246535.1 protein_id gnl|my_center|LOCUS_00530 54156 53308 gene locus_tag LOCUS_00540 gene dapF 54156 53308 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983200.1 protein_id gnl|my_center|LOCUS_00540 55443 54196 gene locus_tag LOCUS_00550 gene lysA 55443 54196 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_00550 56145 55702 gene locus_tag LOCUS_00560 56145 55702 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_00560 56666 56154 gene locus_tag LOCUS_00570 56666 56154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 58580 56697 gene locus_tag LOCUS_00580 58580 56697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 protein_id gnl|my_center|LOCUS_00580 58834 59010 gene locus_tag LOCUS_00590 58834 59010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 60519 59002 gene locus_tag LOCUS_00600 60519 59002 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 protein_id gnl|my_center|LOCUS_00600 63139 60533 gene locus_tag LOCUS_00610 gene ndvB 63139 60533 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_00610 64511 63348 gene locus_tag LOCUS_00620 64511 63348 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_00620 66382 64670 gene locus_tag LOCUS_00630 66382 64670 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_00630 66859 69537 gene locus_tag LOCUS_00640 gene aceE 66859 69537 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199569.1 protein_id gnl|my_center|LOCUS_00640 69553 70863 gene locus_tag LOCUS_00650 69553 70863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70883 72298 gene locus_tag LOCUS_00660 gene lpdA 70883 72298 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031529.1 protein_id gnl|my_center|LOCUS_00660 73123 72386 gene locus_tag LOCUS_00670 gene cysZ 73123 72386 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408742.1 protein_id gnl|my_center|LOCUS_00670 74156 73113 gene locus_tag LOCUS_00680 gene mtnA 74156 73113 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404235.1 protein_id gnl|my_center|LOCUS_00680 74222 75535 gene locus_tag LOCUS_00690 74222 75535 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_00690 75712 76401 gene locus_tag LOCUS_00700 75712 76401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 76771 77058 gene locus_tag LOCUS_00710 76771 77058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 77055 77543 gene locus_tag LOCUS_00720 77055 77543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 77585 78589 gene locus_tag LOCUS_00730 77585 78589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 78687 80273 gene locus_tag LOCUS_00740 78687 80273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 80257 81258 gene locus_tag LOCUS_00750 80257 81258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 81572 82387 gene locus_tag LOCUS_00760 81572 82387 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208589.1 protein_id gnl|my_center|LOCUS_00760 82432 83481 gene locus_tag LOCUS_00770 82432 83481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 83494 84297 gene locus_tag LOCUS_00780 83494 84297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 >Feature sequence002 978 253 gene locus_tag LOCUS_00790 978 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 1880 1071 gene locus_tag LOCUS_00800 gene truA 1880 1071 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768766.1 protein_id gnl|my_center|LOCUS_00800 2388 1873 gene locus_tag LOCUS_00810 2388 1873 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_00810 2805 2972 gene locus_tag LOCUS_00820 2805 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 3005 4297 gene locus_tag LOCUS_00830 gene dctA 3005 4297 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082442.1 protein_id gnl|my_center|LOCUS_00830 5269 4418 gene locus_tag LOCUS_00840 5269 4418 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266255.1 protein_id gnl|my_center|LOCUS_00840 6682 5282 gene locus_tag LOCUS_00850 6682 5282 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262523.1 protein_id gnl|my_center|LOCUS_00850 10324 6704 gene locus_tag LOCUS_00860 10324 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 11396 10494 gene locus_tag LOCUS_00870 11396 10494 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 protein_id gnl|my_center|LOCUS_00870 12181 11459 gene locus_tag LOCUS_00880 12181 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 13143 12181 gene locus_tag LOCUS_00890 gene msrP 13143 12181 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113450.1 protein_id gnl|my_center|LOCUS_00890 13987 13187 gene locus_tag LOCUS_00900 13987 13187 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947815.1 protein_id gnl|my_center|LOCUS_00900 14521 14066 gene locus_tag LOCUS_00910 14521 14066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 15049 14567 gene locus_tag LOCUS_00920 15049 14567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 15293 15730 gene locus_tag LOCUS_00930 15293 15730 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480841.1 protein_id gnl|my_center|LOCUS_00930 15754 17121 gene locus_tag LOCUS_00940 15754 17121 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978886.1 protein_id gnl|my_center|LOCUS_00940 17509 17273 gene locus_tag LOCUS_00950 17509 17273 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 protein_id gnl|my_center|LOCUS_00950 17999 17676 gene locus_tag LOCUS_00960 17999 17676 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 protein_id gnl|my_center|LOCUS_00960 18248 18682 gene locus_tag LOCUS_00970 gene dksA 18248 18682 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_00970 18695 19579 gene locus_tag LOCUS_00980 gene gluQRS 18695 19579 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208180.1 protein_id gnl|my_center|LOCUS_00980 19726 21471 gene locus_tag LOCUS_00990 19726 21471 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266723.1 protein_id gnl|my_center|LOCUS_00990 21479 22807 gene locus_tag LOCUS_01000 21479 22807 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266724.1 protein_id gnl|my_center|LOCUS_01000 22811 24139 gene locus_tag LOCUS_01010 22811 24139 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266725.1 protein_id gnl|my_center|LOCUS_01010 25461 24190 gene locus_tag LOCUS_01020 gene purD 25461 24190 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197681.1 protein_id gnl|my_center|LOCUS_01020 27052 25490 gene locus_tag LOCUS_01030 gene purH 27052 25490 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175670.1 protein_id gnl|my_center|LOCUS_01030 27404 27120 gene locus_tag LOCUS_01040 27404 27120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 28389 27427 gene locus_tag LOCUS_01050 gene dusB 28389 27427 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 protein_id gnl|my_center|LOCUS_01050 28932 28405 gene locus_tag LOCUS_01060 28932 28405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 30344 29148 gene locus_tag LOCUS_01070 30344 29148 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763607.1 protein_id gnl|my_center|LOCUS_01070 31263 30385 gene locus_tag LOCUS_01080 gene prmA 31263 30385 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459549.1 protein_id gnl|my_center|LOCUS_01080 32754 31411 gene locus_tag LOCUS_01090 gene accC 32754 31411 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884888.1 protein_id gnl|my_center|LOCUS_01090 33206 32769 gene locus_tag LOCUS_01100 gene accB 33206 32769 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_01100 33656 33210 gene locus_tag LOCUS_01110 gene aroQ 33656 33210 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_01110 35056 34187 gene locus_tag LOCUS_01120 35056 34187 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922721.1 protein_id gnl|my_center|LOCUS_01120 35509 38715 gene locus_tag LOCUS_01130 35509 38715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 38727 39698 gene locus_tag LOCUS_01140 gene glk 38727 39698 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_01140 42392 39747 gene locus_tag LOCUS_01150 42392 39747 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_01150 43152 42376 gene locus_tag LOCUS_01160 gene map 43152 42376 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266973.1 protein_id gnl|my_center|LOCUS_01160 43430 44176 gene locus_tag LOCUS_01170 gene rpsB 43430 44176 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_01170 44304 45194 gene locus_tag LOCUS_01180 gene tsf 44304 45194 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_01180 45292 46020 gene locus_tag LOCUS_01190 gene pyrH 45292 46020 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_01190 46020 46577 gene locus_tag LOCUS_01200 gene frr 46020 46577 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_01200 46590 47339 gene locus_tag LOCUS_01210 46590 47339 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480970.1 protein_id gnl|my_center|LOCUS_01210 47377 48249 gene locus_tag LOCUS_01220 47377 48249 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958190.1 protein_id gnl|my_center|LOCUS_01220 48246 49430 gene locus_tag LOCUS_01230 gene ispC 48246 49430 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_01230 49430 50791 gene locus_tag LOCUS_01240 gene rseP 49430 50791 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103593.1 protein_id gnl|my_center|LOCUS_01240 50874 51605 gene locus_tag LOCUS_01250 50874 51605 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_01250 52699 51692 gene locus_tag LOCUS_01260 52699 51692 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_01260 54331 52916 gene locus_tag LOCUS_01270 gene lpdA 54331 52916 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267378.1 protein_id gnl|my_center|LOCUS_01270 55595 54336 gene locus_tag LOCUS_01280 gene odhB 55595 54336 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946280.1 protein_id gnl|my_center|LOCUS_01280 58425 55597 gene locus_tag LOCUS_01290 58425 55597 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_01290 59176 58700 gene locus_tag LOCUS_01300 59176 58700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 59387 60025 gene locus_tag LOCUS_01310 gene adk 59387 60025 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812899.1 protein_id gnl|my_center|LOCUS_01310 60093 61115 gene locus_tag LOCUS_01320 60093 61115 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 protein_id gnl|my_center|LOCUS_01320 62063 61185 gene locus_tag LOCUS_01330 62063 61185 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_01330 62959 62534 gene locus_tag LOCUS_01340 62959 62534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 64240 63005 gene locus_tag LOCUS_01350 64240 63005 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence003 819 244 gene locus_tag LOCUS_01360 819 244 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813016.1 protein_id gnl|my_center|LOCUS_01360 1194 2243 gene locus_tag LOCUS_01370 gene prfB 1194 2243 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 protein_id gnl|my_center|LOCUS_01370 2260 3618 gene locus_tag LOCUS_01380 2260 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 3618 4181 gene locus_tag LOCUS_01390 3618 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 4236 5735 gene locus_tag LOCUS_01400 gene lysS 4236 5735 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707134.1 protein_id gnl|my_center|LOCUS_01400 6561 5797 gene locus_tag LOCUS_01410 gene gloB 6561 5797 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_01410 8100 6571 gene locus_tag LOCUS_01420 8100 6571 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_01420 8419 9426 gene locus_tag LOCUS_01430 8419 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 10617 9595 gene locus_tag LOCUS_01440 10617 9595 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_01440 14210 10629 gene locus_tag LOCUS_01450 gene nifJ 14210 10629 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_01450 15851 14214 gene locus_tag LOCUS_01460 15851 14214 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_01460 16090 16488 gene locus_tag LOCUS_01470 16090 16488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 16774 16968 gene locus_tag LOCUS_01480 16774 16968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 17786 17157 gene locus_tag LOCUS_01490 17786 17157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 19551 17800 gene locus_tag LOCUS_01500 19551 17800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 20305 19652 gene locus_tag LOCUS_01510 20305 19652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 20724 20320 gene locus_tag LOCUS_01520 20724 20320 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_01520 22588 20780 gene locus_tag LOCUS_01530 22588 20780 CDS product DUF2341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112717.1 protein_id gnl|my_center|LOCUS_01530 33279 22762 gene locus_tag LOCUS_01540 33279 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 34946 33306 gene locus_tag LOCUS_01550 34946 33306 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112718.1 protein_id gnl|my_center|LOCUS_01550 36885 35137 gene locus_tag LOCUS_01560 36885 35137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 37292 37783 gene locus_tag LOCUS_01570 37292 37783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 38356 37850 gene locus_tag LOCUS_01580 38356 37850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 39545 38337 gene locus_tag LOCUS_01590 gene gspL 39545 38337 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884054.1 protein_id gnl|my_center|LOCUS_01590 40488 39538 gene locus_tag LOCUS_01600 gene xcpX 40488 39538 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_01600 41081 40488 gene locus_tag LOCUS_01610 41081 40488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 41455 41081 gene locus_tag LOCUS_01620 41455 41081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 41994 41452 gene locus_tag LOCUS_01630 41994 41452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 42410 41979 gene locus_tag LOCUS_01640 gene xcpT 42410 41979 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_01640 43739 42528 gene locus_tag LOCUS_01650 gene gspF 43739 42528 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_01650 45261 43744 gene locus_tag LOCUS_01660 gene lspE 45261 43744 CDS product GspE family T2SS ATPase variant LspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947050.1 protein_id gnl|my_center|LOCUS_01660 47156 45261 gene locus_tag LOCUS_01670 gene gspD 47156 45261 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498830.1 protein_id gnl|my_center|LOCUS_01670 47689 47168 gene locus_tag LOCUS_01680 47689 47168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 47995 47920 gene locus_tag LOCUS_t00010 47995 47920 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 48883 48698 gene locus_tag LOCUS_01690 48883 48698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 50212 49655 gene locus_tag LOCUS_01700 50212 49655 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957348.1 protein_id gnl|my_center|LOCUS_01700 52306 50219 gene locus_tag LOCUS_01710 gene recG 52306 50219 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819155.1 protein_id gnl|my_center|LOCUS_01710 52744 52340 gene locus_tag LOCUS_01720 52744 52340 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_01720 53167 52916 gene locus_tag LOCUS_01730 53167 52916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 53397 53101 gene locus_tag LOCUS_01740 53397 53101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 53697 53437 gene locus_tag LOCUS_01750 53697 53437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 53917 53663 gene locus_tag LOCUS_01760 53917 53663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 54746 54234 gene locus_tag LOCUS_01770 54746 54234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 56372 56070 gene locus_tag LOCUS_01780 56372 56070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 56946 56626 gene locus_tag LOCUS_01790 56946 56626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 <61143 56985 gene locus_tag LOCUS_01800 <61143 56985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_179297780.1:RHS repeat-associated core domain-containing protein >Feature sequence004 2125 1268 gene locus_tag LOCUS_01810 gene rpoH 2125 1268 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013101924.1 protein_id gnl|my_center|LOCUS_01810 3224 2205 gene locus_tag LOCUS_01820 gene ftsX 3224 2205 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_01820 3884 3228 gene locus_tag LOCUS_01830 gene ftsE 3884 3228 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_01830 5822 3891 gene locus_tag LOCUS_01840 5822 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 6586 5834 gene locus_tag LOCUS_01850 6586 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 7295 6579 gene locus_tag LOCUS_01860 7295 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_01860 8706 7855 gene locus_tag LOCUS_01870 8706 7855 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_01870 9270 8719 gene locus_tag LOCUS_01880 9270 8719 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216728.1 protein_id gnl|my_center|LOCUS_01880 11065 9425 gene locus_tag LOCUS_01890 gene ctaD 11065 9425 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_01890 12242 11121 gene locus_tag LOCUS_01900 gene coxB 12242 11121 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 protein_id gnl|my_center|LOCUS_01900 14600 12672 gene locus_tag LOCUS_01910 14600 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 16534 14693 gene locus_tag LOCUS_01920 16534 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 17301 16795 gene locus_tag LOCUS_01930 17301 16795 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_01930 17583 17365 gene locus_tag LOCUS_01940 17583 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 18644 17616 gene locus_tag LOCUS_01950 18644 17616 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_01950 19435 18683 gene locus_tag LOCUS_01960 19435 18683 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_01960 19623 20120 gene locus_tag LOCUS_01970 19623 20120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 20550 20131 gene locus_tag LOCUS_01980 20550 20131 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_01980 21554 20739 gene locus_tag LOCUS_01990 21554 20739 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_01990 22086 21649 gene locus_tag LOCUS_02000 gene dtd 22086 21649 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947570.1 protein_id gnl|my_center|LOCUS_02000 22853 22104 gene locus_tag LOCUS_02010 22853 22104 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_02010 23093 23431 gene locus_tag LOCUS_02020 23093 23431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 24081 23515 gene locus_tag LOCUS_02030 24081 23515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 25431 24217 gene locus_tag LOCUS_02040 25431 24217 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_02040 25588 26712 gene locus_tag LOCUS_02050 25588 26712 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266711.1 protein_id gnl|my_center|LOCUS_02050 26792 27514 gene locus_tag LOCUS_02060 26792 27514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 27679 30507 gene locus_tag LOCUS_02070 27679 30507 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011114777.1 protein_id gnl|my_center|LOCUS_02070 30556 30801 gene locus_tag LOCUS_02080 30556 30801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 31929 31591 gene locus_tag LOCUS_02090 31929 31591 CDS product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704941.1 protein_id gnl|my_center|LOCUS_02090 32718 31963 gene locus_tag LOCUS_02100 32718 31963 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852748.1 protein_id gnl|my_center|LOCUS_02100 33075 34121 gene locus_tag LOCUS_02110 33075 34121 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531646.1 protein_id gnl|my_center|LOCUS_02110 34273 35556 gene locus_tag LOCUS_02120 34273 35556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 35567 36283 gene locus_tag LOCUS_02130 35567 36283 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_02130 36370 37953 gene locus_tag LOCUS_02140 36370 37953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 37984 38736 gene locus_tag LOCUS_02150 37984 38736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 38729 40246 gene locus_tag LOCUS_02160 38729 40246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 40371 41759 gene locus_tag LOCUS_02170 40371 41759 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_02170 41833 42339 gene locus_tag LOCUS_02180 41833 42339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 42349 43509 gene locus_tag LOCUS_02190 42349 43509 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483424.1 protein_id gnl|my_center|LOCUS_02190 43730 43548 gene locus_tag LOCUS_02200 43730 43548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 43665 44690 gene locus_tag LOCUS_02210 43665 44690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 44754 45911 gene locus_tag LOCUS_02220 44754 45911 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216554.1 protein_id gnl|my_center|LOCUS_02220 47429 45954 gene locus_tag LOCUS_02230 47429 45954 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_02230 48845 47541 gene locus_tag LOCUS_02240 48845 47541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 51502 48920 gene locus_tag LOCUS_02250 gene mprF 51502 48920 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022655.1 protein_id gnl|my_center|LOCUS_02250 52865 51504 gene locus_tag LOCUS_02260 52865 51504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 53763 52894 gene locus_tag LOCUS_02270 53763 52894 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975902.1 protein_id gnl|my_center|LOCUS_02270 53890 55014 gene locus_tag LOCUS_02280 53890 55014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence005 164 1222 gene locus_tag LOCUS_02290 164 1222 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268559.1 protein_id gnl|my_center|LOCUS_02290 1219 3180 gene locus_tag LOCUS_02300 1219 3180 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_02300 3265 3693 gene locus_tag LOCUS_02310 3265 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 3726 4589 gene locus_tag LOCUS_02320 3726 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4597 5799 gene locus_tag LOCUS_02330 gene waaL-ps 4597 5799 CDS product O-antigen polysaccharide ligase WaaL-ps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815492.1 protein_id gnl|my_center|LOCUS_02330 5799 6536 gene locus_tag LOCUS_02340 5799 6536 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_02340 6545 7621 gene locus_tag LOCUS_02350 6545 7621 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958355.1 protein_id gnl|my_center|LOCUS_02350 7625 8659 gene locus_tag LOCUS_02360 7625 8659 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938297.1 protein_id gnl|my_center|LOCUS_02360 8721 10475 gene locus_tag LOCUS_02370 gene msbA 8721 10475 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010213170.1 protein_id gnl|my_center|LOCUS_02370 10820 10617 gene locus_tag LOCUS_02380 10820 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 11790 10834 gene locus_tag LOCUS_02390 11790 10834 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365085.1 protein_id gnl|my_center|LOCUS_02390 13974 11833 gene locus_tag LOCUS_02400 gene glgX 13974 11833 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 protein_id gnl|my_center|LOCUS_02400 14959 14234 gene locus_tag LOCUS_02410 14959 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_02410 17647 15233 gene locus_tag LOCUS_02420 17647 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 18616 17666 gene locus_tag LOCUS_02430 gene mtrA 18616 17666 CDS product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_02430 19085 18735 gene locus_tag LOCUS_02440 19085 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 19227 21074 gene locus_tag LOCUS_02450 gene uvrC 19227 21074 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_02450 21058 21621 gene locus_tag LOCUS_02460 gene pgsA 21058 21621 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694415.1 protein_id gnl|my_center|LOCUS_02460 21792 22394 gene locus_tag LOCUS_02470 21792 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 23066 22740 gene locus_tag LOCUS_02480 23066 22740 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_02480 23101 23361 gene locus_tag LOCUS_02490 23101 23361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 23364 23546 gene locus_tag LOCUS_02500 23364 23546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 23959 23624 gene locus_tag LOCUS_02510 23959 23624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 25259 24105 gene locus_tag LOCUS_02520 gene rnd 25259 24105 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_02520 26260 25403 gene locus_tag LOCUS_02530 gene ttcA 26260 25403 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925707.1 protein_id gnl|my_center|LOCUS_02530 27557 26337 gene locus_tag LOCUS_02540 gene fabB 27557 26337 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420034.1 protein_id gnl|my_center|LOCUS_02540 28084 27569 gene locus_tag LOCUS_02550 gene fabA 28084 27569 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 protein_id gnl|my_center|LOCUS_02550 30038 28161 gene locus_tag LOCUS_02560 30038 28161 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104597.1 protein_id gnl|my_center|LOCUS_02560 31911 30346 gene locus_tag LOCUS_02570 gene murJ 31911 30346 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957545.1 protein_id gnl|my_center|LOCUS_02570 32008 32271 gene locus_tag LOCUS_02580 gene rpsT 32008 32271 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344603.1 protein_id gnl|my_center|LOCUS_02580 33386 32412 gene locus_tag LOCUS_02590 gene cmoB 33386 32412 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483112.1 protein_id gnl|my_center|LOCUS_02590 34167 33532 gene locus_tag LOCUS_02600 34167 33532 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_02600 34367 35326 gene locus_tag LOCUS_02610 gene hemB 34367 35326 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_02610 35323 36156 gene locus_tag LOCUS_02620 gene aroE 35323 36156 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266136.1 protein_id gnl|my_center|LOCUS_02620 36788 36252 gene locus_tag LOCUS_02630 36788 36252 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103010.1 protein_id gnl|my_center|LOCUS_02630 36910 37626 gene locus_tag LOCUS_02640 36910 37626 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_02640 38691 37651 gene locus_tag LOCUS_02650 38691 37651 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073877.1 protein_id gnl|my_center|LOCUS_02650 38931 39608 gene locus_tag LOCUS_02660 38931 39608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 41507 39669 gene locus_tag LOCUS_02670 gene asnB 41507 39669 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398625.1 protein_id gnl|my_center|LOCUS_02670 43279 41510 gene locus_tag LOCUS_02680 43279 41510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 45977 43326 gene locus_tag LOCUS_02690 gene pepN 45977 43326 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_02690 46371 45964 gene locus_tag LOCUS_02700 46371 45964 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688312.1 protein_id gnl|my_center|LOCUS_02700 46889 46371 gene locus_tag LOCUS_02710 gene moaB 46889 46371 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965931.1 protein_id gnl|my_center|LOCUS_02710 48324 46960 gene locus_tag LOCUS_02720 48324 46960 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262646.1 protein_id gnl|my_center|LOCUS_02720 49974 48466 gene locus_tag LOCUS_02730 49974 48466 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707862.1 protein_id gnl|my_center|LOCUS_02730 50421 50161 gene locus_tag LOCUS_02740 50421 50161 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958608.1 protein_id gnl|my_center|LOCUS_02740 52305 50965 gene locus_tag LOCUS_02750 gene tilS 52305 50965 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_02750 53277 52363 gene locus_tag LOCUS_02760 53277 52363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence006 82 300 gene locus_tag LOCUS_02770 82 300 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_02770 418 912 gene locus_tag LOCUS_02780 418 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 1380 2372 gene locus_tag LOCUS_02790 1380 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 2663 3481 gene locus_tag LOCUS_02800 2663 3481 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_02800 3494 3775 gene locus_tag LOCUS_02810 3494 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 3772 5691 gene locus_tag LOCUS_02820 3772 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5715 5909 gene locus_tag LOCUS_02830 5715 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 5909 6256 gene locus_tag LOCUS_02840 5909 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 6345 6599 gene locus_tag LOCUS_02850 6345 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 6742 7071 gene locus_tag LOCUS_02860 6742 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 7084 7665 gene locus_tag LOCUS_02870 7084 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 7876 9363 gene locus_tag LOCUS_02880 7876 9363 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_02880 9366 9893 gene locus_tag LOCUS_02890 9366 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 9886 12036 gene locus_tag LOCUS_02900 9886 12036 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_02900 12033 12815 gene locus_tag LOCUS_02910 12033 12815 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730760.1 protein_id gnl|my_center|LOCUS_02910 12812 13456 gene locus_tag LOCUS_02920 12812 13456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 13483 14931 gene locus_tag LOCUS_02930 13483 14931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 14937 15308 gene locus_tag LOCUS_02940 14937 15308 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081556.1 protein_id gnl|my_center|LOCUS_02940 16480 15374 gene locus_tag LOCUS_02950 gene leuB 16480 15374 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081326.1 protein_id gnl|my_center|LOCUS_02950 16799 17257 gene locus_tag LOCUS_02960 gene dut 16799 17257 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077682.1 protein_id gnl|my_center|LOCUS_02960 17315 18229 gene locus_tag LOCUS_02970 gene argB 17315 18229 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_02970 18881 18303 gene locus_tag LOCUS_02980 18881 18303 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_02980 19708 18881 gene locus_tag LOCUS_02990 gene proC 19708 18881 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_02990 19838 20830 gene locus_tag LOCUS_03000 19838 20830 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257894.1 protein_id gnl|my_center|LOCUS_03000 20818 21534 gene locus_tag LOCUS_03010 20818 21534 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_03010 22143 21565 gene locus_tag LOCUS_03020 22143 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 23609 22185 gene locus_tag LOCUS_03030 23609 22185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 24249 23713 gene locus_tag LOCUS_03040 gene cobO 24249 23713 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086044.1 protein_id gnl|my_center|LOCUS_03040 24383 25663 gene locus_tag LOCUS_03050 gene hemL 24383 25663 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707264.1 protein_id gnl|my_center|LOCUS_03050 26117 28762 gene locus_tag LOCUS_03060 26117 28762 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090068.1 protein_id gnl|my_center|LOCUS_03060 28846 29394 gene locus_tag LOCUS_03070 28846 29394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 29405 30607 gene locus_tag LOCUS_03080 29405 30607 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_03080 31106 30681 gene locus_tag LOCUS_03090 31106 30681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 31678 31965 gene locus_tag LOCUS_03100 31678 31965 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 protein_id gnl|my_center|LOCUS_03100 32153 31962 gene locus_tag LOCUS_03110 32153 31962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 33367 32243 gene locus_tag LOCUS_03120 33367 32243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 33828 33502 gene locus_tag LOCUS_03130 33828 33502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 34964 35146 gene locus_tag LOCUS_03140 34964 35146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 35499 36035 gene locus_tag LOCUS_03150 35499 36035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 36138 38420 gene locus_tag LOCUS_03160 36138 38420 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 protein_id gnl|my_center|LOCUS_03160 38973 38653 gene locus_tag LOCUS_03170 38973 38653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 39197 40462 gene locus_tag LOCUS_03180 39197 40462 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345374.1 protein_id gnl|my_center|LOCUS_03180 42265 40487 gene locus_tag LOCUS_03190 gene dnaK 42265 40487 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_03190 43335 42262 gene locus_tag LOCUS_03200 43335 42262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 43552 43758 gene locus_tag LOCUS_03210 43552 43758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 43986 45689 gene locus_tag LOCUS_03220 43986 45689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 46543 45878 gene locus_tag LOCUS_03230 46543 45878 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268752.1 protein_id gnl|my_center|LOCUS_03230 47436 46558 gene locus_tag LOCUS_03240 47436 46558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 49828 47426 gene locus_tag LOCUS_03250 49828 47426 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037666.1 protein_id gnl|my_center|LOCUS_03250 50322 51629 gene locus_tag LOCUS_03260 50322 51629 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112837.1 protein_id gnl|my_center|LOCUS_03260 51658 52188 gene locus_tag LOCUS_03270 51658 52188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 52242 53582 gene locus_tag LOCUS_03280 52242 53582 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784141.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence007 2275 371 gene locus_tag LOCUS_03290 2275 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 2610 2410 gene locus_tag LOCUS_03300 2610 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 2609 3157 gene locus_tag LOCUS_03310 2609 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 3194 3613 gene locus_tag LOCUS_03320 3194 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 3887 3702 gene locus_tag LOCUS_03330 3887 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 3970 7662 gene locus_tag LOCUS_03340 gene metH 3970 7662 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096036.1 protein_id gnl|my_center|LOCUS_03340 7677 7946 gene locus_tag LOCUS_03350 7677 7946 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_03350 7973 8923 gene locus_tag LOCUS_03360 7973 8923 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 protein_id gnl|my_center|LOCUS_03360 9111 9629 gene locus_tag LOCUS_03370 9111 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 9766 10686 gene locus_tag LOCUS_03380 9766 10686 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_03380 11232 10732 gene locus_tag LOCUS_03390 11232 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 12214 11255 gene locus_tag LOCUS_03400 12214 11255 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268840.1 protein_id gnl|my_center|LOCUS_03400 13495 12281 gene locus_tag LOCUS_03410 gene argJ 13495 12281 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_03410 14653 13499 gene locus_tag LOCUS_03420 14653 13499 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444330.1 protein_id gnl|my_center|LOCUS_03420 14886 14653 gene locus_tag LOCUS_03430 gene tusA 14886 14653 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_03430 15940 14897 gene locus_tag LOCUS_03440 15940 14897 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_03440 17002 16022 gene locus_tag LOCUS_03450 gene waaA 17002 16022 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 protein_id gnl|my_center|LOCUS_03450 17815 17366 gene locus_tag LOCUS_03460 gene rplI 17815 17366 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 protein_id gnl|my_center|LOCUS_03460 18754 17852 gene locus_tag LOCUS_03470 18754 17852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_03470 19009 18782 gene locus_tag LOCUS_03480 gene rpsR 19009 18782 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947320.1 protein_id gnl|my_center|LOCUS_03480 19500 19042 gene locus_tag LOCUS_03490 19500 19042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 22753 19799 gene locus_tag LOCUS_03500 22753 19799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 24720 23197 gene locus_tag LOCUS_03510 24720 23197 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_03510 24863 25381 gene locus_tag LOCUS_03520 24863 25381 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_03520 25512 26498 gene locus_tag LOCUS_03530 gene pstS 25512 26498 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_03530 26608 28887 gene locus_tag LOCUS_03540 26608 28887 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768357.1 protein_id gnl|my_center|LOCUS_03540 29018 30604 gene locus_tag LOCUS_03550 gene pstA 29018 30604 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174518729.1 protein_id gnl|my_center|LOCUS_03550 30609 31442 gene locus_tag LOCUS_03560 gene pstB 30609 31442 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_03560 31456 32172 gene locus_tag LOCUS_03570 gene phoU 31456 32172 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 protein_id gnl|my_center|LOCUS_03570 33813 32263 gene locus_tag LOCUS_03580 gene ubiB 33813 32263 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_03580 34412 33795 gene locus_tag LOCUS_03590 34412 33795 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215928.1 protein_id gnl|my_center|LOCUS_03590 35184 34435 gene locus_tag LOCUS_03600 gene ubiE 35184 34435 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227959.1 protein_id gnl|my_center|LOCUS_03600 35582 35193 gene locus_tag LOCUS_03610 35582 35193 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_03610 36945 35620 gene locus_tag LOCUS_03620 gene hslU 36945 35620 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208943.1 protein_id gnl|my_center|LOCUS_03620 37495 36950 gene locus_tag LOCUS_03630 gene hslV 37495 36950 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769770.1 protein_id gnl|my_center|LOCUS_03630 38021 37596 gene locus_tag LOCUS_03640 38021 37596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969582.1 protein_id gnl|my_center|LOCUS_03640 38219 38809 gene locus_tag LOCUS_03650 gene mobA 38219 38809 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 protein_id gnl|my_center|LOCUS_03650 42738 38881 gene locus_tag LOCUS_03660 42738 38881 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707626.1 protein_id gnl|my_center|LOCUS_03660 43578 42763 gene locus_tag LOCUS_03670 43578 42763 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 protein_id gnl|my_center|LOCUS_03670 44528 43614 gene locus_tag LOCUS_03680 gene hemF 44528 43614 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070454.1 protein_id gnl|my_center|LOCUS_03680 45114 44710 gene locus_tag LOCUS_03690 45114 44710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 45909 45127 gene locus_tag LOCUS_03700 45909 45127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03700 46567 45962 gene locus_tag LOCUS_03710 46567 45962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 >Feature sequence008 217 534 gene locus_tag LOCUS_03720 217 534 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_03720 536 1009 gene locus_tag LOCUS_03730 536 1009 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 protein_id gnl|my_center|LOCUS_03730 2796 1192 gene locus_tag LOCUS_03740 2796 1192 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_03740 3005 3427 gene locus_tag LOCUS_03750 3005 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 3509 4303 gene locus_tag LOCUS_03760 3509 4303 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873837.1 protein_id gnl|my_center|LOCUS_03760 4337 5179 gene locus_tag LOCUS_03770 gene rlmJ 4337 5179 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313365.1 protein_id gnl|my_center|LOCUS_03770 5215 7062 gene locus_tag LOCUS_03780 5215 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 7059 7883 gene locus_tag LOCUS_03790 gene chbG 7059 7883 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593465.1 protein_id gnl|my_center|LOCUS_03790 8107 9414 gene locus_tag LOCUS_03800 8107 9414 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_03800 9490 9834 gene locus_tag LOCUS_03810 9490 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 9906 10196 gene locus_tag LOCUS_03820 9906 10196 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_03820 11103 10258 gene locus_tag LOCUS_03830 11103 10258 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521932.1 protein_id gnl|my_center|LOCUS_03830 12496 11324 gene locus_tag LOCUS_03840 12496 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 13729 12737 gene locus_tag LOCUS_03850 13729 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 14452 14057 gene locus_tag LOCUS_03860 14452 14057 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 protein_id gnl|my_center|LOCUS_03860 14696 15037 gene locus_tag LOCUS_03870 gene phnA 14696 15037 CDS product alkylphosphonate utilization operon protein PhnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212737.1 protein_id gnl|my_center|LOCUS_03870 15065 16729 gene locus_tag LOCUS_03880 gene ettA 15065 16729 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704886.1 protein_id gnl|my_center|LOCUS_03880 16897 17193 gene locus_tag LOCUS_03890 16897 17193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 17431 17895 gene locus_tag LOCUS_03900 17431 17895 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720132.1 protein_id gnl|my_center|LOCUS_03900 17923 18693 gene locus_tag LOCUS_03910 17923 18693 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_03910 18953 18774 gene locus_tag LOCUS_03920 18953 18774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 19870 19112 gene locus_tag LOCUS_03930 19870 19112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 21080 20172 gene locus_tag LOCUS_03940 gene ylqF 21080 20172 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263367.1 protein_id gnl|my_center|LOCUS_03940 21188 21793 gene locus_tag LOCUS_03950 gene yfbR 21188 21793 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210283.1 protein_id gnl|my_center|LOCUS_03950 23214 21790 gene locus_tag LOCUS_03960 gene sbcB 23214 21790 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 protein_id gnl|my_center|LOCUS_03960 23422 23231 gene locus_tag LOCUS_03970 gene nqrM 23422 23231 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091359.1 protein_id gnl|my_center|LOCUS_03970 24795 23575 gene locus_tag LOCUS_03980 gene nqrF 24795 23575 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951261.1 protein_id gnl|my_center|LOCUS_03980 25416 24808 gene locus_tag LOCUS_03990 gene nqrE 25416 24808 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_03990 26096 25416 gene locus_tag LOCUS_04000 26096 25416 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160493.1 protein_id gnl|my_center|LOCUS_04000 27019 26093 gene locus_tag LOCUS_04010 27019 26093 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_04010 28214 27012 gene locus_tag LOCUS_04020 28214 27012 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_04020 29563 28214 gene locus_tag LOCUS_04030 29563 28214 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689268.1 protein_id gnl|my_center|LOCUS_04030 30730 29831 gene locus_tag LOCUS_04040 30730 29831 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266746.1 protein_id gnl|my_center|LOCUS_04040 30915 31334 gene locus_tag LOCUS_04050 30915 31334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 31455 31613 gene locus_tag LOCUS_04060 31455 31613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 32103 31747 gene locus_tag LOCUS_04070 gene tusC 32103 31747 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405065.1 protein_id gnl|my_center|LOCUS_04070 32499 32110 gene locus_tag LOCUS_04080 gene tusD 32499 32110 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_04080 32622 34190 gene locus_tag LOCUS_04090 32622 34190 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_04090 36072 34594 gene locus_tag LOCUS_04100 36072 34594 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_04100 36943 36110 gene locus_tag LOCUS_04110 36943 36110 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693963.1 protein_id gnl|my_center|LOCUS_04110 38788 36998 gene locus_tag LOCUS_04120 38788 36998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_04120 39159 39752 gene locus_tag LOCUS_04130 39159 39752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 39760 40236 gene locus_tag LOCUS_04140 39760 40236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 40299 40937 gene locus_tag LOCUS_04150 40299 40937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 40946 41473 gene locus_tag LOCUS_04160 40946 41473 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244085.1 protein_id gnl|my_center|LOCUS_04160 41541 43607 gene locus_tag LOCUS_04170 41541 43607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 43608 44057 gene locus_tag LOCUS_04180 gene tppA 43608 44057 CDS product type IVa pilus pseudopilin TppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704652.1 protein_id gnl|my_center|LOCUS_04180 44269 45435 gene locus_tag LOCUS_04190 44269 45435 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence009 1395 274 gene locus_tag LOCUS_04200 gene thiO 1395 274 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_04200 1789 2709 gene locus_tag LOCUS_04210 1789 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 5013 2824 gene locus_tag LOCUS_04220 5013 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5538 6113 gene locus_tag LOCUS_04230 5538 6113 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521981.1 protein_id gnl|my_center|LOCUS_04230 6311 6991 gene locus_tag LOCUS_04240 6311 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173306.1 protein_id gnl|my_center|LOCUS_04240 7794 7063 gene locus_tag LOCUS_04250 7794 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 10212 7801 gene locus_tag LOCUS_04260 gene ppsA 10212 7801 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022627.1 protein_id gnl|my_center|LOCUS_04260 10367 11356 gene locus_tag LOCUS_04270 gene birA 10367 11356 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_04270 11356 12093 gene locus_tag LOCUS_04280 11356 12093 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_04280 12173 13621 gene locus_tag LOCUS_04290 12173 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 13744 14139 gene locus_tag LOCUS_04300 gene msrB 13744 14139 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766799.1 protein_id gnl|my_center|LOCUS_04300 17160 14452 gene locus_tag LOCUS_04310 gene polA 17160 14452 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958446.1 protein_id gnl|my_center|LOCUS_04310 19332 17227 gene locus_tag LOCUS_04320 gene relA 19332 17227 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947186.1 protein_id gnl|my_center|LOCUS_04320 19798 19427 gene locus_tag LOCUS_04330 19798 19427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 22006 19925 gene locus_tag LOCUS_04340 22006 19925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 22265 22813 gene locus_tag LOCUS_04350 22265 22813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 22919 24757 gene locus_tag LOCUS_04360 gene mutL 22919 24757 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065015.1 protein_id gnl|my_center|LOCUS_04360 24764 25711 gene locus_tag LOCUS_04370 gene miaA 24764 25711 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113929.1 protein_id gnl|my_center|LOCUS_04370 26667 25801 gene locus_tag LOCUS_04380 gene sucD 26667 25801 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300222.1 protein_id gnl|my_center|LOCUS_04380 27830 26664 gene locus_tag LOCUS_04390 gene sucC 27830 26664 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_04390 29352 28108 gene locus_tag LOCUS_04400 29352 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 30198 29455 gene locus_tag LOCUS_04410 30198 29455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 31067 30315 gene locus_tag LOCUS_04420 31067 30315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 31346 31783 gene locus_tag LOCUS_04430 31346 31783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 34321 31826 gene locus_tag LOCUS_04440 34321 31826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 34863 34318 gene locus_tag LOCUS_04450 34863 34318 CDS product methanogen output domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331451.1 protein_id gnl|my_center|LOCUS_04450 36070 35354 gene locus_tag LOCUS_04460 36070 35354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 37348 36074 gene locus_tag LOCUS_04470 37348 36074 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_04470 38275 37517 gene locus_tag LOCUS_04480 38275 37517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 38806 38381 gene locus_tag LOCUS_04490 38806 38381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 39758 38808 gene locus_tag LOCUS_04500 39758 38808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 40685 39981 gene locus_tag LOCUS_04510 40685 39981 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566878.1 protein_id gnl|my_center|LOCUS_04510 41498 40833 gene locus_tag LOCUS_04520 41498 40833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 42592 41495 gene locus_tag LOCUS_04530 42592 41495 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478434.1 protein_id gnl|my_center|LOCUS_04530 42680 42847 gene locus_tag LOCUS_04540 42680 42847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 44004 43567 gene locus_tag LOCUS_04550 44004 43567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 44334 44017 gene locus_tag LOCUS_04560 44334 44017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 44673 45317 gene locus_tag LOCUS_04570 44673 45317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence010 1156 305 gene locus_tag LOCUS_04580 1156 305 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 protein_id gnl|my_center|LOCUS_04580 1922 1161 gene locus_tag LOCUS_04590 gene yfiH 1922 1161 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098337.1 protein_id gnl|my_center|LOCUS_04590 2877 1909 gene locus_tag LOCUS_04600 gene rluD 2877 1909 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_04600 3025 3819 gene locus_tag LOCUS_04610 3025 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 3840 4451 gene locus_tag LOCUS_04620 3840 4451 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368574.1 protein_id gnl|my_center|LOCUS_04620 4508 5845 gene locus_tag LOCUS_04630 4508 5845 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_04630 6729 5896 gene locus_tag LOCUS_04640 6729 5896 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_04640 7109 6732 gene locus_tag LOCUS_04650 gene apaG 7109 6732 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036026.1 protein_id gnl|my_center|LOCUS_04650 7239 8603 gene locus_tag LOCUS_04660 gene mpl 7239 8603 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 protein_id gnl|my_center|LOCUS_04660 9683 8619 gene locus_tag LOCUS_04670 9683 8619 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 protein_id gnl|my_center|LOCUS_04670 10548 9703 gene locus_tag LOCUS_04680 10548 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384461.1 protein_id gnl|my_center|LOCUS_04680 10863 10564 gene locus_tag LOCUS_04690 10863 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 11218 12615 gene locus_tag LOCUS_04700 gene leuC 11218 12615 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855526.1 protein_id gnl|my_center|LOCUS_04700 12637 13248 gene locus_tag LOCUS_04710 gene leuD 12637 13248 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802156.1 protein_id gnl|my_center|LOCUS_04710 13368 13673 gene locus_tag LOCUS_04720 13368 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 13764 14282 gene locus_tag LOCUS_04730 13764 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 14511 14819 gene locus_tag LOCUS_04740 14511 14819 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_04740 14906 16426 gene locus_tag LOCUS_04750 14906 16426 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169689.1 protein_id gnl|my_center|LOCUS_04750 16993 16439 gene locus_tag LOCUS_04760 gene fldA 16993 16439 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501067.1 protein_id gnl|my_center|LOCUS_04760 17733 17314 gene locus_tag LOCUS_04770 17733 17314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04770 18112 17714 gene locus_tag LOCUS_04780 18112 17714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04780 18461 18240 gene locus_tag LOCUS_04790 18461 18240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 19746 18535 gene locus_tag LOCUS_04800 19746 18535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 21537 19909 gene locus_tag LOCUS_04810 21537 19909 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 protein_id gnl|my_center|LOCUS_04810 24614 21531 gene locus_tag LOCUS_04820 24614 21531 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455799.1 protein_id gnl|my_center|LOCUS_04820 25263 25958 gene locus_tag LOCUS_04830 25263 25958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 26338 26664 gene locus_tag LOCUS_04840 gene trxA 26338 26664 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280776.1 protein_id gnl|my_center|LOCUS_04840 26854 28110 gene locus_tag LOCUS_04850 gene rho 26854 28110 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_04850 28117 28944 gene locus_tag LOCUS_04860 28117 28944 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_04860 30911 29010 gene locus_tag LOCUS_04870 30911 29010 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929297.1 protein_id gnl|my_center|LOCUS_04870 31496 31843 gene locus_tag LOCUS_04880 31496 31843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 33176 31971 gene locus_tag LOCUS_04890 gene ubiH 33176 31971 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111201.1 protein_id gnl|my_center|LOCUS_04890 34486 33176 gene locus_tag LOCUS_04900 gene pepP 34486 33176 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_04900 35015 34497 gene locus_tag LOCUS_04910 35015 34497 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021494.1 protein_id gnl|my_center|LOCUS_04910 35156 35377 gene locus_tag LOCUS_04920 35156 35377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 35374 35673 gene locus_tag LOCUS_04930 35374 35673 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038364.1 protein_id gnl|my_center|LOCUS_04930 37342 35885 gene locus_tag LOCUS_04940 37342 35885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 37821 37495 gene locus_tag LOCUS_04950 37821 37495 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814240.1 protein_id gnl|my_center|LOCUS_04950 40857 37831 gene locus_tag LOCUS_04960 40857 37831 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202770.1 protein_id gnl|my_center|LOCUS_04960 42073 40922 gene locus_tag LOCUS_04970 42073 40922 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958004.1 protein_id gnl|my_center|LOCUS_04970 43485 42157 gene locus_tag LOCUS_04980 43485 42157 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence011 540 331 gene locus_tag LOCUS_04990 540 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1146 661 gene locus_tag LOCUS_05000 1146 661 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973028.1 protein_id gnl|my_center|LOCUS_05000 3357 1222 gene locus_tag LOCUS_05010 gene recQ 3357 1222 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_05010 3454 5040 gene locus_tag LOCUS_05020 gene gshA 3454 5040 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_05020 5061 5777 gene locus_tag LOCUS_05030 5061 5777 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617365.1 protein_id gnl|my_center|LOCUS_05030 8498 5922 gene locus_tag LOCUS_05040 gene clpB 8498 5922 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_05040 9629 9429 gene locus_tag LOCUS_05050 9629 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 11726 9660 gene locus_tag LOCUS_05060 gene metG 11726 9660 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 protein_id gnl|my_center|LOCUS_05060 11892 12983 gene locus_tag LOCUS_05070 gene apbC 11892 12983 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_05070 13101 13616 gene locus_tag LOCUS_05080 gene dcd 13101 13616 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037700.1 protein_id gnl|my_center|LOCUS_05080 13887 13645 gene locus_tag LOCUS_05090 13887 13645 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162995.1 protein_id gnl|my_center|LOCUS_05090 13973 14578 gene locus_tag LOCUS_05100 13973 14578 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331723.1 protein_id gnl|my_center|LOCUS_05100 14734 14898 gene locus_tag LOCUS_05110 14734 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 15291 16964 gene locus_tag LOCUS_05120 gene ggt 15291 16964 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 protein_id gnl|my_center|LOCUS_05120 16964 17644 gene locus_tag LOCUS_05130 16964 17644 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_05130 17979 17686 gene locus_tag LOCUS_05140 17979 17686 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_05140 19392 18004 gene locus_tag LOCUS_05150 gene argH 19392 18004 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_05150 20879 19587 gene locus_tag LOCUS_05160 20879 19587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 22090 21017 gene locus_tag LOCUS_05170 gene thrC 22090 21017 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048893.1 protein_id gnl|my_center|LOCUS_05170 23415 22099 gene locus_tag LOCUS_05180 23415 22099 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_05180 24675 23491 gene locus_tag LOCUS_05190 gene alaC 24675 23491 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_05190 25663 24869 gene locus_tag LOCUS_05200 gene kdsB 25663 24869 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011593.1 protein_id gnl|my_center|LOCUS_05200 25854 25660 gene locus_tag LOCUS_05210 25854 25660 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422539.1 protein_id gnl|my_center|LOCUS_05210 26843 25851 gene locus_tag LOCUS_05220 gene lpxK 26843 25851 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947544.1 protein_id gnl|my_center|LOCUS_05220 27274 26840 gene locus_tag LOCUS_05230 27274 26840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 27888 27274 gene locus_tag LOCUS_05240 27888 27274 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_05240 29011 27923 gene locus_tag LOCUS_05250 gene aroC 29011 27923 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918437.1 protein_id gnl|my_center|LOCUS_05250 29945 29013 gene locus_tag LOCUS_05260 gene prmB 29945 29013 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072977.1 protein_id gnl|my_center|LOCUS_05260 31642 30236 gene locus_tag LOCUS_05270 gene mucD 31642 30236 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_05270 32330 31746 gene locus_tag LOCUS_05280 32330 31746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 32931 32323 gene locus_tag LOCUS_05290 gene rpoE 32931 32323 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_05290 33099 34715 gene locus_tag LOCUS_05300 gene nadB 33099 34715 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209671.1 protein_id gnl|my_center|LOCUS_05300 35389 34805 gene locus_tag LOCUS_05310 35389 34805 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853249.1 protein_id gnl|my_center|LOCUS_05310 35745 35524 gene locus_tag LOCUS_05320 35745 35524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 36530 35745 gene locus_tag LOCUS_05330 36530 35745 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037280.1 protein_id gnl|my_center|LOCUS_05330 38314 36530 gene locus_tag LOCUS_05340 gene sdhA 38314 36530 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597170.1 protein_id gnl|my_center|LOCUS_05340 38698 38318 gene locus_tag LOCUS_05350 gene sdhD 38698 38318 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067168.1 protein_id gnl|my_center|LOCUS_05350 39089 38712 gene locus_tag LOCUS_05360 gene sdhC 39089 38712 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_05360 39641 39144 gene locus_tag LOCUS_05370 39641 39144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 40163 39960 gene locus_tag LOCUS_05380 40163 39960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 40411 40163 gene locus_tag LOCUS_05390 40411 40163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 40754 40545 gene locus_tag LOCUS_05400 40754 40545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 41156 42232 gene locus_tag LOCUS_05410 41156 42232 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_05410 42309 42512 gene locus_tag LOCUS_05420 42309 42512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 42787 43017 gene locus_tag LOCUS_05430 42787 43017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 43017 43412 gene locus_tag LOCUS_05440 gene vapC 43017 43412 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence012 720 1556 gene locus_tag LOCUS_05450 gene folP 720 1556 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_05450 2320 1757 gene locus_tag LOCUS_05460 2320 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 5030 2337 gene locus_tag LOCUS_05470 5030 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 5523 6161 gene locus_tag LOCUS_05480 5523 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 8101 6164 gene locus_tag LOCUS_05490 gene acs 8101 6164 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_05490 9589 8180 gene locus_tag LOCUS_05500 9589 8180 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945788.1 protein_id gnl|my_center|LOCUS_05500 9862 9653 gene locus_tag LOCUS_05510 9862 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 11268 9883 gene locus_tag LOCUS_05520 gene hemN 11268 9883 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_05520 12513 11269 gene locus_tag LOCUS_05530 gene ccmI 12513 11269 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_05530 12989 12516 gene locus_tag LOCUS_05540 12989 12516 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_05540 13519 12986 gene locus_tag LOCUS_05550 13519 12986 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_05550 15521 13575 gene locus_tag LOCUS_05560 15521 13575 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_05560 15966 15523 gene locus_tag LOCUS_05570 gene ccmE 15966 15523 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268403.1 protein_id gnl|my_center|LOCUS_05570 16125 15973 gene locus_tag LOCUS_05580 16125 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 16886 16122 gene locus_tag LOCUS_05590 gene ccmC 16886 16122 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036839.1 protein_id gnl|my_center|LOCUS_05590 17727 17005 gene locus_tag LOCUS_05600 17727 17005 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693159.1 protein_id gnl|my_center|LOCUS_05600 18724 17819 gene locus_tag LOCUS_05610 18724 17819 CDS product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 protein_id gnl|my_center|LOCUS_05610 19688 18780 gene locus_tag LOCUS_05620 19688 18780 CDS product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 protein_id gnl|my_center|LOCUS_05620 22403 19833 gene locus_tag LOCUS_05630 gene mutS 22403 19833 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707433.1 protein_id gnl|my_center|LOCUS_05630 22439 22918 gene locus_tag LOCUS_05640 gene pncC 22439 22918 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301974.1 protein_id gnl|my_center|LOCUS_05640 23143 22931 gene locus_tag LOCUS_05650 23143 22931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 23295 23723 gene locus_tag LOCUS_05660 23295 23723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 24028 24114 gene locus_tag LOCUS_t00020 24028 24114 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24645 24337 gene locus_tag LOCUS_05670 24645 24337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 25030 24773 gene locus_tag LOCUS_05680 25030 24773 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_05680 25202 25014 gene locus_tag LOCUS_05690 25202 25014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 25636 25214 gene locus_tag LOCUS_05700 25636 25214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 26341 26802 gene locus_tag LOCUS_05710 26341 26802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 26815 27747 gene locus_tag LOCUS_05720 26815 27747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 30601 27785 gene locus_tag LOCUS_05730 gene uvrA 30601 27785 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490537.1 protein_id gnl|my_center|LOCUS_05730 31301 32044 gene locus_tag LOCUS_05740 31301 32044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 32079 35480 gene locus_tag LOCUS_05750 32079 35480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 35936 35511 gene locus_tag LOCUS_05760 35936 35511 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546565.1 protein_id gnl|my_center|LOCUS_05760 36890 36003 gene locus_tag LOCUS_05770 gene sucD 36890 36003 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329405.1 protein_id gnl|my_center|LOCUS_05770 38084 36891 gene locus_tag LOCUS_05780 38084 36891 CDS product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 protein_id gnl|my_center|LOCUS_05780 39122 38172 gene locus_tag LOCUS_05790 39122 38172 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_05790 39397 40563 gene locus_tag LOCUS_05800 39397 40563 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243814.1 protein_id gnl|my_center|LOCUS_05800 40648 41619 gene locus_tag LOCUS_05810 40648 41619 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969966.1 protein_id gnl|my_center|LOCUS_05810 41860 41936 gene locus_tag LOCUS_t00030 41860 41936 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42029 43318 gene locus_tag LOCUS_05820 42029 43318 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence013 416 90 gene locus_tag LOCUS_05830 416 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 660 1535 gene locus_tag LOCUS_05840 660 1535 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827560.1 protein_id gnl|my_center|LOCUS_05840 1628 2143 gene locus_tag LOCUS_05850 gene fae 1628 2143 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532036.1 protein_id gnl|my_center|LOCUS_05850 2897 2220 gene locus_tag LOCUS_05860 2897 2220 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827384.1 protein_id gnl|my_center|LOCUS_05860 2939 3949 gene locus_tag LOCUS_05870 2939 3949 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 protein_id gnl|my_center|LOCUS_05870 3933 5003 gene locus_tag LOCUS_05880 3933 5003 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532038.1 protein_id gnl|my_center|LOCUS_05880 5015 6175 gene locus_tag LOCUS_05890 5015 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 6339 6812 gene locus_tag LOCUS_05900 6339 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 6899 7117 gene locus_tag LOCUS_05910 6899 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7114 7383 gene locus_tag LOCUS_05920 7114 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 8392 7541 gene locus_tag LOCUS_05930 gene mepA 8392 7541 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483061.1 protein_id gnl|my_center|LOCUS_05930 9107 8718 gene locus_tag LOCUS_05940 9107 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 9418 10533 gene locus_tag LOCUS_05950 gene tgt 9418 10533 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420264.1 protein_id gnl|my_center|LOCUS_05950 10588 10941 gene locus_tag LOCUS_05960 gene yajC 10588 10941 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947718.1 protein_id gnl|my_center|LOCUS_05960 11012 12859 gene locus_tag LOCUS_05970 gene secD 11012 12859 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_05970 12914 13840 gene locus_tag LOCUS_05980 gene secF 12914 13840 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 protein_id gnl|my_center|LOCUS_05980 13939 14370 gene locus_tag LOCUS_05990 gene ndk 13939 14370 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072285.1 protein_id gnl|my_center|LOCUS_05990 14354 15457 gene locus_tag LOCUS_06000 14354 15457 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_06000 15447 16223 gene locus_tag LOCUS_06010 15447 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 16242 17525 gene locus_tag LOCUS_06020 gene hisS 16242 17525 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417932.1 protein_id gnl|my_center|LOCUS_06020 17585 18247 gene locus_tag LOCUS_06030 17585 18247 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_06030 18247 19452 gene locus_tag LOCUS_06040 gene bamB 18247 19452 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771013.1 protein_id gnl|my_center|LOCUS_06040 19457 20857 gene locus_tag LOCUS_06050 gene der 19457 20857 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249413.1 protein_id gnl|my_center|LOCUS_06050 20929 21423 gene locus_tag LOCUS_06060 gene tpx 20929 21423 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195100.1 protein_id gnl|my_center|LOCUS_06060 21586 21819 gene locus_tag LOCUS_06070 21586 21819 CDS product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148780.1 protein_id gnl|my_center|LOCUS_06070 21950 23746 gene locus_tag LOCUS_06080 gene oadA 21950 23746 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_06080 23773 24900 gene locus_tag LOCUS_06090 23773 24900 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_06090 25004 25444 gene locus_tag LOCUS_06100 25004 25444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 25775 26797 gene locus_tag LOCUS_06110 25775 26797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 26801 28948 gene locus_tag LOCUS_06120 26801 28948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 29066 30064 gene locus_tag LOCUS_06130 29066 30064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 30061 30639 gene locus_tag LOCUS_06140 30061 30639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 30644 32035 gene locus_tag LOCUS_06150 30644 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 32864 32106 gene locus_tag LOCUS_06160 32864 32106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 33091 34137 gene locus_tag LOCUS_06170 33091 34137 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142183.1 protein_id gnl|my_center|LOCUS_06170 34272 35378 gene locus_tag LOCUS_06180 34272 35378 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388761.1 protein_id gnl|my_center|LOCUS_06180 35837 36001 gene locus_tag LOCUS_06190 35837 36001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 35998 37644 gene locus_tag LOCUS_06200 35998 37644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 37610 38779 gene locus_tag LOCUS_06210 37610 38779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 38834 40237 gene locus_tag LOCUS_06220 38834 40237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 41516 40302 gene locus_tag LOCUS_06230 41516 40302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 42431 43048 gene locus_tag LOCUS_06240 42431 43048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence014 1390 263 gene locus_tag LOCUS_06250 gene pqqE 1390 263 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269165.1 protein_id gnl|my_center|LOCUS_06250 1640 1368 gene locus_tag LOCUS_06260 gene pqqD 1640 1368 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366526.1 protein_id gnl|my_center|LOCUS_06260 2379 1750 gene locus_tag LOCUS_06270 2379 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3406 2363 gene locus_tag LOCUS_06280 3406 2363 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035321.1 protein_id gnl|my_center|LOCUS_06280 3947 3480 gene locus_tag LOCUS_06290 3947 3480 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043551827.1 protein_id gnl|my_center|LOCUS_06290 4713 3982 gene locus_tag LOCUS_06300 gene pqqC 4713 3982 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111679.1 protein_id gnl|my_center|LOCUS_06300 5687 4776 gene locus_tag LOCUS_06310 gene pqqB 5687 4776 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113495.1 protein_id gnl|my_center|LOCUS_06310 6632 6339 gene locus_tag LOCUS_06320 6632 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 7125 7874 gene locus_tag LOCUS_06330 7125 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 8398 9033 gene locus_tag LOCUS_06340 8398 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 9104 9772 gene locus_tag LOCUS_06350 9104 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 11130 9937 gene locus_tag LOCUS_06360 11130 9937 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462412.1 protein_id gnl|my_center|LOCUS_06360 12539 11214 gene locus_tag LOCUS_06370 12539 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 13027 13647 gene locus_tag LOCUS_06380 13027 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 14100 13657 gene locus_tag LOCUS_06390 14100 13657 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378068.1 protein_id gnl|my_center|LOCUS_06390 14209 17700 gene locus_tag LOCUS_06400 gene dnaE 14209 17700 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 protein_id gnl|my_center|LOCUS_06400 20273 17745 gene locus_tag LOCUS_06410 20273 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 20768 21724 gene locus_tag LOCUS_06420 gene rluC 20768 21724 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210927.1 protein_id gnl|my_center|LOCUS_06420 21708 22355 gene locus_tag LOCUS_06430 21708 22355 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_06430 22368 23345 gene locus_tag LOCUS_06440 gene sppA 22368 23345 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_06440 23564 23737 gene locus_tag LOCUS_06450 23564 23737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 23764 24585 gene locus_tag LOCUS_06460 gene aat 23764 24585 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_06460 24687 24529 gene locus_tag LOCUS_06470 24687 24529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 24705 25286 gene locus_tag LOCUS_06480 24705 25286 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_06480 25369 25587 gene locus_tag LOCUS_06490 gene infA 25369 25587 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 protein_id gnl|my_center|LOCUS_06490 27916 25646 gene locus_tag LOCUS_06500 gene clpA 27916 25646 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_06500 28253 27930 gene locus_tag LOCUS_06510 gene clpS 28253 27930 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 protein_id gnl|my_center|LOCUS_06510 28468 28929 gene locus_tag LOCUS_06520 28468 28929 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_06520 28922 30025 gene locus_tag LOCUS_06530 gene mnmA 28922 30025 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005022119.1 protein_id gnl|my_center|LOCUS_06530 30060 31424 gene locus_tag LOCUS_06540 gene purB 30060 31424 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371741.1 protein_id gnl|my_center|LOCUS_06540 33728 31488 gene locus_tag LOCUS_06550 gene parC 33728 31488 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102510.1 protein_id gnl|my_center|LOCUS_06550 34226 33729 gene locus_tag LOCUS_06560 34226 33729 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 protein_id gnl|my_center|LOCUS_06560 34701 34360 gene locus_tag LOCUS_06570 gene rplS 34701 34360 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065250.1 protein_id gnl|my_center|LOCUS_06570 35451 34711 gene locus_tag LOCUS_06580 gene trmD 35451 34711 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552523.1 protein_id gnl|my_center|LOCUS_06580 35966 35460 gene locus_tag LOCUS_06590 gene rimM 35966 35460 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071567.1 protein_id gnl|my_center|LOCUS_06590 36222 35971 gene locus_tag LOCUS_06600 gene rpsP 36222 35971 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071566.1 protein_id gnl|my_center|LOCUS_06600 37715 36360 gene locus_tag LOCUS_06610 gene ffh 37715 36360 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462720.1 protein_id gnl|my_center|LOCUS_06610 37903 38715 gene locus_tag LOCUS_06620 37903 38715 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_06620 38788 41100 gene locus_tag LOCUS_06630 38788 41100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence015 1763 318 gene locus_tag LOCUS_06640 1763 318 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111195.1 protein_id gnl|my_center|LOCUS_06640 3528 1801 gene locus_tag LOCUS_06650 3528 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 3811 3984 gene locus_tag LOCUS_06660 3811 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5478 4069 gene locus_tag LOCUS_06670 gene glnA 5478 4069 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 protein_id gnl|my_center|LOCUS_06670 5933 7276 gene locus_tag LOCUS_06680 5933 7276 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 protein_id gnl|my_center|LOCUS_06680 7544 9718 gene locus_tag LOCUS_06690 7544 9718 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_06690 11731 10322 gene locus_tag LOCUS_06700 11731 10322 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086024044.1 protein_id gnl|my_center|LOCUS_06700 12068 12529 gene locus_tag LOCUS_06710 12068 12529 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_06710 12630 14669 gene locus_tag LOCUS_06720 gene prlC 12630 14669 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_06720 14666 16126 gene locus_tag LOCUS_06730 gene ubiD 14666 16126 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768425.1 protein_id gnl|my_center|LOCUS_06730 16948 16625 gene locus_tag LOCUS_06740 gene iscA 16948 16625 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417916.1 protein_id gnl|my_center|LOCUS_06740 18067 16958 gene locus_tag LOCUS_06750 gene nifS 18067 16958 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_06750 18572 18081 gene locus_tag LOCUS_06760 gene iscR 18572 18081 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_06760 19368 18637 gene locus_tag LOCUS_06770 gene trmJ 19368 18637 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771034.1 protein_id gnl|my_center|LOCUS_06770 19455 20249 gene locus_tag LOCUS_06780 19455 20249 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_06780 20341 20532 gene locus_tag LOCUS_06790 20341 20532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 20924 21448 gene locus_tag LOCUS_06800 20924 21448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 21764 22591 gene locus_tag LOCUS_06810 21764 22591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 22635 23420 gene locus_tag LOCUS_06820 22635 23420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 23807 24286 gene locus_tag LOCUS_06830 gene bfr 23807 24286 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_06830 24303 24785 gene locus_tag LOCUS_06840 gene bfr 24303 24785 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 protein_id gnl|my_center|LOCUS_06840 24895 25092 gene locus_tag LOCUS_06850 24895 25092 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070919.1 protein_id gnl|my_center|LOCUS_06850 25409 25921 gene locus_tag LOCUS_06860 25409 25921 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114194.1 protein_id gnl|my_center|LOCUS_06860 27157 25961 gene locus_tag LOCUS_06870 27157 25961 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207588.1 protein_id gnl|my_center|LOCUS_06870 27357 27500 gene locus_tag LOCUS_06880 27357 27500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 28358 27582 gene locus_tag LOCUS_06890 28358 27582 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061142.1 protein_id gnl|my_center|LOCUS_06890 28617 29540 gene locus_tag LOCUS_06900 28617 29540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 29533 29826 gene locus_tag LOCUS_06910 29533 29826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 31656 29926 gene locus_tag LOCUS_06920 31656 29926 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172599.1 protein_id gnl|my_center|LOCUS_06920 32128 32466 gene locus_tag LOCUS_06930 32128 32466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 32611 32535 gene locus_tag LOCUS_t00040 32611 32535 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32744 32669 gene locus_tag LOCUS_t00050 32744 32669 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 32835 32759 gene locus_tag LOCUS_t00060 32835 32759 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33003 32912 gene locus_tag LOCUS_t00070 33003 32912 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33204 33013 gene locus_tag LOCUS_06940 gene csrA 33204 33013 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006082602.1 protein_id gnl|my_center|LOCUS_06940 34663 33314 gene locus_tag LOCUS_06950 34663 33314 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958494.1 protein_id gnl|my_center|LOCUS_06950 35640 34663 gene locus_tag LOCUS_06960 35640 34663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_06960 37724 35637 gene locus_tag LOCUS_06970 37724 35637 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_06970 39830 37959 gene locus_tag LOCUS_06980 gene ppiD 39830 37959 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 protein_id gnl|my_center|LOCUS_06980 39981 39905 gene locus_tag LOCUS_t00080 39981 39905 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 40063 39988 gene locus_tag LOCUS_t00090 40063 39988 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence016 345 1418 gene locus_tag LOCUS_06990 345 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 1460 1618 gene locus_tag LOCUS_07000 1460 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 1705 3003 gene locus_tag LOCUS_07010 1705 3003 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_07010 5754 3007 gene locus_tag LOCUS_07020 gene ppdK 5754 3007 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460835.1 protein_id gnl|my_center|LOCUS_07020 8076 5779 gene locus_tag LOCUS_07030 8076 5779 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_07030 8082 8261 gene locus_tag LOCUS_07040 8082 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 8290 9243 gene locus_tag LOCUS_07050 gene trxB 8290 9243 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941156.1 protein_id gnl|my_center|LOCUS_07050 10254 9331 gene locus_tag LOCUS_07060 10254 9331 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093339.1 protein_id gnl|my_center|LOCUS_07060 10719 10306 gene locus_tag LOCUS_07070 10719 10306 CDS product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_07070 12510 10843 gene locus_tag LOCUS_07080 gene glnS 12510 10843 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287115.1 protein_id gnl|my_center|LOCUS_07080 12827 12597 gene locus_tag LOCUS_07090 12827 12597 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_07090 12904 14298 gene locus_tag LOCUS_07100 gene cysG 12904 14298 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_07100 15105 16457 gene locus_tag LOCUS_07110 gene miaB 15105 16457 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947064.1 protein_id gnl|my_center|LOCUS_07110 16467 17450 gene locus_tag LOCUS_07120 16467 17450 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_07120 17447 17908 gene locus_tag LOCUS_07130 gene ybeY 17447 17908 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158419.1 protein_id gnl|my_center|LOCUS_07130 17905 18747 gene locus_tag LOCUS_07140 gene corC 17905 18747 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071409.1 protein_id gnl|my_center|LOCUS_07140 18760 19809 gene locus_tag LOCUS_07150 gene galE 18760 19809 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_07150 19825 20547 gene locus_tag LOCUS_07160 gene dnaQ 19825 20547 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262413.1 protein_id gnl|my_center|LOCUS_07160 22429 20624 gene locus_tag LOCUS_07170 22429 20624 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926891.1 protein_id gnl|my_center|LOCUS_07170 22751 23629 gene locus_tag LOCUS_07180 gene dapA 22751 23629 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_07180 23680 24414 gene locus_tag LOCUS_07190 23680 24414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 24442 28344 gene locus_tag LOCUS_07200 gene purL 24442 28344 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266924.1 protein_id gnl|my_center|LOCUS_07200 28450 28836 gene locus_tag LOCUS_07210 28450 28836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 28877 29257 gene locus_tag LOCUS_07220 28877 29257 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_07220 29715 29278 gene locus_tag LOCUS_07230 gene rnhA 29715 29278 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087954.1 protein_id gnl|my_center|LOCUS_07230 30424 29708 gene locus_tag LOCUS_07240 30424 29708 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481108.1 protein_id gnl|my_center|LOCUS_07240 30525 32216 gene locus_tag LOCUS_07250 30525 32216 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705461.1 protein_id gnl|my_center|LOCUS_07250 32453 33940 gene locus_tag LOCUS_07260 32453 33940 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_07260 33933 34367 gene locus_tag LOCUS_07270 33933 34367 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948332.1 protein_id gnl|my_center|LOCUS_07270 34430 37240 gene locus_tag LOCUS_07280 34430 37240 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103493.1 protein_id gnl|my_center|LOCUS_07280 37403 39121 gene locus_tag LOCUS_07290 gene pilB 37403 39121 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence017 1008 682 gene locus_tag LOCUS_07300 1008 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1349 1005 gene locus_tag LOCUS_07310 1349 1005 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_07310 1593 1976 gene locus_tag LOCUS_07320 1593 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2488 2003 gene locus_tag LOCUS_07330 2488 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3925 2507 gene locus_tag LOCUS_07340 gene nhaD 3925 2507 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_07340 4773 4543 gene locus_tag LOCUS_07350 4773 4543 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_07350 7644 4921 gene locus_tag LOCUS_07360 gene secA 7644 4921 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 protein_id gnl|my_center|LOCUS_07360 7935 10508 gene locus_tag LOCUS_07370 7935 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 10505 12406 gene locus_tag LOCUS_07380 10505 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 12544 13029 gene locus_tag LOCUS_07390 12544 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 13556 13251 gene locus_tag LOCUS_07400 13556 13251 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_07400 15282 13621 gene locus_tag LOCUS_07410 gene rpsA 15282 13621 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_07410 16035 15379 gene locus_tag LOCUS_07420 gene cmk 16035 15379 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 protein_id gnl|my_center|LOCUS_07420 18230 16035 gene locus_tag LOCUS_07430 18230 16035 CDS product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 protein_id gnl|my_center|LOCUS_07430 19359 18223 gene locus_tag LOCUS_07440 gene hisC 19359 18223 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_07440 20488 19403 gene locus_tag LOCUS_07450 gene pheA 20488 19403 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_07450 21597 20518 gene locus_tag LOCUS_07460 gene serC 21597 20518 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207406.1 protein_id gnl|my_center|LOCUS_07460 24311 21678 gene locus_tag LOCUS_07470 gene gyrA 24311 21678 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_07470 25213 24488 gene locus_tag LOCUS_07480 25213 24488 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_07480 25726 25223 gene locus_tag LOCUS_07490 25726 25223 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_07490 27058 25757 gene locus_tag LOCUS_07500 27058 25757 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_07500 28261 27071 gene locus_tag LOCUS_07510 28261 27071 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763027.1 protein_id gnl|my_center|LOCUS_07510 29242 28388 gene locus_tag LOCUS_07520 gene hflC 29242 28388 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763025.1 protein_id gnl|my_center|LOCUS_07520 30489 29239 gene locus_tag LOCUS_07530 gene hflK 30489 29239 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_07530 31893 30625 gene locus_tag LOCUS_07540 gene hflX 31893 30625 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957944.1 protein_id gnl|my_center|LOCUS_07540 32180 31941 gene locus_tag LOCUS_07550 32180 31941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 32759 32307 gene locus_tag LOCUS_07560 32759 32307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 33547 32963 gene locus_tag LOCUS_07570 33547 32963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 33794 34042 gene locus_tag LOCUS_07580 33794 34042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 34712 34419 gene locus_tag LOCUS_07590 34712 34419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 36135 34831 gene locus_tag LOCUS_07600 36135 34831 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_07600 37748 36834 gene locus_tag LOCUS_07610 37748 36834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence018 362 105 gene locus_tag LOCUS_07620 362 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 860 1912 gene locus_tag LOCUS_07630 gene dprA 860 1912 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948297.1 protein_id gnl|my_center|LOCUS_07630 1934 2401 gene locus_tag LOCUS_07640 1934 2401 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_07640 2480 4831 gene locus_tag LOCUS_07650 gene topA 2480 4831 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958589.1 protein_id gnl|my_center|LOCUS_07650 5270 4818 gene locus_tag LOCUS_07660 5270 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 6190 5420 gene locus_tag LOCUS_07670 gene lpxA 6190 5420 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071796.1 protein_id gnl|my_center|LOCUS_07670 6636 6193 gene locus_tag LOCUS_07680 gene fabZ 6636 6193 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_07680 7254 6751 gene locus_tag LOCUS_07690 7254 6751 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545058.1 protein_id gnl|my_center|LOCUS_07690 9692 7356 gene locus_tag LOCUS_07700 gene bamA 9692 7356 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_07700 10752 9772 gene locus_tag LOCUS_07710 gene epmA 10752 9772 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770152.1 protein_id gnl|my_center|LOCUS_07710 11321 10752 gene locus_tag LOCUS_07720 gene efp 11321 10752 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_07720 11406 12416 gene locus_tag LOCUS_07730 gene epmB 11406 12416 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_07730 12947 12477 gene locus_tag LOCUS_07740 12947 12477 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 protein_id gnl|my_center|LOCUS_07740 13184 13873 gene locus_tag LOCUS_07750 13184 13873 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_07750 13945 16626 gene locus_tag LOCUS_07760 13945 16626 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 protein_id gnl|my_center|LOCUS_07760 16678 17067 gene locus_tag LOCUS_07770 16678 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 19702 17186 gene locus_tag LOCUS_07780 19702 17186 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_07780 21442 19790 gene locus_tag LOCUS_07790 gene gpmI 21442 19790 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_07790 21698 21904 gene locus_tag LOCUS_07800 21698 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 23001 21994 gene locus_tag LOCUS_07810 gene mltB 23001 21994 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 protein_id gnl|my_center|LOCUS_07810 24125 23001 gene locus_tag LOCUS_07820 gene rodA 24125 23001 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 protein_id gnl|my_center|LOCUS_07820 25959 24115 gene locus_tag LOCUS_07830 gene mrdA 25959 24115 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_07830 26463 25975 gene locus_tag LOCUS_07840 gene mreD 26463 25975 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073800.1 protein_id gnl|my_center|LOCUS_07840 27214 26450 gene locus_tag LOCUS_07850 27214 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 28438 27392 gene locus_tag LOCUS_07860 28438 27392 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473772.1 protein_id gnl|my_center|LOCUS_07860 28784 29071 gene locus_tag LOCUS_07870 gene gatC 28784 29071 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_07870 29086 30537 gene locus_tag LOCUS_07880 gene gatA 29086 30537 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091960758.1 protein_id gnl|my_center|LOCUS_07880 30548 31981 gene locus_tag LOCUS_07890 gene gatB 30548 31981 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958250.1 protein_id gnl|my_center|LOCUS_07890 33468 32071 gene locus_tag LOCUS_07900 gene amt 33468 32071 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_07900 33825 33487 gene locus_tag LOCUS_07910 gene glnK 33825 33487 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_07910 35600 34179 gene locus_tag LOCUS_07920 gene ntrC 35600 34179 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_07920 36642 35593 gene locus_tag LOCUS_07930 gene ntrB 36642 35593 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_07930 36820 36999 gene locus_tag LOCUS_07940 36820 36999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence019 68 1009 gene locus_tag LOCUS_07950 gene ribF 68 1009 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 protein_id gnl|my_center|LOCUS_07950 1006 3825 gene locus_tag LOCUS_07960 gene ileS 1006 3825 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 protein_id gnl|my_center|LOCUS_07960 3818 4309 gene locus_tag LOCUS_07970 gene lspA 3818 4309 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_07970 4933 4403 gene locus_tag LOCUS_07980 gene ampD 4933 4403 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923721.1 protein_id gnl|my_center|LOCUS_07980 5274 7661 gene locus_tag LOCUS_07990 5274 7661 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 protein_id gnl|my_center|LOCUS_07990 8250 7669 gene locus_tag LOCUS_08000 8250 7669 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_08000 10010 8250 gene locus_tag LOCUS_08010 gene argS 10010 8250 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_08010 12302 10089 gene locus_tag LOCUS_08020 12302 10089 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266372.1 protein_id gnl|my_center|LOCUS_08020 14026 13133 gene locus_tag LOCUS_08030 14026 13133 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_08030 14144 14776 gene locus_tag LOCUS_08040 gene nth 14144 14776 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164815.1 protein_id gnl|my_center|LOCUS_08040 14896 14747 gene locus_tag LOCUS_08050 14896 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 14946 15389 gene locus_tag LOCUS_08060 14946 15389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091625.1 protein_id gnl|my_center|LOCUS_08060 15469 16320 gene locus_tag LOCUS_08070 15469 16320 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 protein_id gnl|my_center|LOCUS_08070 16313 17071 gene locus_tag LOCUS_08080 16313 17071 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_08080 17808 17233 gene locus_tag LOCUS_08090 17808 17233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 17954 18451 gene locus_tag LOCUS_08100 gene purE 17954 18451 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_08100 18448 19542 gene locus_tag LOCUS_08110 18448 19542 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105529.1 protein_id gnl|my_center|LOCUS_08110 19570 20355 gene locus_tag LOCUS_08120 gene cmoA 19570 20355 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_08120 20932 20429 gene locus_tag LOCUS_08130 20932 20429 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 protein_id gnl|my_center|LOCUS_08130 21489 21103 gene locus_tag LOCUS_08140 21489 21103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 21916 22185 gene locus_tag LOCUS_08150 21916 22185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 22399 23373 gene locus_tag LOCUS_08160 22399 23373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 23376 24365 gene locus_tag LOCUS_08170 23376 24365 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706078.1 protein_id gnl|my_center|LOCUS_08170 24370 25395 gene locus_tag LOCUS_08180 24370 25395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 25588 28392 gene locus_tag LOCUS_08190 gene glnE 25588 28392 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266458.1 protein_id gnl|my_center|LOCUS_08190 28507 29295 gene locus_tag LOCUS_08200 gene lgt 28507 29295 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_08200 29314 30147 gene locus_tag LOCUS_08210 gene thyA 29314 30147 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369929.1 protein_id gnl|my_center|LOCUS_08210 30211 30828 gene locus_tag LOCUS_08220 30211 30828 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872152.1 protein_id gnl|my_center|LOCUS_08220 33621 30859 gene locus_tag LOCUS_08230 33621 30859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 34053 35378 gene locus_tag LOCUS_08240 34053 35378 CDS product selenium-binding protein SBP56-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728146.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence020 1499 276 gene locus_tag LOCUS_08250 1499 276 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_08250 1816 1496 gene locus_tag LOCUS_08260 1816 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2116 2394 gene locus_tag LOCUS_08270 2116 2394 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_08270 2407 2691 gene locus_tag LOCUS_08280 2407 2691 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_08280 2750 3037 gene locus_tag LOCUS_08290 2750 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 3040 4431 gene locus_tag LOCUS_08300 gene chrA 3040 4431 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_08300 4793 5932 gene locus_tag LOCUS_08310 4793 5932 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_08310 5984 9136 gene locus_tag LOCUS_08320 5984 9136 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_08320 9129 10559 gene locus_tag LOCUS_08330 9129 10559 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_08330 11536 10751 gene locus_tag LOCUS_08340 gene lpxA 11536 10751 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087617.1 protein_id gnl|my_center|LOCUS_08340 12426 11542 gene locus_tag LOCUS_08350 gene xerD 12426 11542 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071230.1 protein_id gnl|my_center|LOCUS_08350 13017 12427 gene locus_tag LOCUS_08360 13017 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 13378 13127 gene locus_tag LOCUS_08370 13378 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 13548 14819 gene locus_tag LOCUS_08380 13548 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 14882 15985 gene locus_tag LOCUS_08390 14882 15985 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_08390 15990 17156 gene locus_tag LOCUS_08400 15990 17156 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_08400 19386 17311 gene locus_tag LOCUS_08410 gene pnp 19386 17311 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037640.1 protein_id gnl|my_center|LOCUS_08410 19905 19636 gene locus_tag LOCUS_08420 gene rpsO 19905 19636 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 protein_id gnl|my_center|LOCUS_08420 20977 20024 gene locus_tag LOCUS_08430 gene truB 20977 20024 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124044.1 protein_id gnl|my_center|LOCUS_08430 21348 20974 gene locus_tag LOCUS_08440 gene rbfA 21348 20974 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456060.1 protein_id gnl|my_center|LOCUS_08440 24085 21353 gene locus_tag LOCUS_08450 gene infB 24085 21353 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948462.1 protein_id gnl|my_center|LOCUS_08450 25615 24116 gene locus_tag LOCUS_08460 gene nusA 25615 24116 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340582.1 protein_id gnl|my_center|LOCUS_08460 26090 25605 gene locus_tag LOCUS_08470 gene rimP 26090 25605 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004411704.1 protein_id gnl|my_center|LOCUS_08470 26292 26216 gene locus_tag LOCUS_t00100 26292 26216 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26660 26463 gene locus_tag LOCUS_08480 26660 26463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 28043 26814 gene locus_tag LOCUS_08490 28043 26814 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731386.1 protein_id gnl|my_center|LOCUS_08490 30671 28059 gene locus_tag LOCUS_08500 gene alaS 30671 28059 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103723.1 protein_id gnl|my_center|LOCUS_08500 31190 30711 gene locus_tag LOCUS_08510 31190 30711 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957973.1 protein_id gnl|my_center|LOCUS_08510 32259 31219 gene locus_tag LOCUS_08520 gene recA 32259 31219 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_08520 32999 32346 gene locus_tag LOCUS_08530 32999 32346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 33683 33189 gene locus_tag LOCUS_08540 gene ssb 33683 33189 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_08540 35061 33883 gene locus_tag LOCUS_08550 35061 33883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence021 301 11 gene locus_tag LOCUS_08560 301 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 547 1023 gene locus_tag LOCUS_08570 547 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1321 1232 gene locus_tag LOCUS_t00110 1321 1232 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1761 1411 gene locus_tag LOCUS_08580 1761 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 2406 1837 gene locus_tag LOCUS_08590 2406 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038180.1 protein_id gnl|my_center|LOCUS_08590 4398 2491 gene locus_tag LOCUS_08600 4398 2491 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_08600 5654 4788 gene locus_tag LOCUS_08610 5654 4788 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351062.1 protein_id gnl|my_center|LOCUS_08610 6244 5651 gene locus_tag LOCUS_08620 6244 5651 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_08620 6711 7514 gene locus_tag LOCUS_08630 6711 7514 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_08630 7511 8686 gene locus_tag LOCUS_08640 7511 8686 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072738.1 protein_id gnl|my_center|LOCUS_08640 9134 10639 gene locus_tag LOCUS_08650 gene nifB 9134 10639 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_08650 10748 11026 gene locus_tag LOCUS_08660 10748 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 11042 11464 gene locus_tag LOCUS_08670 11042 11464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 protein_id gnl|my_center|LOCUS_08670 11457 12737 gene locus_tag LOCUS_08680 11457 12737 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140334.1 protein_id gnl|my_center|LOCUS_08680 12765 13052 gene locus_tag LOCUS_08690 gene fdxC 12765 13052 CDS product ferredoxin FdxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 protein_id gnl|my_center|LOCUS_08690 13099 13452 gene locus_tag LOCUS_08700 13099 13452 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389669.1 protein_id gnl|my_center|LOCUS_08700 13455 14030 gene locus_tag LOCUS_08710 13455 14030 CDS product nitrogen fixation protein NifQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565963.1 protein_id gnl|my_center|LOCUS_08710 14826 14530 gene locus_tag LOCUS_08720 14826 14530 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_08720 15076 14789 gene locus_tag LOCUS_08730 15076 14789 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613797.1 protein_id gnl|my_center|LOCUS_08730 15815 17044 gene locus_tag LOCUS_08740 15815 17044 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_08740 17180 19537 gene locus_tag LOCUS_08750 17180 19537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 19707 20636 gene locus_tag LOCUS_08760 19707 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 21772 20708 gene locus_tag LOCUS_08770 gene lptG 21772 20708 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406700.1 protein_id gnl|my_center|LOCUS_08770 22909 21773 gene locus_tag LOCUS_08780 gene lptF 22909 21773 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 protein_id gnl|my_center|LOCUS_08780 23408 23211 gene locus_tag LOCUS_08790 23408 23211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 23377 24894 gene locus_tag LOCUS_08800 23377 24894 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 protein_id gnl|my_center|LOCUS_08800 24966 27092 gene locus_tag LOCUS_08810 gene hyfB 24966 27092 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_08810 27199 28143 gene locus_tag LOCUS_08820 27199 28143 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_08820 28143 28820 gene locus_tag LOCUS_08830 28143 28820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_08830 28817 30280 gene locus_tag LOCUS_08840 28817 30280 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_08840 30277 31863 gene locus_tag LOCUS_08850 30277 31863 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089083.1 protein_id gnl|my_center|LOCUS_08850 31873 32397 gene locus_tag LOCUS_08860 31873 32397 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_08860 32445 33386 gene locus_tag LOCUS_08870 32445 33386 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_08870 33398 33589 gene locus_tag LOCUS_08880 33398 33589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 33745 34548 gene locus_tag LOCUS_08890 33745 34548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence022 1470 460 gene locus_tag LOCUS_08900 gene waaF 1470 460 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 protein_id gnl|my_center|LOCUS_08900 2420 1491 gene locus_tag LOCUS_08910 gene ilvE 2420 1491 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_08910 2718 3899 gene locus_tag LOCUS_08920 2718 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 5836 4028 gene locus_tag LOCUS_08930 5836 4028 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228281.1 protein_id gnl|my_center|LOCUS_08930 6217 6068 gene locus_tag LOCUS_08940 6217 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6466 6741 gene locus_tag LOCUS_08950 6466 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 6760 7173 gene locus_tag LOCUS_08960 6760 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 7465 7262 gene locus_tag LOCUS_08970 gene cspC 7465 7262 CDS product cold shock-like protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874276.1 protein_id gnl|my_center|LOCUS_08970 8006 7596 gene locus_tag LOCUS_08980 8006 7596 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_08980 8353 8003 gene locus_tag LOCUS_08990 8353 8003 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_08990 9141 8362 gene locus_tag LOCUS_09000 9141 8362 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_09000 9866 9138 gene locus_tag LOCUS_09010 9866 9138 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_09010 10263 11147 gene locus_tag LOCUS_09020 10263 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 11292 12404 gene locus_tag LOCUS_09030 gene ald 11292 12404 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_09030 12737 13078 gene locus_tag LOCUS_09040 12737 13078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 13109 13300 gene locus_tag LOCUS_09050 13109 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 15226 13349 gene locus_tag LOCUS_09060 15226 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 16390 15368 gene locus_tag LOCUS_09070 gene gatD 16390 15368 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869512.1 protein_id gnl|my_center|LOCUS_09070 16521 16961 gene locus_tag LOCUS_09080 gene folA 16521 16961 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_09080 17051 18136 gene locus_tag LOCUS_09090 gene aroG 17051 18136 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109233.1 protein_id gnl|my_center|LOCUS_09090 18136 19113 gene locus_tag LOCUS_09100 18136 19113 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_09100 19119 19808 gene locus_tag LOCUS_09110 gene trmB 19119 19808 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173629.1 protein_id gnl|my_center|LOCUS_09110 20946 19828 gene locus_tag LOCUS_09120 20946 19828 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901552.1 protein_id gnl|my_center|LOCUS_09120 22666 20972 gene locus_tag LOCUS_09130 22666 20972 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083348.1 protein_id gnl|my_center|LOCUS_09130 23052 22762 gene locus_tag LOCUS_09140 23052 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947734.1 protein_id gnl|my_center|LOCUS_09140 24139 23180 gene locus_tag LOCUS_09150 24139 23180 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087474.1 protein_id gnl|my_center|LOCUS_09150 24713 24150 gene locus_tag LOCUS_09160 24713 24150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 25130 25960 gene locus_tag LOCUS_09170 25130 25960 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_09170 27715 26081 gene locus_tag LOCUS_09180 gene pgi 27715 26081 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789981.1 protein_id gnl|my_center|LOCUS_09180 27997 28611 gene locus_tag LOCUS_09190 27997 28611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 28804 29715 gene locus_tag LOCUS_09200 28804 29715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 29716 30141 gene locus_tag LOCUS_09210 29716 30141 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462564.1 protein_id gnl|my_center|LOCUS_09210 30219 30971 gene locus_tag LOCUS_09220 30219 30971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 31204 30968 gene locus_tag LOCUS_09230 31204 30968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 31329 32903 gene locus_tag LOCUS_09240 31329 32903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 33386 33198 gene locus_tag LOCUS_09250 33386 33198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 33788 33552 gene locus_tag LOCUS_09260 33788 33552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence023 87 1199 gene locus_tag LOCUS_09270 87 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1204 1980 gene locus_tag LOCUS_09280 1204 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1980 2696 gene locus_tag LOCUS_09290 1980 2696 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_09290 2887 3462 gene locus_tag LOCUS_09300 2887 3462 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888851.1 protein_id gnl|my_center|LOCUS_09300 3594 4190 gene locus_tag LOCUS_09310 3594 4190 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480360.1 protein_id gnl|my_center|LOCUS_09310 4190 5224 gene locus_tag LOCUS_09320 4190 5224 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266638.1 protein_id gnl|my_center|LOCUS_09320 5211 6419 gene locus_tag LOCUS_09330 5211 6419 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388656.1 protein_id gnl|my_center|LOCUS_09330 6346 7155 gene locus_tag LOCUS_09340 6346 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209071.1 protein_id gnl|my_center|LOCUS_09340 7161 8252 gene locus_tag LOCUS_09350 7161 8252 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388654.1 protein_id gnl|my_center|LOCUS_09350 8249 9184 gene locus_tag LOCUS_09360 8249 9184 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388653.1 protein_id gnl|my_center|LOCUS_09360 9266 9718 gene locus_tag LOCUS_09370 9266 9718 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614818.1 protein_id gnl|my_center|LOCUS_09370 10028 10936 gene locus_tag LOCUS_09380 gene cysD 10028 10936 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707309.1 protein_id gnl|my_center|LOCUS_09380 10982 12607 gene locus_tag LOCUS_09390 gene cysN 10982 12607 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110029.1 protein_id gnl|my_center|LOCUS_09390 12634 14553 gene locus_tag LOCUS_09400 12634 14553 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262264.1 protein_id gnl|my_center|LOCUS_09400 14550 15284 gene locus_tag LOCUS_09410 gene tsaB 14550 15284 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262263.1 protein_id gnl|my_center|LOCUS_09410 15479 17194 gene locus_tag LOCUS_09420 15479 17194 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_09420 17237 18646 gene locus_tag LOCUS_09430 17237 18646 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979630.1 protein_id gnl|my_center|LOCUS_09430 18627 18839 gene locus_tag LOCUS_09440 18627 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 18839 19048 gene locus_tag LOCUS_09450 18839 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 19074 19217 gene locus_tag LOCUS_09460 19074 19217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 19952 19296 gene locus_tag LOCUS_09470 19952 19296 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268547.1 protein_id gnl|my_center|LOCUS_09470 20351 20064 gene locus_tag LOCUS_09480 20351 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 20584 21183 gene locus_tag LOCUS_09490 20584 21183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 21444 21701 gene locus_tag LOCUS_09500 21444 21701 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_09500 21698 24439 gene locus_tag LOCUS_09510 21698 24439 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091704098.1 protein_id gnl|my_center|LOCUS_09510 24767 24943 gene locus_tag LOCUS_09520 24767 24943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 24940 26517 gene locus_tag LOCUS_09530 gene casA 24940 26517 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366321.1 protein_id gnl|my_center|LOCUS_09530 26514 27116 gene locus_tag LOCUS_09540 26514 27116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 27126 28190 gene locus_tag LOCUS_09550 gene cas7e 27126 28190 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 protein_id gnl|my_center|LOCUS_09550 28202 28981 gene locus_tag LOCUS_09560 gene cas5e 28202 28981 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_09560 28981 29856 gene locus_tag LOCUS_09570 28981 29856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 29867 30778 gene locus_tag LOCUS_09580 gene cas1e 29867 30778 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942041.1 protein_id gnl|my_center|LOCUS_09580 30759 31049 gene locus_tag LOCUS_09590 gene cas2e 30759 31049 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 protein_id gnl|my_center|LOCUS_09590 31150 33435 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccacatccgtggggatgaaccg >Feature sequence024 343 173 gene locus_tag LOCUS_09600 343 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1055 381 gene locus_tag LOCUS_09610 gene ccmB 1055 381 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_09610 1678 1055 gene locus_tag LOCUS_09620 gene ccmA 1678 1055 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420299.1 protein_id gnl|my_center|LOCUS_09620 2428 1679 gene locus_tag LOCUS_09630 gene rlmB 2428 1679 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_09630 4750 2483 gene locus_tag LOCUS_09640 gene rnr 4750 2483 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105236.1 protein_id gnl|my_center|LOCUS_09640 5951 5352 gene locus_tag LOCUS_09650 5951 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 8014 6146 gene locus_tag LOCUS_09660 gene thiC 8014 6146 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_09660 8356 9093 gene locus_tag LOCUS_09670 8356 9093 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_09670 9825 9439 gene locus_tag LOCUS_09680 9825 9439 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_09680 10049 9822 gene locus_tag LOCUS_09690 10049 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 10650 10333 gene locus_tag LOCUS_09700 10650 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 11091 11813 gene locus_tag LOCUS_09710 11091 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 12936 11800 gene locus_tag LOCUS_09720 gene queG 12936 11800 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_09720 14233 12974 gene locus_tag LOCUS_09730 14233 12974 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706195.1 protein_id gnl|my_center|LOCUS_09730 15232 14441 gene locus_tag LOCUS_09740 15232 14441 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_09740 15368 16600 gene locus_tag LOCUS_09750 15368 16600 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 protein_id gnl|my_center|LOCUS_09750 16634 17116 gene locus_tag LOCUS_09760 16634 17116 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106526.1 protein_id gnl|my_center|LOCUS_09760 17987 17106 gene locus_tag LOCUS_09770 17987 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 18754 17987 gene locus_tag LOCUS_09780 18754 17987 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_09780 20111 18756 gene locus_tag LOCUS_09790 20111 18756 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105299.1 protein_id gnl|my_center|LOCUS_09790 21026 20175 gene locus_tag LOCUS_09800 gene metF 21026 20175 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_09800 22444 21152 gene locus_tag LOCUS_09810 gene ahcY 22444 21152 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_09810 23630 22470 gene locus_tag LOCUS_09820 gene metK 23630 22470 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706910.1 protein_id gnl|my_center|LOCUS_09820 23773 23697 gene locus_tag LOCUS_t00120 23773 23697 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 25592 23781 gene locus_tag LOCUS_09830 gene rpoD 25592 23781 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453778.1 protein_id gnl|my_center|LOCUS_09830 27409 25670 gene locus_tag LOCUS_09840 gene dnaG 27409 25670 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453774.1 protein_id gnl|my_center|LOCUS_09840 27863 27414 gene locus_tag LOCUS_09850 27863 27414 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_09850 28112 27879 gene locus_tag LOCUS_09860 gene rpsU 28112 27879 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 protein_id gnl|my_center|LOCUS_09860 28219 29220 gene locus_tag LOCUS_09870 gene tsaD 28219 29220 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262666.1 protein_id gnl|my_center|LOCUS_09870 29864 29427 gene locus_tag LOCUS_09880 29864 29427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 30246 29875 gene locus_tag LOCUS_09890 30246 29875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 30942 30376 gene locus_tag LOCUS_09900 30942 30376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 31384 30953 gene locus_tag LOCUS_09910 31384 30953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 32165 31671 gene locus_tag LOCUS_09920 32165 31671 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223804324.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence025 930 1457 gene locus_tag LOCUS_09930 930 1457 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_09930 1457 1639 gene locus_tag LOCUS_09940 gene rpmF 1457 1639 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010368401.1 protein_id gnl|my_center|LOCUS_09940 1722 2750 gene locus_tag LOCUS_09950 gene plsX 1722 2750 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_09950 2747 3715 gene locus_tag LOCUS_09960 2747 3715 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170737.1 protein_id gnl|my_center|LOCUS_09960 3739 4689 gene locus_tag LOCUS_09970 gene fabD 3739 4689 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210934.1 protein_id gnl|my_center|LOCUS_09970 4682 5410 gene locus_tag LOCUS_09980 gene fabG 4682 5410 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918744.1 protein_id gnl|my_center|LOCUS_09980 5549 5779 gene locus_tag LOCUS_09990 gene acpP 5549 5779 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381096.1 protein_id gnl|my_center|LOCUS_09990 5882 7096 gene locus_tag LOCUS_10000 gene fabF 5882 7096 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_10000 7126 7959 gene locus_tag LOCUS_10010 gene pabC 7126 7959 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020799938.1 protein_id gnl|my_center|LOCUS_10010 7949 8998 gene locus_tag LOCUS_10020 gene mltG 7949 8998 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_10020 8985 9608 gene locus_tag LOCUS_10030 gene tmk 8985 9608 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 protein_id gnl|my_center|LOCUS_10030 9605 10600 gene locus_tag LOCUS_10040 9605 10600 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_10040 10597 10944 gene locus_tag LOCUS_10050 10597 10944 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_10050 10957 11727 gene locus_tag LOCUS_10060 10957 11727 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_10060 12020 12661 gene locus_tag LOCUS_10070 gene hxlA 12020 12661 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776031.1 protein_id gnl|my_center|LOCUS_10070 12664 13197 gene locus_tag LOCUS_10080 gene hxlB 12664 13197 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879292.1 protein_id gnl|my_center|LOCUS_10080 13340 15334 gene locus_tag LOCUS_10090 gene tkt 13340 15334 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157073.1 protein_id gnl|my_center|LOCUS_10090 15453 16271 gene locus_tag LOCUS_10100 15453 16271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 16274 17065 gene locus_tag LOCUS_10110 16274 17065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 17262 18248 gene locus_tag LOCUS_10120 17262 18248 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 protein_id gnl|my_center|LOCUS_10120 18348 19427 gene locus_tag LOCUS_10130 gene fbaA 18348 19427 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_10130 20327 19515 gene locus_tag LOCUS_10140 20327 19515 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532025.1 protein_id gnl|my_center|LOCUS_10140 21220 20324 gene locus_tag LOCUS_10150 gene fhcD 21220 20324 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532026.1 protein_id gnl|my_center|LOCUS_10150 22357 21407 gene locus_tag LOCUS_10160 gene pip 22357 21407 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_10160 22749 22381 gene locus_tag LOCUS_10170 22749 22381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 23702 22746 gene locus_tag LOCUS_10180 gene lipA 23702 22746 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958112.1 protein_id gnl|my_center|LOCUS_10180 24304 23699 gene locus_tag LOCUS_10190 gene lipB 24304 23699 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 protein_id gnl|my_center|LOCUS_10190 24618 24355 gene locus_tag LOCUS_10200 24618 24355 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021138.1 protein_id gnl|my_center|LOCUS_10200 25878 24706 gene locus_tag LOCUS_10210 25878 24706 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444497.1 protein_id gnl|my_center|LOCUS_10210 27114 26419 gene locus_tag LOCUS_10220 gene kdpE 27114 26419 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517659.1 protein_id gnl|my_center|LOCUS_10220 29881 27140 gene locus_tag LOCUS_10230 29881 27140 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526440.1 protein_id gnl|my_center|LOCUS_10230 30466 29891 gene locus_tag LOCUS_10240 gene kdpC 30466 29891 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_10240 30633 30478 gene locus_tag LOCUS_10250 30633 30478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence026 1248 589 gene locus_tag LOCUS_10260 1248 589 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_10260 1797 1249 gene locus_tag LOCUS_10270 1797 1249 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_10270 3079 1775 gene locus_tag LOCUS_10280 3079 1775 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_10280 3988 3425 gene locus_tag LOCUS_10290 gene msrA 3988 3425 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056729.1 protein_id gnl|my_center|LOCUS_10290 4157 5023 gene locus_tag LOCUS_10300 gene hslO 4157 5023 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943636.1 protein_id gnl|my_center|LOCUS_10300 5165 8683 gene locus_tag LOCUS_10310 gene smc 5165 8683 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_10310 8683 9327 gene locus_tag LOCUS_10320 8683 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 9403 11424 gene locus_tag LOCUS_10330 gene ligA 9403 11424 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665886.1 protein_id gnl|my_center|LOCUS_10330 12780 11446 gene locus_tag LOCUS_10340 gene rlmD 12780 11446 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242253.1 protein_id gnl|my_center|LOCUS_10340 13703 12813 gene locus_tag LOCUS_10350 gene cysM 13703 12813 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554618.1 protein_id gnl|my_center|LOCUS_10350 13997 14554 gene locus_tag LOCUS_10360 13997 14554 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532041.1 protein_id gnl|my_center|LOCUS_10360 14551 15945 gene locus_tag LOCUS_10370 14551 15945 CDS product DUF6513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532040.1 protein_id gnl|my_center|LOCUS_10370 15942 16505 gene locus_tag LOCUS_10380 15942 16505 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532039.1 protein_id gnl|my_center|LOCUS_10380 16502 17176 gene locus_tag LOCUS_10390 16502 17176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 17273 18490 gene locus_tag LOCUS_10400 gene ispG 17273 18490 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_10400 18617 18760 gene locus_tag LOCUS_10410 18617 18760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 18945 20348 gene locus_tag LOCUS_10420 18945 20348 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_10420 20386 21267 gene locus_tag LOCUS_10430 gene galU 20386 21267 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225519.1 protein_id gnl|my_center|LOCUS_10430 21542 23128 gene locus_tag LOCUS_10440 21542 23128 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_10440 23239 23955 gene locus_tag LOCUS_10450 23239 23955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 25523 23991 gene locus_tag LOCUS_10460 25523 23991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 26299 25568 gene locus_tag LOCUS_10470 26299 25568 CDS product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073732.1 protein_id gnl|my_center|LOCUS_10470 26869 26420 gene locus_tag LOCUS_10480 26869 26420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 27383 28012 gene locus_tag LOCUS_10490 27383 28012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 28252 28512 gene locus_tag LOCUS_10500 28252 28512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 28798 29415 gene locus_tag LOCUS_10510 28798 29415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence027 1477 149 gene locus_tag LOCUS_10520 gene pgaC 1477 149 CDS product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368679.1 protein_id gnl|my_center|LOCUS_10520 3555 1474 gene locus_tag LOCUS_10530 gene pgaB 3555 1474 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206024.1 protein_id gnl|my_center|LOCUS_10530 4375 3623 gene locus_tag LOCUS_10540 4375 3623 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_10540 5321 4545 gene locus_tag LOCUS_10550 5321 4545 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_10550 6061 5321 gene locus_tag LOCUS_10560 6061 5321 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 protein_id gnl|my_center|LOCUS_10560 7449 6058 gene locus_tag LOCUS_10570 gene lpdA 7449 6058 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957594.1 protein_id gnl|my_center|LOCUS_10570 7965 7534 gene locus_tag LOCUS_10580 7965 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 9177 7975 gene locus_tag LOCUS_10590 9177 7975 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_10590 10423 9425 gene locus_tag LOCUS_10600 gene dusA 10423 9425 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 protein_id gnl|my_center|LOCUS_10600 10970 10647 gene locus_tag LOCUS_10610 10970 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 11094 11786 gene locus_tag LOCUS_10620 gene phoB 11094 11786 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_10620 11792 13069 gene locus_tag LOCUS_10630 gene phoR 11792 13069 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_10630 13812 13039 gene locus_tag LOCUS_10640 13812 13039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 13978 15447 gene locus_tag LOCUS_10650 gene zwf 13978 15447 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072454.1 protein_id gnl|my_center|LOCUS_10650 15485 17305 gene locus_tag LOCUS_10660 gene edd 15485 17305 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 protein_id gnl|my_center|LOCUS_10660 17456 18106 gene locus_tag LOCUS_10670 17456 18106 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163029.1 protein_id gnl|my_center|LOCUS_10670 18213 19517 gene locus_tag LOCUS_10680 gene gltA 18213 19517 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188362.1 protein_id gnl|my_center|LOCUS_10680 19667 21268 gene locus_tag LOCUS_10690 19667 21268 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 protein_id gnl|my_center|LOCUS_10690 21268 21582 gene locus_tag LOCUS_10700 21268 21582 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 protein_id gnl|my_center|LOCUS_10700 21606 21911 gene locus_tag LOCUS_10710 21606 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 21975 23105 gene locus_tag LOCUS_10720 gene nirF 21975 23105 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_10720 23109 23567 gene locus_tag LOCUS_10730 23109 23567 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_10730 23560 24066 gene locus_tag LOCUS_10740 23560 24066 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 protein_id gnl|my_center|LOCUS_10740 24053 24496 gene locus_tag LOCUS_10750 24053 24496 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_10750 24496 24978 gene locus_tag LOCUS_10760 24496 24978 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_10760 25109 24912 gene locus_tag LOCUS_10770 25109 24912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 25411 25241 gene locus_tag LOCUS_10780 25411 25241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 25875 25663 gene locus_tag LOCUS_10790 25875 25663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 26090 25872 gene locus_tag LOCUS_10800 26090 25872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 26968 26294 gene locus_tag LOCUS_10810 26968 26294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 29232 26989 gene locus_tag LOCUS_10820 29232 26989 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159898.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence028 194 388 gene locus_tag LOCUS_10830 194 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 444 728 gene locus_tag LOCUS_10840 444 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1136 2365 gene locus_tag LOCUS_10850 1136 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2447 3712 gene locus_tag LOCUS_10860 2447 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3709 4932 gene locus_tag LOCUS_10870 3709 4932 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_10870 5079 6275 gene locus_tag LOCUS_10880 5079 6275 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256778.1 protein_id gnl|my_center|LOCUS_10880 6272 7240 gene locus_tag LOCUS_10890 6272 7240 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965618.1 protein_id gnl|my_center|LOCUS_10890 7247 7777 gene locus_tag LOCUS_10900 gene cysE 7247 7777 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964006.1 protein_id gnl|my_center|LOCUS_10900 8211 9086 gene locus_tag LOCUS_10910 8211 9086 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_10910 9086 9805 gene locus_tag LOCUS_10920 9086 9805 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_10920 9805 11256 gene locus_tag LOCUS_10930 9805 11256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 11312 11800 gene locus_tag LOCUS_10940 11312 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 11885 12223 gene locus_tag LOCUS_10950 11885 12223 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_10950 12378 12133 gene locus_tag LOCUS_10960 12378 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 12342 13739 gene locus_tag LOCUS_10970 gene dnaB 12342 13739 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380723.1 protein_id gnl|my_center|LOCUS_10970 13736 14848 gene locus_tag LOCUS_10980 gene alr 13736 14848 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817869.1 protein_id gnl|my_center|LOCUS_10980 14922 18029 gene locus_tag LOCUS_10990 14922 18029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 18026 19159 gene locus_tag LOCUS_11000 18026 19159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_11000 19161 19964 gene locus_tag LOCUS_11010 19161 19964 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_11010 19957 20955 gene locus_tag LOCUS_11020 19957 20955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 20962 21621 gene locus_tag LOCUS_11030 20962 21621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 21861 21682 gene locus_tag LOCUS_11040 21861 21682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 22674 22180 gene locus_tag LOCUS_11050 22674 22180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11050 24007 22661 gene locus_tag LOCUS_11060 24007 22661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 26134 24521 gene locus_tag LOCUS_11070 26134 24521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 28983 26131 gene locus_tag LOCUS_11080 28983 26131 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence029 464 120 gene locus_tag LOCUS_11090 464 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1636 461 gene locus_tag LOCUS_11100 1636 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2869 1664 gene locus_tag LOCUS_11110 2869 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4258 3143 gene locus_tag LOCUS_11120 4258 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 4620 4300 gene locus_tag LOCUS_11130 4620 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5496 6128 gene locus_tag LOCUS_11140 5496 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 6344 6601 gene locus_tag LOCUS_11150 6344 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 6588 6980 gene locus_tag LOCUS_11160 6588 6980 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_11160 9070 7010 gene locus_tag LOCUS_11170 gene cstA 9070 7010 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047792095.1 protein_id gnl|my_center|LOCUS_11170 9523 9074 gene locus_tag LOCUS_11180 9523 9074 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406157.1 protein_id gnl|my_center|LOCUS_11180 9743 10789 gene locus_tag LOCUS_11190 9743 10789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 10959 14357 gene locus_tag LOCUS_11200 10959 14357 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_11200 14392 15699 gene locus_tag LOCUS_11210 14392 15699 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_11210 15780 18350 gene locus_tag LOCUS_11220 15780 18350 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105233.1 protein_id gnl|my_center|LOCUS_11220 18347 19282 gene locus_tag LOCUS_11230 18347 19282 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_11230 19341 20036 gene locus_tag LOCUS_11240 19341 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085279.1 protein_id gnl|my_center|LOCUS_11240 20085 20873 gene locus_tag LOCUS_11250 20085 20873 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_11250 20906 21661 gene locus_tag LOCUS_11260 20906 21661 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_11260 22690 21752 gene locus_tag LOCUS_11270 22690 21752 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311706.1 protein_id gnl|my_center|LOCUS_11270 24141 22690 gene locus_tag LOCUS_11280 24141 22690 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_11280 25230 24298 gene locus_tag LOCUS_11290 gene rimK 25230 24298 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_11290 26298 25366 gene locus_tag LOCUS_11300 26298 25366 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532938.1 protein_id gnl|my_center|LOCUS_11300 26501 27874 gene locus_tag LOCUS_11310 gene radA 26501 27874 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 protein_id gnl|my_center|LOCUS_11310 28123 27899 gene locus_tag LOCUS_11320 28123 27899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_11320 28376 28110 gene locus_tag LOCUS_11330 28376 28110 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence030 3734 2523 gene locus_tag LOCUS_11340 3734 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4062 3727 gene locus_tag LOCUS_11350 gene nirD 4062 3727 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261473.1 protein_id gnl|my_center|LOCUS_11350 6602 4062 gene locus_tag LOCUS_11360 gene nirB 6602 4062 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901082.1 protein_id gnl|my_center|LOCUS_11360 7973 6681 gene locus_tag LOCUS_11370 7973 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 9838 8072 gene locus_tag LOCUS_11380 9838 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 10868 9852 gene locus_tag LOCUS_11390 10868 9852 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_11390 12320 10920 gene locus_tag LOCUS_11400 12320 10920 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_11400 13248 12685 gene locus_tag LOCUS_11410 13248 12685 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142575.1 protein_id gnl|my_center|LOCUS_11410 13529 13311 gene locus_tag LOCUS_11420 13529 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 13627 14673 gene locus_tag LOCUS_11430 13627 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 15498 14881 gene locus_tag LOCUS_11440 15498 14881 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261211.1 protein_id gnl|my_center|LOCUS_11440 16285 15563 gene locus_tag LOCUS_11450 gene rph 16285 15563 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_11450 16448 17314 gene locus_tag LOCUS_11460 16448 17314 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947727.1 protein_id gnl|my_center|LOCUS_11460 17759 18148 gene locus_tag LOCUS_11470 gene queF 17759 18148 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_11470 18172 19032 gene locus_tag LOCUS_11480 gene asd 18172 19032 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811301.1 protein_id gnl|my_center|LOCUS_11480 20382 19090 gene locus_tag LOCUS_11490 20382 19090 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_11490 21344 20382 gene locus_tag LOCUS_11500 21344 20382 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_11500 21854 21348 gene locus_tag LOCUS_11510 gene pyrR 21854 21348 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266430.1 protein_id gnl|my_center|LOCUS_11510 22310 21858 gene locus_tag LOCUS_11520 gene ruvX 22310 21858 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073217.1 protein_id gnl|my_center|LOCUS_11520 22888 22310 gene locus_tag LOCUS_11530 22888 22310 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946323.1 protein_id gnl|my_center|LOCUS_11530 23784 22885 gene locus_tag LOCUS_11540 23784 22885 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_11540 24748 23801 gene locus_tag LOCUS_11550 gene gshB 24748 23801 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593266.1 protein_id gnl|my_center|LOCUS_11550 24880 25116 gene locus_tag LOCUS_11560 gene rpmB 24880 25116 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096556.1 protein_id gnl|my_center|LOCUS_11560 25128 25283 gene locus_tag LOCUS_11570 gene rpmG 25128 25283 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 protein_id gnl|my_center|LOCUS_11570 26229 27137 gene locus_tag LOCUS_11580 26229 27137 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_11580 27313 27567 gene locus_tag LOCUS_11590 27313 27567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence031 452 1225 gene locus_tag LOCUS_11600 gene rfbF 452 1225 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 protein_id gnl|my_center|LOCUS_11600 1222 2313 gene locus_tag LOCUS_11610 gene rfbG 1222 2313 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_11610 2301 2555 gene locus_tag LOCUS_11620 2301 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2539 4143 gene locus_tag LOCUS_11630 gene rfbH 2539 4143 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_11630 4145 4693 gene locus_tag LOCUS_11640 4145 4693 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167727.1 protein_id gnl|my_center|LOCUS_11640 4686 5591 gene locus_tag LOCUS_11650 4686 5591 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167728.1 protein_id gnl|my_center|LOCUS_11650 5603 7135 gene locus_tag LOCUS_11660 5603 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 7174 8142 gene locus_tag LOCUS_11670 7174 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 9113 9952 gene locus_tag LOCUS_11680 9113 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 10042 11085 gene locus_tag LOCUS_11690 10042 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 11139 12293 gene locus_tag LOCUS_11700 11139 12293 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331373.1 protein_id gnl|my_center|LOCUS_11700 12340 12906 gene locus_tag LOCUS_11710 12340 12906 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974186.1 protein_id gnl|my_center|LOCUS_11710 12910 14580 gene locus_tag LOCUS_11720 12910 14580 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525090.1 protein_id gnl|my_center|LOCUS_11720 14573 15544 gene locus_tag LOCUS_11730 14573 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 15554 16258 gene locus_tag LOCUS_11740 15554 16258 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902763.1 protein_id gnl|my_center|LOCUS_11740 16560 17399 gene locus_tag LOCUS_11750 16560 17399 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_11750 17436 18509 gene locus_tag LOCUS_11760 17436 18509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 18550 19116 gene locus_tag LOCUS_11770 gene gmhA 18550 19116 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858021.1 protein_id gnl|my_center|LOCUS_11770 19106 20530 gene locus_tag LOCUS_11780 gene hldE 19106 20530 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693548.1 protein_id gnl|my_center|LOCUS_11780 20527 21471 gene locus_tag LOCUS_11790 gene rfaD 20527 21471 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 protein_id gnl|my_center|LOCUS_11790 21653 23608 gene locus_tag LOCUS_11800 21653 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 23649 24878 gene locus_tag LOCUS_11810 23649 24878 CDS product WcaI family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051330685.1 protein_id gnl|my_center|LOCUS_11810 24923 25645 gene locus_tag LOCUS_11820 24923 25645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 25675 27021 gene locus_tag LOCUS_11830 25675 27021 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389246.1 protein_id gnl|my_center|LOCUS_11830 27130 27513 gene locus_tag LOCUS_11840 27130 27513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence032 1252 98 gene locus_tag LOCUS_11850 1252 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1864 1577 gene locus_tag LOCUS_11860 1864 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2413 1895 gene locus_tag LOCUS_11870 2413 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3490 2627 gene locus_tag LOCUS_11880 gene rlmA 3490 2627 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460128.1 protein_id gnl|my_center|LOCUS_11880 3694 4707 gene locus_tag LOCUS_11890 gene gap 3694 4707 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522067.1 protein_id gnl|my_center|LOCUS_11890 4721 6169 gene locus_tag LOCUS_11900 gene pyk 4721 6169 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091169.1 protein_id gnl|my_center|LOCUS_11900 8405 6240 gene locus_tag LOCUS_11910 gene uvrD 8405 6240 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815343.1 protein_id gnl|my_center|LOCUS_11910 8524 8757 gene locus_tag LOCUS_11920 8524 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 9249 8812 gene locus_tag LOCUS_11930 9249 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 9416 11305 gene locus_tag LOCUS_11940 gene dsbD 9416 11305 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862442.1 protein_id gnl|my_center|LOCUS_11940 11305 11892 gene locus_tag LOCUS_11950 11305 11892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 12939 12058 gene locus_tag LOCUS_11960 12939 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 14106 13096 gene locus_tag LOCUS_11970 14106 13096 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_11970 14962 14315 gene locus_tag LOCUS_11980 14962 14315 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_11980 16170 14971 gene locus_tag LOCUS_11990 gene purT 16170 14971 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064909.1 protein_id gnl|my_center|LOCUS_11990 17765 16167 gene locus_tag LOCUS_12000 17765 16167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 18755 17790 gene locus_tag LOCUS_12010 gene hemH 18755 17790 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_12010 19306 18764 gene locus_tag LOCUS_12020 gene folE 19306 18764 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216616.1 protein_id gnl|my_center|LOCUS_12020 20970 19588 gene locus_tag LOCUS_12030 20970 19588 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969784.1 protein_id gnl|my_center|LOCUS_12030 21945 20986 gene locus_tag LOCUS_12040 gene nspC 21945 20986 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 protein_id gnl|my_center|LOCUS_12040 22437 22718 gene locus_tag LOCUS_12050 22437 22718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 22760 24280 gene locus_tag LOCUS_12060 22760 24280 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074108.1 protein_id gnl|my_center|LOCUS_12060 24518 24748 gene locus_tag LOCUS_12070 24518 24748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 24738 25037 gene locus_tag LOCUS_12080 24738 25037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 25823 25416 gene locus_tag LOCUS_12090 25823 25416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 26031 >27387 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccacggatgtggggaacac >Feature sequence033 134 1042 gene locus_tag LOCUS_12100 134 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1639 1103 gene locus_tag LOCUS_12110 1639 1103 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 protein_id gnl|my_center|LOCUS_12110 2190 1636 gene locus_tag LOCUS_12120 2190 1636 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207169.1 protein_id gnl|my_center|LOCUS_12120 2705 2160 gene locus_tag LOCUS_12130 2705 2160 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207168.1 protein_id gnl|my_center|LOCUS_12130 2842 3780 gene locus_tag LOCUS_12140 2842 3780 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207178.1 protein_id gnl|my_center|LOCUS_12140 3777 5012 gene locus_tag LOCUS_12150 3777 5012 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 protein_id gnl|my_center|LOCUS_12150 5015 5776 gene locus_tag LOCUS_12160 5015 5776 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275405.1 protein_id gnl|my_center|LOCUS_12160 5802 7064 gene locus_tag LOCUS_12170 5802 7064 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 protein_id gnl|my_center|LOCUS_12170 7078 7593 gene locus_tag LOCUS_12180 7078 7593 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036520.1 protein_id gnl|my_center|LOCUS_12180 7586 8362 gene locus_tag LOCUS_12190 7586 8362 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207173.1 protein_id gnl|my_center|LOCUS_12190 8377 9408 gene locus_tag LOCUS_12200 8377 9408 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_12200 9421 10731 gene locus_tag LOCUS_12210 9421 10731 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036016.1 protein_id gnl|my_center|LOCUS_12210 11449 10739 gene locus_tag LOCUS_12220 11449 10739 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506728.1 protein_id gnl|my_center|LOCUS_12220 12344 11505 gene locus_tag LOCUS_12230 12344 11505 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 protein_id gnl|my_center|LOCUS_12230 15211 12353 gene locus_tag LOCUS_12240 gene rapA 15211 12353 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948005.1 protein_id gnl|my_center|LOCUS_12240 15531 16646 gene locus_tag LOCUS_12250 15531 16646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 16646 17452 gene locus_tag LOCUS_12260 16646 17452 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194135.1 protein_id gnl|my_center|LOCUS_12260 17449 18099 gene locus_tag LOCUS_12270 17449 18099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224750.1 protein_id gnl|my_center|LOCUS_12270 18107 19282 gene locus_tag LOCUS_12280 18107 19282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 19345 20379 gene locus_tag LOCUS_12290 19345 20379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 20397 21152 gene locus_tag LOCUS_12300 20397 21152 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103245.1 protein_id gnl|my_center|LOCUS_12300 21152 21784 gene locus_tag LOCUS_12310 21152 21784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266513.1 protein_id gnl|my_center|LOCUS_12310 21818 22471 gene locus_tag LOCUS_12320 21818 22471 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769043.1 protein_id gnl|my_center|LOCUS_12320 22471 23205 gene locus_tag LOCUS_12330 22471 23205 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245498.1 protein_id gnl|my_center|LOCUS_12330 23202 23522 gene locus_tag LOCUS_12340 23202 23522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407887.1 protein_id gnl|my_center|LOCUS_12340 23525 25318 gene locus_tag LOCUS_12350 23525 25318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266516.1 protein_id gnl|my_center|LOCUS_12350 25315 25935 gene locus_tag LOCUS_12360 25315 25935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence034 150 611 gene locus_tag LOCUS_12370 150 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 638 1174 gene locus_tag LOCUS_12380 gene fldA 638 1174 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163372.1 protein_id gnl|my_center|LOCUS_12380 1482 3215 gene locus_tag LOCUS_12390 1482 3215 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104709.1 protein_id gnl|my_center|LOCUS_12390 3225 3938 gene locus_tag LOCUS_12400 3225 3938 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_12400 4092 6392 gene locus_tag LOCUS_12410 4092 6392 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_12410 6450 8714 gene locus_tag LOCUS_12420 6450 8714 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268475.1 protein_id gnl|my_center|LOCUS_12420 8719 9159 gene locus_tag LOCUS_12430 8719 9159 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_12430 9152 9745 gene locus_tag LOCUS_12440 9152 9745 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268476.1 protein_id gnl|my_center|LOCUS_12440 9748 11409 gene locus_tag LOCUS_12450 9748 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 11949 11626 gene locus_tag LOCUS_12460 11949 11626 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_12460 13112 12135 gene locus_tag LOCUS_12470 13112 12135 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_12470 13411 14268 gene locus_tag LOCUS_12480 13411 14268 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_12480 14284 15663 gene locus_tag LOCUS_12490 14284 15663 CDS product DUF4147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182574366.1 protein_id gnl|my_center|LOCUS_12490 15695 16948 gene locus_tag LOCUS_12500 15695 16948 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_12500 17098 18417 gene locus_tag LOCUS_12510 17098 18417 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979630.1 protein_id gnl|my_center|LOCUS_12510 18417 18854 gene locus_tag LOCUS_12520 18417 18854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 19061 20230 gene locus_tag LOCUS_12530 19061 20230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 20227 20910 gene locus_tag LOCUS_12540 20227 20910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 21068 22741 gene locus_tag LOCUS_12550 21068 22741 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396100.1 protein_id gnl|my_center|LOCUS_12550 22814 24418 gene locus_tag LOCUS_12560 22814 24418 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810157.1 protein_id gnl|my_center|LOCUS_12560 24604 25446 gene locus_tag LOCUS_12570 24604 25446 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670838.1 protein_id gnl|my_center|LOCUS_12570 25908 25531 gene locus_tag LOCUS_12580 25908 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence035 1026 2306 gene locus_tag LOCUS_12590 gene glgC 1026 2306 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_12590 2521 4170 gene locus_tag LOCUS_12600 2521 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 4186 5664 gene locus_tag LOCUS_12610 gene malQ 4186 5664 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_12610 6588 5755 gene locus_tag LOCUS_12620 6588 5755 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966732.1 protein_id gnl|my_center|LOCUS_12620 6882 6807 gene locus_tag LOCUS_t00130 6882 6807 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7063 6988 gene locus_tag LOCUS_t00140 7063 6988 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7169 7094 gene locus_tag LOCUS_t00150 7169 7094 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8619 7216 gene locus_tag LOCUS_12630 gene gltX 8619 7216 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222185.1 protein_id gnl|my_center|LOCUS_12630 9091 8624 gene locus_tag LOCUS_12640 9091 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 10376 9084 gene locus_tag LOCUS_12650 gene serS 10376 9084 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317946.1 protein_id gnl|my_center|LOCUS_12650 14380 10448 gene locus_tag LOCUS_12660 14380 10448 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189879.1 protein_id gnl|my_center|LOCUS_12660 14756 14439 gene locus_tag LOCUS_12670 14756 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 15460 14753 gene locus_tag LOCUS_12680 15460 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 16008 15463 gene locus_tag LOCUS_12690 gene orn 16008 15463 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704162.1 protein_id gnl|my_center|LOCUS_12690 16096 17346 gene locus_tag LOCUS_12700 16096 17346 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_12700 17343 18230 gene locus_tag LOCUS_12710 gene rsgA 17343 18230 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039215125.1 protein_id gnl|my_center|LOCUS_12710 21266 18273 gene locus_tag LOCUS_12720 21266 18273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 24208 21263 gene locus_tag LOCUS_12730 24208 21263 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence036 208 606 gene locus_tag LOCUS_12740 208 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 718 1509 gene locus_tag LOCUS_12750 gene olsB 718 1509 CDS product L-ornithine N(alpha)-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093970.1 protein_id gnl|my_center|LOCUS_12750 1481 2266 gene locus_tag LOCUS_12760 gene olsA 1481 2266 CDS product lyso-ornithine lipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 protein_id gnl|my_center|LOCUS_12760 2556 2386 gene locus_tag LOCUS_12770 2556 2386 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947264.1 protein_id gnl|my_center|LOCUS_12770 2883 3746 gene locus_tag LOCUS_12780 gene glyQ 2883 3746 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_12780 3748 5817 gene locus_tag LOCUS_12790 gene glyS 3748 5817 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 protein_id gnl|my_center|LOCUS_12790 5872 6417 gene locus_tag LOCUS_12800 gene gmhB 5872 6417 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814404.1 protein_id gnl|my_center|LOCUS_12800 6383 7129 gene locus_tag LOCUS_12810 6383 7129 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_12810 7227 7682 gene locus_tag LOCUS_12820 7227 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 9120 7735 gene locus_tag LOCUS_12830 gene cpsG 9120 7735 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954427.1 protein_id gnl|my_center|LOCUS_12830 9333 12677 gene locus_tag LOCUS_12840 gene mscK 9333 12677 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051444.1 protein_id gnl|my_center|LOCUS_12840 14253 12760 gene locus_tag LOCUS_12850 gene opmB 14253 12760 CDS product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_12850 17398 14270 gene locus_tag LOCUS_12860 gene mdtC 17398 14270 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667525.1 protein_id gnl|my_center|LOCUS_12860 20541 17398 gene locus_tag LOCUS_12870 gene muxB 20541 17398 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_12870 21848 20547 gene locus_tag LOCUS_12880 21848 20547 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_12880 22503 21859 gene locus_tag LOCUS_12890 22503 21859 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_12890 23184 22699 gene locus_tag LOCUS_12900 23184 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 23817 23218 gene locus_tag LOCUS_12910 gene nudF 23817 23218 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457144.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence037 275 1282 gene locus_tag LOCUS_12920 275 1282 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 protein_id gnl|my_center|LOCUS_12920 1282 2229 gene locus_tag LOCUS_12930 1282 2229 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091295.1 protein_id gnl|my_center|LOCUS_12930 2262 2753 gene locus_tag LOCUS_12940 2262 2753 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038328.1 protein_id gnl|my_center|LOCUS_12940 2750 3730 gene locus_tag LOCUS_12950 2750 3730 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_12950 3727 5499 gene locus_tag LOCUS_12960 3727 5499 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107432.1 protein_id gnl|my_center|LOCUS_12960 6057 5973 gene locus_tag LOCUS_t00160 6057 5973 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6494 6072 gene locus_tag LOCUS_12970 gene secG 6494 6072 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095194.1 protein_id gnl|my_center|LOCUS_12970 7257 6511 gene locus_tag LOCUS_12980 gene tpiA 7257 6511 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706224.1 protein_id gnl|my_center|LOCUS_12980 8661 7315 gene locus_tag LOCUS_12990 gene glmM 8661 7315 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_12990 10726 8792 gene locus_tag LOCUS_13000 gene ftsH 10726 8792 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_13000 11455 10868 gene locus_tag LOCUS_13010 gene rlmE 11455 10868 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443939.1 protein_id gnl|my_center|LOCUS_13010 11532 11798 gene locus_tag LOCUS_13020 11532 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 12336 11860 gene locus_tag LOCUS_13030 gene greA 12336 11860 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128178593.1 protein_id gnl|my_center|LOCUS_13030 15615 12397 gene locus_tag LOCUS_13040 gene carB 15615 12397 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037013.1 protein_id gnl|my_center|LOCUS_13040 16770 15637 gene locus_tag LOCUS_13050 gene carA 16770 15637 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045131.1 protein_id gnl|my_center|LOCUS_13050 17370 16912 gene locus_tag LOCUS_13060 17370 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 18154 20799 gene locus_tag LOCUS_13070 18154 20799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 21142 24240 gene locus_tag LOCUS_13080 21142 24240 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766460.1 protein_id gnl|my_center|LOCUS_13080 24357 24282 gene locus_tag LOCUS_t00170 24357 24282 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence038 271 1527 gene locus_tag LOCUS_13090 271 1527 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 protein_id gnl|my_center|LOCUS_13090 1530 3707 gene locus_tag LOCUS_13100 1530 3707 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 protein_id gnl|my_center|LOCUS_13100 3700 5124 gene locus_tag LOCUS_13110 3700 5124 CDS product TolC family type I secretion outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938786.1 protein_id gnl|my_center|LOCUS_13110 5385 5519 gene locus_tag LOCUS_13120 5385 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5862 6368 gene locus_tag LOCUS_13130 5862 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6694 6984 gene locus_tag LOCUS_13140 6694 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 7631 8554 gene locus_tag LOCUS_13150 gene mlaF 7631 8554 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_13150 8635 9417 gene locus_tag LOCUS_13160 gene mlaE 8635 9417 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_13160 9419 9886 gene locus_tag LOCUS_13170 gene mlaD 9419 9886 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_13170 9883 10236 gene locus_tag LOCUS_13180 9883 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 10249 11514 gene locus_tag LOCUS_13190 gene murA 10249 11514 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_13190 11524 12150 gene locus_tag LOCUS_13200 gene hisG 11524 12150 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739058.1 protein_id gnl|my_center|LOCUS_13200 12155 13459 gene locus_tag LOCUS_13210 gene hisD 12155 13459 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 protein_id gnl|my_center|LOCUS_13210 13520 14617 gene locus_tag LOCUS_13220 gene hisC 13520 14617 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_13220 14759 15358 gene locus_tag LOCUS_13230 gene petA 14759 15358 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_13230 15355 16782 gene locus_tag LOCUS_13240 15355 16782 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070939.1 protein_id gnl|my_center|LOCUS_13240 16784 17503 gene locus_tag LOCUS_13250 16784 17503 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994029.1 protein_id gnl|my_center|LOCUS_13250 17640 18275 gene locus_tag LOCUS_13260 gene sspA 17640 18275 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 protein_id gnl|my_center|LOCUS_13260 18286 18663 gene locus_tag LOCUS_13270 18286 18663 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207701.1 protein_id gnl|my_center|LOCUS_13270 18882 20348 gene locus_tag LOCUS_13280 gene guaB 18882 20348 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380633.1 protein_id gnl|my_center|LOCUS_13280 20476 22062 gene locus_tag LOCUS_13290 gene guaA 20476 22062 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266918.1 protein_id gnl|my_center|LOCUS_13290 22053 22514 gene locus_tag LOCUS_13300 gene tadA 22053 22514 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 protein_id gnl|my_center|LOCUS_13300 22937 22581 gene locus_tag LOCUS_13310 22937 22581 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_13310 23277 22978 gene locus_tag LOCUS_13320 23277 22978 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_13320 23494 23258 gene locus_tag LOCUS_13330 23494 23258 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_13330 24029 23673 gene locus_tag LOCUS_13340 24029 23673 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence039 5313 364 gene locus_tag LOCUS_13350 5313 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5545 6525 gene locus_tag LOCUS_13360 gene nagZ 5545 6525 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529292.1 protein_id gnl|my_center|LOCUS_13360 6544 7098 gene locus_tag LOCUS_13370 6544 7098 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768820.1 protein_id gnl|my_center|LOCUS_13370 7095 7835 gene locus_tag LOCUS_13380 7095 7835 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765040.1 protein_id gnl|my_center|LOCUS_13380 8005 9783 gene locus_tag LOCUS_13390 8005 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 9786 10505 gene locus_tag LOCUS_13400 9786 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 10552 11034 gene locus_tag LOCUS_13410 10552 11034 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_13410 11112 12614 gene locus_tag LOCUS_13420 11112 12614 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_13420 12607 13083 gene locus_tag LOCUS_13430 12607 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 13408 13322 gene locus_tag LOCUS_t00180 13408 13322 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13501 14517 gene locus_tag LOCUS_13440 gene queA 13501 14517 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771042.1 protein_id gnl|my_center|LOCUS_13440 14536 17979 gene locus_tag LOCUS_13450 gene mfd 14536 17979 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024299434.1 protein_id gnl|my_center|LOCUS_13450 19123 18047 gene locus_tag LOCUS_13460 gene modC 19123 18047 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104308.1 protein_id gnl|my_center|LOCUS_13460 19809 19123 gene locus_tag LOCUS_13470 gene modB 19809 19123 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_13470 20588 19824 gene locus_tag LOCUS_13480 gene modA 20588 19824 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_13480 22180 20660 gene locus_tag LOCUS_13490 22180 20660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 23568 22420 gene locus_tag LOCUS_13500 gene modC 23568 22420 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388460.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence040 1284 166 gene locus_tag LOCUS_13510 1284 166 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770934.1 protein_id gnl|my_center|LOCUS_13510 2704 1298 gene locus_tag LOCUS_13520 2704 1298 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770932.1 protein_id gnl|my_center|LOCUS_13520 3459 2791 gene locus_tag LOCUS_13530 3459 2791 CDS product alginate O-acetyltransferase AlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770931.1 protein_id gnl|my_center|LOCUS_13530 4277 3465 gene locus_tag LOCUS_13540 4277 3465 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556137.1 protein_id gnl|my_center|LOCUS_13540 5364 4468 gene locus_tag LOCUS_13550 5364 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6571 5897 gene locus_tag LOCUS_13560 6571 5897 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225669.1 protein_id gnl|my_center|LOCUS_13560 7605 6568 gene locus_tag LOCUS_13570 7605 6568 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269130.1 protein_id gnl|my_center|LOCUS_13570 7713 10700 gene locus_tag LOCUS_13580 7713 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 10697 11992 gene locus_tag LOCUS_13590 10697 11992 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444876.1 protein_id gnl|my_center|LOCUS_13590 12013 12600 gene locus_tag LOCUS_13600 12013 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 12616 13083 gene locus_tag LOCUS_13610 12616 13083 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_13610 13282 13482 gene locus_tag LOCUS_13620 13282 13482 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_13620 13762 14238 gene locus_tag LOCUS_13630 13762 14238 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064347.1 protein_id gnl|my_center|LOCUS_13630 14235 15788 gene locus_tag LOCUS_13640 14235 15788 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 protein_id gnl|my_center|LOCUS_13640 15813 18665 gene locus_tag LOCUS_13650 gene fdhF 15813 18665 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 protein_id gnl|my_center|LOCUS_13650 18724 19560 gene locus_tag LOCUS_13660 gene fdhD 18724 19560 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 protein_id gnl|my_center|LOCUS_13660 19557 19772 gene locus_tag LOCUS_13670 19557 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 19870 22146 gene locus_tag LOCUS_13680 19870 22146 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966435.1 protein_id gnl|my_center|LOCUS_13680 22374 22580 gene locus_tag LOCUS_13690 gene cspE 22374 22580 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210893.1 protein_id gnl|my_center|LOCUS_13690 22690 22956 gene locus_tag LOCUS_13700 22690 22956 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_13700 23241 23008 gene locus_tag LOCUS_13710 23241 23008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence041 127 417 gene locus_tag LOCUS_13720 127 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1626 379 gene locus_tag LOCUS_13730 1626 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2811 1630 gene locus_tag LOCUS_13740 gene mexE 2811 1630 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_13740 3035 4597 gene locus_tag LOCUS_13750 3035 4597 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_13750 4599 6221 gene locus_tag LOCUS_13760 4599 6221 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122546.1 protein_id gnl|my_center|LOCUS_13760 6445 6182 gene locus_tag LOCUS_13770 6445 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 7954 6683 gene locus_tag LOCUS_13780 7954 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 8287 8625 gene locus_tag LOCUS_13790 gene glnK 8287 8625 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_13790 8627 9919 gene locus_tag LOCUS_13800 8627 9919 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_13800 9980 11665 gene locus_tag LOCUS_13810 gene gspE 9980 11665 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_13810 11667 12878 gene locus_tag LOCUS_13820 11667 12878 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_13820 12890 13327 gene locus_tag LOCUS_13830 gene gspG 12890 13327 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_13830 13351 13830 gene locus_tag LOCUS_13840 13351 13830 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533579.1 protein_id gnl|my_center|LOCUS_13840 13808 14230 gene locus_tag LOCUS_13850 13808 14230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 14227 14979 gene locus_tag LOCUS_13860 14227 14979 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405015.1 protein_id gnl|my_center|LOCUS_13860 14979 15932 gene locus_tag LOCUS_13870 14979 15932 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035906.1 protein_id gnl|my_center|LOCUS_13870 15907 17109 gene locus_tag LOCUS_13880 15907 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 17110 17712 gene locus_tag LOCUS_13890 17110 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 17712 18317 gene locus_tag LOCUS_13900 17712 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 18314 20584 gene locus_tag LOCUS_13910 gene gspD 18314 20584 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035910.1 protein_id gnl|my_center|LOCUS_13910 21341 20688 gene locus_tag LOCUS_13920 gene rpiA 21341 20688 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 protein_id gnl|my_center|LOCUS_13920 22360 21425 gene locus_tag LOCUS_13930 22360 21425 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039058.1 protein_id gnl|my_center|LOCUS_13930 22697 22909 gene locus_tag LOCUS_13940 22697 22909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence042 142 951 gene locus_tag LOCUS_13950 142 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1222 3486 gene locus_tag LOCUS_13960 gene mrcB 1222 3486 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_13960 3496 4134 gene locus_tag LOCUS_13970 3496 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4240 5934 gene locus_tag LOCUS_13980 4240 5934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947342.1 protein_id gnl|my_center|LOCUS_13980 6046 6762 gene locus_tag LOCUS_13990 6046 6762 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_13990 7256 6897 gene locus_tag LOCUS_14000 7256 6897 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207864.1 protein_id gnl|my_center|LOCUS_14000 7753 9903 gene locus_tag LOCUS_14010 7753 9903 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704810.1 protein_id gnl|my_center|LOCUS_14010 9996 10694 gene locus_tag LOCUS_14020 9996 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_14020 10966 10891 gene locus_tag LOCUS_t00190 10966 10891 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 11073 10997 gene locus_tag LOCUS_t00200 11073 10997 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11155 11079 gene locus_tag LOCUS_t00210 11155 11079 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11893 11255 gene locus_tag LOCUS_14030 11893 11255 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259121.1 protein_id gnl|my_center|LOCUS_14030 12682 11975 gene locus_tag LOCUS_14040 12682 11975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14040 13362 12712 gene locus_tag LOCUS_14050 13362 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14050 13480 14064 gene locus_tag LOCUS_14060 13480 14064 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122280.1 protein_id gnl|my_center|LOCUS_14060 14160 14891 gene locus_tag LOCUS_14070 gene lpxH 14160 14891 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489008.1 protein_id gnl|my_center|LOCUS_14070 15130 17052 gene locus_tag LOCUS_14080 15130 17052 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532070.1 protein_id gnl|my_center|LOCUS_14080 17164 18168 gene locus_tag LOCUS_14090 17164 18168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 19781 18165 gene locus_tag LOCUS_14100 19781 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 21501 19762 gene locus_tag LOCUS_14110 21501 19762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 21609 22040 gene locus_tag LOCUS_14120 21609 22040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 22735 22061 gene locus_tag LOCUS_14130 22735 22061 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence043 287 102 gene locus_tag LOCUS_14140 287 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 716 1606 gene locus_tag LOCUS_14150 716 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1741 2070 gene locus_tag LOCUS_14160 1741 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2108 2356 gene locus_tag LOCUS_14170 2108 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546304.1 protein_id gnl|my_center|LOCUS_14170 2372 4915 gene locus_tag LOCUS_14180 gene mgtA 2372 4915 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_14180 6988 5066 gene locus_tag LOCUS_14190 gene ftsH 6988 5066 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107466.1 protein_id gnl|my_center|LOCUS_14190 8554 7160 gene locus_tag LOCUS_14200 8554 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 9542 9066 gene locus_tag LOCUS_14210 9542 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 13783 9659 gene locus_tag LOCUS_14220 13783 9659 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_14220 15284 13992 gene locus_tag LOCUS_14230 15284 13992 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092515.1 protein_id gnl|my_center|LOCUS_14230 15490 16215 gene locus_tag LOCUS_14240 15490 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 18282 16234 gene locus_tag LOCUS_14250 18282 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 19427 18402 gene locus_tag LOCUS_14260 gene hypE 19427 18402 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393663.1 protein_id gnl|my_center|LOCUS_14260 22503 19705 gene locus_tag LOCUS_14270 gene ppc 22503 19705 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_14270 22842 22555 gene locus_tag LOCUS_14280 22842 22555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence044 196 1086 gene locus_tag LOCUS_14290 196 1086 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_14290 1091 1612 gene locus_tag LOCUS_14300 1091 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1649 2650 gene locus_tag LOCUS_14310 1649 2650 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002890.1 protein_id gnl|my_center|LOCUS_14310 2678 2818 gene locus_tag LOCUS_14320 2678 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2910 3611 gene locus_tag LOCUS_14330 2910 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3622 4065 gene locus_tag LOCUS_14340 3622 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 4133 4672 gene locus_tag LOCUS_14350 4133 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 5003 5578 gene locus_tag LOCUS_14360 5003 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 7487 5718 gene locus_tag LOCUS_14370 7487 5718 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110082.1 protein_id gnl|my_center|LOCUS_14370 8953 7484 gene locus_tag LOCUS_14380 8953 7484 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387312.1 protein_id gnl|my_center|LOCUS_14380 11365 8975 gene locus_tag LOCUS_14390 11365 8975 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 protein_id gnl|my_center|LOCUS_14390 14788 11531 gene locus_tag LOCUS_14400 14788 11531 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_14400 15873 14788 gene locus_tag LOCUS_14410 15873 14788 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 protein_id gnl|my_center|LOCUS_14410 17281 15884 gene locus_tag LOCUS_14420 gene tolC 17281 15884 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969270.1 protein_id gnl|my_center|LOCUS_14420 17502 17302 gene locus_tag LOCUS_14430 17502 17302 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_14430 18784 17504 gene locus_tag LOCUS_14440 18784 17504 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_14440 19158 20720 gene locus_tag LOCUS_14450 gene cydA 19158 20720 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261597.1 protein_id gnl|my_center|LOCUS_14450 20717 21856 gene locus_tag LOCUS_14460 gene cydB 20717 21856 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 protein_id gnl|my_center|LOCUS_14460 21866 22435 gene locus_tag LOCUS_14470 21866 22435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence045 214 1203 gene locus_tag LOCUS_14480 214 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2113 1469 gene locus_tag LOCUS_14490 2113 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2868 3431 gene locus_tag LOCUS_14500 gene def 2868 3431 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461416.1 protein_id gnl|my_center|LOCUS_14500 3434 4357 gene locus_tag LOCUS_14510 gene fmt 3434 4357 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958586.1 protein_id gnl|my_center|LOCUS_14510 4365 5651 gene locus_tag LOCUS_14520 gene rsmB 4365 5651 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_14520 5701 6213 gene locus_tag LOCUS_14530 5701 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 6288 8351 gene locus_tag LOCUS_14540 6288 8351 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807333.1 protein_id gnl|my_center|LOCUS_14540 8359 9720 gene locus_tag LOCUS_14550 8359 9720 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_14550 9936 10364 gene locus_tag LOCUS_14560 gene rplM 9936 10364 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 protein_id gnl|my_center|LOCUS_14560 10376 10768 gene locus_tag LOCUS_14570 gene rpsI 10376 10768 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162424.1 protein_id gnl|my_center|LOCUS_14570 10943 11698 gene locus_tag LOCUS_14580 gene minC 10943 11698 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368369.1 protein_id gnl|my_center|LOCUS_14580 11715 12521 gene locus_tag LOCUS_14590 gene minD 11715 12521 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072528.1 protein_id gnl|my_center|LOCUS_14590 12524 12778 gene locus_tag LOCUS_14600 gene minE 12524 12778 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 protein_id gnl|my_center|LOCUS_14600 12925 13122 gene locus_tag LOCUS_14610 12925 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 13557 14783 gene locus_tag LOCUS_14620 13557 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 14780 15892 gene locus_tag LOCUS_14630 14780 15892 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763543.1 protein_id gnl|my_center|LOCUS_14630 15892 18954 gene locus_tag LOCUS_14640 15892 18954 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_14640 18951 19256 gene locus_tag LOCUS_14650 18951 19256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 20993 19389 gene locus_tag LOCUS_14660 20993 19389 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965710.1 protein_id gnl|my_center|LOCUS_14660 21670 20990 gene locus_tag LOCUS_14670 21670 20990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence046 361 1854 gene locus_tag LOCUS_14680 361 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3390 2380 gene locus_tag LOCUS_14690 gene ispB 3390 2380 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925908.1 protein_id gnl|my_center|LOCUS_14690 3657 3968 gene locus_tag LOCUS_14700 gene rplU 3657 3968 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094761.1 protein_id gnl|my_center|LOCUS_14700 3986 4243 gene locus_tag LOCUS_14710 gene rpmA 3986 4243 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004385076.1 protein_id gnl|my_center|LOCUS_14710 4387 5421 gene locus_tag LOCUS_14720 gene cgtA 4387 5421 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957543.1 protein_id gnl|my_center|LOCUS_14720 5408 6529 gene locus_tag LOCUS_14730 gene proB 5408 6529 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_14730 6640 8088 gene locus_tag LOCUS_14740 gene mgtE 6640 8088 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767763.1 protein_id gnl|my_center|LOCUS_14740 8261 8773 gene locus_tag LOCUS_14750 8261 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 8923 8848 gene locus_tag LOCUS_t00220 8923 8848 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9030 8955 gene locus_tag LOCUS_t00230 9030 8955 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11251 9077 gene locus_tag LOCUS_14760 11251 9077 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_14760 12057 11248 gene locus_tag LOCUS_14770 12057 11248 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225376.1 protein_id gnl|my_center|LOCUS_14770 12995 12180 gene locus_tag LOCUS_14780 gene mutM 12995 12180 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_14780 13366 13983 gene locus_tag LOCUS_14790 13366 13983 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 protein_id gnl|my_center|LOCUS_14790 13999 15042 gene locus_tag LOCUS_14800 13999 15042 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 protein_id gnl|my_center|LOCUS_14800 15256 15618 gene locus_tag LOCUS_14810 15256 15618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 16636 15935 gene locus_tag LOCUS_14820 16636 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 17272 17099 gene locus_tag LOCUS_14830 17272 17099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 17992 17498 gene locus_tag LOCUS_14840 17992 17498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 18077 18601 gene locus_tag LOCUS_14850 18077 18601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14850 18598 19854 gene locus_tag LOCUS_14860 gene moeA 18598 19854 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 protein_id gnl|my_center|LOCUS_14860 19989 20249 gene locus_tag LOCUS_14870 19989 20249 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140360.1 protein_id gnl|my_center|LOCUS_14870 20249 20518 gene locus_tag LOCUS_14880 20249 20518 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140361.1 protein_id gnl|my_center|LOCUS_14880 20783 20466 gene locus_tag LOCUS_14890 20783 20466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 21277 20801 gene locus_tag LOCUS_14900 21277 20801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14900 >Feature sequence047 962 348 gene locus_tag LOCUS_14910 962 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1942 1595 gene locus_tag LOCUS_14920 1942 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 2380 2033 gene locus_tag LOCUS_14930 2380 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 3267 2647 gene locus_tag LOCUS_14940 gene ureG 3267 2647 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261400.1 protein_id gnl|my_center|LOCUS_14940 3954 3280 gene locus_tag LOCUS_14950 3954 3280 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_14950 4384 3947 gene locus_tag LOCUS_14960 gene ureE 4384 3947 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 protein_id gnl|my_center|LOCUS_14960 6109 4406 gene locus_tag LOCUS_14970 gene ureC 6109 4406 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_14970 6423 6106 gene locus_tag LOCUS_14980 6423 6106 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972299.1 protein_id gnl|my_center|LOCUS_14980 6752 6450 gene locus_tag LOCUS_14990 gene ureA 6752 6450 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 protein_id gnl|my_center|LOCUS_14990 7258 6842 gene locus_tag LOCUS_15000 7258 6842 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_15000 7506 7255 gene locus_tag LOCUS_15010 7506 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 8506 7685 gene locus_tag LOCUS_15020 8506 7685 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098766.1 protein_id gnl|my_center|LOCUS_15020 8750 8523 gene locus_tag LOCUS_15030 8750 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 9630 8848 gene locus_tag LOCUS_15040 gene urtE 9630 8848 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_15040 10454 9630 gene locus_tag LOCUS_15050 gene urtD 10454 9630 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 protein_id gnl|my_center|LOCUS_15050 11542 10451 gene locus_tag LOCUS_15060 gene urtC 11542 10451 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_15060 13237 11591 gene locus_tag LOCUS_15070 gene urtB 13237 11591 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531848.1 protein_id gnl|my_center|LOCUS_15070 14635 13337 gene locus_tag LOCUS_15080 gene urtA 14635 13337 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244008.1 protein_id gnl|my_center|LOCUS_15080 15913 14663 gene locus_tag LOCUS_15090 15913 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 16106 16897 gene locus_tag LOCUS_15100 16106 16897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 16976 20332 gene locus_tag LOCUS_15110 16976 20332 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393613.1 protein_id gnl|my_center|LOCUS_15110 20696 20340 gene locus_tag LOCUS_15120 20696 20340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence048 531 3770 gene locus_tag LOCUS_15130 531 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3819 5489 gene locus_tag LOCUS_15140 gene bcsE 3819 5489 CDS product cellulose biosynthesis protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817396.1 protein_id gnl|my_center|LOCUS_15140 5496 5669 gene locus_tag LOCUS_15150 5496 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 5680 7287 gene locus_tag LOCUS_15160 gene bcsG 5680 7287 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263705.1 protein_id gnl|my_center|LOCUS_15160 7308 7490 gene locus_tag LOCUS_15170 7308 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 7491 8234 gene locus_tag LOCUS_15180 gene bcsQ 7491 8234 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 protein_id gnl|my_center|LOCUS_15180 8249 10873 gene locus_tag LOCUS_15190 gene bcsA 8249 10873 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602571.1 protein_id gnl|my_center|LOCUS_15190 10875 13157 gene locus_tag LOCUS_15200 gene bcsB 10875 13157 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263700.1 protein_id gnl|my_center|LOCUS_15200 13354 14292 gene locus_tag LOCUS_15210 gene bcsZ 13354 14292 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817393.1 protein_id gnl|my_center|LOCUS_15210 15884 14289 gene locus_tag LOCUS_15220 15884 14289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 17418 15910 gene locus_tag LOCUS_15230 17418 15910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 18956 17523 gene locus_tag LOCUS_15240 gene glgA 18956 17523 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_15240 <20600 18998 gene locus_tag LOCUS_15250 <20600 18998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257047.1:1,4-alpha-glucan branching protein GlgB >Feature sequence049 510 1121 gene locus_tag LOCUS_15260 510 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1135 1689 gene locus_tag LOCUS_15270 1135 1689 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263183.1 protein_id gnl|my_center|LOCUS_15270 2357 1737 gene locus_tag LOCUS_15280 2357 1737 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 protein_id gnl|my_center|LOCUS_15280 3123 2458 gene locus_tag LOCUS_15290 3123 2458 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731839.1 protein_id gnl|my_center|LOCUS_15290 3239 3844 gene locus_tag LOCUS_15300 gene yihA 3239 3844 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183344.1 protein_id gnl|my_center|LOCUS_15300 4248 4751 gene locus_tag LOCUS_15310 gene folK 4248 4751 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 protein_id gnl|my_center|LOCUS_15310 4752 5567 gene locus_tag LOCUS_15320 gene panB 4752 5567 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_15320 5573 6415 gene locus_tag LOCUS_15330 gene panC 5573 6415 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071159.1 protein_id gnl|my_center|LOCUS_15330 6578 6961 gene locus_tag LOCUS_15340 6578 6961 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_15340 7133 7567 gene locus_tag LOCUS_15350 gene rlmH 7133 7567 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071400.1 protein_id gnl|my_center|LOCUS_15350 7567 8142 gene locus_tag LOCUS_15360 7567 8142 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_15360 8139 9593 gene locus_tag LOCUS_15370 gene rng 8139 9593 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_15370 9609 13448 gene locus_tag LOCUS_15380 9609 13448 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 protein_id gnl|my_center|LOCUS_15380 13460 14278 gene locus_tag LOCUS_15390 13460 14278 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_15390 14281 14934 gene locus_tag LOCUS_15400 14281 14934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 15120 16559 gene locus_tag LOCUS_15410 gene tldD 15120 16559 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_15410 16627 17958 gene locus_tag LOCUS_15420 gene pmbA 16627 17958 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_15420 18257 19282 gene locus_tag LOCUS_15430 18257 19282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 19312 19833 gene locus_tag LOCUS_15440 19312 19833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence050 973 1326 gene locus_tag LOCUS_15450 973 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1423 2355 gene locus_tag LOCUS_15460 gene htpX 1423 2355 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369784.1 protein_id gnl|my_center|LOCUS_15460 2473 2850 gene locus_tag LOCUS_15470 2473 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2879 3562 gene locus_tag LOCUS_15480 2879 3562 CDS product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262095.1 protein_id gnl|my_center|LOCUS_15480 3559 5607 gene locus_tag LOCUS_15490 3559 5607 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262096.1 protein_id gnl|my_center|LOCUS_15490 5718 9647 gene locus_tag LOCUS_15500 gene hrpA 5718 9647 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268680.1 protein_id gnl|my_center|LOCUS_15500 10399 9830 gene locus_tag LOCUS_15510 gene plsY 10399 9830 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071503.1 protein_id gnl|my_center|LOCUS_15510 10492 10845 gene locus_tag LOCUS_15520 gene folB 10492 10845 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_15520 10849 11337 gene locus_tag LOCUS_15530 gene folK 10849 11337 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_15530 12141 11410 gene locus_tag LOCUS_15540 12141 11410 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_15540 12398 12988 gene locus_tag LOCUS_15550 12398 12988 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_15550 14094 13090 gene locus_tag LOCUS_15560 14094 13090 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_15560 14569 15168 gene locus_tag LOCUS_15570 14569 15168 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198059.1 protein_id gnl|my_center|LOCUS_15570 15225 15629 gene locus_tag LOCUS_15580 15225 15629 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123244.1 protein_id gnl|my_center|LOCUS_15580 15654 16226 gene locus_tag LOCUS_15590 15654 16226 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947139.1 protein_id gnl|my_center|LOCUS_15590 16284 16766 gene locus_tag LOCUS_15600 16284 16766 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071597.1 protein_id gnl|my_center|LOCUS_15600 16799 19132 gene locus_tag LOCUS_15610 gene rlmKL 16799 19132 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017709633.1 protein_id gnl|my_center|LOCUS_15610 19892 19817 gene locus_tag LOCUS_t00240 19892 19817 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 3078 181 gene locus_tag LOCUS_15620 3078 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 4171 3080 gene locus_tag LOCUS_15630 4171 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 5600 4149 gene locus_tag LOCUS_15640 5600 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 6057 5593 gene locus_tag LOCUS_15650 6057 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 8221 6251 gene locus_tag LOCUS_15660 gene htpG 8221 6251 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_15660 8978 8499 gene locus_tag LOCUS_15670 8978 8499 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_15670 9839 9075 gene locus_tag LOCUS_15680 9839 9075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_15680 10764 9844 gene locus_tag LOCUS_15690 10764 9844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_15690 10907 12406 gene locus_tag LOCUS_15700 gene ppx 10907 12406 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_15700 12495 13688 gene locus_tag LOCUS_15710 12495 13688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 14945 13800 gene locus_tag LOCUS_15720 gene lpxB 14945 13800 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_15720 16048 14951 gene locus_tag LOCUS_15730 16048 14951 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_15730 17014 16079 gene locus_tag LOCUS_15740 17014 16079 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947102.1 protein_id gnl|my_center|LOCUS_15740 17989 17147 gene locus_tag LOCUS_15750 17989 17147 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_15750 19357 18122 gene locus_tag LOCUS_15760 19357 18122 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243792.1 protein_id gnl|my_center|LOCUS_15760 19500 19829 gene locus_tag LOCUS_15770 19500 19829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence052 223 1779 gene locus_tag LOCUS_15780 223 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2912 1734 gene locus_tag LOCUS_15790 2912 1734 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948327.1 protein_id gnl|my_center|LOCUS_15790 3183 4067 gene locus_tag LOCUS_15800 3183 4067 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409651.1 protein_id gnl|my_center|LOCUS_15800 4073 5767 gene locus_tag LOCUS_15810 gene recN 4073 5767 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418848.1 protein_id gnl|my_center|LOCUS_15810 7965 5875 gene locus_tag LOCUS_15820 gene fusA 7965 5875 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774533.1 protein_id gnl|my_center|LOCUS_15820 8936 8172 gene locus_tag LOCUS_15830 8936 8172 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_15830 10001 8997 gene locus_tag LOCUS_15840 gene rfbB 10001 8997 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186461.1 protein_id gnl|my_center|LOCUS_15840 10882 10001 gene locus_tag LOCUS_15850 gene rfbD 10882 10001 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931999.1 protein_id gnl|my_center|LOCUS_15850 11447 10875 gene locus_tag LOCUS_15860 gene rfbC 11447 10875 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_15860 12335 11448 gene locus_tag LOCUS_15870 gene rfbA 12335 11448 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795876.1 protein_id gnl|my_center|LOCUS_15870 13391 12354 gene locus_tag LOCUS_15880 gene holA 13391 12354 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_15880 13890 13393 gene locus_tag LOCUS_15890 gene lptE 13890 13393 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269949.1 protein_id gnl|my_center|LOCUS_15890 16430 13980 gene locus_tag LOCUS_15900 gene leuS 16430 13980 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154223677.1 protein_id gnl|my_center|LOCUS_15900 16514 16999 gene locus_tag LOCUS_15910 16514 16999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 17059 17844 gene locus_tag LOCUS_15920 17059 17844 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_15920 17962 18759 gene locus_tag LOCUS_15930 17962 18759 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence053 765 223 gene locus_tag LOCUS_15940 gene def 765 223 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_15940 3533 765 gene locus_tag LOCUS_15950 gene ppk1 3533 765 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_15950 4436 3537 gene locus_tag LOCUS_15960 4436 3537 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_15960 4928 4452 gene locus_tag LOCUS_15970 4928 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 5055 6062 gene locus_tag LOCUS_15980 gene moaA 5055 6062 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104052.1 protein_id gnl|my_center|LOCUS_15980 7811 6066 gene locus_tag LOCUS_15990 gene recJ 7811 6066 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266941.1 protein_id gnl|my_center|LOCUS_15990 9612 7837 gene locus_tag LOCUS_16000 9612 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 9919 12705 gene locus_tag LOCUS_16010 9919 12705 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 protein_id gnl|my_center|LOCUS_16010 12752 15082 gene locus_tag LOCUS_16020 12752 15082 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786535.1 protein_id gnl|my_center|LOCUS_16020 15154 15591 gene locus_tag LOCUS_16030 gene ssb1 15154 15591 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168322.1 protein_id gnl|my_center|LOCUS_16030 16109 15720 gene locus_tag LOCUS_16040 16109 15720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 16139 16915 gene locus_tag LOCUS_16050 16139 16915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 17840 17157 gene locus_tag LOCUS_16060 17840 17157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 18220 17867 gene locus_tag LOCUS_16070 18220 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 18645 19205 gene locus_tag LOCUS_16080 18645 19205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence054 632 249 gene locus_tag LOCUS_16090 632 249 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329247.1 protein_id gnl|my_center|LOCUS_16090 783 1115 gene locus_tag LOCUS_16100 783 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1905 2519 gene locus_tag LOCUS_16110 1905 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3048 3368 gene locus_tag LOCUS_16120 3048 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 4882 3437 gene locus_tag LOCUS_16130 4882 3437 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448901.1 protein_id gnl|my_center|LOCUS_16130 9528 4906 gene locus_tag LOCUS_16140 gene gltB 9528 4906 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_16140 9884 11101 gene locus_tag LOCUS_16150 9884 11101 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707015.1 protein_id gnl|my_center|LOCUS_16150 11575 11180 gene locus_tag LOCUS_16160 11575 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 11760 13187 gene locus_tag LOCUS_16170 11760 13187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 13365 13742 gene locus_tag LOCUS_16180 13365 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 15145 13754 gene locus_tag LOCUS_16190 15145 13754 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_16190 15676 15242 gene locus_tag LOCUS_16200 15676 15242 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_16200 16042 15764 gene locus_tag LOCUS_16210 16042 15764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 16644 16312 gene locus_tag LOCUS_16220 gene erpA 16644 16312 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_16220 17753 16707 gene locus_tag LOCUS_16230 gene argC 17753 16707 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_16230 17839 18828 gene locus_tag LOCUS_16240 17839 18828 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_16240 18834 19247 gene locus_tag LOCUS_16250 18834 19247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence055 3240 145 gene locus_tag LOCUS_16260 3240 145 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459048.1 protein_id gnl|my_center|LOCUS_16260 3610 3329 gene locus_tag LOCUS_16270 3610 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 3855 3607 gene locus_tag LOCUS_16280 3855 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 4563 3949 gene locus_tag LOCUS_16290 4563 3949 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_16290 5239 4613 gene locus_tag LOCUS_16300 5239 4613 CDS product DUF3780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117920.1 protein_id gnl|my_center|LOCUS_16300 8362 5243 gene locus_tag LOCUS_16310 8362 5243 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117919.1 protein_id gnl|my_center|LOCUS_16310 8623 8916 gene locus_tag LOCUS_16320 8623 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 9403 9194 gene locus_tag LOCUS_16330 9403 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 9700 10827 gene locus_tag LOCUS_16340 9700 10827 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_16340 10824 12620 gene locus_tag LOCUS_16350 10824 12620 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566012.1 protein_id gnl|my_center|LOCUS_16350 12631 13347 gene locus_tag LOCUS_16360 gene cybH 12631 13347 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965636.1 protein_id gnl|my_center|LOCUS_16360 13344 14027 gene locus_tag LOCUS_16370 13344 14027 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 protein_id gnl|my_center|LOCUS_16370 14027 14323 gene locus_tag LOCUS_16380 14027 14323 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089676.1 protein_id gnl|my_center|LOCUS_16380 14320 14739 gene locus_tag LOCUS_16390 14320 14739 CDS product hydrogenase expression/formation protein HupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089675.1 protein_id gnl|my_center|LOCUS_16390 14786 15634 gene locus_tag LOCUS_16400 14786 15634 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 protein_id gnl|my_center|LOCUS_16400 15631 15858 gene locus_tag LOCUS_16410 15631 15858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16410 15855 16328 gene locus_tag LOCUS_16420 gene hybE 15855 16328 CDS product [NiFe]-hydrogenase assembly chaperone HybE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089672.1 protein_id gnl|my_center|LOCUS_16420 16328 17530 gene locus_tag LOCUS_16430 16328 17530 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_16430 17523 17864 gene locus_tag LOCUS_16440 gene hypA 17523 17864 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_16440 17864 18679 gene locus_tag LOCUS_16450 gene hypB 17864 18679 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337646.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence056 659 126 gene locus_tag LOCUS_16460 659 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1173 1394 gene locus_tag LOCUS_16470 1173 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1582 1770 gene locus_tag LOCUS_16480 1582 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1790 2068 gene locus_tag LOCUS_16490 1790 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2183 2794 gene locus_tag LOCUS_16500 2183 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2794 5259 gene locus_tag LOCUS_16510 gene copA 2794 5259 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_16510 5262 6092 gene locus_tag LOCUS_16520 5262 6092 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178201.1 protein_id gnl|my_center|LOCUS_16520 6190 8523 gene locus_tag LOCUS_16530 6190 8523 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_16530 8557 9849 gene locus_tag LOCUS_16540 8557 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 10095 10628 gene locus_tag LOCUS_16550 10095 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 12439 10700 gene locus_tag LOCUS_16560 12439 10700 CDS product sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088244.1 protein_id gnl|my_center|LOCUS_16560 18002 12555 gene locus_tag LOCUS_16570 18002 12555 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651396.1 protein_id gnl|my_center|LOCUS_16570 18731 18420 gene locus_tag LOCUS_16580 18731 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16580 >Feature sequence057 1317 2981 gene locus_tag LOCUS_16590 1317 2981 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799342.1 protein_id gnl|my_center|LOCUS_16590 2996 5269 gene locus_tag LOCUS_16600 2996 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5303 6856 gene locus_tag LOCUS_16610 5303 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 6905 8251 gene locus_tag LOCUS_16620 gene tssK 6905 8251 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973757.1 protein_id gnl|my_center|LOCUS_16620 8256 9611 gene locus_tag LOCUS_16630 8256 9611 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190689.1 protein_id gnl|my_center|LOCUS_16630 9628 13140 gene locus_tag LOCUS_16640 gene tssM 9628 13140 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 protein_id gnl|my_center|LOCUS_16640 13140 14609 gene locus_tag LOCUS_16650 13140 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 14628 15638 gene locus_tag LOCUS_16660 gene tssA 14628 15638 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115054.1 protein_id gnl|my_center|LOCUS_16660 15668 16192 gene locus_tag LOCUS_16670 gene tssB 15668 16192 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 protein_id gnl|my_center|LOCUS_16670 16196 17689 gene locus_tag LOCUS_16680 gene tssC 16196 17689 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 protein_id gnl|my_center|LOCUS_16680 17771 18169 gene locus_tag LOCUS_16690 gene hcp 17771 18169 CDS product type VI secretion system receptor/chaperone Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083670.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence058 124 1515 gene locus_tag LOCUS_16700 124 1515 CDS product RES domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339587.1 protein_id gnl|my_center|LOCUS_16700 2613 3065 gene locus_tag LOCUS_16710 gene nrdR 2613 3065 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_16710 3065 4162 gene locus_tag LOCUS_16720 gene ribD 3065 4162 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150434.1 protein_id gnl|my_center|LOCUS_16720 4172 4828 gene locus_tag LOCUS_16730 4172 4828 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_16730 4828 5931 gene locus_tag LOCUS_16740 gene ribBA 4828 5931 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_16740 5993 6469 gene locus_tag LOCUS_16750 gene ribE 5993 6469 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555427.1 protein_id gnl|my_center|LOCUS_16750 6469 6921 gene locus_tag LOCUS_16760 gene nusB 6469 6921 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_16760 6922 7857 gene locus_tag LOCUS_16770 gene thiL 6922 7857 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694465.1 protein_id gnl|my_center|LOCUS_16770 7841 8359 gene locus_tag LOCUS_16780 7841 8359 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_16780 9982 8429 gene locus_tag LOCUS_16790 9982 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 10460 12337 gene locus_tag LOCUS_16800 10460 12337 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766050.1 protein_id gnl|my_center|LOCUS_16800 12546 13574 gene locus_tag LOCUS_16810 12546 13574 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_16810 13571 14797 gene locus_tag LOCUS_16820 gene lplT 13571 14797 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_16820 15002 16426 gene locus_tag LOCUS_16830 15002 16426 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056019.1 protein_id gnl|my_center|LOCUS_16830 17696 16464 gene locus_tag LOCUS_16840 17696 16464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 18019 17693 gene locus_tag LOCUS_16850 18019 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence059 849 139 gene locus_tag LOCUS_16860 849 139 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_16860 945 1145 gene locus_tag LOCUS_16870 gene rpmE 945 1145 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 protein_id gnl|my_center|LOCUS_16870 1399 2499 gene locus_tag LOCUS_16880 gene pilM 1399 2499 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_16880 2496 3101 gene locus_tag LOCUS_16890 2496 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3082 3690 gene locus_tag LOCUS_16900 3082 3690 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014841277.1 protein_id gnl|my_center|LOCUS_16900 3801 4253 gene locus_tag LOCUS_16910 3801 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4334 5908 gene locus_tag LOCUS_16920 4334 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 7723 5912 gene locus_tag LOCUS_16930 7723 5912 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070895.1 protein_id gnl|my_center|LOCUS_16930 8135 8623 gene locus_tag LOCUS_16940 8135 8623 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_16940 8629 9720 gene locus_tag LOCUS_16950 gene aroB 8629 9720 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 protein_id gnl|my_center|LOCUS_16950 9698 10474 gene locus_tag LOCUS_16960 9698 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 10510 11574 gene locus_tag LOCUS_16970 gene hemE 10510 11574 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095015.1 protein_id gnl|my_center|LOCUS_16970 12665 11697 gene locus_tag LOCUS_16980 gene accA 12665 11697 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212147.1 protein_id gnl|my_center|LOCUS_16980 12826 13230 gene locus_tag LOCUS_16990 12826 13230 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880124.1 protein_id gnl|my_center|LOCUS_16990 13237 13680 gene locus_tag LOCUS_17000 13237 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 15818 13701 gene locus_tag LOCUS_17010 15818 13701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 15994 16524 gene locus_tag LOCUS_17020 15994 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 16530 17024 gene locus_tag LOCUS_17030 16530 17024 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104801.1 protein_id gnl|my_center|LOCUS_17030 17553 17026 gene locus_tag LOCUS_17040 17553 17026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence060 634 798 gene locus_tag LOCUS_17050 634 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1115 1534 gene locus_tag LOCUS_17060 1115 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2662 1565 gene locus_tag LOCUS_17070 gene nadA 2662 1565 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_17070 4471 2678 gene locus_tag LOCUS_17080 gene aspS 4471 2678 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104814.1 protein_id gnl|my_center|LOCUS_17080 4828 4559 gene locus_tag LOCUS_17090 4828 4559 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772089.1 protein_id gnl|my_center|LOCUS_17090 4940 5971 gene locus_tag LOCUS_17100 gene pyrC 4940 5971 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073490.1 protein_id gnl|my_center|LOCUS_17100 6057 6680 gene locus_tag LOCUS_17110 gene rnt 6057 6680 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_17110 7090 6767 gene locus_tag LOCUS_17120 gene grxD 7090 6767 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771068.1 protein_id gnl|my_center|LOCUS_17120 7267 8448 gene locus_tag LOCUS_17130 7267 8448 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_17130 8457 9356 gene locus_tag LOCUS_17140 gene argF 8457 9356 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_17140 9350 10084 gene locus_tag LOCUS_17150 9350 10084 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125331.1 protein_id gnl|my_center|LOCUS_17150 10336 10148 gene locus_tag LOCUS_17160 10336 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 12432 10420 gene locus_tag LOCUS_17170 gene uvrB 12432 10420 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769676.1 protein_id gnl|my_center|LOCUS_17170 12538 13719 gene locus_tag LOCUS_17180 12538 13719 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945831.1 protein_id gnl|my_center|LOCUS_17180 14226 13786 gene locus_tag LOCUS_17190 gene gloA 14226 13786 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_17190 16028 14376 gene locus_tag LOCUS_17200 16028 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 16528 16076 gene locus_tag LOCUS_17210 16528 16076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 17371 16577 gene locus_tag LOCUS_17220 17371 16577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence061 405 1019 gene locus_tag LOCUS_17230 405 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1334 1128 gene locus_tag LOCUS_17240 1334 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1499 2155 gene locus_tag LOCUS_17250 1499 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3123 2158 gene locus_tag LOCUS_17260 3123 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3370 4461 gene locus_tag LOCUS_17270 gene ychF 3370 4461 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 protein_id gnl|my_center|LOCUS_17270 4516 4592 gene locus_tag LOCUS_t00250 4516 4592 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4647 8528 gene locus_tag LOCUS_17280 4647 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 8758 9720 gene locus_tag LOCUS_17290 8758 9720 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_17290 11315 9717 gene locus_tag LOCUS_17300 11315 9717 CDS product UDP-phosphomannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957674.1 protein_id gnl|my_center|LOCUS_17300 11393 12052 gene locus_tag LOCUS_17310 11393 12052 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_17310 13633 12251 gene locus_tag LOCUS_17320 gene tolC 13633 12251 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735329.1 protein_id gnl|my_center|LOCUS_17320 16782 13633 gene locus_tag LOCUS_17330 gene mexK 16782 13633 CDS product multidrug efflux RND transporter permease subunit MexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_17330 17306 16779 gene locus_tag LOCUS_17340 17306 16779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence062 2471 126 gene locus_tag LOCUS_17350 2471 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3217 4209 gene locus_tag LOCUS_17360 3217 4209 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_17360 4206 4637 gene locus_tag LOCUS_17370 4206 4637 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300228.1 protein_id gnl|my_center|LOCUS_17370 5196 4675 gene locus_tag LOCUS_17380 5196 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6117 5362 gene locus_tag LOCUS_17390 6117 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 7334 6255 gene locus_tag LOCUS_17400 7334 6255 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728430.1 protein_id gnl|my_center|LOCUS_17400 8035 7349 gene locus_tag LOCUS_17410 gene pgl 8035 7349 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547427.1 protein_id gnl|my_center|LOCUS_17410 9521 8037 gene locus_tag LOCUS_17420 gene zwf 9521 8037 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_17420 11007 9562 gene locus_tag LOCUS_17430 gene gnd 11007 9562 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477829.1 protein_id gnl|my_center|LOCUS_17430 11190 11265 gene locus_tag LOCUS_t00260 11190 11265 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11410 12231 gene locus_tag LOCUS_17440 11410 12231 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799698.1 protein_id gnl|my_center|LOCUS_17440 12668 12396 gene locus_tag LOCUS_17450 12668 12396 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377382.1 protein_id gnl|my_center|LOCUS_17450 14280 12670 gene locus_tag LOCUS_17460 14280 12670 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_17460 16294 14666 gene locus_tag LOCUS_17470 16294 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 16510 17124 gene locus_tag LOCUS_17480 16510 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence063 86 820 gene locus_tag LOCUS_17490 86 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 899 1525 gene locus_tag LOCUS_17500 899 1525 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 protein_id gnl|my_center|LOCUS_17500 1527 2729 gene locus_tag LOCUS_17510 gene trpB 1527 2729 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 protein_id gnl|my_center|LOCUS_17510 2726 3529 gene locus_tag LOCUS_17520 gene trpA 2726 3529 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_17520 3562 4524 gene locus_tag LOCUS_17530 gene accD 3562 4524 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706493.1 protein_id gnl|my_center|LOCUS_17530 4537 5826 gene locus_tag LOCUS_17540 gene folC 4537 5826 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957872.1 protein_id gnl|my_center|LOCUS_17540 5823 6662 gene locus_tag LOCUS_17550 5823 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 6705 7196 gene locus_tag LOCUS_17560 6705 7196 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957874.1 protein_id gnl|my_center|LOCUS_17560 7223 8722 gene locus_tag LOCUS_17570 gene purF 7223 8722 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347797.1 protein_id gnl|my_center|LOCUS_17570 8799 9983 gene locus_tag LOCUS_17580 8799 9983 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_17580 10001 10897 gene locus_tag LOCUS_17590 gene yihV 10001 10897 CDS product sulfofructose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621622.1 protein_id gnl|my_center|LOCUS_17590 10925 11953 gene locus_tag LOCUS_17600 10925 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 12020 13471 gene locus_tag LOCUS_17610 12020 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 13468 14871 gene locus_tag LOCUS_17620 13468 14871 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970749.1 protein_id gnl|my_center|LOCUS_17620 15282 16319 gene locus_tag LOCUS_17630 15282 16319 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_17630 16800 16411 gene locus_tag LOCUS_17640 16800 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence064 589 1203 gene locus_tag LOCUS_17650 589 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1912 1304 gene locus_tag LOCUS_17660 1912 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2102 2719 gene locus_tag LOCUS_17670 2102 2719 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391567.1 protein_id gnl|my_center|LOCUS_17670 3924 2725 gene locus_tag LOCUS_17680 gene coaBC 3924 2725 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260987.1 protein_id gnl|my_center|LOCUS_17680 6444 4027 gene locus_tag LOCUS_17690 gene gyrB 6444 4027 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356688.1 protein_id gnl|my_center|LOCUS_17690 7566 6490 gene locus_tag LOCUS_17700 gene recF 7566 6490 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 protein_id gnl|my_center|LOCUS_17700 8694 7576 gene locus_tag LOCUS_17710 gene dnaN 8694 7576 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_17710 10381 9047 gene locus_tag LOCUS_17720 gene dnaA 10381 9047 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945763.1 protein_id gnl|my_center|LOCUS_17720 10550 10684 gene locus_tag LOCUS_17730 gene rpmH 10550 10684 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828326.1 protein_id gnl|my_center|LOCUS_17730 10695 11063 gene locus_tag LOCUS_17740 gene rnpA 10695 11063 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707927.1 protein_id gnl|my_center|LOCUS_17740 11271 12989 gene locus_tag LOCUS_17750 gene yidC 11271 12989 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_17750 12991 14334 gene locus_tag LOCUS_17760 gene mnmE 12991 14334 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019075.1 protein_id gnl|my_center|LOCUS_17760 16902 14542 gene locus_tag LOCUS_17770 16902 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence065 2423 162 gene locus_tag LOCUS_17780 2423 162 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 protein_id gnl|my_center|LOCUS_17780 3232 2552 gene locus_tag LOCUS_17790 gene lolD 3232 2552 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481886.1 protein_id gnl|my_center|LOCUS_17790 4472 3225 gene locus_tag LOCUS_17800 4472 3225 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_17800 4913 4497 gene locus_tag LOCUS_17810 gene fur 4913 4497 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_17810 5203 5589 gene locus_tag LOCUS_17820 5203 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 5941 5657 gene locus_tag LOCUS_17830 5941 5657 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 protein_id gnl|my_center|LOCUS_17830 6365 5934 gene locus_tag LOCUS_17840 6365 5934 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815876.1 protein_id gnl|my_center|LOCUS_17840 7727 6366 gene locus_tag LOCUS_17850 7727 6366 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_17850 7825 8310 gene locus_tag LOCUS_17860 gene smpB 7825 8310 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120348.1 protein_id gnl|my_center|LOCUS_17860 8359 8718 gene locus_tag LOCUS_17870 8359 8718 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_17870 8821 9561 gene locus_tag LOCUS_17880 gene pssA 8821 9561 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_17880 9807 11351 gene locus_tag LOCUS_17890 9807 11351 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_17890 11405 12100 gene locus_tag LOCUS_17900 11405 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 12109 12636 gene locus_tag LOCUS_17910 gene rimI 12109 12636 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_17910 13597 12923 gene locus_tag LOCUS_17920 gene radC 13597 12923 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_17920 14228 13707 gene locus_tag LOCUS_17930 14228 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 14866 14288 gene locus_tag LOCUS_17940 14866 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 15346 14867 gene locus_tag LOCUS_17950 15346 14867 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731152.1 protein_id gnl|my_center|LOCUS_17950 16938 15385 gene locus_tag LOCUS_17960 16938 15385 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396789.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence066 2407 95 gene locus_tag LOCUS_17970 2407 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 3541 2750 gene locus_tag LOCUS_17980 gene eutC 3541 2750 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770129.1 protein_id gnl|my_center|LOCUS_17980 4935 3538 gene locus_tag LOCUS_17990 4935 3538 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093232.1 protein_id gnl|my_center|LOCUS_17990 5250 4990 gene locus_tag LOCUS_18000 5250 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 6810 5266 gene locus_tag LOCUS_18010 6810 5266 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880089.1 protein_id gnl|my_center|LOCUS_18010 8411 6810 gene locus_tag LOCUS_18020 8411 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 8810 9394 gene locus_tag LOCUS_18030 gene rsxA 8810 9394 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_18030 9408 9974 gene locus_tag LOCUS_18040 9408 9974 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339116.1 protein_id gnl|my_center|LOCUS_18040 9968 11491 gene locus_tag LOCUS_18050 gene rsxC 9968 11491 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_18050 11488 12561 gene locus_tag LOCUS_18060 11488 12561 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_18060 12610 13320 gene locus_tag LOCUS_18070 gene rsxG 12610 13320 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_18070 13330 14022 gene locus_tag LOCUS_18080 13330 14022 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119632344.1 protein_id gnl|my_center|LOCUS_18080 14050 14310 gene locus_tag LOCUS_18090 14050 14310 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192405.1 protein_id gnl|my_center|LOCUS_18090 14317 14772 gene locus_tag LOCUS_18100 14317 14772 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754241.1 protein_id gnl|my_center|LOCUS_18100 14797 15369 gene locus_tag LOCUS_18110 14797 15369 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_18110 15679 15434 gene locus_tag LOCUS_18120 15679 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence067 530 1648 gene locus_tag LOCUS_18130 530 1648 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194378.1 protein_id gnl|my_center|LOCUS_18130 1742 2854 gene locus_tag LOCUS_18140 1742 2854 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938575.1 protein_id gnl|my_center|LOCUS_18140 2847 3887 gene locus_tag LOCUS_18150 2847 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 4910 3891 gene locus_tag LOCUS_18160 4910 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 5098 6111 gene locus_tag LOCUS_18170 5098 6111 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_18170 6124 7347 gene locus_tag LOCUS_18180 6124 7347 CDS product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968670.1 protein_id gnl|my_center|LOCUS_18180 8703 7354 gene locus_tag LOCUS_18190 8703 7354 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447772.1 protein_id gnl|my_center|LOCUS_18190 16351 8705 gene locus_tag LOCUS_18200 16351 8705 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063855.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence068 <1 1171 gene locus_tag LOCUS_18210 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003806883.1:elongation factor Tu 1220 1295 gene locus_tag LOCUS_t00270 1220 1295 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1339 1737 gene locus_tag LOCUS_18220 gene secE 1339 1737 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555502.1 protein_id gnl|my_center|LOCUS_18220 1742 2275 gene locus_tag LOCUS_18230 gene nusG 1742 2275 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 protein_id gnl|my_center|LOCUS_18230 2397 2828 gene locus_tag LOCUS_18240 gene rplK 2397 2828 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 protein_id gnl|my_center|LOCUS_18240 2828 3523 gene locus_tag LOCUS_18250 gene rplA 2828 3523 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707704.1 protein_id gnl|my_center|LOCUS_18250 3707 4204 gene locus_tag LOCUS_18260 gene rplJ 3707 4204 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946071.1 protein_id gnl|my_center|LOCUS_18260 4256 4624 gene locus_tag LOCUS_18270 gene rplL 4256 4624 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_18270 4765 8856 gene locus_tag LOCUS_18280 gene rpoB 4765 8856 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_18280 9026 13231 gene locus_tag LOCUS_18290 gene rpoC 9026 13231 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_18290 13354 13776 gene locus_tag LOCUS_18300 gene rpsL 13354 13776 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417208.1 protein_id gnl|my_center|LOCUS_18300 13795 14265 gene locus_tag LOCUS_18310 gene rpsG 13795 14265 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093742.1 protein_id gnl|my_center|LOCUS_18310 14299 16392 gene locus_tag LOCUS_18320 gene fusA 14299 16392 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946076.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence069 3289 230 gene locus_tag LOCUS_18330 3289 230 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921619.1 protein_id gnl|my_center|LOCUS_18330 4426 3296 gene locus_tag LOCUS_18340 4426 3296 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171251.1 protein_id gnl|my_center|LOCUS_18340 6039 4480 gene locus_tag LOCUS_18350 6039 4480 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_18350 6207 7592 gene locus_tag LOCUS_18360 gene dbpA 6207 7592 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940864.1 protein_id gnl|my_center|LOCUS_18360 8455 7598 gene locus_tag LOCUS_18370 gene rapZ 8455 7598 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268862.1 protein_id gnl|my_center|LOCUS_18370 8838 8548 gene locus_tag LOCUS_18380 gene hpf 8838 8548 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073700.1 protein_id gnl|my_center|LOCUS_18380 10344 8893 gene locus_tag LOCUS_18390 10344 8893 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377556.1 protein_id gnl|my_center|LOCUS_18390 11151 10426 gene locus_tag LOCUS_18400 gene lptB 11151 10426 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_18400 11800 11246 gene locus_tag LOCUS_18410 gene lptA 11800 11246 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216438.1 protein_id gnl|my_center|LOCUS_18410 12368 11781 gene locus_tag LOCUS_18420 gene lptC 12368 11781 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195210.1 protein_id gnl|my_center|LOCUS_18420 12919 12365 gene locus_tag LOCUS_18430 12919 12365 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689546.1 protein_id gnl|my_center|LOCUS_18430 13896 12919 gene locus_tag LOCUS_18440 13896 12919 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_18440 14264 14686 gene locus_tag LOCUS_18450 14264 14686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 15099 15665 gene locus_tag LOCUS_18460 15099 15665 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880261.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence070 1010 615 gene locus_tag LOCUS_18470 1010 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1333 1106 gene locus_tag LOCUS_18480 1333 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2695 1643 gene locus_tag LOCUS_18490 2695 1643 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203518.1 protein_id gnl|my_center|LOCUS_18490 3590 4204 gene locus_tag LOCUS_18500 3590 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 4787 4260 gene locus_tag LOCUS_18510 gene rfaH 4787 4260 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268290.1 protein_id gnl|my_center|LOCUS_18510 5453 4866 gene locus_tag LOCUS_18520 5453 4866 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207732.1 protein_id gnl|my_center|LOCUS_18520 6191 5460 gene locus_tag LOCUS_18530 6191 5460 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 protein_id gnl|my_center|LOCUS_18530 7491 6193 gene locus_tag LOCUS_18540 7491 6193 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_18540 7886 7488 gene locus_tag LOCUS_18550 7886 7488 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931865.1 protein_id gnl|my_center|LOCUS_18550 8749 7883 gene locus_tag LOCUS_18560 8749 7883 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 protein_id gnl|my_center|LOCUS_18560 9802 8774 gene locus_tag LOCUS_18570 gene wecA 9802 8774 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211988.1 protein_id gnl|my_center|LOCUS_18570 10527 9814 gene locus_tag LOCUS_18580 10527 9814 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389242.1 protein_id gnl|my_center|LOCUS_18580 11263 10550 gene locus_tag LOCUS_18590 11263 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 13521 11272 gene locus_tag LOCUS_18600 13521 11272 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_18600 14186 13590 gene locus_tag LOCUS_18610 14186 13590 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 protein_id gnl|my_center|LOCUS_18610 15576 14233 gene locus_tag LOCUS_18620 15576 14233 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639895.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence071 1239 394 gene locus_tag LOCUS_18630 1239 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2779 1586 gene locus_tag LOCUS_18640 2779 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 3208 4569 gene locus_tag LOCUS_18650 gene trkA 3208 4569 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 protein_id gnl|my_center|LOCUS_18650 4630 6087 gene locus_tag LOCUS_18660 4630 6087 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_18660 7450 6098 gene locus_tag LOCUS_18670 gene xseA 7450 6098 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261371.1 protein_id gnl|my_center|LOCUS_18670 7538 7858 gene locus_tag LOCUS_18680 gene sugE 7538 7858 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142980.1 protein_id gnl|my_center|LOCUS_18680 7860 8150 gene locus_tag LOCUS_18690 7860 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 8141 8473 gene locus_tag LOCUS_18700 gene tusE 8141 8473 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904446.1 protein_id gnl|my_center|LOCUS_18700 8889 8494 gene locus_tag LOCUS_18710 gene hslR 8889 8494 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703665.1 protein_id gnl|my_center|LOCUS_18710 9838 8879 gene locus_tag LOCUS_18720 gene ispH 9838 8879 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 protein_id gnl|my_center|LOCUS_18720 10360 9875 gene locus_tag LOCUS_18730 gene rraA 10360 9875 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417181.1 protein_id gnl|my_center|LOCUS_18730 11769 10375 gene locus_tag LOCUS_18740 gene yegQ 11769 10375 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_18740 11904 14042 gene locus_tag LOCUS_18750 gene scpA 11904 14042 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073260.1 protein_id gnl|my_center|LOCUS_18750 14039 15046 gene locus_tag LOCUS_18760 gene meaB 14039 15046 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606505.1 protein_id gnl|my_center|LOCUS_18760 15043 15837 gene locus_tag LOCUS_18770 gene scpB 15043 15837 CDS product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816217.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence072 990 613 gene locus_tag LOCUS_18780 990 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1178 987 gene locus_tag LOCUS_18790 1178 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2600 1275 gene locus_tag LOCUS_18800 2600 1275 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195684.1 protein_id gnl|my_center|LOCUS_18800 2712 3794 gene locus_tag LOCUS_18810 2712 3794 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073947.1 protein_id gnl|my_center|LOCUS_18810 3808 6465 gene locus_tag LOCUS_18820 3808 6465 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 protein_id gnl|my_center|LOCUS_18820 6511 8670 gene locus_tag LOCUS_18830 6511 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 8697 9818 gene locus_tag LOCUS_18840 gene aroG 8697 9818 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_18840 11711 9819 gene locus_tag LOCUS_18850 gene parE 11711 9819 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195318.1 protein_id gnl|my_center|LOCUS_18850 12596 11775 gene locus_tag LOCUS_18860 gene mazG 12596 11775 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 protein_id gnl|my_center|LOCUS_18860 13544 12612 gene locus_tag LOCUS_18870 13544 12612 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_18870 13914 13555 gene locus_tag LOCUS_18880 13914 13555 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002902.1 protein_id gnl|my_center|LOCUS_18880 14383 14003 gene locus_tag LOCUS_18890 gene gcvH 14383 14003 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307993.1 protein_id gnl|my_center|LOCUS_18890 14523 14780 gene locus_tag LOCUS_18900 gene grxC 14523 14780 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_18900 15018 15617 gene locus_tag LOCUS_18910 15018 15617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence073 86 1441 gene locus_tag LOCUS_18920 86 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2218 1664 gene locus_tag LOCUS_18930 2218 1664 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 protein_id gnl|my_center|LOCUS_18930 2299 2664 gene locus_tag LOCUS_18940 2299 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2751 4010 gene locus_tag LOCUS_18950 2751 4010 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_18950 4020 5678 gene locus_tag LOCUS_18960 4020 5678 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922276.1 protein_id gnl|my_center|LOCUS_18960 6306 5851 gene locus_tag LOCUS_18970 6306 5851 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_18970 7349 6672 gene locus_tag LOCUS_18980 7349 6672 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206353.1 protein_id gnl|my_center|LOCUS_18980 8524 7346 gene locus_tag LOCUS_18990 8524 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 9697 8621 gene locus_tag LOCUS_19000 9697 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 10163 9690 gene locus_tag LOCUS_19010 10163 9690 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542282.1 protein_id gnl|my_center|LOCUS_19010 10604 10260 gene locus_tag LOCUS_19020 10604 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 12226 10601 gene locus_tag LOCUS_19030 12226 10601 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 protein_id gnl|my_center|LOCUS_19030 12964 12233 gene locus_tag LOCUS_19040 gene cpaB 12964 12233 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_19040 13585 12983 gene locus_tag LOCUS_19050 13585 12983 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523374.1 protein_id gnl|my_center|LOCUS_19050 13916 13728 gene locus_tag LOCUS_19060 13916 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 15230 14322 gene locus_tag LOCUS_19070 15230 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence074 <1 939 gene locus_tag LOCUS_19080 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002243962.1:quinone-dependent dihydroorotate dehydrogenase 1805 1062 gene locus_tag LOCUS_19090 1805 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3518 2154 gene locus_tag LOCUS_19100 3518 2154 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946399.1 protein_id gnl|my_center|LOCUS_19100 4703 3597 gene locus_tag LOCUS_19110 4703 3597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168094.1 protein_id gnl|my_center|LOCUS_19110 5836 4706 gene locus_tag LOCUS_19120 5836 4706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168097.1 protein_id gnl|my_center|LOCUS_19120 7550 5829 gene locus_tag LOCUS_19130 7550 5829 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 protein_id gnl|my_center|LOCUS_19130 8560 7547 gene locus_tag LOCUS_19140 gene hlyD 8560 7547 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158910.1 protein_id gnl|my_center|LOCUS_19140 8768 9541 gene locus_tag LOCUS_19150 8768 9541 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774684.1 protein_id gnl|my_center|LOCUS_19150 9607 10059 gene locus_tag LOCUS_19160 9607 10059 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502504.1 protein_id gnl|my_center|LOCUS_19160 10512 10084 gene locus_tag LOCUS_19170 10512 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 10671 11480 gene locus_tag LOCUS_19180 10671 11480 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943595.1 protein_id gnl|my_center|LOCUS_19180 13138 11504 gene locus_tag LOCUS_19190 13138 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19190 13821 13129 gene locus_tag LOCUS_19200 13821 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19200 15139 13901 gene locus_tag LOCUS_19210 15139 13901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence075 510 1733 gene locus_tag LOCUS_19220 510 1733 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 protein_id gnl|my_center|LOCUS_19220 2917 1901 gene locus_tag LOCUS_19230 gene ilvC 2917 1901 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_19230 3481 2987 gene locus_tag LOCUS_19240 gene ilvN 3481 2987 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_19240 5214 3478 gene locus_tag LOCUS_19250 5214 3478 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185769.1 protein_id gnl|my_center|LOCUS_19250 5864 5448 gene locus_tag LOCUS_19260 5864 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 6745 5906 gene locus_tag LOCUS_19270 gene prmC 6745 5906 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948043.1 protein_id gnl|my_center|LOCUS_19270 7837 6752 gene locus_tag LOCUS_19280 gene prfA 7837 6752 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019960.1 protein_id gnl|my_center|LOCUS_19280 9093 7834 gene locus_tag LOCUS_19290 gene hemA 9093 7834 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_19290 9355 11100 gene locus_tag LOCUS_19300 9355 11100 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074907579.1 protein_id gnl|my_center|LOCUS_19300 11154 11696 gene locus_tag LOCUS_19310 gene lolB 11154 11696 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365627.1 protein_id gnl|my_center|LOCUS_19310 11704 12558 gene locus_tag LOCUS_19320 gene ispE 11704 12558 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_19320 12563 12637 gene locus_tag LOCUS_t00280 12563 12637 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12676 13629 gene locus_tag LOCUS_19330 12676 13629 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036108.1 protein_id gnl|my_center|LOCUS_19330 13697 14299 gene locus_tag LOCUS_19340 13697 14299 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948352.1 protein_id gnl|my_center|LOCUS_19340 14318 14884 gene locus_tag LOCUS_19350 gene pth 14318 14884 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931308.1 protein_id gnl|my_center|LOCUS_19350 15047 15131 gene locus_tag LOCUS_t00290 15047 15131 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence076 <1 1171 gene locus_tag LOCUS_19360 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003806883.1:elongation factor Tu 1177 1488 gene locus_tag LOCUS_19370 gene rpsJ 1177 1488 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 protein_id gnl|my_center|LOCUS_19370 1507 2157 gene locus_tag LOCUS_19380 gene rplC 1507 2157 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103877.1 protein_id gnl|my_center|LOCUS_19380 2161 2781 gene locus_tag LOCUS_19390 gene rplD 2161 2781 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417226.1 protein_id gnl|my_center|LOCUS_19390 2778 3077 gene locus_tag LOCUS_19400 gene rplW 2778 3077 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307955.1 protein_id gnl|my_center|LOCUS_19400 3117 3944 gene locus_tag LOCUS_19410 gene rplB 3117 3944 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103878.1 protein_id gnl|my_center|LOCUS_19410 3957 4229 gene locus_tag LOCUS_19420 gene rpsS 3957 4229 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004883670.1 protein_id gnl|my_center|LOCUS_19420 4236 4571 gene locus_tag LOCUS_19430 gene rplV 4236 4571 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957457.1 protein_id gnl|my_center|LOCUS_19430 4581 5252 gene locus_tag LOCUS_19440 gene rpsC 4581 5252 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_19440 5269 5682 gene locus_tag LOCUS_19450 gene rplP 5269 5682 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555482.1 protein_id gnl|my_center|LOCUS_19450 5682 5873 gene locus_tag LOCUS_19460 gene rpmC 5682 5873 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307965.1 protein_id gnl|my_center|LOCUS_19460 5876 6139 gene locus_tag LOCUS_19470 gene rpsQ 5876 6139 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070622.1 protein_id gnl|my_center|LOCUS_19470 6177 6545 gene locus_tag LOCUS_19480 gene rplN 6177 6545 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_19480 6560 6877 gene locus_tag LOCUS_19490 gene rplX 6560 6877 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729178.1 protein_id gnl|my_center|LOCUS_19490 6892 7431 gene locus_tag LOCUS_19500 gene rplE 6892 7431 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 protein_id gnl|my_center|LOCUS_19500 7446 7751 gene locus_tag LOCUS_19510 gene rpsN 7446 7751 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093701.1 protein_id gnl|my_center|LOCUS_19510 7783 8178 gene locus_tag LOCUS_19520 gene rpsH 7783 8178 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644434.1 protein_id gnl|my_center|LOCUS_19520 8191 8724 gene locus_tag LOCUS_19530 gene rplF 8191 8724 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768939.1 protein_id gnl|my_center|LOCUS_19530 8734 9087 gene locus_tag LOCUS_19540 gene rplR 8734 9087 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358956.1 protein_id gnl|my_center|LOCUS_19540 9097 9603 gene locus_tag LOCUS_19550 gene rpsE 9097 9603 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 protein_id gnl|my_center|LOCUS_19550 9611 9796 gene locus_tag LOCUS_19560 gene rpmD 9611 9796 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417257.1 protein_id gnl|my_center|LOCUS_19560 9796 10230 gene locus_tag LOCUS_19570 gene rplO 9796 10230 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215449.1 protein_id gnl|my_center|LOCUS_19570 10231 11553 gene locus_tag LOCUS_19580 gene secY 10231 11553 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070629.1 protein_id gnl|my_center|LOCUS_19580 11775 12131 gene locus_tag LOCUS_19590 gene rpsM 11775 12131 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090771.1 protein_id gnl|my_center|LOCUS_19590 12157 12543 gene locus_tag LOCUS_19600 gene rpsK 12157 12543 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005319702.1 protein_id gnl|my_center|LOCUS_19600 12562 13182 gene locus_tag LOCUS_19610 gene rpsD 12562 13182 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 protein_id gnl|my_center|LOCUS_19610 13204 14220 gene locus_tag LOCUS_19620 gene rpoA 13204 14220 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_19620 14238 14600 gene locus_tag LOCUS_19630 gene rplQ 14238 14600 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417273.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence077 225 4133 gene locus_tag LOCUS_19640 225 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 4148 5068 gene locus_tag LOCUS_19650 4148 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 5087 5746 gene locus_tag LOCUS_19660 5087 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 6122 7561 gene locus_tag LOCUS_19670 gene nifE 6122 7561 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_19670 7561 8961 gene locus_tag LOCUS_19680 gene nifN 7561 8961 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389940.1 protein_id gnl|my_center|LOCUS_19680 9006 9437 gene locus_tag LOCUS_19690 gene nifX 9006 9437 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533486.1 protein_id gnl|my_center|LOCUS_19690 9520 9993 gene locus_tag LOCUS_19700 9520 9993 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_19700 10005 10220 gene locus_tag LOCUS_19710 10005 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 10234 10551 gene locus_tag LOCUS_19720 gene fdxB 10234 10551 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_19720 10566 10889 gene locus_tag LOCUS_19730 10566 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 10889 11260 gene locus_tag LOCUS_19740 10889 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 11265 12224 gene locus_tag LOCUS_19750 11265 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 12221 12655 gene locus_tag LOCUS_19760 12221 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 12658 13998 gene locus_tag LOCUS_19770 12658 13998 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209630.1 protein_id gnl|my_center|LOCUS_19770 14194 14445 gene locus_tag LOCUS_19780 14194 14445 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_19780 14453 14704 gene locus_tag LOCUS_19790 14453 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence078 875 1342 gene locus_tag LOCUS_19800 875 1342 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_19800 2276 1398 gene locus_tag LOCUS_19810 2276 1398 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_19810 2376 3047 gene locus_tag LOCUS_19820 gene rpe 2376 3047 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 protein_id gnl|my_center|LOCUS_19820 3149 5071 gene locus_tag LOCUS_19830 3149 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 5107 5268 gene locus_tag LOCUS_19840 5107 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 5530 5736 gene locus_tag LOCUS_19850 5530 5736 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681091.1 protein_id gnl|my_center|LOCUS_19850 5720 6100 gene locus_tag LOCUS_19860 5720 6100 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684748.1 protein_id gnl|my_center|LOCUS_19860 6110 7597 gene locus_tag LOCUS_19870 gene trpE 6110 7597 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_19870 7594 8184 gene locus_tag LOCUS_19880 7594 8184 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_19880 8225 9241 gene locus_tag LOCUS_19890 gene trpD 8225 9241 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_19890 9263 10063 gene locus_tag LOCUS_19900 gene trpC 9263 10063 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767891.1 protein_id gnl|my_center|LOCUS_19900 10105 10776 gene locus_tag LOCUS_19910 10105 10776 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_19910 13509 10864 gene locus_tag LOCUS_19920 13509 10864 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143241.1 protein_id gnl|my_center|LOCUS_19920 13955 13509 gene locus_tag LOCUS_19930 13955 13509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence079 1424 243 gene locus_tag LOCUS_19940 1424 243 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763015.1 protein_id gnl|my_center|LOCUS_19940 2042 1629 gene locus_tag LOCUS_19950 gene tsaE 2042 1629 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317192.1 protein_id gnl|my_center|LOCUS_19950 3538 2042 gene locus_tag LOCUS_19960 3538 2042 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_19960 4695 3610 gene locus_tag LOCUS_19970 gene purM 4695 3610 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693936.1 protein_id gnl|my_center|LOCUS_19970 4866 5270 gene locus_tag LOCUS_19980 4866 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 5686 5477 gene locus_tag LOCUS_19990 5686 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 7450 6014 gene locus_tag LOCUS_20000 gene glgA 7450 6014 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_20000 8171 9040 gene locus_tag LOCUS_20010 8171 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 9726 9409 gene locus_tag LOCUS_20020 gene ftsB 9726 9409 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377835.1 protein_id gnl|my_center|LOCUS_20020 11048 9768 gene locus_tag LOCUS_20030 gene eno 11048 9768 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_20030 12010 11114 gene locus_tag LOCUS_20040 12010 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 13275 12007 gene locus_tag LOCUS_20050 13275 12007 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088620334.1 protein_id gnl|my_center|LOCUS_20050 14236 13403 gene locus_tag LOCUS_20060 gene kdsA 14236 13403 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946916.1 protein_id gnl|my_center|LOCUS_20060 <14908 14236 gene locus_tag LOCUS_20070 <14908 14236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703305.1:CTP synthase (glutamine hydrolyzing) >Feature sequence080 345 269 gene locus_tag LOCUS_t00300 345 269 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 803 501 gene locus_tag LOCUS_20080 gene ihfA 803 501 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_20080 3182 807 gene locus_tag LOCUS_20090 gene pheT 3182 807 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672328.1 protein_id gnl|my_center|LOCUS_20090 4235 3216 gene locus_tag LOCUS_20100 gene pheS 4235 3216 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_20100 4701 4336 gene locus_tag LOCUS_20110 gene rplT 4701 4336 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770935.1 protein_id gnl|my_center|LOCUS_20110 4912 4715 gene locus_tag LOCUS_20120 gene rpmI 4912 4715 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811096.1 protein_id gnl|my_center|LOCUS_20120 5595 5125 gene locus_tag LOCUS_20130 gene infC 5595 5125 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080562882.1 protein_id gnl|my_center|LOCUS_20130 7581 5671 gene locus_tag LOCUS_20140 gene thrS 7581 5671 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738829.1 protein_id gnl|my_center|LOCUS_20140 7718 7642 gene locus_tag LOCUS_t00310 7718 7642 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8928 7900 gene locus_tag LOCUS_20150 gene rluB 8928 7900 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694244.1 protein_id gnl|my_center|LOCUS_20150 9589 8918 gene locus_tag LOCUS_20160 gene scpB 9589 8918 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356904.1 protein_id gnl|my_center|LOCUS_20160 10538 9714 gene locus_tag LOCUS_20170 10538 9714 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 protein_id gnl|my_center|LOCUS_20170 11240 10584 gene locus_tag LOCUS_20180 11240 10584 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_20180 11876 11256 gene locus_tag LOCUS_20190 11876 11256 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_20190 11969 12493 gene locus_tag LOCUS_20200 11969 12493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 12563 13054 gene locus_tag LOCUS_20210 12563 13054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 13407 13706 gene locus_tag LOCUS_20220 13407 13706 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_20220 13711 13992 gene locus_tag LOCUS_20230 13711 13992 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence081 296 1222 gene locus_tag LOCUS_20240 gene hemC 296 1222 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114031.1 protein_id gnl|my_center|LOCUS_20240 1229 2002 gene locus_tag LOCUS_20250 1229 2002 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948434.1 protein_id gnl|my_center|LOCUS_20250 1999 3525 gene locus_tag LOCUS_20260 1999 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 3536 4759 gene locus_tag LOCUS_20270 3536 4759 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 protein_id gnl|my_center|LOCUS_20270 4970 6025 gene locus_tag LOCUS_20280 gene hrcA 4970 6025 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_20280 6092 6706 gene locus_tag LOCUS_20290 6092 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 6779 8704 gene locus_tag LOCUS_20300 gene dnaK 6779 8704 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_20300 8936 9139 gene locus_tag LOCUS_20310 8936 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 9240 10376 gene locus_tag LOCUS_20320 gene dnaJ 9240 10376 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071368.1 protein_id gnl|my_center|LOCUS_20320 10380 11183 gene locus_tag LOCUS_20330 gene dapB 10380 11183 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095210.1 protein_id gnl|my_center|LOCUS_20330 11487 11657 gene locus_tag LOCUS_20340 gene oscA 11487 11657 CDS product sulfur starvation response protein OscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084246.1 protein_id gnl|my_center|LOCUS_20340 11766 13328 gene locus_tag LOCUS_20350 11766 13328 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967062.1 protein_id gnl|my_center|LOCUS_20350 13359 14288 gene locus_tag LOCUS_20360 13359 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence082 1052 120 gene locus_tag LOCUS_20370 1052 120 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 protein_id gnl|my_center|LOCUS_20370 1334 2644 gene locus_tag LOCUS_20380 gene rhlE 1334 2644 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704814.1 protein_id gnl|my_center|LOCUS_20380 4165 2732 gene locus_tag LOCUS_20390 4165 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 5067 4183 gene locus_tag LOCUS_20400 5067 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 5771 5067 gene locus_tag LOCUS_20410 5771 5067 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003197.1 protein_id gnl|my_center|LOCUS_20410 6525 5872 gene locus_tag LOCUS_20420 gene pyrE 6525 5872 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_20420 6672 6920 gene locus_tag LOCUS_20430 6672 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 9124 7103 gene locus_tag LOCUS_20440 gene rep 9124 7103 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045224090.1 protein_id gnl|my_center|LOCUS_20440 9464 9865 gene locus_tag LOCUS_20450 9464 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 13715 10002 gene locus_tag LOCUS_20460 13715 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence083 416 1459 gene locus_tag LOCUS_20470 gene mutY 416 1459 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 protein_id gnl|my_center|LOCUS_20470 1462 1734 gene locus_tag LOCUS_20480 1462 1734 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_20480 2233 1799 gene locus_tag LOCUS_20490 2233 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 3405 2341 gene locus_tag LOCUS_20500 3405 2341 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124950.1 protein_id gnl|my_center|LOCUS_20500 3851 5047 gene locus_tag LOCUS_20510 gene dapC 3851 5047 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_20510 5056 5874 gene locus_tag LOCUS_20520 gene dapD 5056 5874 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_20520 5988 6464 gene locus_tag LOCUS_20530 5988 6464 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016620.1 protein_id gnl|my_center|LOCUS_20530 6545 6787 gene locus_tag LOCUS_20540 6545 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 6796 7140 gene locus_tag LOCUS_20550 6796 7140 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067705.1 protein_id gnl|my_center|LOCUS_20550 7137 8273 gene locus_tag LOCUS_20560 gene dapE 7137 8273 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_20560 8419 10602 gene locus_tag LOCUS_20570 8419 10602 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_20570 10615 11934 gene locus_tag LOCUS_20580 10615 11934 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 protein_id gnl|my_center|LOCUS_20580 12150 12872 gene locus_tag LOCUS_20590 12150 12872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 13842 13081 gene locus_tag LOCUS_20600 13842 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence084 903 121 gene locus_tag LOCUS_20610 903 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 4868 1110 gene locus_tag LOCUS_20620 4868 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 6233 5013 gene locus_tag LOCUS_20630 6233 5013 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_20630 6795 6514 gene locus_tag LOCUS_20640 6795 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 6903 10376 gene locus_tag LOCUS_20650 gene hsdR 6903 10376 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073938.1 protein_id gnl|my_center|LOCUS_20650 10505 10780 gene locus_tag LOCUS_20660 10505 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 10764 11060 gene locus_tag LOCUS_20670 10764 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 11065 12672 gene locus_tag LOCUS_20680 11065 12672 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073936.1 protein_id gnl|my_center|LOCUS_20680 12669 13718 gene locus_tag LOCUS_20690 12669 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence085 541 131 gene locus_tag LOCUS_20700 541 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1530 607 gene locus_tag LOCUS_20710 1530 607 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_20710 1673 2341 gene locus_tag LOCUS_20720 1673 2341 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_20720 2710 2501 gene locus_tag LOCUS_20730 2710 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2885 3508 gene locus_tag LOCUS_20740 gene hflD 2885 3508 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767416.1 protein_id gnl|my_center|LOCUS_20740 3520 4443 gene locus_tag LOCUS_20750 3520 4443 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_20750 4440 5198 gene locus_tag LOCUS_20760 4440 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 5195 6538 gene locus_tag LOCUS_20770 5195 6538 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_20770 6632 8293 gene locus_tag LOCUS_20780 6632 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 8290 8976 gene locus_tag LOCUS_20790 8290 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 9007 9468 gene locus_tag LOCUS_20800 9007 9468 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389836.1 protein_id gnl|my_center|LOCUS_20800 9692 10843 gene locus_tag LOCUS_20810 9692 10843 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329265.1 protein_id gnl|my_center|LOCUS_20810 11095 12672 gene locus_tag LOCUS_20820 11095 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20820 >Feature sequence086 296 2494 gene locus_tag LOCUS_20830 296 2494 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880726.1 protein_id gnl|my_center|LOCUS_20830 2546 2740 gene locus_tag LOCUS_20840 2546 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3298 2744 gene locus_tag LOCUS_20850 gene rsmD 3298 2744 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262816.1 protein_id gnl|my_center|LOCUS_20850 4625 3288 gene locus_tag LOCUS_20860 4625 3288 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_20860 5977 4625 gene locus_tag LOCUS_20870 5977 4625 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_20870 6080 6967 gene locus_tag LOCUS_20880 gene cyoE 6080 6967 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768584.1 protein_id gnl|my_center|LOCUS_20880 6964 7989 gene locus_tag LOCUS_20890 6964 7989 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_20890 9415 8063 gene locus_tag LOCUS_20900 gene cptA 9415 8063 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_20900 10670 9486 gene locus_tag LOCUS_20910 10670 9486 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958285.1 protein_id gnl|my_center|LOCUS_20910 11000 11461 gene locus_tag LOCUS_20920 11000 11461 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158897.1 protein_id gnl|my_center|LOCUS_20920 11487 11954 gene locus_tag LOCUS_20930 gene secB 11487 11954 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372189.1 protein_id gnl|my_center|LOCUS_20930 11961 12959 gene locus_tag LOCUS_20940 gene gpsA 11961 12959 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_20940 13343 13543 gene locus_tag LOCUS_20950 13343 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence087 127 747 gene locus_tag LOCUS_20960 127 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3150 886 gene locus_tag LOCUS_20970 3150 886 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372678.1 protein_id gnl|my_center|LOCUS_20970 3310 6396 gene locus_tag LOCUS_20980 3310 6396 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 protein_id gnl|my_center|LOCUS_20980 6506 6880 gene locus_tag LOCUS_20990 6506 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 7668 7000 gene locus_tag LOCUS_21000 7668 7000 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_21000 7943 9592 gene locus_tag LOCUS_21010 7943 9592 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037499.1 protein_id gnl|my_center|LOCUS_21010 9752 9979 gene locus_tag LOCUS_21020 9752 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 9976 10422 gene locus_tag LOCUS_21030 9976 10422 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_21030 11080 10484 gene locus_tag LOCUS_21040 11080 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 11574 12122 gene locus_tag LOCUS_21050 11574 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490290.1 protein_id gnl|my_center|LOCUS_21050 12109 13005 gene locus_tag LOCUS_21060 12109 13005 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence088 1367 2275 gene locus_tag LOCUS_21070 1367 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2650 3267 gene locus_tag LOCUS_21080 2650 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3431 4099 gene locus_tag LOCUS_21090 3431 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 4120 4737 gene locus_tag LOCUS_21100 4120 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 5010 5750 gene locus_tag LOCUS_21110 5010 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 5977 5768 gene locus_tag LOCUS_21120 5977 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 5962 6315 gene locus_tag LOCUS_21130 5962 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 6424 7041 gene locus_tag LOCUS_21140 6424 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 7141 7458 gene locus_tag LOCUS_21150 7141 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 7469 8203 gene locus_tag LOCUS_21160 7469 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 8534 9916 gene locus_tag LOCUS_21170 8534 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 10080 10568 gene locus_tag LOCUS_21180 10080 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 10900 11169 gene locus_tag LOCUS_21190 10900 11169 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785693.1 protein_id gnl|my_center|LOCUS_21190 11180 11419 gene locus_tag LOCUS_21200 11180 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 12386 11787 gene locus_tag LOCUS_21210 12386 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence089 281 721 gene locus_tag LOCUS_21220 281 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 732 1595 gene locus_tag LOCUS_21230 gene cysW 732 1595 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 protein_id gnl|my_center|LOCUS_21230 1694 2737 gene locus_tag LOCUS_21240 1694 2737 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074249.1 protein_id gnl|my_center|LOCUS_21240 2873 3772 gene locus_tag LOCUS_21250 gene cysB 2873 3772 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406770.1 protein_id gnl|my_center|LOCUS_21250 3845 4261 gene locus_tag LOCUS_21260 3845 4261 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_21260 4272 4691 gene locus_tag LOCUS_21270 4272 4691 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_21270 5245 4766 gene locus_tag LOCUS_21280 5245 4766 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 protein_id gnl|my_center|LOCUS_21280 6098 5268 gene locus_tag LOCUS_21290 gene nadC 6098 5268 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_21290 6905 6246 gene locus_tag LOCUS_21300 gene yrfG 6905 6246 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343604.1 protein_id gnl|my_center|LOCUS_21300 6945 7496 gene locus_tag LOCUS_21310 gene nudE 6945 7496 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957683.1 protein_id gnl|my_center|LOCUS_21310 7545 9137 gene locus_tag LOCUS_21320 7545 9137 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 protein_id gnl|my_center|LOCUS_21320 9285 10364 gene locus_tag LOCUS_21330 gene mltB 9285 10364 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050519.1 protein_id gnl|my_center|LOCUS_21330 10397 10621 gene locus_tag LOCUS_21340 10397 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 11571 10633 gene locus_tag LOCUS_21350 11571 10633 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087597.1 protein_id gnl|my_center|LOCUS_21350 12152 11577 gene locus_tag LOCUS_21360 12152 11577 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence090 1960 818 gene locus_tag LOCUS_21370 gene nirJ 1960 818 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_21370 2851 1970 gene locus_tag LOCUS_21380 gene ubiA 2851 1970 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455228.1 protein_id gnl|my_center|LOCUS_21380 2987 3601 gene locus_tag LOCUS_21390 gene wrbA 2987 3601 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115189.1 protein_id gnl|my_center|LOCUS_21390 3612 3959 gene locus_tag LOCUS_21400 3612 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 3962 4675 gene locus_tag LOCUS_21410 gene hda 3962 4675 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958403.1 protein_id gnl|my_center|LOCUS_21410 5368 4787 gene locus_tag LOCUS_21420 gene sodB 5368 4787 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094005.1 protein_id gnl|my_center|LOCUS_21420 7134 5662 gene locus_tag LOCUS_21430 7134 5662 CDS product succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816216.1 protein_id gnl|my_center|LOCUS_21430 7465 7220 gene locus_tag LOCUS_21440 7465 7220 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943075.1 protein_id gnl|my_center|LOCUS_21440 7862 8587 gene locus_tag LOCUS_21450 7862 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 8687 9742 gene locus_tag LOCUS_21460 8687 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 9732 11690 gene locus_tag LOCUS_21470 9732 11690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 11728 11919 gene locus_tag LOCUS_21480 11728 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 11916 12332 gene locus_tag LOCUS_21490 gene hicB 11916 12332 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence091 289 1509 gene locus_tag LOCUS_21500 gene glgC 289 1509 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454156.1 protein_id gnl|my_center|LOCUS_21500 1751 2431 gene locus_tag LOCUS_21510 1751 2431 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_21510 2481 3497 gene locus_tag LOCUS_21520 2481 3497 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_21520 3490 4260 gene locus_tag LOCUS_21530 3490 4260 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_21530 4488 4836 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttgagtaatagtagccgt 6918 5857 gene locus_tag LOCUS_21540 6918 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 7197 6919 gene locus_tag LOCUS_21550 7197 6919 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_21550 7496 7194 gene locus_tag LOCUS_21560 7496 7194 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767703.1 protein_id gnl|my_center|LOCUS_21560 8036 7500 gene locus_tag LOCUS_21570 8036 7500 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_21570 8235 8540 gene locus_tag LOCUS_21580 8235 8540 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046692.1 protein_id gnl|my_center|LOCUS_21580 8676 9758 gene locus_tag LOCUS_21590 8676 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 9806 10444 gene locus_tag LOCUS_21600 9806 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 11971 10478 gene locus_tag LOCUS_21610 gene cydC 11971 10478 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205201.1 protein_id gnl|my_center|LOCUS_21610 11928 12104 gene locus_tag LOCUS_21620 11928 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence092 2078 3037 gene locus_tag LOCUS_21630 2078 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3638 4162 gene locus_tag LOCUS_21640 3638 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4243 5130 gene locus_tag LOCUS_21650 4243 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 5415 8081 gene locus_tag LOCUS_21660 5415 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 8102 9652 gene locus_tag LOCUS_21670 8102 9652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 9662 10186 gene locus_tag LOCUS_21680 9662 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 10212 11120 gene locus_tag LOCUS_21690 10212 11120 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_21690 11555 11115 gene locus_tag LOCUS_21700 11555 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 12003 11620 gene locus_tag LOCUS_21710 12003 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence093 636 133 gene locus_tag LOCUS_21720 636 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 845 699 gene locus_tag LOCUS_21730 845 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 823 1506 gene locus_tag LOCUS_21740 gene pyrF 823 1506 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039203.1 protein_id gnl|my_center|LOCUS_21740 1583 2245 gene locus_tag LOCUS_21750 1583 2245 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_21750 2255 3217 gene locus_tag LOCUS_21760 2255 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 3963 3220 gene locus_tag LOCUS_21770 gene pdxJ 3963 3220 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071560.1 protein_id gnl|my_center|LOCUS_21770 4673 3960 gene locus_tag LOCUS_21780 gene recO 4673 3960 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524618.1 protein_id gnl|my_center|LOCUS_21780 5547 4663 gene locus_tag LOCUS_21790 gene era 5547 4663 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_21790 6227 5544 gene locus_tag LOCUS_21800 gene rnc 6227 5544 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882136.1 protein_id gnl|my_center|LOCUS_21800 7074 6298 gene locus_tag LOCUS_21810 gene lepB 7074 6298 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444404.1 protein_id gnl|my_center|LOCUS_21810 8938 7139 gene locus_tag LOCUS_21820 gene lepA 8938 7139 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209677.1 protein_id gnl|my_center|LOCUS_21820 9777 9124 gene locus_tag LOCUS_21830 9777 9124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_21830 11036 9774 gene locus_tag LOCUS_21840 11036 9774 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966731.1 protein_id gnl|my_center|LOCUS_21840 11688 11407 gene locus_tag LOCUS_21850 11688 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence094 542 835 gene locus_tag LOCUS_21860 542 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 946 2091 gene locus_tag LOCUS_21870 946 2091 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670244.1 protein_id gnl|my_center|LOCUS_21870 2088 5159 gene locus_tag LOCUS_21880 2088 5159 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072762.1 protein_id gnl|my_center|LOCUS_21880 5439 5284 gene locus_tag LOCUS_21890 5439 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 8766 5647 gene locus_tag LOCUS_21900 8766 5647 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_21900 10196 8769 gene locus_tag LOCUS_21910 10196 8769 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_21910 11532 10189 gene locus_tag LOCUS_21920 11532 10189 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence095 1781 330 gene locus_tag LOCUS_21930 gene nhaD 1781 330 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_21930 2312 3376 gene locus_tag LOCUS_21940 2312 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3388 4845 gene locus_tag LOCUS_21950 3388 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 5750 4842 gene locus_tag LOCUS_21960 5750 4842 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 protein_id gnl|my_center|LOCUS_21960 6724 5747 gene locus_tag LOCUS_21970 gene cysK 6724 5747 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222180.1 protein_id gnl|my_center|LOCUS_21970 8164 6923 gene locus_tag LOCUS_21980 8164 6923 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_21980 11360 8172 gene locus_tag LOCUS_21990 11360 8172 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence096 2621 147 gene locus_tag LOCUS_22000 2621 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 5396 2682 gene locus_tag LOCUS_22010 5396 2682 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117924.1 protein_id gnl|my_center|LOCUS_22010 5730 5419 gene locus_tag LOCUS_22020 5730 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 6127 5768 gene locus_tag LOCUS_22030 6127 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 8987 6147 gene locus_tag LOCUS_22040 8987 6147 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459048.1 protein_id gnl|my_center|LOCUS_22040 9269 8994 gene locus_tag LOCUS_22050 9269 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 9517 9266 gene locus_tag LOCUS_22060 9517 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 9957 9658 gene locus_tag LOCUS_22070 9957 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 10147 9929 gene locus_tag LOCUS_22080 10147 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 10767 10186 gene locus_tag LOCUS_22090 10767 10186 CDS product DUF3780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117920.1 protein_id gnl|my_center|LOCUS_22090 11438 10764 gene locus_tag LOCUS_22100 11438 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence097 515 231 gene locus_tag LOCUS_22110 515 231 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_22110 831 508 gene locus_tag LOCUS_22120 831 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010692226.1 protein_id gnl|my_center|LOCUS_22120 1378 2541 gene locus_tag LOCUS_22130 1378 2541 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 protein_id gnl|my_center|LOCUS_22130 2551 5583 gene locus_tag LOCUS_22140 2551 5583 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267831.1 protein_id gnl|my_center|LOCUS_22140 7727 5700 gene locus_tag LOCUS_22150 7727 5700 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454986.1 protein_id gnl|my_center|LOCUS_22150 9584 7797 gene locus_tag LOCUS_22160 9584 7797 CDS product di-heme-cytochrome C peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114647.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence098 1850 186 gene locus_tag LOCUS_22170 1850 186 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089646.1 protein_id gnl|my_center|LOCUS_22170 2217 1864 gene locus_tag LOCUS_22180 2217 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 3619 2228 gene locus_tag LOCUS_22190 gene hpnO 3619 2228 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_22190 4411 3683 gene locus_tag LOCUS_22200 4411 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 6384 4408 gene locus_tag LOCUS_22210 gene shc 6384 4408 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529547.1 protein_id gnl|my_center|LOCUS_22210 7681 6395 gene locus_tag LOCUS_22220 7681 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 7966 9075 gene locus_tag LOCUS_22230 gene hpnH 7966 9075 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 protein_id gnl|my_center|LOCUS_22230 9265 9822 gene locus_tag LOCUS_22240 9265 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 9842 10786 gene locus_tag LOCUS_22250 9842 10786 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521932.1 protein_id gnl|my_center|LOCUS_22250 11339 10824 gene locus_tag LOCUS_22260 11339 10824 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence099 260 2761 gene locus_tag LOCUS_22270 260 2761 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_22270 2776 3246 gene locus_tag LOCUS_22280 gene trmL 2776 3246 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652354.1 protein_id gnl|my_center|LOCUS_22280 3262 4296 gene locus_tag LOCUS_22290 3262 4296 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947351.1 protein_id gnl|my_center|LOCUS_22290 4610 4272 gene locus_tag LOCUS_22300 4610 4272 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_22300 5218 4622 gene locus_tag LOCUS_22310 gene recR 5218 4622 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095898.1 protein_id gnl|my_center|LOCUS_22310 5543 5220 gene locus_tag LOCUS_22320 5543 5220 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_22320 7142 5547 gene locus_tag LOCUS_22330 gene dnaX 7142 5547 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957718.1 protein_id gnl|my_center|LOCUS_22330 9563 7389 gene locus_tag LOCUS_22340 gene spoT 9563 7389 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957490.1 protein_id gnl|my_center|LOCUS_22340 9811 9572 gene locus_tag LOCUS_22350 9811 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 11168 9996 gene locus_tag LOCUS_22360 11168 9996 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence100 130 55 gene locus_tag LOCUS_t00320 130 55 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 491 219 gene locus_tag LOCUS_22370 491 219 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_22370 3122 690 gene locus_tag LOCUS_22380 gene lon 3122 690 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047611.1 protein_id gnl|my_center|LOCUS_22380 4641 3367 gene locus_tag LOCUS_22390 gene clpX 4641 3367 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_22390 5360 4713 gene locus_tag LOCUS_22400 gene clpP 5360 4713 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_22400 6671 5370 gene locus_tag LOCUS_22410 gene tig 6671 5370 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267215.1 protein_id gnl|my_center|LOCUS_22410 6861 6777 gene locus_tag LOCUS_t00330 6861 6777 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7790 6936 gene locus_tag LOCUS_22420 7790 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 8143 8739 gene locus_tag LOCUS_22430 gene mtgA 8143 8739 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666147.1 protein_id gnl|my_center|LOCUS_22430 9166 8858 gene locus_tag LOCUS_22440 9166 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 9729 9166 gene locus_tag LOCUS_22450 9729 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 10019 9726 gene locus_tag LOCUS_22460 gene cas2 10019 9726 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545199.1 protein_id gnl|my_center|LOCUS_22460 10262 10501 gene locus_tag LOCUS_22470 10262 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 10556 10714 gene locus_tag LOCUS_22480 10556 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 11156 10656 gene locus_tag LOCUS_22490 11156 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence101 1579 227 gene locus_tag LOCUS_22500 1579 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 3866 1626 gene locus_tag LOCUS_22510 gene shc 3866 1626 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529547.1 protein_id gnl|my_center|LOCUS_22510 4499 3897 gene locus_tag LOCUS_22520 4499 3897 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403887.1 protein_id gnl|my_center|LOCUS_22520 6095 4509 gene locus_tag LOCUS_22530 gene cyp51 6095 4509 CDS product lanosterol 14-alpha demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898577.1 protein_id gnl|my_center|LOCUS_22530 7067 6312 gene locus_tag LOCUS_22540 gene surE 7067 6312 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770587.1 protein_id gnl|my_center|LOCUS_22540 7143 7709 gene locus_tag LOCUS_22550 7143 7709 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957861.1 protein_id gnl|my_center|LOCUS_22550 8828 7854 gene locus_tag LOCUS_22560 8828 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 9225 8956 gene locus_tag LOCUS_22570 9225 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 9559 9248 gene locus_tag LOCUS_22580 9559 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 9817 9563 gene locus_tag LOCUS_22590 9817 9563 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_22590 10061 9834 gene locus_tag LOCUS_22600 10061 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 10501 10073 gene locus_tag LOCUS_22610 10501 10073 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_22610 10919 10491 gene locus_tag LOCUS_22620 10919 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence102 266 108 gene locus_tag LOCUS_22630 266 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 640 332 gene locus_tag LOCUS_22640 640 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 1585 923 gene locus_tag LOCUS_22650 1585 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2460 1588 gene locus_tag LOCUS_22660 2460 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 5336 2601 gene locus_tag LOCUS_22670 gene tssH 5336 2601 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 protein_id gnl|my_center|LOCUS_22670 5877 5410 gene locus_tag LOCUS_22680 5877 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 6515 6006 gene locus_tag LOCUS_22690 6515 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 7582 6554 gene locus_tag LOCUS_22700 gene tssG 7582 6554 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 protein_id gnl|my_center|LOCUS_22700 9423 7546 gene locus_tag LOCUS_22710 gene tssF 9423 7546 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 protein_id gnl|my_center|LOCUS_22710 9930 9427 gene locus_tag LOCUS_22720 gene tssE 9930 9427 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104971.1 protein_id gnl|my_center|LOCUS_22720 10732 9935 gene locus_tag LOCUS_22730 gene tagJ 10732 9935 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence103 567 211 gene locus_tag LOCUS_22740 567 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 807 720 gene locus_tag LOCUS_t00340 807 720 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2801 891 gene locus_tag LOCUS_22750 2801 891 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268339.1 protein_id gnl|my_center|LOCUS_22750 4528 2921 gene locus_tag LOCUS_22760 4528 2921 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115437.1 protein_id gnl|my_center|LOCUS_22760 5672 4599 gene locus_tag LOCUS_22770 5672 4599 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388234.1 protein_id gnl|my_center|LOCUS_22770 5830 6606 gene locus_tag LOCUS_22780 5830 6606 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966736.1 protein_id gnl|my_center|LOCUS_22780 6700 6909 gene locus_tag LOCUS_22790 6700 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 7639 7211 gene locus_tag LOCUS_22800 7639 7211 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817109.1 protein_id gnl|my_center|LOCUS_22800 10127 7806 gene locus_tag LOCUS_22810 10127 7806 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_22810 10691 10191 gene locus_tag LOCUS_22820 10691 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence104 486 950 gene locus_tag LOCUS_22830 486 950 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958178.1 protein_id gnl|my_center|LOCUS_22830 1002 2450 gene locus_tag LOCUS_22840 gene sufB 1002 2450 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_22840 2507 3262 gene locus_tag LOCUS_22850 gene sufC 2507 3262 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946339.1 protein_id gnl|my_center|LOCUS_22850 3262 4590 gene locus_tag LOCUS_22860 gene sufD 3262 4590 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_22860 4587 5810 gene locus_tag LOCUS_22870 4587 5810 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_22870 5810 6262 gene locus_tag LOCUS_22880 5810 6262 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_22880 6286 7056 gene locus_tag LOCUS_22890 6286 7056 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770277.1 protein_id gnl|my_center|LOCUS_22890 7105 7419 gene locus_tag LOCUS_22900 7105 7419 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_22900 7663 8046 gene locus_tag LOCUS_22910 7663 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 8252 8638 gene locus_tag LOCUS_22920 8252 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 9446 8889 gene locus_tag LOCUS_22930 9446 8889 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973634.1 protein_id gnl|my_center|LOCUS_22930 10046 9480 gene locus_tag LOCUS_22940 10046 9480 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_22940 10190 10498 gene locus_tag LOCUS_22950 10190 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence105 304 231 gene locus_tag LOCUS_t00350 304 231 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 431 357 gene locus_tag LOCUS_t00360 431 357 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1016 486 gene locus_tag LOCUS_22960 1016 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2106 1303 gene locus_tag LOCUS_22970 2106 1303 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088931.1 protein_id gnl|my_center|LOCUS_22970 2843 2103 gene locus_tag LOCUS_22980 2843 2103 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528736.1 protein_id gnl|my_center|LOCUS_22980 3802 2840 gene locus_tag LOCUS_22990 3802 2840 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532045.1 protein_id gnl|my_center|LOCUS_22990 5001 3805 gene locus_tag LOCUS_23000 5001 3805 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172006.1 protein_id gnl|my_center|LOCUS_23000 5136 5960 gene locus_tag LOCUS_23010 5136 5960 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_23010 6211 6561 gene locus_tag LOCUS_23020 6211 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 6664 6939 gene locus_tag LOCUS_23030 6664 6939 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_23030 6923 7162 gene locus_tag LOCUS_23040 6923 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 7183 7542 gene locus_tag LOCUS_23050 7183 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 7542 7751 gene locus_tag LOCUS_23060 7542 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 7881 8183 gene locus_tag LOCUS_23070 7881 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence106 1404 157 gene locus_tag LOCUS_23080 1404 157 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 protein_id gnl|my_center|LOCUS_23080 2888 1530 gene locus_tag LOCUS_23090 gene nhaD 2888 1530 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_23090 3043 4695 gene locus_tag LOCUS_23100 3043 4695 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_23100 4682 5134 gene locus_tag LOCUS_23110 4682 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 6383 5208 gene locus_tag LOCUS_23120 6383 5208 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_23120 8337 6391 gene locus_tag LOCUS_23130 gene asnB 8337 6391 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_23130 9404 8340 gene locus_tag LOCUS_23140 9404 8340 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_23140 10030 9401 gene locus_tag LOCUS_23150 10030 9401 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167942160.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence107 220 1002 gene locus_tag LOCUS_23160 220 1002 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051345837.1 protein_id gnl|my_center|LOCUS_23160 4674 1186 gene locus_tag LOCUS_23170 gene recC 4674 1186 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266563.1 protein_id gnl|my_center|LOCUS_23170 5994 5029 gene locus_tag LOCUS_23180 5994 5029 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_23180 6224 5994 gene locus_tag LOCUS_23190 6224 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 8041 6248 gene locus_tag LOCUS_23200 8041 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 8276 8028 gene locus_tag LOCUS_23210 8276 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 9225 8260 gene locus_tag LOCUS_23220 9225 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018641672.1 protein_id gnl|my_center|LOCUS_23220 9583 9350 gene locus_tag LOCUS_23230 9583 9350 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_23230 10156 9617 gene locus_tag LOCUS_23240 10156 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence108 127 684 gene locus_tag LOCUS_23250 127 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 993 1214 gene locus_tag LOCUS_23260 993 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1217 1441 gene locus_tag LOCUS_23270 1217 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2009 1731 gene locus_tag LOCUS_23280 2009 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2631 1993 gene locus_tag LOCUS_23290 2631 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2745 4652 gene locus_tag LOCUS_23300 2745 4652 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766050.1 protein_id gnl|my_center|LOCUS_23300 5317 4667 gene locus_tag LOCUS_23310 5317 4667 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404330.1 protein_id gnl|my_center|LOCUS_23310 5677 5399 gene locus_tag LOCUS_23320 5677 5399 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114084.1 protein_id gnl|my_center|LOCUS_23320 5893 5705 gene locus_tag LOCUS_23330 5893 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 7914 5926 gene locus_tag LOCUS_23340 gene recD 7914 5926 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266565.1 protein_id gnl|my_center|LOCUS_23340 <10253 7911 gene locus_tag LOCUS_23350 <10253 7911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103276.1:exodeoxyribonuclease V subunit beta >Feature sequence109 1594 320 gene locus_tag LOCUS_23360 gene clpX 1594 320 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661954.1 protein_id gnl|my_center|LOCUS_23360 2458 1610 gene locus_tag LOCUS_23370 2458 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2939 2460 gene locus_tag LOCUS_23380 2939 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3250 2936 gene locus_tag LOCUS_23390 3250 2936 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_23390 3393 3271 gene locus_tag LOCUS_23400 3393 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3911 3405 gene locus_tag LOCUS_23410 3911 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 4706 3912 gene locus_tag LOCUS_23420 gene cysE 4706 3912 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 protein_id gnl|my_center|LOCUS_23420 4898 4752 gene locus_tag LOCUS_23430 4898 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 6037 4913 gene locus_tag LOCUS_23440 gene nifV 6037 4913 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_23440 7262 6051 gene locus_tag LOCUS_23450 gene nifS 7262 6051 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_23450 8164 7259 gene locus_tag LOCUS_23460 gene nifU 8164 7259 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_23460 8591 8235 gene locus_tag LOCUS_23470 8591 8235 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389926.1 protein_id gnl|my_center|LOCUS_23470 8793 9071 gene locus_tag LOCUS_23480 8793 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 9147 10004 gene locus_tag LOCUS_23490 9147 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence110 110 1195 gene locus_tag LOCUS_23500 110 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1364 1513 gene locus_tag LOCUS_23510 1364 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 1586 2845 gene locus_tag LOCUS_23520 1586 2845 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015207390.1 protein_id gnl|my_center|LOCUS_23520 3785 5185 gene locus_tag LOCUS_23530 3785 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 5257 6264 gene locus_tag LOCUS_23540 5257 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 6261 9305 gene locus_tag LOCUS_23550 6261 9305 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_23550 9298 9903 gene locus_tag LOCUS_23560 9298 9903 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence111 1261 365 gene locus_tag LOCUS_23570 1261 365 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_23570 1487 1254 gene locus_tag LOCUS_23580 1487 1254 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551852.1 protein_id gnl|my_center|LOCUS_23580 2698 1787 gene locus_tag LOCUS_23590 2698 1787 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_23590 4057 3017 gene locus_tag LOCUS_23600 4057 3017 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_23600 4559 4047 gene locus_tag LOCUS_23610 4559 4047 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680156.1 protein_id gnl|my_center|LOCUS_23610 7588 4556 gene locus_tag LOCUS_23620 7588 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 8571 7591 gene locus_tag LOCUS_23630 8571 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 9833 8613 gene locus_tag LOCUS_23640 9833 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence112 1536 1081 gene locus_tag LOCUS_23650 1536 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1424 3202 gene locus_tag LOCUS_23660 1424 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 4117 5034 gene locus_tag LOCUS_23670 4117 5034 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184450.1 protein_id gnl|my_center|LOCUS_23670 5021 7078 gene locus_tag LOCUS_23680 5021 7078 CDS product family 2A encapsulin nanocompartment cargo protein cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206474.1 protein_id gnl|my_center|LOCUS_23680 8160 7210 gene locus_tag LOCUS_23690 8160 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 9524 8163 gene locus_tag LOCUS_23700 9524 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 9882 9586 gene locus_tag LOCUS_23710 9882 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence113 546 319 gene locus_tag LOCUS_23720 546 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2756 741 gene locus_tag LOCUS_23730 2756 741 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_23730 3453 2764 gene locus_tag LOCUS_23740 3453 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 4568 3453 gene locus_tag LOCUS_23750 4568 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 5521 4907 gene locus_tag LOCUS_23760 5521 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 5716 5859 gene locus_tag LOCUS_23770 5716 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 9146 6039 gene locus_tag LOCUS_23780 9146 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 9838 9569 gene locus_tag LOCUS_23790 9838 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence114 1708 1196 gene locus_tag LOCUS_23800 1708 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1872 2330 gene locus_tag LOCUS_23810 1872 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 3886 2327 gene locus_tag LOCUS_23820 3886 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 4063 4236 gene locus_tag LOCUS_23830 4063 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 4495 5763 gene locus_tag LOCUS_23840 4495 5763 CDS product autotransporter strand-loop-strand O-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200982.1 protein_id gnl|my_center|LOCUS_23840 8709 5974 gene locus_tag LOCUS_23850 8709 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence115 3806 279 gene locus_tag LOCUS_23860 3806 279 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_23860 4456 3803 gene locus_tag LOCUS_23870 4456 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 5724 4456 gene locus_tag LOCUS_23880 5724 4456 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105320.1 protein_id gnl|my_center|LOCUS_23880 8333 5799 gene locus_tag LOCUS_23890 8333 5799 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968158.1 protein_id gnl|my_center|LOCUS_23890 8896 8606 gene locus_tag LOCUS_23900 8896 8606 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011809180.1 protein_id gnl|my_center|LOCUS_23900 9264 9010 gene locus_tag LOCUS_23910 9264 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence116 152 1174 gene locus_tag LOCUS_23920 152 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1161 2225 gene locus_tag LOCUS_23930 1161 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2794 3489 gene locus_tag LOCUS_23940 2794 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3982 3680 gene locus_tag LOCUS_23950 3982 3680 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_23950 4604 4020 gene locus_tag LOCUS_23960 4604 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 6604 4616 gene locus_tag LOCUS_23970 gene tssI 6604 4616 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143801.1 protein_id gnl|my_center|LOCUS_23970 7268 7080 gene locus_tag LOCUS_23980 7268 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23980 7867 7484 gene locus_tag LOCUS_23990 7867 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 8539 7928 gene locus_tag LOCUS_24000 8539 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418997.1 protein_id gnl|my_center|LOCUS_24000 9379 8600 gene locus_tag LOCUS_24010 9379 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence117 738 124 gene locus_tag LOCUS_24020 738 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 1358 909 gene locus_tag LOCUS_24030 1358 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 1642 1346 gene locus_tag LOCUS_24040 1642 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2241 1657 gene locus_tag LOCUS_24050 2241 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 3134 2394 gene locus_tag LOCUS_24060 3134 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 3433 3278 gene locus_tag LOCUS_24070 3433 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 3977 6946 gene locus_tag LOCUS_24080 3977 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 7367 7840 gene locus_tag LOCUS_24090 7367 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence118 438 644 gene locus_tag LOCUS_24100 438 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1498 752 gene locus_tag LOCUS_24110 gene moeB 1498 752 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807436.1 protein_id gnl|my_center|LOCUS_24110 1638 1925 gene locus_tag LOCUS_24120 gene groES 1638 1925 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_24120 1999 3636 gene locus_tag LOCUS_24130 gene groL 1999 3636 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 protein_id gnl|my_center|LOCUS_24130 3851 5233 gene locus_tag LOCUS_24140 gene atpD 3851 5233 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946152.1 protein_id gnl|my_center|LOCUS_24140 5233 5643 gene locus_tag LOCUS_24150 5233 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946788.1 protein_id gnl|my_center|LOCUS_24150 5640 5909 gene locus_tag LOCUS_24160 5640 5909 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946787.1 protein_id gnl|my_center|LOCUS_24160 5933 6598 gene locus_tag LOCUS_24170 5933 6598 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946786.1 protein_id gnl|my_center|LOCUS_24170 6602 6868 gene locus_tag LOCUS_24180 6602 6868 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019235654.1 protein_id gnl|my_center|LOCUS_24180 6882 7637 gene locus_tag LOCUS_24190 6882 7637 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946784.1 protein_id gnl|my_center|LOCUS_24190 7624 9156 gene locus_tag LOCUS_24200 7624 9156 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946783.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence119 415 768 gene locus_tag LOCUS_24210 415 768 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694481.1 protein_id gnl|my_center|LOCUS_24210 761 1063 gene locus_tag LOCUS_24220 761 1063 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_24220 1981 5424 gene locus_tag LOCUS_24230 gene sbcC 1981 5424 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095822.1 protein_id gnl|my_center|LOCUS_24230 5494 5832 gene locus_tag LOCUS_24240 5494 5832 CDS product DUF2782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096984.1 protein_id gnl|my_center|LOCUS_24240 5942 7450 gene locus_tag LOCUS_24250 5942 7450 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_24250 7486 8031 gene locus_tag LOCUS_24260 7486 8031 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880804.1 protein_id gnl|my_center|LOCUS_24260 8031 8531 gene locus_tag LOCUS_24270 8031 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 9192 8614 gene locus_tag LOCUS_24280 9192 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 9437 9222 gene locus_tag LOCUS_24290 9437 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence120 686 138 gene locus_tag LOCUS_24300 gene sufT 686 138 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_24300 1424 696 gene locus_tag LOCUS_24310 1424 696 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245137.1 protein_id gnl|my_center|LOCUS_24310 2095 1421 gene locus_tag LOCUS_24320 gene gph 2095 1421 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_24320 2809 2102 gene locus_tag LOCUS_24330 2809 2102 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 protein_id gnl|my_center|LOCUS_24330 3967 2927 gene locus_tag LOCUS_24340 gene lpxD 3967 2927 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_24340 4570 4058 gene locus_tag LOCUS_24350 gene moaC 4570 4058 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719152.1 protein_id gnl|my_center|LOCUS_24350 4618 4851 gene locus_tag LOCUS_24360 gene moaD 4618 4851 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598624.1 protein_id gnl|my_center|LOCUS_24360 4854 5306 gene locus_tag LOCUS_24370 gene moaE 4854 5306 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_24370 5341 6180 gene locus_tag LOCUS_24380 5341 6180 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_24380 6250 7239 gene locus_tag LOCUS_24390 gene dhaK 6250 7239 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528089.1 protein_id gnl|my_center|LOCUS_24390 7869 7222 gene locus_tag LOCUS_24400 gene dhaL 7869 7222 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728173.1 protein_id gnl|my_center|LOCUS_24400 8326 7943 gene locus_tag LOCUS_24410 8326 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 8459 8938 gene locus_tag LOCUS_24420 gene coaD 8459 8938 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_24420 8947 9195 gene locus_tag LOCUS_24430 8947 9195 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence121 185 871 gene locus_tag LOCUS_24440 185 871 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_24440 959 1870 gene locus_tag LOCUS_24450 959 1870 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_24450 1912 3255 gene locus_tag LOCUS_24460 1912 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 3294 4415 gene locus_tag LOCUS_24470 3294 4415 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532032.1 protein_id gnl|my_center|LOCUS_24470 4393 5376 gene locus_tag LOCUS_24480 gene mch 4393 5376 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532033.1 protein_id gnl|my_center|LOCUS_24480 5395 6297 gene locus_tag LOCUS_24490 5395 6297 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532034.1 protein_id gnl|my_center|LOCUS_24490 6408 7889 gene locus_tag LOCUS_24500 6408 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 7886 8893 gene locus_tag LOCUS_24510 7886 8893 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508752.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence122 155 1660 gene locus_tag LOCUS_24520 155 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1671 4076 gene locus_tag LOCUS_24530 1671 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 4095 7034 gene locus_tag LOCUS_24540 4095 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 7027 7797 gene locus_tag LOCUS_24550 7027 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 8957 7836 gene locus_tag LOCUS_24560 8957 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence123 1061 615 gene locus_tag LOCUS_24570 1061 615 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444136.1 protein_id gnl|my_center|LOCUS_24570 1405 2409 gene locus_tag LOCUS_24580 gene bioB 1405 2409 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_24580 2406 3620 gene locus_tag LOCUS_24590 gene bioF 2406 3620 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 protein_id gnl|my_center|LOCUS_24590 3617 4393 gene locus_tag LOCUS_24600 gene bioH 3617 4393 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817359.1 protein_id gnl|my_center|LOCUS_24600 4384 5166 gene locus_tag LOCUS_24610 gene bioC 4384 5166 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705389.1 protein_id gnl|my_center|LOCUS_24610 5173 5853 gene locus_tag LOCUS_24620 gene bioD 5173 5853 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957946.1 protein_id gnl|my_center|LOCUS_24620 6323 5967 gene locus_tag LOCUS_24630 gene rsfS 6323 5967 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_24630 6972 6349 gene locus_tag LOCUS_24640 gene nadD 6972 6349 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_24640 8229 6973 gene locus_tag LOCUS_24650 8229 6973 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence124 428 1234 gene locus_tag LOCUS_24660 428 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1246 1911 gene locus_tag LOCUS_24670 1246 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2072 2326 gene locus_tag LOCUS_24680 2072 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2627 2944 gene locus_tag LOCUS_24690 2627 2944 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_24690 3640 3194 gene locus_tag LOCUS_24700 3640 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4838 3858 gene locus_tag LOCUS_24710 4838 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 5127 4924 gene locus_tag LOCUS_24720 5127 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 5350 6930 gene locus_tag LOCUS_24730 5350 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 8382 8131 gene locus_tag LOCUS_24740 8382 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence125 654 436 gene locus_tag LOCUS_24750 654 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 1683 721 gene locus_tag LOCUS_24760 1683 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2463 1699 gene locus_tag LOCUS_24770 2463 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2743 2477 gene locus_tag LOCUS_24780 2743 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3459 2740 gene locus_tag LOCUS_24790 3459 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 3665 3465 gene locus_tag LOCUS_24800 3665 3465 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723758.1 protein_id gnl|my_center|LOCUS_24800 3892 3668 gene locus_tag LOCUS_24810 3892 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 5533 3962 gene locus_tag LOCUS_24820 gene nifK 5533 3962 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_24820 7108 5627 gene locus_tag LOCUS_24830 gene nifD 7108 5627 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_24830 8124 7243 gene locus_tag LOCUS_24840 gene nifH 8124 7243 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence126 939 307 gene locus_tag LOCUS_24850 939 307 CDS product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103486.1 protein_id gnl|my_center|LOCUS_24850 1357 932 gene locus_tag LOCUS_24860 1357 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 3131 1497 gene locus_tag LOCUS_24870 3131 1497 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_24870 3256 3747 gene locus_tag LOCUS_24880 3256 3747 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236185.1 protein_id gnl|my_center|LOCUS_24880 3794 4111 gene locus_tag LOCUS_24890 3794 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 5077 4169 gene locus_tag LOCUS_24900 gene rdgC 5077 4169 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 protein_id gnl|my_center|LOCUS_24900 5742 5230 gene locus_tag LOCUS_24910 5742 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 5823 6644 gene locus_tag LOCUS_24920 5823 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582849.1 protein_id gnl|my_center|LOCUS_24920 7018 6656 gene locus_tag LOCUS_24930 7018 6656 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_24930 7208 8263 gene locus_tag LOCUS_24940 7208 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence127 146 1075 gene locus_tag LOCUS_24950 146 1075 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_24950 1139 1858 gene locus_tag LOCUS_24960 1139 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 2513 2052 gene locus_tag LOCUS_24970 2513 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 3299 2550 gene locus_tag LOCUS_24980 3299 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 3941 3318 gene locus_tag LOCUS_24990 3941 3318 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_24990 6310 4172 gene locus_tag LOCUS_25000 6310 4172 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_25000 7251 6361 gene locus_tag LOCUS_25010 gene yghX 7251 6361 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_25010 7808 7266 gene locus_tag LOCUS_25020 7808 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence128 134 511 gene locus_tag LOCUS_25030 134 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 608 874 gene locus_tag LOCUS_25040 608 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1007 3571 gene locus_tag LOCUS_25050 1007 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 3571 3837 gene locus_tag LOCUS_25060 3571 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 3827 4111 gene locus_tag LOCUS_25070 3827 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 4108 4287 gene locus_tag LOCUS_25080 4108 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 4284 4532 gene locus_tag LOCUS_25090 4284 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 5007 4576 gene locus_tag LOCUS_25100 5007 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966380.1 protein_id gnl|my_center|LOCUS_25100 5905 5198 gene locus_tag LOCUS_25110 5905 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 6583 6194 gene locus_tag LOCUS_25120 6583 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 7170 7445 gene locus_tag LOCUS_25130 7170 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 7501 7725 gene locus_tag LOCUS_25140 7501 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 7709 7975 gene locus_tag LOCUS_25150 7709 7975 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence129 3156 2227 gene locus_tag LOCUS_25160 3156 2227 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_25160 3850 7878 gene locus_tag LOCUS_25170 3850 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence130 649 137 gene locus_tag LOCUS_25180 649 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1164 676 gene locus_tag LOCUS_25190 1164 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1179 1772 gene locus_tag LOCUS_25200 1179 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1785 2393 gene locus_tag LOCUS_25210 1785 2393 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_25210 3767 2508 gene locus_tag LOCUS_25220 3767 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25220 4939 3815 gene locus_tag LOCUS_25230 4939 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 4869 5069 gene locus_tag LOCUS_25240 4869 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 5164 5418 gene locus_tag LOCUS_25250 5164 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 6076 5735 gene locus_tag LOCUS_25260 6076 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 6270 6067 gene locus_tag LOCUS_25270 6270 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 7340 6375 gene locus_tag LOCUS_25280 7340 6375 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 protein_id gnl|my_center|LOCUS_25280 7802 7347 gene locus_tag LOCUS_25290 7802 7347 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815434.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence131 <1 1109 gene locus_tag LOCUS_25300 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966109.1:DEAD/DEAH box helicase family protein 1128 1598 gene locus_tag LOCUS_25310 1128 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1641 1952 gene locus_tag LOCUS_25320 1641 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2234 2407 gene locus_tag LOCUS_25330 2234 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2422 3546 gene locus_tag LOCUS_25340 2422 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 3567 4139 gene locus_tag LOCUS_25350 3567 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 4132 5004 gene locus_tag LOCUS_25360 4132 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 6510 5017 gene locus_tag LOCUS_25370 6510 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 7086 6688 gene locus_tag LOCUS_25380 7086 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 7346 7083 gene locus_tag LOCUS_25390 7346 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence132 775 2559 gene locus_tag LOCUS_25400 775 2559 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104709.1 protein_id gnl|my_center|LOCUS_25400 2561 3274 gene locus_tag LOCUS_25410 2561 3274 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_25410 3747 3352 gene locus_tag LOCUS_25420 3747 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 6311 3822 gene locus_tag LOCUS_25430 6311 3822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 protein_id gnl|my_center|LOCUS_25430 7036 6308 gene locus_tag LOCUS_25440 7036 6308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_25440 6999 7517 gene locus_tag LOCUS_25450 gene tesA 6999 7517 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114753.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence133 292 143 gene locus_tag LOCUS_25460 292 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 274 639 gene locus_tag LOCUS_25470 274 639 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049049137.1 protein_id gnl|my_center|LOCUS_25470 687 1121 gene locus_tag LOCUS_25480 687 1121 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095198.1 protein_id gnl|my_center|LOCUS_25480 1275 2264 gene locus_tag LOCUS_25490 gene arsB 1275 2264 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_25490 2333 3682 gene locus_tag LOCUS_25500 2333 3682 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105320.1 protein_id gnl|my_center|LOCUS_25500 3682 4404 gene locus_tag LOCUS_25510 3682 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 5351 4638 gene locus_tag LOCUS_25520 5351 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 5805 5353 gene locus_tag LOCUS_25530 5805 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 6113 5805 gene locus_tag LOCUS_25540 6113 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 <7685 6402 gene locus_tag LOCUS_25550 <7685 6402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037394620.1:M10 family metallopeptidase C-terminal domain-containing protein >Feature sequence134 2353 659 gene locus_tag LOCUS_25560 2353 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3091 2522 gene locus_tag LOCUS_25570 3091 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 3547 3137 gene locus_tag LOCUS_25580 3547 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 4866 4027 gene locus_tag LOCUS_25590 4866 4027 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533515.1 protein_id gnl|my_center|LOCUS_25590 5368 6381 gene locus_tag LOCUS_25600 5368 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_25600 6593 7021 gene locus_tag LOCUS_25610 6593 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence135 160 2355 gene locus_tag LOCUS_25620 160 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2361 2762 gene locus_tag LOCUS_25630 2361 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 5314 4265 gene locus_tag LOCUS_25640 5314 4265 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149357996.1 protein_id gnl|my_center|LOCUS_25640 5561 6079 gene locus_tag LOCUS_25650 5561 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 6561 6355 gene locus_tag LOCUS_25660 6561 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 6886 6686 gene locus_tag LOCUS_25670 6886 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 6990 7436 gene locus_tag LOCUS_25680 6990 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence136 245 877 gene locus_tag LOCUS_25690 245 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 4525 1043 gene locus_tag LOCUS_25700 4525 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 <7444 5170 gene locus_tag LOCUS_25710 <7444 5170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404782.1:serine/threonine protein kinase PknD >Feature sequence137 188 538 gene locus_tag LOCUS_25720 188 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 577 1056 gene locus_tag LOCUS_25730 577 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1053 1541 gene locus_tag LOCUS_25740 1053 1541 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 protein_id gnl|my_center|LOCUS_25740 1548 2423 gene locus_tag LOCUS_25750 1548 2423 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008487788.1 protein_id gnl|my_center|LOCUS_25750 2420 2875 gene locus_tag LOCUS_25760 2420 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 4124 2904 gene locus_tag LOCUS_25770 gene mshG 4124 2904 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_25770 5850 4126 gene locus_tag LOCUS_25780 5850 4126 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073811.1 protein_id gnl|my_center|LOCUS_25780 7143 5851 gene locus_tag LOCUS_25790 7143 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence138 125 355 gene locus_tag LOCUS_25800 125 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 2141 426 gene locus_tag LOCUS_25810 gene cydC 2141 426 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205201.1 protein_id gnl|my_center|LOCUS_25810 3856 2138 gene locus_tag LOCUS_25820 gene cydD 3856 2138 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075764720.1 protein_id gnl|my_center|LOCUS_25820 4234 5319 gene locus_tag LOCUS_25830 4234 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 5356 5730 gene locus_tag LOCUS_25840 5356 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 5651 5866 gene locus_tag LOCUS_25850 5651 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 5922 6575 gene locus_tag LOCUS_25860 5922 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 <7288 6666 gene locus_tag LOCUS_25870 <7288 6666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256867.1:multicopper oxidase domain-containing protein >Feature sequence139 1384 179 gene locus_tag LOCUS_25880 1384 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25880 2673 1396 gene locus_tag LOCUS_25890 2673 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25890 3398 2670 gene locus_tag LOCUS_25900 3398 2670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_25900 3361 3969 gene locus_tag LOCUS_25910 gene tesA 3361 3969 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114753.1 protein_id gnl|my_center|LOCUS_25910 3984 4412 gene locus_tag LOCUS_25920 3984 4412 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 protein_id gnl|my_center|LOCUS_25920 5290 4511 gene locus_tag LOCUS_25930 gene tatC 5290 4511 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260928.1 protein_id gnl|my_center|LOCUS_25930 5603 5277 gene locus_tag LOCUS_25940 5603 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 5823 5605 gene locus_tag LOCUS_25950 gene tatA 5823 5605 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648696.1 protein_id gnl|my_center|LOCUS_25950 6240 5917 gene locus_tag LOCUS_25960 6240 5917 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105340.1 protein_id gnl|my_center|LOCUS_25960 6628 6233 gene locus_tag LOCUS_25970 gene hisI 6628 6233 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_25970 <7237 6625 gene locus_tag LOCUS_25980 <7237 6625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106334.1:imidazole glycerol phosphate synthase subunit HisF >Feature sequence140 1395 25 gene locus_tag LOCUS_25990 1395 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 2147 1719 gene locus_tag LOCUS_26000 2147 1719 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_26000 2595 2278 gene locus_tag LOCUS_26010 2595 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2807 2601 gene locus_tag LOCUS_26020 gene tatA 2807 2601 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214303.1 protein_id gnl|my_center|LOCUS_26020 4091 2907 gene locus_tag LOCUS_26030 4091 2907 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115339.1 protein_id gnl|my_center|LOCUS_26030 5865 4312 gene locus_tag LOCUS_26040 5865 4312 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114902.1 protein_id gnl|my_center|LOCUS_26040 6598 6011 gene locus_tag LOCUS_26050 6598 6011 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811316.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence141 448 206 gene locus_tag LOCUS_26060 448 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 1345 710 gene locus_tag LOCUS_26070 1345 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 1532 2869 gene locus_tag LOCUS_26080 1532 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2872 3663 gene locus_tag LOCUS_26090 2872 3663 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921843.1 protein_id gnl|my_center|LOCUS_26090 5175 3736 gene locus_tag LOCUS_26100 5175 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 5645 5899 gene locus_tag LOCUS_26110 5645 5899 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_26110 5896 6255 gene locus_tag LOCUS_26120 5896 6255 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence142 1062 613 gene locus_tag LOCUS_26130 gene tolR 1062 613 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 protein_id gnl|my_center|LOCUS_26130 1736 1059 gene locus_tag LOCUS_26140 gene tolQ 1736 1059 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_26140 2136 1726 gene locus_tag LOCUS_26150 gene ybgC 2136 1726 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_26150 3230 2196 gene locus_tag LOCUS_26160 gene ruvB 3230 2196 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 protein_id gnl|my_center|LOCUS_26160 3838 3227 gene locus_tag LOCUS_26170 gene ruvA 3838 3227 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_26170 4335 3835 gene locus_tag LOCUS_26180 gene ruvC 4335 3835 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457261.1 protein_id gnl|my_center|LOCUS_26180 4993 4355 gene locus_tag LOCUS_26190 4993 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 5113 5658 gene locus_tag LOCUS_26200 5113 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 5662 6087 gene locus_tag LOCUS_26210 gene hemJ 5662 6087 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_26210 6686 6258 gene locus_tag LOCUS_26220 6686 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence143 2454 184 gene locus_tag LOCUS_26230 gene hypF 2454 184 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_26230 3557 2460 gene locus_tag LOCUS_26240 gene hypD 3557 2460 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250950.1 protein_id gnl|my_center|LOCUS_26240 3848 3612 gene locus_tag LOCUS_26250 3848 3612 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_26250 4091 3885 gene locus_tag LOCUS_26260 gene yacG 4091 3885 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429021.1 protein_id gnl|my_center|LOCUS_26260 4874 4104 gene locus_tag LOCUS_26270 gene zapD 4874 4104 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815038.1 protein_id gnl|my_center|LOCUS_26270 5484 4867 gene locus_tag LOCUS_26280 gene coaE 5484 4867 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704406.1 protein_id gnl|my_center|LOCUS_26280 6371 5490 gene locus_tag LOCUS_26290 6371 5490 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence144 39 1886 gene locus_tag LOCUS_26300 39 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 1886 3739 gene locus_tag LOCUS_26310 gene pcrA 1886 3739 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225356248.1 protein_id gnl|my_center|LOCUS_26310 4474 6558 gene locus_tag LOCUS_26320 4474 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence145 1117 98 gene locus_tag LOCUS_26330 1117 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1419 1123 gene locus_tag LOCUS_26340 1419 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1527 1709 gene locus_tag LOCUS_26350 1527 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1706 2002 gene locus_tag LOCUS_26360 1706 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2003 2536 gene locus_tag LOCUS_26370 2003 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 3273 4082 gene locus_tag LOCUS_26380 3273 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 5540 4113 gene locus_tag LOCUS_26390 5540 4113 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036632.1 protein_id gnl|my_center|LOCUS_26390 6433 5537 gene locus_tag LOCUS_26400 6433 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence146 513 250 gene locus_tag LOCUS_26410 513 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 591 2462 gene locus_tag LOCUS_26420 gene mnmG 591 2462 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 protein_id gnl|my_center|LOCUS_26420 2462 3106 gene locus_tag LOCUS_26430 gene rsmG 2462 3106 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948576.1 protein_id gnl|my_center|LOCUS_26430 3094 3870 gene locus_tag LOCUS_26440 3094 3870 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948577.1 protein_id gnl|my_center|LOCUS_26440 3861 4163 gene locus_tag LOCUS_26450 3861 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 4262 5116 gene locus_tag LOCUS_26460 4262 5116 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_26460 5723 5214 gene locus_tag LOCUS_26470 5723 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 6149 6466 gene locus_tag LOCUS_26480 6149 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence147 1811 2098 gene locus_tag LOCUS_26490 1811 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 3316 2129 gene locus_tag LOCUS_26500 3316 2129 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_26500 5933 3546 gene locus_tag LOCUS_26510 5933 3546 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence148 209 1789 gene locus_tag LOCUS_26520 209 1789 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946608.1 protein_id gnl|my_center|LOCUS_26520 2179 1865 gene locus_tag LOCUS_26530 2179 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 3674 2280 gene locus_tag LOCUS_26540 gene pntB 3674 2280 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014036.1 protein_id gnl|my_center|LOCUS_26540 5249 3687 gene locus_tag LOCUS_26550 gene pntA 5249 3687 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219360.1 protein_id gnl|my_center|LOCUS_26550 5441 6358 gene locus_tag LOCUS_26560 5441 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence149 222 1388 gene locus_tag LOCUS_26570 222 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1398 2138 gene locus_tag LOCUS_26580 1398 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 3878 2154 gene locus_tag LOCUS_26590 3878 2154 CDS product DUF2326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964053.1 protein_id gnl|my_center|LOCUS_26590 4096 3869 gene locus_tag LOCUS_26600 4096 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015758591.1 protein_id gnl|my_center|LOCUS_26600 5057 4083 gene locus_tag LOCUS_26610 5057 4083 CDS product SMEK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964051.1 protein_id gnl|my_center|LOCUS_26610 6091 5489 gene locus_tag LOCUS_26620 6091 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence150 456 217 gene locus_tag LOCUS_26630 456 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 735 466 gene locus_tag LOCUS_26640 735 466 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189463936.1 protein_id gnl|my_center|LOCUS_26640 904 1185 gene locus_tag LOCUS_26650 904 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1182 1685 gene locus_tag LOCUS_26660 1182 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_26660 1871 1653 gene locus_tag LOCUS_26670 1871 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2385 1948 gene locus_tag LOCUS_26680 2385 1948 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_26680 3139 2651 gene locus_tag LOCUS_26690 3139 2651 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533488.1 protein_id gnl|my_center|LOCUS_26690 3408 3136 gene locus_tag LOCUS_26700 3408 3136 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045874275.1 protein_id gnl|my_center|LOCUS_26700 3962 3561 gene locus_tag LOCUS_26710 3962 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 4220 4011 gene locus_tag LOCUS_26720 4220 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 5546 4911 gene locus_tag LOCUS_26730 5546 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 5967 5650 gene locus_tag LOCUS_26740 5967 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence151 323 123 gene locus_tag LOCUS_26750 323 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 526 272 gene locus_tag LOCUS_26760 526 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 1021 611 gene locus_tag LOCUS_26770 1021 611 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_26770 1245 1018 gene locus_tag LOCUS_26780 1245 1018 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_26780 2379 1342 gene locus_tag LOCUS_26790 2379 1342 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 protein_id gnl|my_center|LOCUS_26790 4114 2447 gene locus_tag LOCUS_26800 gene hcp 4114 2447 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705038.1 protein_id gnl|my_center|LOCUS_26800 4351 5835 gene locus_tag LOCUS_26810 gene norR 4351 5835 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence152 384 226 gene locus_tag LOCUS_26820 384 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 627 391 gene locus_tag LOCUS_26830 627 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 1022 615 gene locus_tag LOCUS_26840 1022 615 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649049.1 protein_id gnl|my_center|LOCUS_26840 1273 1019 gene locus_tag LOCUS_26850 1273 1019 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649046.1 protein_id gnl|my_center|LOCUS_26850 1593 1345 gene locus_tag LOCUS_26860 1593 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1912 1616 gene locus_tag LOCUS_26870 1912 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 3130 1994 gene locus_tag LOCUS_26880 3130 1994 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_26880 4226 3123 gene locus_tag LOCUS_26890 4226 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 5828 4302 gene locus_tag LOCUS_26900 5828 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence153 729 995 gene locus_tag LOCUS_26910 729 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 1953 1363 gene locus_tag LOCUS_26920 1953 1363 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762703.1 protein_id gnl|my_center|LOCUS_26920 3061 1940 gene locus_tag LOCUS_26930 3061 1940 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272343.1 protein_id gnl|my_center|LOCUS_26930 5325 3073 gene locus_tag LOCUS_26940 5325 3073 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_26940 5795 5322 gene locus_tag LOCUS_26950 5795 5322 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence154 788 339 gene locus_tag LOCUS_26960 788 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1060 791 gene locus_tag LOCUS_26970 1060 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 1576 1400 gene locus_tag LOCUS_26980 1576 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2027 3883 gene locus_tag LOCUS_26990 gene ilvD 2027 3883 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 protein_id gnl|my_center|LOCUS_26990 4258 4476 gene locus_tag LOCUS_27000 4258 4476 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_27000 4641 4940 gene locus_tag LOCUS_27010 4641 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 5023 5847 gene locus_tag LOCUS_27020 5023 5847 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence155 <1 1293 gene locus_tag LOCUS_27030 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein 1290 1793 gene locus_tag LOCUS_27040 1290 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 1768 2775 gene locus_tag LOCUS_27050 1768 2775 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_27050 2777 3091 gene locus_tag LOCUS_27060 2777 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3097 3894 gene locus_tag LOCUS_27070 3097 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 4807 4535 gene locus_tag LOCUS_27080 4807 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 5069 5683 gene locus_tag LOCUS_27090 5069 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence156 4214 768 gene locus_tag LOCUS_27100 4214 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_27100 5246 4383 gene locus_tag LOCUS_27110 5246 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 5458 5243 gene locus_tag LOCUS_27120 5458 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence157 3369 859 gene locus_tag LOCUS_27130 3369 859 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_27130 4241 3630 gene locus_tag LOCUS_27140 gene thiE 4241 3630 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368782.1 protein_id gnl|my_center|LOCUS_27140 5029 4238 gene locus_tag LOCUS_27150 5029 4238 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427216.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence158 748 104 gene locus_tag LOCUS_27160 748 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2575 1496 gene locus_tag LOCUS_27170 gene zapE 2575 1496 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388963.1 protein_id gnl|my_center|LOCUS_27170 2461 2703 gene locus_tag LOCUS_27180 2461 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2877 3800 gene locus_tag LOCUS_27190 gene lpxC 2877 3800 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_27190 5440 3875 gene locus_tag LOCUS_27200 gene lnt 5440 3875 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence159 213 605 gene locus_tag LOCUS_27210 213 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 1248 727 gene locus_tag LOCUS_27220 1248 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 1990 1241 gene locus_tag LOCUS_27230 1990 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 2309 2569 gene locus_tag LOCUS_27240 2309 2569 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_27240 3333 3100 gene locus_tag LOCUS_27250 3333 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27250 3501 3334 gene locus_tag LOCUS_27260 3501 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27260 3778 3548 gene locus_tag LOCUS_27270 3778 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27270 3896 4234 gene locus_tag LOCUS_27280 3896 4234 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_27280 4218 4508 gene locus_tag LOCUS_27290 4218 4508 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_27290 4514 5437 gene locus_tag LOCUS_27300 4514 5437 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200836483.1 protein_id gnl|my_center|LOCUS_27300 5613 5771 gene locus_tag LOCUS_27310 5613 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence160 583 1530 gene locus_tag LOCUS_27320 583 1530 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728707.1 protein_id gnl|my_center|LOCUS_27320 1536 1796 gene locus_tag LOCUS_27330 1536 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 2246 1737 gene locus_tag LOCUS_27340 2246 1737 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087269.1 protein_id gnl|my_center|LOCUS_27340 2523 2239 gene locus_tag LOCUS_27350 2523 2239 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100678.1 protein_id gnl|my_center|LOCUS_27350 3452 2679 gene locus_tag LOCUS_27360 3452 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3716 4570 gene locus_tag LOCUS_27370 3716 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence161 870 2111 gene locus_tag LOCUS_27380 870 2111 CDS product ISL3-like element ISEc53 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343766.1 protein_id gnl|my_center|LOCUS_27380 2477 2247 gene locus_tag LOCUS_27390 2477 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 3269 2976 gene locus_tag LOCUS_27400 3269 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27400 3611 3375 gene locus_tag LOCUS_27410 gene vapB 3611 3375 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261287.1 protein_id gnl|my_center|LOCUS_27410 4557 5246 gene locus_tag LOCUS_27420 4557 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence162 1152 478 gene locus_tag LOCUS_27430 gene queC 1152 478 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_27430 1743 1159 gene locus_tag LOCUS_27440 gene queE 1743 1159 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_27440 2570 1803 gene locus_tag LOCUS_27450 gene ybgF 2570 1803 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_27450 3329 2736 gene locus_tag LOCUS_27460 gene pal 3329 2736 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176628.1 protein_id gnl|my_center|LOCUS_27460 4718 3390 gene locus_tag LOCUS_27470 gene tolB 4718 3390 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_27470 <5491 4823 gene locus_tag LOCUS_27480 <5491 4823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947301.1:cell envelope integrity protein TolA >Feature sequence163 758 348 gene locus_tag LOCUS_27490 758 348 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771285.1 protein_id gnl|my_center|LOCUS_27490 1424 762 gene locus_tag LOCUS_27500 1424 762 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010203861.1 protein_id gnl|my_center|LOCUS_27500 1847 1458 gene locus_tag LOCUS_27510 1847 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 1735 2190 gene locus_tag LOCUS_27520 1735 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 4779 2359 gene locus_tag LOCUS_27530 4779 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence164 797 456 gene locus_tag LOCUS_27540 797 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 1422 790 gene locus_tag LOCUS_27550 1422 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 2022 1438 gene locus_tag LOCUS_27560 2022 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 3001 2030 gene locus_tag LOCUS_27570 3001 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 3316 4455 gene locus_tag LOCUS_27580 gene hemW 3316 4455 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_27580 4498 5136 gene locus_tag LOCUS_27590 gene pyrE 4498 5136 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815272.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence165 178 1035 gene locus_tag LOCUS_27600 178 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1066 1992 gene locus_tag LOCUS_27610 gene cas6 1066 1992 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941839.1 protein_id gnl|my_center|LOCUS_27610 2148 3156 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttagaaagttgccctgattaagaagggattaagac 3260 3514 gene locus_tag LOCUS_27620 3260 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390515.1 protein_id gnl|my_center|LOCUS_27620 3591 4553 gene locus_tag LOCUS_27630 gene cas1 3591 4553 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_27630 4537 4815 gene locus_tag LOCUS_27640 4537 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 4828 4980 gene locus_tag LOCUS_27650 4828 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence166 2444 108 gene locus_tag LOCUS_27660 2444 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 3717 4040 gene locus_tag LOCUS_27670 3717 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 4066 4341 gene locus_tag LOCUS_27680 4066 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 4341 4556 gene locus_tag LOCUS_27690 4341 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 4562 4906 gene locus_tag LOCUS_27700 4562 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence167 1793 201 gene locus_tag LOCUS_27710 gene cydD 1793 201 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075764720.1 protein_id gnl|my_center|LOCUS_27710 1929 2510 gene locus_tag LOCUS_27720 1929 2510 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_27720 2786 4105 gene locus_tag LOCUS_27730 gene argA 2786 4105 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211624.1 protein_id gnl|my_center|LOCUS_27730 4112 4903 gene locus_tag LOCUS_27740 gene cpdA 4112 4903 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 protein_id gnl|my_center|LOCUS_27740 >Feature sequence168 775 95 gene locus_tag LOCUS_27750 775 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 960 772 gene locus_tag LOCUS_27760 960 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1232 957 gene locus_tag LOCUS_27770 1232 957 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202715939.1 protein_id gnl|my_center|LOCUS_27770 2492 1275 gene locus_tag LOCUS_27780 2492 1275 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938994.1 protein_id gnl|my_center|LOCUS_27780 4882 2483 gene locus_tag LOCUS_27790 4882 2483 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence169 1039 299 gene locus_tag LOCUS_27800 gene hisA 1039 299 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_27800 1714 1073 gene locus_tag LOCUS_27810 gene hisH 1714 1073 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207858.1 protein_id gnl|my_center|LOCUS_27810 2337 1744 gene locus_tag LOCUS_27820 gene hisB 2337 1744 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551454.1 protein_id gnl|my_center|LOCUS_27820 4279 2468 gene locus_tag LOCUS_27830 gene typA 4279 2468 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021411.1 protein_id gnl|my_center|LOCUS_27830 4785 4393 gene locus_tag LOCUS_27840 4785 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence170 698 1141 gene locus_tag LOCUS_27850 698 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 1202 1561 gene locus_tag LOCUS_27860 1202 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 3310 2174 gene locus_tag LOCUS_27870 3310 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4612 3860 gene locus_tag LOCUS_27880 4612 3860 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 protein_id gnl|my_center|LOCUS_27880 4782 4609 gene locus_tag LOCUS_27890 4782 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence171 526 846 gene locus_tag LOCUS_27900 526 846 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_27900 2109 1366 gene locus_tag LOCUS_27910 gene istB 2109 1366 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_27910 3779 2238 gene locus_tag LOCUS_27920 gene istA 3779 2238 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_27920 4236 3994 gene locus_tag LOCUS_27930 4236 3994 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986881.1 protein_id gnl|my_center|LOCUS_27930 4471 4250 gene locus_tag LOCUS_27940 4471 4250 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_27940 4866 4624 gene locus_tag LOCUS_27950 4866 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence172 184 411 gene locus_tag LOCUS_27960 184 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 445 627 gene locus_tag LOCUS_27970 445 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 1039 1305 gene locus_tag LOCUS_27980 1039 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 1903 1328 gene locus_tag LOCUS_27990 1903 1328 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_27990 2335 2571 gene locus_tag LOCUS_28000 2335 2571 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_28000 2584 2757 gene locus_tag LOCUS_28010 2584 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 3581 4429 gene locus_tag LOCUS_28020 3581 4429 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence173 2644 569 gene locus_tag LOCUS_28030 2644 569 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525144.1 protein_id gnl|my_center|LOCUS_28030 4494 2833 gene locus_tag LOCUS_28040 4494 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence174 187 450 gene locus_tag LOCUS_28050 187 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 447 1817 gene locus_tag LOCUS_28060 gene rmuC 447 1817 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_28060 1817 3091 gene locus_tag LOCUS_28070 1817 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 3096 4229 gene locus_tag LOCUS_28080 3096 4229 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419707.1 protein_id gnl|my_center|LOCUS_28080 4562 4681 gene locus_tag LOCUS_28090 4562 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence175 551 1267 gene locus_tag LOCUS_28100 551 1267 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530487.1 protein_id gnl|my_center|LOCUS_28100 1258 2025 gene locus_tag LOCUS_28110 1258 2025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 protein_id gnl|my_center|LOCUS_28110 3028 2069 gene locus_tag LOCUS_28120 3028 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 3393 3785 gene locus_tag LOCUS_28130 3393 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28130 3857 4636 gene locus_tag LOCUS_28140 3857 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28140 >Feature sequence176 358 122 gene locus_tag LOCUS_28150 358 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 741 361 gene locus_tag LOCUS_28160 gene cmr5 741 361 CDS product type III-B CRISPR module-associated protein Cmr5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879355.1 protein_id gnl|my_center|LOCUS_28160 1634 744 gene locus_tag LOCUS_28170 gene cmr4 1634 744 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221897993.1 protein_id gnl|my_center|LOCUS_28170 2939 1647 gene locus_tag LOCUS_28180 gene cmr3 2939 1647 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155321014.1 protein_id gnl|my_center|LOCUS_28180 4617 2932 gene locus_tag LOCUS_28190 4617 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence177 493 227 gene locus_tag LOCUS_28200 493 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 842 510 gene locus_tag LOCUS_28210 842 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 2575 1079 gene locus_tag LOCUS_28220 gene lnt 2575 1079 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118259.1 protein_id gnl|my_center|LOCUS_28220 2778 3077 gene locus_tag LOCUS_28230 2778 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3074 3553 gene locus_tag LOCUS_28240 3074 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3578 3883 gene locus_tag LOCUS_28250 3578 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3953 4156 gene locus_tag LOCUS_28260 3953 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 4153 4434 gene locus_tag LOCUS_28270 4153 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence178 2085 82 gene locus_tag LOCUS_28280 gene kdpB 2085 82 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_28280 3963 2155 gene locus_tag LOCUS_28290 gene kdpA 3963 2155 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 protein_id gnl|my_center|LOCUS_28290 4327 4512 gene locus_tag LOCUS_28300 4327 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence179 838 329 gene locus_tag LOCUS_28310 838 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2016 835 gene locus_tag LOCUS_28320 2016 835 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_28320 2173 2658 gene locus_tag LOCUS_28330 2173 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 3671 2724 gene locus_tag LOCUS_28340 3671 2724 CDS product lectin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144928.1 protein_id gnl|my_center|LOCUS_28340 4250 3969 gene locus_tag LOCUS_28350 4250 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence180 218 1312 gene locus_tag LOCUS_28360 218 1312 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_28360 1386 2264 gene locus_tag LOCUS_28370 1386 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2297 2671 gene locus_tag LOCUS_28380 2297 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 2678 3784 gene locus_tag LOCUS_28390 2678 3784 CDS product ATP-binding protein/SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704394.1 protein_id gnl|my_center|LOCUS_28390 3772 4404 gene locus_tag LOCUS_28400 3772 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence181 267 121 gene locus_tag LOCUS_28410 267 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 482 1390 gene locus_tag LOCUS_28420 482 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 1387 2715 gene locus_tag LOCUS_28430 1387 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2757 2954 gene locus_tag LOCUS_28440 2757 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 2968 4128 gene locus_tag LOCUS_28450 2968 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 4118 4411 gene locus_tag LOCUS_28460 4118 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence182 <1 1183 gene locus_tag LOCUS_28470 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206818886.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase 1305 1766 gene locus_tag LOCUS_28480 1305 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 2375 2989 gene locus_tag LOCUS_28490 2375 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3493 4155 gene locus_tag LOCUS_28500 3493 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence183 411 767 gene locus_tag LOCUS_28510 411 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1048 2001 gene locus_tag LOCUS_28520 1048 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3004 4287 gene locus_tag LOCUS_28530 3004 4287 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence184 1304 165 gene locus_tag LOCUS_28540 gene hemW 1304 165 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_28540 1815 2843 gene locus_tag LOCUS_28550 1815 2843 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 protein_id gnl|my_center|LOCUS_28550 2951 3817 gene locus_tag LOCUS_28560 2951 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 4165 3893 gene locus_tag LOCUS_28570 4165 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence185 157 435 gene locus_tag LOCUS_28580 157 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 473 652 gene locus_tag LOCUS_28590 473 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 933 694 gene locus_tag LOCUS_28600 933 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 1193 933 gene locus_tag LOCUS_28610 1193 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 1581 2627 gene locus_tag LOCUS_28620 1581 2627 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_28620 2631 3926 gene locus_tag LOCUS_28630 gene mtaB 2631 3926 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_28630 3964 4110 gene locus_tag LOCUS_28640 3964 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence186 183 659 gene locus_tag LOCUS_28650 183 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 652 2670 gene locus_tag LOCUS_28660 652 2670 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400611.1 protein_id gnl|my_center|LOCUS_28660 3858 2773 gene locus_tag LOCUS_28670 3858 2773 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510611.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence187 937 515 gene locus_tag LOCUS_28680 937 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2069 1428 gene locus_tag LOCUS_28690 2069 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2650 2066 gene locus_tag LOCUS_28700 2650 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 3028 2744 gene locus_tag LOCUS_28710 3028 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036801.1 protein_id gnl|my_center|LOCUS_28710 3350 3147 gene locus_tag LOCUS_28720 3350 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 3950 3462 gene locus_tag LOCUS_28730 3950 3462 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035384.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence188 502 278 gene locus_tag LOCUS_28740 502 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2825 513 gene locus_tag LOCUS_28750 gene feoB 2825 513 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 protein_id gnl|my_center|LOCUS_28750 3058 2825 gene locus_tag LOCUS_28760 3058 2825 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence189 316 765 gene locus_tag LOCUS_28770 316 765 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815835.1 protein_id gnl|my_center|LOCUS_28770 1272 769 gene locus_tag LOCUS_28780 1272 769 CDS product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940855.1 protein_id gnl|my_center|LOCUS_28780 1594 1382 gene locus_tag LOCUS_28790 1594 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 2494 2279 gene locus_tag LOCUS_28800 2494 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 2726 2508 gene locus_tag LOCUS_28810 2726 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 3889 2840 gene locus_tag LOCUS_28820 3889 2840 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393512.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence190 98 466 gene locus_tag LOCUS_28830 98 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 580 446 gene locus_tag LOCUS_28840 580 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 700 858 gene locus_tag LOCUS_28850 700 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 1327 956 gene locus_tag LOCUS_28860 1327 956 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405865.1 protein_id gnl|my_center|LOCUS_28860 1521 1324 gene locus_tag LOCUS_28870 1521 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1734 1892 gene locus_tag LOCUS_28880 1734 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 2187 1876 gene locus_tag LOCUS_28890 2187 1876 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943076.1 protein_id gnl|my_center|LOCUS_28890 2422 2177 gene locus_tag LOCUS_28900 2422 2177 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943075.1 protein_id gnl|my_center|LOCUS_28900 2606 2755 gene locus_tag LOCUS_28910 2606 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3072 3353 gene locus_tag LOCUS_28920 3072 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 >Feature sequence191 209 1330 gene locus_tag LOCUS_28930 gene gmd 209 1330 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048190.1 protein_id gnl|my_center|LOCUS_28930 1335 2309 gene locus_tag LOCUS_28940 1335 2309 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 protein_id gnl|my_center|LOCUS_28940 3473 3916 gene locus_tag LOCUS_28950 3473 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence192 167 715 gene locus_tag LOCUS_28960 167 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 712 2820 gene locus_tag LOCUS_28970 712 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 2871 3311 gene locus_tag LOCUS_28980 2871 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 3292 3870 gene locus_tag LOCUS_28990 3292 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 >Feature sequence193 1587 226 gene locus_tag LOCUS_29000 1587 226 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_29000 1757 2434 gene locus_tag LOCUS_29010 1757 2434 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_29010 2544 2870 gene locus_tag LOCUS_29020 2544 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 3625 2966 gene locus_tag LOCUS_29030 3625 2966 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence194 310 119 gene locus_tag LOCUS_29040 310 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 764 318 gene locus_tag LOCUS_29050 764 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29050 1765 740 gene locus_tag LOCUS_29060 1765 740 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 protein_id gnl|my_center|LOCUS_29060 3055 1772 gene locus_tag LOCUS_29070 gene tviB 3055 1772 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063859.1 protein_id gnl|my_center|LOCUS_29070 3897 3514 gene locus_tag LOCUS_29080 3897 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence195 470 1477 gene locus_tag LOCUS_29090 470 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 1971 2603 gene locus_tag LOCUS_29100 1971 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 2733 3068 gene locus_tag LOCUS_29110 2733 3068 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105450.1 protein_id gnl|my_center|LOCUS_29110 3061 3393 gene locus_tag LOCUS_29120 3061 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3426 3656 gene locus_tag LOCUS_29130 3426 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence196 162 839 gene locus_tag LOCUS_29140 162 839 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_29140 898 2244 gene locus_tag LOCUS_29150 898 2244 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_29150 2223 3131 gene locus_tag LOCUS_29160 2223 3131 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120268.1 protein_id gnl|my_center|LOCUS_29160 3324 3533 gene locus_tag LOCUS_29170 3324 3533 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence197 418 1962 gene locus_tag LOCUS_29180 418 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 1971 3242 gene locus_tag LOCUS_29190 1971 3242 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_29190 3439 3296 gene locus_tag LOCUS_29200 3439 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 3688 3470 gene locus_tag LOCUS_29210 3688 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence198 166 3642 gene locus_tag LOCUS_29220 166 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence199 190 2136 gene locus_tag LOCUS_29230 190 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2740 2327 gene locus_tag LOCUS_29240 2740 2327 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_29240 2988 2743 gene locus_tag LOCUS_29250 2988 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 3498 3046 gene locus_tag LOCUS_29260 3498 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence200 456 118 gene locus_tag LOCUS_29270 456 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 842 453 gene locus_tag LOCUS_29280 842 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 1270 845 gene locus_tag LOCUS_29290 1270 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1963 2529 gene locus_tag LOCUS_29300 gene yeiP 1963 2529 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228019.1 protein_id gnl|my_center|LOCUS_29300 2554 3615 gene locus_tag LOCUS_29310 2554 3615 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112793.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence201 914 60 gene locus_tag LOCUS_29320 914 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1899 925 gene locus_tag LOCUS_29330 1899 925 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 protein_id gnl|my_center|LOCUS_29330 3316 1904 gene locus_tag LOCUS_29340 3316 1904 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence202 1540 344 gene locus_tag LOCUS_29350 gene tyrS 1540 344 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_29350 1705 3087 gene locus_tag LOCUS_29360 1705 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 3311 3601 gene locus_tag LOCUS_29370 3311 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence203 112 1065 gene locus_tag LOCUS_29380 112 1065 CDS product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703829.1 protein_id gnl|my_center|LOCUS_29380 1052 2653 gene locus_tag LOCUS_29390 1052 2653 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_29390 2637 3263 gene locus_tag LOCUS_29400 2637 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188163.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence204 1500 826 gene locus_tag LOCUS_29410 1500 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 2104 1697 gene locus_tag LOCUS_29420 2104 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 2415 2227 gene locus_tag LOCUS_29430 2415 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 2973 2473 gene locus_tag LOCUS_29440 2973 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 3254 2970 gene locus_tag LOCUS_29450 3254 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence205 453 208 gene locus_tag LOCUS_29460 453 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 977 2050 gene locus_tag LOCUS_29470 977 2050 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080803342.1 protein_id gnl|my_center|LOCUS_29470 2061 2564 gene locus_tag LOCUS_29480 2061 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 3211 2948 gene locus_tag LOCUS_29490 3211 2948 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_29490 3464 3198 gene locus_tag LOCUS_29500 3464 3198 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039846953.1 protein_id gnl|my_center|LOCUS_29500 >Feature sequence206 <1 613 gene locus_tag LOCUS_29510 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106334.1:imidazole glycerol phosphate synthase subunit HisF 610 1005 gene locus_tag LOCUS_29520 gene hisI 610 1005 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_29520 998 1321 gene locus_tag LOCUS_29530 998 1321 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105340.1 protein_id gnl|my_center|LOCUS_29530 1415 1633 gene locus_tag LOCUS_29540 gene tatA 1415 1633 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648696.1 protein_id gnl|my_center|LOCUS_29540 1635 1961 gene locus_tag LOCUS_29550 1635 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 1948 2733 gene locus_tag LOCUS_29560 gene tatC 1948 2733 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260928.1 protein_id gnl|my_center|LOCUS_29560 3250 2822 gene locus_tag LOCUS_29570 3250 2822 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 protein_id gnl|my_center|LOCUS_29570 >Feature sequence207 490 1422 gene locus_tag LOCUS_29580 490 1422 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966734.1 protein_id gnl|my_center|LOCUS_29580 1424 2170 gene locus_tag LOCUS_29590 1424 2170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173656.1 protein_id gnl|my_center|LOCUS_29590 2167 2907 gene locus_tag LOCUS_29600 2167 2907 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532066.1 protein_id gnl|my_center|LOCUS_29600 3068 3298 gene locus_tag LOCUS_29610 3068 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence208 2542 122 gene locus_tag LOCUS_29620 2542 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 2872 2717 gene locus_tag LOCUS_29630 2872 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence209 676 996 gene locus_tag LOCUS_29640 676 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 1066 1794 gene locus_tag LOCUS_29650 1066 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 1791 2831 gene locus_tag LOCUS_29660 1791 2831 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902730.1 protein_id gnl|my_center|LOCUS_29660 2868 3245 gene locus_tag LOCUS_29670 2868 3245 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404257.1 protein_id gnl|my_center|LOCUS_29670 3263 3451 gene locus_tag LOCUS_29680 3263 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence210 1132 107 gene locus_tag LOCUS_29690 1132 107 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 protein_id gnl|my_center|LOCUS_29690 1584 3413 gene locus_tag LOCUS_29700 1584 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence211 499 125 gene locus_tag LOCUS_29710 499 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 764 528 gene locus_tag LOCUS_29720 764 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 1049 1519 gene locus_tag LOCUS_29730 1049 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 2516 1584 gene locus_tag LOCUS_29740 gene rocF 2516 1584 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887296.1 protein_id gnl|my_center|LOCUS_29740 3165 2566 gene locus_tag LOCUS_29750 3165 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3416 3192 gene locus_tag LOCUS_29760 3416 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 >Feature sequence212 314 1384 gene locus_tag LOCUS_29770 314 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 1530 2114 gene locus_tag LOCUS_29780 1530 2114 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_29780 2410 3288 gene locus_tag LOCUS_29790 2410 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence213 161 33 gene locus_tag LOCUS_29800 161 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 617 850 gene locus_tag LOCUS_29810 617 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 1398 1186 gene locus_tag LOCUS_29820 1398 1186 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_29820 2006 1791 gene locus_tag LOCUS_29830 2006 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 2334 1993 gene locus_tag LOCUS_29840 2334 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099360.1 protein_id gnl|my_center|LOCUS_29840 3173 2952 gene locus_tag LOCUS_29850 3173 2952 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_29850 3372 3166 gene locus_tag LOCUS_29860 3372 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence214 764 1567 gene locus_tag LOCUS_29870 764 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 1578 2480 gene locus_tag LOCUS_29880 1578 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 2480 2893 gene locus_tag LOCUS_29890 2480 2893 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206769.1 protein_id gnl|my_center|LOCUS_29890 3002 3256 gene locus_tag LOCUS_29900 3002 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence215 148 2022 gene locus_tag LOCUS_29910 148 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 2438 2977 gene locus_tag LOCUS_29920 2438 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence216 605 2038 gene locus_tag LOCUS_29930 605 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 2048 3277 gene locus_tag LOCUS_29940 2048 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence217 111 1982 gene locus_tag LOCUS_29950 111 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2365 2177 gene locus_tag LOCUS_29960 2365 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 >Feature sequence218 671 3091 gene locus_tag LOCUS_29970 671 3091 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117919.1 protein_id gnl|my_center|LOCUS_29970 >Feature sequence219 815 408 gene locus_tag LOCUS_29980 815 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1598 1044 gene locus_tag LOCUS_29990 1598 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 2973 1585 gene locus_tag LOCUS_30000 gene pabB 2973 1585 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063909.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence220 313 1041 gene locus_tag LOCUS_30010 313 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 1060 1542 gene locus_tag LOCUS_30020 1060 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 1532 2641 gene locus_tag LOCUS_30030 1532 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 >Feature sequence221 408 253 gene locus_tag LOCUS_30040 408 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 553 1395 gene locus_tag LOCUS_30050 553 1395 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530558.1 protein_id gnl|my_center|LOCUS_30050 1408 2145 gene locus_tag LOCUS_30060 1408 2145 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401371.1 protein_id gnl|my_center|LOCUS_30060 2132 2821 gene locus_tag LOCUS_30070 2132 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 2811 2996 gene locus_tag LOCUS_30080 2811 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 >Feature sequence222 757 1299 gene locus_tag LOCUS_30090 757 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 1392 1592 gene locus_tag LOCUS_30100 1392 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1621 2775 gene locus_tag LOCUS_30110 1621 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence223 163 975 gene locus_tag LOCUS_30120 163 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 1734 2903 gene locus_tag LOCUS_30130 1734 2903 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence224 237 16 gene locus_tag LOCUS_30140 237 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 1183 179 gene locus_tag LOCUS_30150 1183 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2328 1180 gene locus_tag LOCUS_30160 2328 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence225 2074 377 gene locus_tag LOCUS_30170 2074 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 2654 2169 gene locus_tag LOCUS_30180 2654 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 >Feature sequence226 1330 542 gene locus_tag LOCUS_30190 1330 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 1891 1340 gene locus_tag LOCUS_30200 1891 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 2675 1869 gene locus_tag LOCUS_30210 2675 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence227 1475 171 gene locus_tag LOCUS_30220 gene wzx 1475 171 CDS product O13/O129/O135 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022479.1 protein_id gnl|my_center|LOCUS_30220 2865 1729 gene locus_tag LOCUS_30230 2865 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence228 871 80 gene locus_tag LOCUS_30240 871 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 1047 874 gene locus_tag LOCUS_30250 1047 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 1797 1078 gene locus_tag LOCUS_30260 1797 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2695 1808 gene locus_tag LOCUS_30270 2695 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 >Feature sequence229 <1 1014 gene locus_tag LOCUS_30280 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064474.1:ATP-binding protein 1004 2854 gene locus_tag LOCUS_30290 1004 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence230 113 619 gene locus_tag LOCUS_30300 113 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 642 1430 gene locus_tag LOCUS_30310 642 1430 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_30310 1430 2665 gene locus_tag LOCUS_30320 1430 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence231 1034 120 gene locus_tag LOCUS_30330 1034 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 2757 1063 gene locus_tag LOCUS_30340 2757 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence232 1085 525 gene locus_tag LOCUS_30350 1085 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 1393 1151 gene locus_tag LOCUS_30360 1393 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 1571 1362 gene locus_tag LOCUS_30370 1571 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 2359 1757 gene locus_tag LOCUS_30380 2359 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence233 364 179 gene locus_tag LOCUS_30390 364 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 1618 416 gene locus_tag LOCUS_30400 1618 416 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484770.1 protein_id gnl|my_center|LOCUS_30400 <2719 1615 gene locus_tag LOCUS_30410 <2719 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948400.1:class I SAM-dependent DNA methyltransferase >Feature sequence234 401 90 gene locus_tag LOCUS_30420 401 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 685 458 gene locus_tag LOCUS_30430 685 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 905 621 gene locus_tag LOCUS_30440 905 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 965 1366 gene locus_tag LOCUS_30450 965 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 1815 1387 gene locus_tag LOCUS_30460 1815 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 2576 2037 gene locus_tag LOCUS_30470 2576 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence235 1671 1372 gene locus_tag LOCUS_30480 1671 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390515.1 protein_id gnl|my_center|LOCUS_30480 2004 1801 gene locus_tag LOCUS_30490 2004 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 2440 1994 gene locus_tag LOCUS_30500 2440 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence236 771 974 gene locus_tag LOCUS_30510 771 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30510 981 1280 gene locus_tag LOCUS_30520 981 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1277 1777 gene locus_tag LOCUS_30530 1277 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 1827 2045 gene locus_tag LOCUS_30540 1827 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 2035 2421 gene locus_tag LOCUS_30550 2035 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence237 2263 98 gene locus_tag LOCUS_30560 2263 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence238 733 951 gene locus_tag LOCUS_30570 733 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 1060 1938 gene locus_tag LOCUS_30580 1060 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 1948 2595 gene locus_tag LOCUS_30590 1948 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence239 2222 1413 gene locus_tag LOCUS_30600 2222 1413 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence240 640 302 gene locus_tag LOCUS_30610 640 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 2097 1597 gene locus_tag LOCUS_30620 2097 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 >Feature sequence241 295 1152 gene locus_tag LOCUS_30630 295 1152 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_30630 1888 1610 gene locus_tag LOCUS_30640 1888 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence242 1689 133 gene locus_tag LOCUS_30650 1689 133 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969262.1 protein_id gnl|my_center|LOCUS_30650 2305 1697 gene locus_tag LOCUS_30660 2305 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 >Feature sequence243 200 526 gene locus_tag LOCUS_30670 200 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 877 638 gene locus_tag LOCUS_30680 877 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 1269 994 gene locus_tag LOCUS_30690 1269 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 1594 2373 gene locus_tag LOCUS_30700 1594 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence244 567 292 gene locus_tag LOCUS_30710 567 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 2109 835 gene locus_tag LOCUS_30720 2109 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence245 1942 1577 gene locus_tag LOCUS_30730 gene tnpB 1942 1577 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004883347.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence246 2305 146 gene locus_tag LOCUS_30740 2305 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence247 160 420 gene locus_tag LOCUS_30750 160 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 >Feature sequence248 1125 1409 gene locus_tag LOCUS_30760 1125 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 2324 1389 gene locus_tag LOCUS_30770 2324 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence249 1689 1060 gene locus_tag LOCUS_30780 1689 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence250 1933 134 gene locus_tag LOCUS_30790 1933 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence251 390 1769 gene locus_tag LOCUS_30800 gene yjjJ 390 1769 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035780.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence252 135 1865 gene locus_tag LOCUS_30810 135 1865 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921802.1 protein_id gnl|my_center|LOCUS_30810 >Feature sequence253 122 34 gene locus_tag LOCUS_t00370 122 34 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 198 127 gene locus_tag LOCUS_t00380 198 127 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 539 465 gene locus_tag LOCUS_t00390 539 465 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1587 805 gene locus_tag LOCUS_30820 1587 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 1743 2213 gene locus_tag LOCUS_30830 1743 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence254 1059 235 gene locus_tag LOCUS_30840 gene rsmA 1059 235 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_30840 2056 1064 gene locus_tag LOCUS_30850 gene pdxA 2056 1064 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093001.1 protein_id gnl|my_center|LOCUS_30850 >Feature sequence255 1237 611 gene locus_tag LOCUS_30860 1237 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 1764 1678 gene locus_tag LOCUS_t00400 1764 1678 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence256 247 2193 gene locus_tag LOCUS_30870 247 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence257 672 106 gene locus_tag LOCUS_30880 672 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 1863 676 gene locus_tag LOCUS_30890 1863 676 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874549.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence258 1 192 gene locus_tag LOCUS_30900 1 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 957 553 gene locus_tag LOCUS_30910 957 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 2110 968 gene locus_tag LOCUS_30920 2110 968 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence259 141 323 gene locus_tag LOCUS_30930 141 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 977 375 gene locus_tag LOCUS_30940 977 375 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_30940 1396 1911 gene locus_tag LOCUS_30950 1396 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence260 531 196 gene locus_tag LOCUS_30960 531 196 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_30960 940 521 gene locus_tag LOCUS_30970 940 521 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_30970 1313 981 gene locus_tag LOCUS_30980 1313 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence261 242 439 gene locus_tag LOCUS_30990 242 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 558 1442 gene locus_tag LOCUS_31000 558 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 1414 1533 gene locus_tag LOCUS_31010 1414 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 1568 2005 gene locus_tag LOCUS_31020 1568 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence262 409 179 gene locus_tag LOCUS_31030 409 179 CDS product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768830.1 protein_id gnl|my_center|LOCUS_31030 995 1999 gene locus_tag LOCUS_31040 995 1999 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943439.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence263 418 651 gene locus_tag LOCUS_31050 418 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 1604 1783 gene locus_tag LOCUS_31060 1604 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1776 1991 gene locus_tag LOCUS_31070 1776 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 >Feature sequence264 1921 986 gene locus_tag LOCUS_31080 1921 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 >Feature sequence265 656 892 gene locus_tag LOCUS_31090 656 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 892 1338 gene locus_tag LOCUS_31100 892 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 1388 1594 gene locus_tag LOCUS_31110 1388 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence266 133 1977 gene locus_tag LOCUS_31120 133 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence267 513 136 gene locus_tag LOCUS_31130 513 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 858 1826 gene locus_tag LOCUS_31140 858 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence268 1173 190 gene locus_tag LOCUS_31150 1173 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 1120 1611 gene locus_tag LOCUS_31160 1120 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 >Feature sequence269 564 1814 gene locus_tag LOCUS_31170 564 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence270 463 191 gene locus_tag LOCUS_31180 463 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 1097 573 gene locus_tag LOCUS_31190 1097 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence271 322 1356 gene locus_tag LOCUS_31200 322 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 1494 1877 gene locus_tag LOCUS_31210 1494 1877 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192119.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence272 >Feature sequence273 1259 246 gene locus_tag LOCUS_31220 1259 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 >Feature sequence274 683 318 gene locus_tag LOCUS_31230 683 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 943 728 gene locus_tag LOCUS_31240 943 728 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_31240 1193 930 gene locus_tag LOCUS_31250 1193 930 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence275 188 379 gene locus_tag LOCUS_31260 188 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31260 385 675 gene locus_tag LOCUS_31270 385 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31270 1513 677 gene locus_tag LOCUS_31280 gene murI 1513 677 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence276 120 1679 gene locus_tag LOCUS_31290 120 1679 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110915.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence277 91 1293 gene locus_tag LOCUS_31300 91 1293 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761338.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence278 19 975 gene locus_tag LOCUS_31310 19 975 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391782.1 protein_id gnl|my_center|LOCUS_31310 >Feature sequence279 199 405 gene locus_tag LOCUS_31320 199 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 402 1481 gene locus_tag LOCUS_31330 402 1481 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_31330 >Feature sequence280 >Feature sequence281 673 341 gene locus_tag LOCUS_31340 673 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 751 1332 gene locus_tag LOCUS_31350 751 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence282 470 174 gene locus_tag LOCUS_31360 470 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 1632 736 gene locus_tag LOCUS_31370 1632 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence283 808 278 gene locus_tag LOCUS_31380 808 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 1526 795 gene locus_tag LOCUS_31390 1526 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 >Feature sequence284 1053 256 gene locus_tag LOCUS_31400 1053 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence285 291 518 gene locus_tag LOCUS_31410 291 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 515 805 gene locus_tag LOCUS_31420 515 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 1189 1025 gene locus_tag LOCUS_31430 1189 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 >Feature sequence286 177 335 gene locus_tag LOCUS_31440 177 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 360 719 gene locus_tag LOCUS_31450 360 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 709 882 gene locus_tag LOCUS_31460 709 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1268 1020 gene locus_tag LOCUS_31470 1268 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 1407 1234 gene locus_tag LOCUS_31480 1407 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence287 1505 258 gene locus_tag LOCUS_31490 1505 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence288 >Feature sequence289 88 585 gene locus_tag LOCUS_31500 88 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 582 893 gene locus_tag LOCUS_31510 582 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 1286 1558 gene locus_tag LOCUS_31520 1286 1558 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140282.1 protein_id gnl|my_center|LOCUS_31520 >Feature sequence290 <1663 1017 gene locus_tag LOCUS_31530 <1663 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816217.1:methylmalonyl-CoA decarboxylase >Feature sequence291 768 1529 gene locus_tag LOCUS_31540 768 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 >Feature sequence292 217 675 gene locus_tag LOCUS_31550 217 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 840 1220 gene locus_tag LOCUS_31560 840 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 1121 1555 gene locus_tag LOCUS_31570 1121 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence293 1034 744 gene locus_tag LOCUS_31580 1034 744 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626074.1 protein_id gnl|my_center|LOCUS_31580 1299 1039 gene locus_tag LOCUS_31590 1299 1039 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence294 153 1412 gene locus_tag LOCUS_31600 153 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600