>Feature sequence001 1228 446 gene locus_tag LOCUS_00010 1228 446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089634.1 protein_id gnl|my_center|LOCUS_00010 2100 1225 gene locus_tag LOCUS_00020 2100 1225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965651.1 protein_id gnl|my_center|LOCUS_00020 3937 2102 gene locus_tag LOCUS_00030 3937 2102 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965650.1 protein_id gnl|my_center|LOCUS_00030 5012 3969 gene locus_tag LOCUS_00040 5012 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5996 5088 gene locus_tag LOCUS_00050 5996 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7475 7990 gene locus_tag LOCUS_00060 7475 7990 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390622.1 protein_id gnl|my_center|LOCUS_00060 8052 9227 gene locus_tag LOCUS_00070 8052 9227 CDS product alkylhydroperoxidase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705511.1 protein_id gnl|my_center|LOCUS_00070 9231 10511 gene locus_tag LOCUS_00080 9231 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10508 11182 gene locus_tag LOCUS_00090 gene mtrA 10508 11182 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_00090 11349 12332 gene locus_tag LOCUS_00100 11349 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12470 13327 gene locus_tag LOCUS_00110 12470 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13324 14190 gene locus_tag LOCUS_00120 gene pstA 13324 14190 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538554.1 protein_id gnl|my_center|LOCUS_00120 14203 14952 gene locus_tag LOCUS_00130 gene pstB 14203 14952 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878856.1 protein_id gnl|my_center|LOCUS_00130 15239 15166 gene locus_tag LOCUS_t00010 15239 15166 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15501 16550 gene locus_tag LOCUS_00140 15501 16550 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530992.1 protein_id gnl|my_center|LOCUS_00140 16699 17475 gene locus_tag LOCUS_00150 16699 17475 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530993.1 protein_id gnl|my_center|LOCUS_00150 17472 18464 gene locus_tag LOCUS_00160 17472 18464 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530994.1 protein_id gnl|my_center|LOCUS_00160 19627 18473 gene locus_tag LOCUS_00170 gene ychF 19627 18473 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858396.1 protein_id gnl|my_center|LOCUS_00170 19727 20887 gene locus_tag LOCUS_00180 19727 20887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21333 22013 gene locus_tag LOCUS_00190 21333 22013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22692 22123 gene locus_tag LOCUS_00200 gene raiA 22692 22123 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632742.1 protein_id gnl|my_center|LOCUS_00200 23915 22872 gene locus_tag LOCUS_00210 gene ltaE 23915 22872 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_00210 25054 23912 gene locus_tag LOCUS_00220 25054 23912 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_00220 25356 26798 gene locus_tag LOCUS_00230 25356 26798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28214 26775 gene locus_tag LOCUS_00240 28214 26775 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_00240 29589 28246 gene locus_tag LOCUS_00250 gene trkA 29589 28246 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_00250 31467 29596 gene locus_tag LOCUS_00260 gene typA 31467 29596 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256721.1 protein_id gnl|my_center|LOCUS_00260 33082 31640 gene locus_tag LOCUS_00270 33082 31640 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_00270 34071 33127 gene locus_tag LOCUS_00280 34071 33127 CDS product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940923.1 protein_id gnl|my_center|LOCUS_00280 34937 34083 gene locus_tag LOCUS_00290 34937 34083 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943314.1 protein_id gnl|my_center|LOCUS_00290 35228 35455 gene locus_tag LOCUS_00300 35228 35455 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_00300 35452 35952 gene locus_tag LOCUS_00310 35452 35952 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406868.1 protein_id gnl|my_center|LOCUS_00310 36366 36169 gene locus_tag LOCUS_00320 36366 36169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37780 36530 gene locus_tag LOCUS_00330 37780 36530 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_00330 38881 37790 gene locus_tag LOCUS_00340 38881 37790 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_00340 39215 40516 gene locus_tag LOCUS_00350 39215 40516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40526 42457 gene locus_tag LOCUS_00360 gene selB 40526 42457 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_00360 43101 42454 gene locus_tag LOCUS_00370 43101 42454 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_00370 44001 43159 gene locus_tag LOCUS_00380 gene trpC 44001 43159 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_00380 45040 44018 gene locus_tag LOCUS_00390 gene trpD 45040 44018 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_00390 45650 45057 gene locus_tag LOCUS_00400 45650 45057 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174596.1 protein_id gnl|my_center|LOCUS_00400 46708 45647 gene locus_tag LOCUS_00410 gene trpS 46708 45647 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889658.1 protein_id gnl|my_center|LOCUS_00410 48231 46723 gene locus_tag LOCUS_00420 gene trpE 48231 46723 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257292.1 protein_id gnl|my_center|LOCUS_00420 49414 48620 gene locus_tag LOCUS_00430 49414 48620 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393072.1 protein_id gnl|my_center|LOCUS_00430 51194 49449 gene locus_tag LOCUS_00440 51194 49449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 51774 52397 gene locus_tag LOCUS_00450 51774 52397 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_00450 52414 54378 gene locus_tag LOCUS_00460 52414 54378 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_00460 54394 55149 gene locus_tag LOCUS_00470 54394 55149 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_00470 55207 56643 gene locus_tag LOCUS_00480 55207 56643 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_00480 58268 56640 gene locus_tag LOCUS_00490 58268 56640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 60097 58265 gene locus_tag LOCUS_00500 60097 58265 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_00500 60340 60104 gene locus_tag LOCUS_00510 60340 60104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 62223 60364 gene locus_tag LOCUS_00520 62223 60364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 62558 62265 gene locus_tag LOCUS_00530 62558 62265 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015947.1 protein_id gnl|my_center|LOCUS_00530 62829 64898 gene locus_tag LOCUS_00540 62829 64898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 65945 64962 gene locus_tag LOCUS_00550 65945 64962 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582676.1 protein_id gnl|my_center|LOCUS_00550 66633 65956 gene locus_tag LOCUS_00560 66633 65956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 67638 66658 gene locus_tag LOCUS_00570 67638 66658 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 protein_id gnl|my_center|LOCUS_00570 69114 67648 gene locus_tag LOCUS_00580 69114 67648 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_00580 69431 69341 gene locus_tag LOCUS_t00020 69431 69341 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 70148 69528 gene locus_tag LOCUS_00590 70148 69528 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883553.1 protein_id gnl|my_center|LOCUS_00590 70396 71592 gene locus_tag LOCUS_00600 70396 71592 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242781.1 protein_id gnl|my_center|LOCUS_00600 72057 71646 gene locus_tag LOCUS_tm00010 72057 71646 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 72275 73225 gene locus_tag LOCUS_00610 72275 73225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 73328 74200 gene locus_tag LOCUS_00620 73328 74200 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940312.1 protein_id gnl|my_center|LOCUS_00620 75380 74205 gene locus_tag LOCUS_00630 75380 74205 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941297.1 protein_id gnl|my_center|LOCUS_00630 75868 75413 gene locus_tag LOCUS_00640 75868 75413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 76190 79075 gene locus_tag LOCUS_00650 76190 79075 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_00650 79226 80731 gene locus_tag LOCUS_00660 79226 80731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 81928 80786 gene locus_tag LOCUS_00670 81928 80786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 82554 81973 gene locus_tag LOCUS_00680 82554 81973 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_00680 83351 82551 gene locus_tag LOCUS_00690 83351 82551 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259682.1 protein_id gnl|my_center|LOCUS_00690 83965 83351 gene locus_tag LOCUS_00700 83965 83351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 84197 84757 gene locus_tag LOCUS_00710 gene efp 84197 84757 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258741.1 protein_id gnl|my_center|LOCUS_00710 85648 84812 gene locus_tag LOCUS_00720 85648 84812 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312430.1 protein_id gnl|my_center|LOCUS_00720 86619 85687 gene locus_tag LOCUS_00730 86619 85687 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311603.1 protein_id gnl|my_center|LOCUS_00730 88097 86778 gene locus_tag LOCUS_00740 88097 86778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 89456 88479 gene locus_tag LOCUS_00750 89456 88479 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_00750 91279 89459 gene locus_tag LOCUS_00760 91279 89459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 91674 91276 gene locus_tag LOCUS_00770 91674 91276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 92291 91671 gene locus_tag LOCUS_00780 gene pgiA 92291 91671 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250062.1 protein_id gnl|my_center|LOCUS_00780 92636 93415 gene locus_tag LOCUS_00790 gene rhaR 92636 93415 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_00790 93613 93434 gene locus_tag LOCUS_00800 93613 93434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 93985 94914 gene locus_tag LOCUS_00810 gene xerD 93985 94914 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565337.1 protein_id gnl|my_center|LOCUS_00810 95360 94950 gene locus_tag LOCUS_00820 95360 94950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 95449 95832 gene locus_tag LOCUS_00830 95449 95832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 96859 97632 gene locus_tag LOCUS_00840 96859 97632 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_00840 97635 98030 gene locus_tag LOCUS_00850 97635 98030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 98034 98897 gene locus_tag LOCUS_00860 98034 98897 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259466.1 protein_id gnl|my_center|LOCUS_00860 98890 99669 gene locus_tag LOCUS_00870 98890 99669 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975713.1 protein_id gnl|my_center|LOCUS_00870 100900 99935 gene locus_tag LOCUS_00880 100900 99935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 100877 101083 gene locus_tag LOCUS_00890 100877 101083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 101671 102303 gene locus_tag LOCUS_00900 gene thrH 101671 102303 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_00900 102300 102770 gene locus_tag LOCUS_00910 102300 102770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 102767 104320 gene locus_tag LOCUS_00920 gene zwf 102767 104320 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_00920 104321 105076 gene locus_tag LOCUS_00930 gene pgl 104321 105076 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_00930 105078 105953 gene locus_tag LOCUS_00940 105078 105953 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404256.1 protein_id gnl|my_center|LOCUS_00940 105959 107149 gene locus_tag LOCUS_00950 105959 107149 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_00950 108219 107221 gene locus_tag LOCUS_00960 108219 107221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 111919 108221 gene locus_tag LOCUS_00970 111919 108221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 115365 111916 gene locus_tag LOCUS_00980 115365 111916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 117206 115398 gene locus_tag LOCUS_00990 117206 115398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 119668 117239 gene locus_tag LOCUS_01000 119668 117239 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141612405.1 protein_id gnl|my_center|LOCUS_01000 <121495 119679 gene locus_tag LOCUS_01010 <121495 119679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257223.1:DUF2298 domain-containing protein note possible pseudo, frameshifted >Feature sequence002 <1 641 gene locus_tag LOCUS_01020 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257009.1:MBL fold metallo-hydrolase 1406 774 gene locus_tag LOCUS_01030 1406 774 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082103.1 protein_id gnl|my_center|LOCUS_01030 1913 1437 gene locus_tag LOCUS_01040 1913 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 4222 2384 gene locus_tag LOCUS_01050 4222 2384 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256397.1 protein_id gnl|my_center|LOCUS_01050 5112 4222 gene locus_tag LOCUS_01060 gene malD 5112 4222 CDS product maltosaccharide ABC transporter permease MalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022608.1 protein_id gnl|my_center|LOCUS_01060 6682 5105 gene locus_tag LOCUS_01070 gene malF 6682 5105 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583081.1 protein_id gnl|my_center|LOCUS_01070 7980 6682 gene locus_tag LOCUS_01080 gene malE 7980 6682 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080109.1 protein_id gnl|my_center|LOCUS_01080 8330 8947 gene locus_tag LOCUS_01090 8330 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 9933 8956 gene locus_tag LOCUS_01100 gene galE 9933 8956 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_01100 11339 10107 gene locus_tag LOCUS_01110 11339 10107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_01110 12448 11681 gene locus_tag LOCUS_01120 12448 11681 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_01120 13741 12566 gene locus_tag LOCUS_01130 13741 12566 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_01130 14166 14909 gene locus_tag LOCUS_01140 14166 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 15516 14917 gene locus_tag LOCUS_01150 15516 14917 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_01150 15750 17981 gene locus_tag LOCUS_01160 15750 17981 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928938.1 protein_id gnl|my_center|LOCUS_01160 18059 19219 gene locus_tag LOCUS_01170 gene mnmA 18059 19219 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_01170 19216 19554 gene locus_tag LOCUS_01180 19216 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 19863 21095 gene locus_tag LOCUS_01190 19863 21095 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257464.1 protein_id gnl|my_center|LOCUS_01190 21095 21730 gene locus_tag LOCUS_01200 21095 21730 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_01200 21727 23301 gene locus_tag LOCUS_01210 21727 23301 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 protein_id gnl|my_center|LOCUS_01210 24186 23311 gene locus_tag LOCUS_01220 24186 23311 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869093.1 protein_id gnl|my_center|LOCUS_01220 24516 25610 gene locus_tag LOCUS_01230 24516 25610 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_01230 27429 25690 gene locus_tag LOCUS_01240 27429 25690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944620.1 protein_id gnl|my_center|LOCUS_01240 27675 33797 gene locus_tag LOCUS_01250 27675 33797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 33870 35201 gene locus_tag LOCUS_01260 33870 35201 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_01260 36478 35273 gene locus_tag LOCUS_01270 36478 35273 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258379.1 protein_id gnl|my_center|LOCUS_01270 37397 36516 gene locus_tag LOCUS_01280 37397 36516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 38742 37465 gene locus_tag LOCUS_01290 38742 37465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 39264 38764 gene locus_tag LOCUS_01300 gene ruvX 39264 38764 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719835.1 protein_id gnl|my_center|LOCUS_01300 40828 39254 gene locus_tag LOCUS_01310 40828 39254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 43548 40825 gene locus_tag LOCUS_01320 gene alaS 43548 40825 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259677.1 protein_id gnl|my_center|LOCUS_01320 45102 43720 gene locus_tag LOCUS_01330 45102 43720 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_01330 46280 45108 gene locus_tag LOCUS_01340 46280 45108 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339538.1 protein_id gnl|my_center|LOCUS_01340 47300 46293 gene locus_tag LOCUS_01350 47300 46293 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809738.1 protein_id gnl|my_center|LOCUS_01350 48508 47297 gene locus_tag LOCUS_01360 48508 47297 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 protein_id gnl|my_center|LOCUS_01360 49577 48513 gene locus_tag LOCUS_01370 49577 48513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 50032 49574 gene locus_tag LOCUS_01380 50032 49574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 50907 50059 gene locus_tag LOCUS_01390 50907 50059 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258591.1 protein_id gnl|my_center|LOCUS_01390 51784 50912 gene locus_tag LOCUS_01400 51784 50912 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080391.1 protein_id gnl|my_center|LOCUS_01400 52654 51800 gene locus_tag LOCUS_01410 52654 51800 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927126.1 protein_id gnl|my_center|LOCUS_01410 53687 52680 gene locus_tag LOCUS_01420 53687 52680 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817430.1 protein_id gnl|my_center|LOCUS_01420 54351 53695 gene locus_tag LOCUS_01430 54351 53695 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225250.1 protein_id gnl|my_center|LOCUS_01430 54830 56401 gene locus_tag LOCUS_01440 54830 56401 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339154.1 protein_id gnl|my_center|LOCUS_01440 56566 57507 gene locus_tag LOCUS_01450 56566 57507 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769341.1 protein_id gnl|my_center|LOCUS_01450 57500 58372 gene locus_tag LOCUS_01460 57500 58372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339156.1 protein_id gnl|my_center|LOCUS_01460 58376 59365 gene locus_tag LOCUS_01470 58376 59365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_01470 59362 60399 gene locus_tag LOCUS_01480 59362 60399 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_01480 60477 61157 gene locus_tag LOCUS_01490 60477 61157 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333956.1 protein_id gnl|my_center|LOCUS_01490 61283 62488 gene locus_tag LOCUS_01500 61283 62488 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_01500 62511 63881 gene locus_tag LOCUS_01510 62511 63881 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_01510 63881 65029 gene locus_tag LOCUS_01520 63881 65029 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272567.1 protein_id gnl|my_center|LOCUS_01520 65076 66488 gene locus_tag LOCUS_01530 65076 66488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 66491 67441 gene locus_tag LOCUS_01540 66491 67441 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203830.1 protein_id gnl|my_center|LOCUS_01540 67461 68699 gene locus_tag LOCUS_01550 67461 68699 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_01550 68696 69865 gene locus_tag LOCUS_01560 68696 69865 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_01560 69954 71003 gene locus_tag LOCUS_01570 69954 71003 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061829.1 protein_id gnl|my_center|LOCUS_01570 71000 72001 gene locus_tag LOCUS_01580 71000 72001 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086118.1 protein_id gnl|my_center|LOCUS_01580 72262 73161 gene locus_tag LOCUS_01590 72262 73161 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_01590 73388 74308 gene locus_tag LOCUS_01600 73388 74308 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_01600 74319 74942 gene locus_tag LOCUS_01610 74319 74942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 75004 75798 gene locus_tag LOCUS_01620 75004 75798 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_01620 77235 75868 gene locus_tag LOCUS_01630 77235 75868 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_01630 78641 77232 gene locus_tag LOCUS_01640 78641 77232 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_01640 79830 78658 gene locus_tag LOCUS_01650 79830 78658 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384268.1 protein_id gnl|my_center|LOCUS_01650 81590 79827 gene locus_tag LOCUS_01660 81590 79827 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_01660 81800 83419 gene locus_tag LOCUS_01670 81800 83419 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385396.1 protein_id gnl|my_center|LOCUS_01670 83534 84511 gene locus_tag LOCUS_01680 83534 84511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_01680 84514 85455 gene locus_tag LOCUS_01690 84514 85455 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731601.1 protein_id gnl|my_center|LOCUS_01690 85528 86616 gene locus_tag LOCUS_01700 85528 86616 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013798.1 protein_id gnl|my_center|LOCUS_01700 86713 89091 gene locus_tag LOCUS_01710 86713 89091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 89177 90178 gene locus_tag LOCUS_01720 89177 90178 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_01720 90189 92789 gene locus_tag LOCUS_01730 gene mutS 90189 92789 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_01730 93857 92937 gene locus_tag LOCUS_01740 93857 92937 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529067.1 protein_id gnl|my_center|LOCUS_01740 94066 95466 gene locus_tag LOCUS_01750 94066 95466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 95646 95954 gene locus_tag LOCUS_01760 95646 95954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 97034 96084 gene locus_tag LOCUS_01770 97034 96084 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_01770 97668 97075 gene locus_tag LOCUS_01780 97668 97075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 98020 97655 gene locus_tag LOCUS_01790 98020 97655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 99468 98683 gene locus_tag LOCUS_01800 99468 98683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 100412 100549 gene locus_tag LOCUS_01810 100412 100549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 100705 101847 gene locus_tag LOCUS_01820 100705 101847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 101943 102101 gene locus_tag LOCUS_01830 101943 102101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 102112 103626 gene locus_tag LOCUS_01840 102112 103626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 <104594 103900 gene locus_tag LOCUS_01850 <104594 103900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202675.1:DEAD/DEAH box helicase family protein >Feature sequence003 <1 2997 gene locus_tag LOCUS_01860 <1 2997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975932.1:aminotransferase class III-fold pyridoxal phosphate-dependent enzyme 3090 3803 gene locus_tag LOCUS_01870 3090 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 5567 4026 gene locus_tag LOCUS_01880 5567 4026 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925697.1 protein_id gnl|my_center|LOCUS_01880 7030 5564 gene locus_tag LOCUS_01890 7030 5564 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974081.1 protein_id gnl|my_center|LOCUS_01890 8163 7051 gene locus_tag LOCUS_01900 8163 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 10364 8283 gene locus_tag LOCUS_01910 10364 8283 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_01910 11179 10361 gene locus_tag LOCUS_01920 11179 10361 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272652.1 protein_id gnl|my_center|LOCUS_01920 12207 11290 gene locus_tag LOCUS_01930 12207 11290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385397.1 protein_id gnl|my_center|LOCUS_01930 13904 12285 gene locus_tag LOCUS_01940 13904 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 15049 13937 gene locus_tag LOCUS_01950 15049 13937 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704492.1 protein_id gnl|my_center|LOCUS_01950 15933 15046 gene locus_tag LOCUS_01960 15933 15046 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_01960 17555 15930 gene locus_tag LOCUS_01970 17555 15930 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086403.1 protein_id gnl|my_center|LOCUS_01970 19713 17569 gene locus_tag LOCUS_01980 19713 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01980 22057 19898 gene locus_tag LOCUS_01990 22057 19898 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_01990 22388 23476 gene locus_tag LOCUS_02000 22388 23476 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704465.1 protein_id gnl|my_center|LOCUS_02000 23572 25203 gene locus_tag LOCUS_02010 23572 25203 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086403.1 protein_id gnl|my_center|LOCUS_02010 25190 26899 gene locus_tag LOCUS_02020 25190 26899 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376432.1 protein_id gnl|my_center|LOCUS_02020 26896 28062 gene locus_tag LOCUS_02030 26896 28062 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042889.1 protein_id gnl|my_center|LOCUS_02030 29057 28176 gene locus_tag LOCUS_02040 29057 28176 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_02040 29956 29066 gene locus_tag LOCUS_02050 29956 29066 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_02050 31670 30009 gene locus_tag LOCUS_02060 31670 30009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 31952 33145 gene locus_tag LOCUS_02070 gene lhgO 31952 33145 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_02070 35471 33162 gene locus_tag LOCUS_02080 gene glgB 35471 33162 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141306.1 protein_id gnl|my_center|LOCUS_02080 37030 35570 gene locus_tag LOCUS_02090 gene guaB 37030 35570 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_02090 39086 36996 gene locus_tag LOCUS_02100 39086 36996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 39443 41230 gene locus_tag LOCUS_02110 39443 41230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 41270 42721 gene locus_tag LOCUS_02120 41270 42721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 43805 42756 gene locus_tag LOCUS_02130 43805 42756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 45155 43935 gene locus_tag LOCUS_02140 45155 43935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 46247 45249 gene locus_tag LOCUS_02150 46247 45249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258150.1 protein_id gnl|my_center|LOCUS_02150 47298 46237 gene locus_tag LOCUS_02160 47298 46237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258151.1 protein_id gnl|my_center|LOCUS_02160 48830 47295 gene locus_tag LOCUS_02170 48830 47295 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258152.1 protein_id gnl|my_center|LOCUS_02170 50074 48830 gene locus_tag LOCUS_02180 gene rhaI 50074 48830 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_02180 50370 51128 gene locus_tag LOCUS_02190 50370 51128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 51761 51153 gene locus_tag LOCUS_02200 51761 51153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 52762 51758 gene locus_tag LOCUS_02210 gene cofD 52762 51758 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_02210 53423 52767 gene locus_tag LOCUS_02220 53423 52767 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259451.1 protein_id gnl|my_center|LOCUS_02220 53623 54633 gene locus_tag LOCUS_02230 gene mer 53623 54633 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_02230 55878 54673 gene locus_tag LOCUS_02240 gene dgoD 55878 54673 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731095.1 protein_id gnl|my_center|LOCUS_02240 56783 55875 gene locus_tag LOCUS_02250 gene dapA 56783 55875 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172098.1 protein_id gnl|my_center|LOCUS_02250 57781 56780 gene locus_tag LOCUS_02260 57781 56780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 58524 57778 gene locus_tag LOCUS_02270 58524 57778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 59697 58534 gene locus_tag LOCUS_02280 59697 58534 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_02280 60736 59684 gene locus_tag LOCUS_02290 60736 59684 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_02290 61704 60733 gene locus_tag LOCUS_02300 61704 60733 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888206.1 protein_id gnl|my_center|LOCUS_02300 62675 61701 gene locus_tag LOCUS_02310 62675 61701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_02310 63515 62685 gene locus_tag LOCUS_02320 63515 62685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_02320 64468 63524 gene locus_tag LOCUS_02330 64468 63524 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095722.1 protein_id gnl|my_center|LOCUS_02330 66253 64619 gene locus_tag LOCUS_02340 66253 64619 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065721.1 protein_id gnl|my_center|LOCUS_02340 67209 66379 gene locus_tag LOCUS_02350 67209 66379 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039135.1 protein_id gnl|my_center|LOCUS_02350 68130 67222 gene locus_tag LOCUS_02360 68130 67222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 69427 68174 gene locus_tag LOCUS_02370 69427 68174 CDS product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051352.1 protein_id gnl|my_center|LOCUS_02370 70409 69723 gene locus_tag LOCUS_02380 70409 69723 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_02380 72980 70458 gene locus_tag LOCUS_02390 72980 70458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943051.1 protein_id gnl|my_center|LOCUS_02390 73745 73020 gene locus_tag LOCUS_02400 73745 73020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943050.1 protein_id gnl|my_center|LOCUS_02400 75068 73806 gene locus_tag LOCUS_02410 75068 73806 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_02410 75135 75920 gene locus_tag LOCUS_02420 75135 75920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 75954 76424 gene locus_tag LOCUS_02430 75954 76424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 76433 77785 gene locus_tag LOCUS_02440 gene asnS 76433 77785 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257312.1 protein_id gnl|my_center|LOCUS_02440 77815 78909 gene locus_tag LOCUS_02450 77815 78909 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257404.1 protein_id gnl|my_center|LOCUS_02450 78910 80907 gene locus_tag LOCUS_02460 78910 80907 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_02460 83649 80914 gene locus_tag LOCUS_02470 83649 80914 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141077.1 protein_id gnl|my_center|LOCUS_02470 85071 83707 gene locus_tag LOCUS_02480 85071 83707 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_02480 85950 85168 gene locus_tag LOCUS_02490 85950 85168 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119176.1 protein_id gnl|my_center|LOCUS_02490 87181 85964 gene locus_tag LOCUS_02500 87181 85964 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_02500 87423 88445 gene locus_tag LOCUS_02510 87423 88445 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 protein_id gnl|my_center|LOCUS_02510 88450 89433 gene locus_tag LOCUS_02520 88450 89433 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_02520 89442 90872 gene locus_tag LOCUS_02530 89442 90872 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257562.1 protein_id gnl|my_center|LOCUS_02530 91958 90936 gene locus_tag LOCUS_02540 91958 90936 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134732678.1 protein_id gnl|my_center|LOCUS_02540 92995 91955 gene locus_tag LOCUS_02550 gene fni 92995 91955 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_02550 93326 94924 gene locus_tag LOCUS_02560 93326 94924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 96113 95076 gene locus_tag LOCUS_02570 96113 95076 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928654.1 protein_id gnl|my_center|LOCUS_02570 97028 96369 gene locus_tag LOCUS_02580 97028 96369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_02580 97890 97126 gene locus_tag LOCUS_02590 97890 97126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_02590 100261 97883 gene locus_tag LOCUS_02600 100261 97883 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_02600 101298 100258 gene locus_tag LOCUS_02610 101298 100258 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_02610 102345 101314 gene locus_tag LOCUS_02620 102345 101314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 102724 103857 gene locus_tag LOCUS_02630 102724 103857 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence004 1678 398 gene locus_tag LOCUS_02640 1678 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2665 1682 gene locus_tag LOCUS_02650 2665 1682 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 protein_id gnl|my_center|LOCUS_02650 5008 2738 gene locus_tag LOCUS_02660 5008 2738 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_02660 5375 5019 gene locus_tag LOCUS_02670 gene hinT 5375 5019 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461572.1 protein_id gnl|my_center|LOCUS_02670 6553 5522 gene locus_tag LOCUS_02680 6553 5522 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480366.1 protein_id gnl|my_center|LOCUS_02680 7436 6822 gene locus_tag LOCUS_02690 7436 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 7836 9539 gene locus_tag LOCUS_02700 7836 9539 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_02700 10428 9574 gene locus_tag LOCUS_02710 10428 9574 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 protein_id gnl|my_center|LOCUS_02710 11501 10425 gene locus_tag LOCUS_02720 11501 10425 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532944.1 protein_id gnl|my_center|LOCUS_02720 12480 11674 gene locus_tag LOCUS_02730 12480 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 13488 12592 gene locus_tag LOCUS_02740 13488 12592 CDS product CRISPR-associated ring nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258133.1 protein_id gnl|my_center|LOCUS_02740 17287 13571 gene locus_tag LOCUS_02750 17287 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 17757 18908 gene locus_tag LOCUS_02760 17757 18908 CDS product CRISPR-associated protein Csx3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258132.1 protein_id gnl|my_center|LOCUS_02760 20085 18895 gene locus_tag LOCUS_02770 20085 18895 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836207.1 protein_id gnl|my_center|LOCUS_02770 20364 21236 gene locus_tag LOCUS_02780 20364 21236 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_02780 21809 21294 gene locus_tag LOCUS_02790 21809 21294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 22387 22019 gene locus_tag LOCUS_02800 22387 22019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 22446 22517 gene locus_tag LOCUS_t00030 22446 22517 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22693 23472 gene locus_tag LOCUS_02810 22693 23472 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 protein_id gnl|my_center|LOCUS_02810 24462 23497 gene locus_tag LOCUS_02820 24462 23497 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175128.1 protein_id gnl|my_center|LOCUS_02820 25201 24470 gene locus_tag LOCUS_02830 25201 24470 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530726.1 protein_id gnl|my_center|LOCUS_02830 26599 25289 gene locus_tag LOCUS_02840 26599 25289 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_02840 26809 27213 gene locus_tag LOCUS_02850 26809 27213 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_02850 27214 28242 gene locus_tag LOCUS_02860 gene meaB 27214 28242 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_02860 30140 28206 gene locus_tag LOCUS_02870 30140 28206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 30407 30153 gene locus_tag LOCUS_02880 30407 30153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 31180 30416 gene locus_tag LOCUS_02890 31180 30416 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_02890 34806 31150 gene locus_tag LOCUS_02900 34806 31150 CDS product ribonucleotide reductase N-terminal alpha domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459011.1 protein_id gnl|my_center|LOCUS_02900 35370 34909 gene locus_tag LOCUS_02910 gene nrdR 35370 34909 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640274.1 protein_id gnl|my_center|LOCUS_02910 36825 35620 gene locus_tag LOCUS_02920 gene ftsZ 36825 35620 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_02920 38225 36957 gene locus_tag LOCUS_02930 gene ftsA 38225 36957 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_02930 39087 38305 gene locus_tag LOCUS_02940 39087 38305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 40324 39248 gene locus_tag LOCUS_02950 40324 39248 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_02950 41316 40321 gene locus_tag LOCUS_02960 gene murB 41316 40321 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256646.1 protein_id gnl|my_center|LOCUS_02960 42760 41297 gene locus_tag LOCUS_02970 gene murC 42760 41297 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256647.1 protein_id gnl|my_center|LOCUS_02970 43304 42771 gene locus_tag LOCUS_02980 43304 42771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 43968 43309 gene locus_tag LOCUS_02990 43968 43309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 45115 43958 gene locus_tag LOCUS_03000 45115 43958 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_03000 46412 45081 gene locus_tag LOCUS_03010 gene ftsW 46412 45081 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_03010 47920 46403 gene locus_tag LOCUS_03020 gene murD 47920 46403 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_03020 48983 47955 gene locus_tag LOCUS_03030 gene mraY 48983 47955 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_03030 50532 48976 gene locus_tag LOCUS_03040 50532 48976 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_03040 52389 50542 gene locus_tag LOCUS_03050 52389 50542 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256655.1 protein_id gnl|my_center|LOCUS_03050 53084 52386 gene locus_tag LOCUS_03060 53084 52386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 54166 53189 gene locus_tag LOCUS_03070 gene rsmH 54166 53189 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_03070 54645 54172 gene locus_tag LOCUS_03080 gene mraZ 54645 54172 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_03080 55135 55506 gene locus_tag LOCUS_03090 55135 55506 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 protein_id gnl|my_center|LOCUS_03090 55513 56070 gene locus_tag LOCUS_03100 55513 56070 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_03100 56087 57916 gene locus_tag LOCUS_03110 56087 57916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 57992 59929 gene locus_tag LOCUS_03120 57992 59929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 59995 62526 gene locus_tag LOCUS_03130 gene nuoG 59995 62526 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 protein_id gnl|my_center|LOCUS_03130 62587 63579 gene locus_tag LOCUS_03140 gene nuoH 62587 63579 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258755.1 protein_id gnl|my_center|LOCUS_03140 63639 64109 gene locus_tag LOCUS_03150 gene nuoI 63639 64109 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888136.1 protein_id gnl|my_center|LOCUS_03150 64156 64668 gene locus_tag LOCUS_03160 64156 64668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 64739 65041 gene locus_tag LOCUS_03170 gene nuoK 64739 65041 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_03170 65050 66939 gene locus_tag LOCUS_03180 gene nuoL 65050 66939 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258759.1 protein_id gnl|my_center|LOCUS_03180 67023 68555 gene locus_tag LOCUS_03190 67023 68555 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_03190 68552 70039 gene locus_tag LOCUS_03200 68552 70039 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_03200 71383 70055 gene locus_tag LOCUS_03210 71383 70055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 72187 71417 gene locus_tag LOCUS_03220 72187 71417 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 protein_id gnl|my_center|LOCUS_03220 72332 74323 gene locus_tag LOCUS_03230 72332 74323 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973626.1 protein_id gnl|my_center|LOCUS_03230 74397 75383 gene locus_tag LOCUS_03240 74397 75383 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970413.1 protein_id gnl|my_center|LOCUS_03240 75431 76567 gene locus_tag LOCUS_03250 75431 76567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970414.1 protein_id gnl|my_center|LOCUS_03250 76594 78729 gene locus_tag LOCUS_03260 76594 78729 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_03260 78729 80096 gene locus_tag LOCUS_03270 78729 80096 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_03270 80966 80142 gene locus_tag LOCUS_03280 80966 80142 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687382.1 protein_id gnl|my_center|LOCUS_03280 82108 80966 gene locus_tag LOCUS_03290 gene phnW 82108 80966 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004774.1 protein_id gnl|my_center|LOCUS_03290 83951 82176 gene locus_tag LOCUS_03300 83951 82176 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425530.1 protein_id gnl|my_center|LOCUS_03300 85063 83948 gene locus_tag LOCUS_03310 85063 83948 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705805.1 protein_id gnl|my_center|LOCUS_03310 86194 85151 gene locus_tag LOCUS_03320 86194 85151 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892094.1 protein_id gnl|my_center|LOCUS_03320 86429 87199 gene locus_tag LOCUS_03330 86429 87199 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_03330 87998 87204 gene locus_tag LOCUS_03340 gene eutC 87998 87204 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732749.1 protein_id gnl|my_center|LOCUS_03340 89398 88031 gene locus_tag LOCUS_03350 89398 88031 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868826.1 protein_id gnl|my_center|LOCUS_03350 90842 89412 gene locus_tag LOCUS_03360 gene eutA 90842 89412 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097478.1 protein_id gnl|my_center|LOCUS_03360 91504 90986 gene locus_tag LOCUS_03370 91504 90986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 92368 91712 gene locus_tag LOCUS_03380 92368 91712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_03380 <96506 92569 gene locus_tag LOCUS_03390 <96506 92569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258209.1:lamin tail domain-containing protein 94162 94238 gene locus_tag LOCUS_t00040 94162 94238 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence005 3 659 gene locus_tag LOCUS_03400 3 659 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728936.1 protein_id gnl|my_center|LOCUS_03400 833 2365 gene locus_tag LOCUS_03410 833 2365 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_03410 2484 3401 gene locus_tag LOCUS_03420 2484 3401 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243183.1 protein_id gnl|my_center|LOCUS_03420 3403 4236 gene locus_tag LOCUS_03430 3403 4236 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_03430 4238 4525 gene locus_tag LOCUS_03440 4238 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 4552 5649 gene locus_tag LOCUS_03450 4552 5649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979120.1 protein_id gnl|my_center|LOCUS_03450 5653 6744 gene locus_tag LOCUS_03460 5653 6744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528081.1 protein_id gnl|my_center|LOCUS_03460 6818 7891 gene locus_tag LOCUS_03470 gene dhaK 6818 7891 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938278.1 protein_id gnl|my_center|LOCUS_03470 7908 8567 gene locus_tag LOCUS_03480 gene dhaL 7908 8567 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938279.1 protein_id gnl|my_center|LOCUS_03480 8564 11089 gene locus_tag LOCUS_03490 gene ptsP 8564 11089 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938280.1 protein_id gnl|my_center|LOCUS_03490 11193 12308 gene locus_tag LOCUS_03500 11193 12308 CDS product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_03500 12305 12742 gene locus_tag LOCUS_03510 12305 12742 CDS product 1-methylthio-xylulose 5-phosphate sulfo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389753.1 protein_id gnl|my_center|LOCUS_03510 12752 13750 gene locus_tag LOCUS_03520 12752 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 13762 14382 gene locus_tag LOCUS_03530 gene dhaL 13762 14382 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 protein_id gnl|my_center|LOCUS_03530 14535 14822 gene locus_tag LOCUS_03540 14535 14822 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066790080.1 protein_id gnl|my_center|LOCUS_03540 15063 16010 gene locus_tag LOCUS_03550 15063 16010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 18064 15980 gene locus_tag LOCUS_03560 18064 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 19511 18108 gene locus_tag LOCUS_03570 19511 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 20821 19523 gene locus_tag LOCUS_03580 20821 19523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 21855 20827 gene locus_tag LOCUS_03590 21855 20827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 24332 22083 gene locus_tag LOCUS_03600 24332 22083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 25723 24410 gene locus_tag LOCUS_03610 25723 24410 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257217.1 protein_id gnl|my_center|LOCUS_03610 26727 25738 gene locus_tag LOCUS_03620 26727 25738 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_03620 27698 26724 gene locus_tag LOCUS_03630 27698 26724 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257219.1 protein_id gnl|my_center|LOCUS_03630 28151 29236 gene locus_tag LOCUS_03640 28151 29236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 30334 29237 gene locus_tag LOCUS_03650 gene rho 30334 29237 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880530.1 protein_id gnl|my_center|LOCUS_03650 30619 31479 gene locus_tag LOCUS_03660 30619 31479 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967715.1 protein_id gnl|my_center|LOCUS_03660 31480 32646 gene locus_tag LOCUS_03670 31480 32646 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_03670 32755 35268 gene locus_tag LOCUS_03680 32755 35268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 35453 36535 gene locus_tag LOCUS_03690 gene leuB 35453 36535 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_03690 36532 39288 gene locus_tag LOCUS_03700 gene ppc 36532 39288 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_03700 39306 40061 gene locus_tag LOCUS_03710 39306 40061 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_03710 40121 41785 gene locus_tag LOCUS_03720 gene cimA 40121 41785 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_03720 43284 41794 gene locus_tag LOCUS_03730 43284 41794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 44017 43316 gene locus_tag LOCUS_03740 44017 43316 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_03740 44293 45990 gene locus_tag LOCUS_03750 44293 45990 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_03750 46004 46759 gene locus_tag LOCUS_03760 46004 46759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 46802 47800 gene locus_tag LOCUS_03770 46802 47800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 47835 50696 gene locus_tag LOCUS_03780 47835 50696 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 protein_id gnl|my_center|LOCUS_03780 51885 50791 gene locus_tag LOCUS_03790 51885 50791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 52173 53564 gene locus_tag LOCUS_03800 52173 53564 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_03800 53599 54276 gene locus_tag LOCUS_03810 53599 54276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_03810 54354 55418 gene locus_tag LOCUS_03820 54354 55418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 55452 57827 gene locus_tag LOCUS_03830 55452 57827 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_03830 57892 58683 gene locus_tag LOCUS_03840 57892 58683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 58667 58939 gene locus_tag LOCUS_03850 58667 58939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 58933 59682 gene locus_tag LOCUS_03860 58933 59682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 60413 59772 gene locus_tag LOCUS_03870 60413 59772 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893113.1 protein_id gnl|my_center|LOCUS_03870 62108 60429 gene locus_tag LOCUS_03880 gene araB 62108 60429 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_03880 63212 62124 gene locus_tag LOCUS_03890 63212 62124 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816110.1 protein_id gnl|my_center|LOCUS_03890 64701 63232 gene locus_tag LOCUS_03900 64701 63232 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_03900 64907 64997 gene locus_tag LOCUS_t00050 64907 64997 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 65016 66485 gene locus_tag LOCUS_03910 65016 66485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 66482 66955 gene locus_tag LOCUS_03920 66482 66955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 66965 68104 gene locus_tag LOCUS_03930 66965 68104 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_03930 68135 68635 gene locus_tag LOCUS_03940 68135 68635 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_03940 68632 69261 gene locus_tag LOCUS_03950 68632 69261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 69258 70040 gene locus_tag LOCUS_03960 69258 70040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 71435 70077 gene locus_tag LOCUS_03970 71435 70077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 72586 71513 gene locus_tag LOCUS_03980 72586 71513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 73234 72647 gene locus_tag LOCUS_03990 73234 72647 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909135.1 protein_id gnl|my_center|LOCUS_03990 74481 73231 gene locus_tag LOCUS_04000 74481 73231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 76078 74522 gene locus_tag LOCUS_04010 76078 74522 CDS product CpXC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257830.1 protein_id gnl|my_center|LOCUS_04010 76227 76619 gene locus_tag LOCUS_04020 gene hypA 76227 76619 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_04020 76600 77280 gene locus_tag LOCUS_04030 gene hypB 76600 77280 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258628.1 protein_id gnl|my_center|LOCUS_04030 77354 77611 gene locus_tag LOCUS_04040 77354 77611 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_04040 77642 78760 gene locus_tag LOCUS_04050 gene hypD 77642 78760 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_04050 78828 79886 gene locus_tag LOCUS_04060 gene hypE 78828 79886 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_04060 79927 81315 gene locus_tag LOCUS_04070 79927 81315 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_04070 82225 81359 gene locus_tag LOCUS_04080 82225 81359 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259049.1 protein_id gnl|my_center|LOCUS_04080 85041 82393 gene locus_tag LOCUS_04090 85041 82393 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223224.1 protein_id gnl|my_center|LOCUS_04090 85237 86898 gene locus_tag LOCUS_04100 gene betA 85237 86898 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_04100 88180 86933 gene locus_tag LOCUS_04110 gene icd 88180 86933 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_04110 88479 88703 gene locus_tag LOCUS_04120 88479 88703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence006 307 2118 gene locus_tag LOCUS_04130 307 2118 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398544.1 protein_id gnl|my_center|LOCUS_04130 2128 3939 gene locus_tag LOCUS_04140 2128 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 4713 3970 gene locus_tag LOCUS_04150 4713 3970 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_04150 4855 6564 gene locus_tag LOCUS_04160 4855 6564 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_04160 7075 6617 gene locus_tag LOCUS_04170 7075 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 7228 8184 gene locus_tag LOCUS_04180 gene fmt 7228 8184 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255944.1 protein_id gnl|my_center|LOCUS_04180 8760 11972 gene locus_tag LOCUS_04190 gene ileS 8760 11972 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258550.1 protein_id gnl|my_center|LOCUS_04190 11980 13359 gene locus_tag LOCUS_04200 11980 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 13499 14560 gene locus_tag LOCUS_04210 13499 14560 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705297.1 protein_id gnl|my_center|LOCUS_04210 14582 16576 gene locus_tag LOCUS_04220 14582 16576 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111257634.1 protein_id gnl|my_center|LOCUS_04220 16573 18723 gene locus_tag LOCUS_04230 16573 18723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 18752 19747 gene locus_tag LOCUS_04240 18752 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 19753 20514 gene locus_tag LOCUS_04250 19753 20514 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_04250 20635 21978 gene locus_tag LOCUS_04260 20635 21978 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 protein_id gnl|my_center|LOCUS_04260 22093 23124 gene locus_tag LOCUS_04270 22093 23124 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256958.1 protein_id gnl|my_center|LOCUS_04270 23255 24637 gene locus_tag LOCUS_04280 23255 24637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 27171 24766 gene locus_tag LOCUS_04290 27171 24766 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259434.1 protein_id gnl|my_center|LOCUS_04290 29120 27156 gene locus_tag LOCUS_04300 29120 27156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 29297 29599 gene locus_tag LOCUS_04310 29297 29599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 29756 30217 gene locus_tag LOCUS_04320 29756 30217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 31172 30327 gene locus_tag LOCUS_04330 31172 30327 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_04330 32155 31169 gene locus_tag LOCUS_04340 32155 31169 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_04340 33058 32168 gene locus_tag LOCUS_04350 33058 32168 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_04350 33994 33062 gene locus_tag LOCUS_04360 33994 33062 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 protein_id gnl|my_center|LOCUS_04360 35402 34062 gene locus_tag LOCUS_04370 35402 34062 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223059.1 protein_id gnl|my_center|LOCUS_04370 36429 35521 gene locus_tag LOCUS_04380 36429 35521 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_04380 37218 36496 gene locus_tag LOCUS_04390 37218 36496 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102227.1 protein_id gnl|my_center|LOCUS_04390 37982 37281 gene locus_tag LOCUS_04400 37982 37281 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_04400 38254 39528 gene locus_tag LOCUS_04410 38254 39528 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_04410 39540 40760 gene locus_tag LOCUS_04420 gene argJ 39540 40760 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259189.1 protein_id gnl|my_center|LOCUS_04420 40829 41401 gene locus_tag LOCUS_04430 40829 41401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 41391 41858 gene locus_tag LOCUS_04440 41391 41858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 41947 43419 gene locus_tag LOCUS_04450 41947 43419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 43409 45292 gene locus_tag LOCUS_04460 43409 45292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 45267 45968 gene locus_tag LOCUS_04470 gene can 45267 45968 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189176.1 protein_id gnl|my_center|LOCUS_04470 45987 46616 gene locus_tag LOCUS_04480 45987 46616 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258339.1 protein_id gnl|my_center|LOCUS_04480 46648 49212 gene locus_tag LOCUS_04490 gene pheT 46648 49212 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_04490 49237 49791 gene locus_tag LOCUS_04500 49237 49791 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389121.1 protein_id gnl|my_center|LOCUS_04500 50035 51414 gene locus_tag LOCUS_04510 50035 51414 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_04510 51496 52281 gene locus_tag LOCUS_04520 51496 52281 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_04520 53253 52342 gene locus_tag LOCUS_04530 53253 52342 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400349.1 protein_id gnl|my_center|LOCUS_04530 53370 54686 gene locus_tag LOCUS_04540 53370 54686 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_04540 54752 56101 gene locus_tag LOCUS_04550 54752 56101 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_04550 56236 56811 gene locus_tag LOCUS_04560 56236 56811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 56808 58094 gene locus_tag LOCUS_04570 56808 58094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 58100 59698 gene locus_tag LOCUS_04580 58100 59698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 59855 60502 gene locus_tag LOCUS_04590 gene sanA 59855 60502 CDS product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211966.1 protein_id gnl|my_center|LOCUS_04590 60879 60532 gene locus_tag LOCUS_04600 60879 60532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 61055 63139 gene locus_tag LOCUS_04610 61055 63139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 63136 63975 gene locus_tag LOCUS_04620 63136 63975 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061273.1 protein_id gnl|my_center|LOCUS_04620 65152 64016 gene locus_tag LOCUS_04630 gene carA 65152 64016 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_04630 65433 68393 gene locus_tag LOCUS_04640 gene secA 65433 68393 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256432.1 protein_id gnl|my_center|LOCUS_04640 68390 69244 gene locus_tag LOCUS_04650 68390 69244 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927833.1 protein_id gnl|my_center|LOCUS_04650 69724 71001 gene locus_tag LOCUS_04660 69724 71001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 72371 71052 gene locus_tag LOCUS_04670 72371 71052 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_04670 73070 72381 gene locus_tag LOCUS_04680 73070 72381 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_04680 74195 73086 gene locus_tag LOCUS_04690 74195 73086 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921854.1 protein_id gnl|my_center|LOCUS_04690 75088 74192 gene locus_tag LOCUS_04700 75088 74192 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_04700 75387 77174 gene locus_tag LOCUS_04710 75387 77174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 77226 78002 gene locus_tag LOCUS_04720 77226 78002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 79082 78030 gene locus_tag LOCUS_04730 79082 78030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 80209 79079 gene locus_tag LOCUS_04740 80209 79079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 80892 80227 gene locus_tag LOCUS_04750 80892 80227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 81404 81006 gene locus_tag LOCUS_04760 gene gcvH 81404 81006 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146698.1 protein_id gnl|my_center|LOCUS_04760 82568 81477 gene locus_tag LOCUS_04770 gene gcvT 82568 81477 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259334.1 protein_id gnl|my_center|LOCUS_04770 84355 82685 gene locus_tag LOCUS_04780 84355 82685 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_04780 84572 85648 gene locus_tag LOCUS_04790 84572 85648 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence007 2496 394 gene locus_tag LOCUS_04800 2496 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 3555 2686 gene locus_tag LOCUS_04810 3555 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 5185 3548 gene locus_tag LOCUS_04820 5185 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 6426 5182 gene locus_tag LOCUS_04830 6426 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 8394 6490 gene locus_tag LOCUS_04840 8394 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 8891 8391 gene locus_tag LOCUS_04850 8891 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 9190 9564 gene locus_tag LOCUS_04860 9190 9564 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_04860 9579 9767 gene locus_tag LOCUS_04870 9579 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 9745 9990 gene locus_tag LOCUS_04880 9745 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 9914 10648 gene locus_tag LOCUS_04890 9914 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 11715 10654 gene locus_tag LOCUS_04900 gene ruvB 11715 10654 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258937.1 protein_id gnl|my_center|LOCUS_04900 11945 14119 gene locus_tag LOCUS_04910 11945 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 14202 15395 gene locus_tag LOCUS_04920 gene solA 14202 15395 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705029.1 protein_id gnl|my_center|LOCUS_04920 15982 15371 gene locus_tag LOCUS_04930 15982 15371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 17268 15979 gene locus_tag LOCUS_04940 17268 15979 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_04940 18966 17323 gene locus_tag LOCUS_04950 gene pgm 18966 17323 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_04950 19879 19034 gene locus_tag LOCUS_04960 19879 19034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 21700 19910 gene locus_tag LOCUS_04970 gene recN 21700 19910 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_04970 21894 22721 gene locus_tag LOCUS_04980 21894 22721 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_04980 22738 23475 gene locus_tag LOCUS_04990 22738 23475 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_04990 26147 23766 gene locus_tag LOCUS_05000 26147 23766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 26402 28630 gene locus_tag LOCUS_05010 26402 28630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 28740 28913 gene locus_tag LOCUS_05020 28740 28913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 28840 32961 gene locus_tag LOCUS_05030 28840 32961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 33129 35312 gene locus_tag LOCUS_05040 33129 35312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 35406 36371 gene locus_tag LOCUS_05050 35406 36371 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969661.1 protein_id gnl|my_center|LOCUS_05050 36387 36902 gene locus_tag LOCUS_05060 36387 36902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 37016 37870 gene locus_tag LOCUS_05070 37016 37870 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339263.1 protein_id gnl|my_center|LOCUS_05070 38416 37922 gene locus_tag LOCUS_05080 38416 37922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 38552 39556 gene locus_tag LOCUS_05090 gene msrP 38552 39556 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257868.1 protein_id gnl|my_center|LOCUS_05090 39568 40248 gene locus_tag LOCUS_05100 39568 40248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 40351 42126 gene locus_tag LOCUS_05110 40351 42126 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_05110 42123 42830 gene locus_tag LOCUS_05120 42123 42830 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226418.1 protein_id gnl|my_center|LOCUS_05120 42827 43666 gene locus_tag LOCUS_05130 42827 43666 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172618.1 protein_id gnl|my_center|LOCUS_05130 43826 44500 gene locus_tag LOCUS_05140 43826 44500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 44596 47106 gene locus_tag LOCUS_05150 44596 47106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 48543 47134 gene locus_tag LOCUS_05160 48543 47134 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258451.1 protein_id gnl|my_center|LOCUS_05160 49301 48735 gene locus_tag LOCUS_05170 gene lepB 49301 48735 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870097.1 protein_id gnl|my_center|LOCUS_05170 49391 52618 gene locus_tag LOCUS_05180 49391 52618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 54027 52645 gene locus_tag LOCUS_05190 54027 52645 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259710.1 protein_id gnl|my_center|LOCUS_05190 55290 54064 gene locus_tag LOCUS_05200 55290 54064 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_05200 55526 56986 gene locus_tag LOCUS_05210 55526 56986 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_05210 56983 58332 gene locus_tag LOCUS_05220 56983 58332 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_05220 58329 58709 gene locus_tag LOCUS_05230 58329 58709 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680676.1 protein_id gnl|my_center|LOCUS_05230 59597 58746 gene locus_tag LOCUS_05240 59597 58746 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_05240 60524 59634 gene locus_tag LOCUS_05250 60524 59634 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_05250 61148 60591 gene locus_tag LOCUS_05260 gene cobU 61148 60591 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258421.1 protein_id gnl|my_center|LOCUS_05260 61975 61133 gene locus_tag LOCUS_05270 61975 61133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 64563 61975 gene locus_tag LOCUS_05280 64563 61975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 65234 64590 gene locus_tag LOCUS_05290 gene pdxH 65234 64590 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112518.1 protein_id gnl|my_center|LOCUS_05290 65402 65330 gene locus_tag LOCUS_t00060 65402 65330 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 65560 65489 gene locus_tag LOCUS_t00070 65560 65489 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 65639 65565 gene locus_tag LOCUS_t00080 65639 65565 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 65826 66485 gene locus_tag LOCUS_05300 65826 66485 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989894.1 protein_id gnl|my_center|LOCUS_05300 66482 67417 gene locus_tag LOCUS_05310 66482 67417 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967479.1 protein_id gnl|my_center|LOCUS_05310 67493 69169 gene locus_tag LOCUS_05320 67493 69169 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_05320 69189 69482 gene locus_tag LOCUS_05330 69189 69482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 69558 70715 gene locus_tag LOCUS_05340 69558 70715 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258702.1 protein_id gnl|my_center|LOCUS_05340 70867 71058 gene locus_tag LOCUS_05350 70867 71058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 71129 71347 gene locus_tag LOCUS_05360 gene infA 71129 71347 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937325.1 protein_id gnl|my_center|LOCUS_05360 71903 71436 gene locus_tag LOCUS_05370 71903 71436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 72630 71884 gene locus_tag LOCUS_05380 72630 71884 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_05380 72816 73508 gene locus_tag LOCUS_05390 gene rsmG 72816 73508 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_05390 74210 73560 gene locus_tag LOCUS_05400 74210 73560 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_05400 74332 75597 gene locus_tag LOCUS_05410 74332 75597 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257882.1 protein_id gnl|my_center|LOCUS_05410 76239 75613 gene locus_tag LOCUS_05420 gene nadD 76239 75613 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869642.1 protein_id gnl|my_center|LOCUS_05420 77510 76236 gene locus_tag LOCUS_05430 gene obgE 77510 76236 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257169.1 protein_id gnl|my_center|LOCUS_05430 77658 80129 gene locus_tag LOCUS_05440 77658 80129 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_05440 80559 82127 gene locus_tag LOCUS_05450 80559 82127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 84338 82176 gene locus_tag LOCUS_05460 84338 82176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 84649 84722 gene locus_tag LOCUS_t00090 84649 84722 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 84811 84894 gene locus_tag LOCUS_t00100 84811 84894 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 84901 84974 gene locus_tag LOCUS_t00110 84901 84974 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 232 1050 gene locus_tag LOCUS_05470 232 1050 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 protein_id gnl|my_center|LOCUS_05470 1244 2686 gene locus_tag LOCUS_05480 1244 2686 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536396.1 protein_id gnl|my_center|LOCUS_05480 2803 3735 gene locus_tag LOCUS_05490 2803 3735 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894671.1 protein_id gnl|my_center|LOCUS_05490 3754 4617 gene locus_tag LOCUS_05500 3754 4617 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894672.1 protein_id gnl|my_center|LOCUS_05500 4625 5740 gene locus_tag LOCUS_05510 gene ugpC 4625 5740 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583259.1 protein_id gnl|my_center|LOCUS_05510 5752 6852 gene locus_tag LOCUS_05520 5752 6852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250726.1 protein_id gnl|my_center|LOCUS_05520 6866 8398 gene locus_tag LOCUS_05530 6866 8398 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969793.1 protein_id gnl|my_center|LOCUS_05530 8407 9468 gene locus_tag LOCUS_05540 8407 9468 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 protein_id gnl|my_center|LOCUS_05540 9475 11004 gene locus_tag LOCUS_05550 gene xylB 9475 11004 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_05550 11001 11756 gene locus_tag LOCUS_05560 gene fabG 11001 11756 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_05560 11778 13334 gene locus_tag LOCUS_05570 11778 13334 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067242.1 protein_id gnl|my_center|LOCUS_05570 13345 14589 gene locus_tag LOCUS_05580 gene egsA 13345 14589 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 protein_id gnl|my_center|LOCUS_05580 14658 15125 gene locus_tag LOCUS_05590 14658 15125 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389113.1 protein_id gnl|my_center|LOCUS_05590 15902 15168 gene locus_tag LOCUS_05600 15902 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 17902 16052 gene locus_tag LOCUS_05610 17902 16052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_05610 19724 17895 gene locus_tag LOCUS_05620 19724 17895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_05620 21443 20136 gene locus_tag LOCUS_05630 21443 20136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 22473 21472 gene locus_tag LOCUS_05640 22473 21472 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057378.1 protein_id gnl|my_center|LOCUS_05640 23015 22479 gene locus_tag LOCUS_05650 gene lspA 23015 22479 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_05650 23312 24127 gene locus_tag LOCUS_05660 23312 24127 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868514.1 protein_id gnl|my_center|LOCUS_05660 24138 24707 gene locus_tag LOCUS_05670 24138 24707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 24704 25393 gene locus_tag LOCUS_05680 gene hisH 24704 25393 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_05680 25591 26730 gene locus_tag LOCUS_05690 25591 26730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 27759 26848 gene locus_tag LOCUS_05700 27759 26848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 28776 27967 gene locus_tag LOCUS_05710 28776 27967 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_05710 29215 28859 gene locus_tag LOCUS_05720 gene rplT 29215 28859 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_05720 29618 29412 gene locus_tag LOCUS_05730 29618 29412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 30280 29774 gene locus_tag LOCUS_05740 30280 29774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 32302 30473 gene locus_tag LOCUS_05750 gene thrS 32302 30473 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257081.1 protein_id gnl|my_center|LOCUS_05750 33489 32329 gene locus_tag LOCUS_05760 33489 32329 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_05760 33894 33818 gene locus_tag LOCUS_t00120 33894 33818 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 34644 33976 gene locus_tag LOCUS_05770 34644 33976 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257137.1 protein_id gnl|my_center|LOCUS_05770 35817 34720 gene locus_tag LOCUS_05780 35817 34720 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228739.1 protein_id gnl|my_center|LOCUS_05780 36544 35897 gene locus_tag LOCUS_05790 36544 35897 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990695.1 protein_id gnl|my_center|LOCUS_05790 37789 36569 gene locus_tag LOCUS_05800 37789 36569 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258790.1 protein_id gnl|my_center|LOCUS_05800 38501 37827 gene locus_tag LOCUS_05810 38501 37827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 39563 38571 gene locus_tag LOCUS_05820 39563 38571 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_05820 39774 42107 gene locus_tag LOCUS_05830 39774 42107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 42157 42945 gene locus_tag LOCUS_05840 42157 42945 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_05840 44206 43061 gene locus_tag LOCUS_05850 44206 43061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 47169 44203 gene locus_tag LOCUS_05860 gene uvrA 47169 44203 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_05860 47349 47840 gene locus_tag LOCUS_05870 47349 47840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 48952 47939 gene locus_tag LOCUS_05880 gene selD 48952 47939 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_05880 49325 49050 gene locus_tag LOCUS_05890 49325 49050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 49825 49391 gene locus_tag LOCUS_05900 49825 49391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 49952 49855 gene locus_tag LOCUS_t00130 49952 49855 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 50141 50806 gene locus_tag LOCUS_05910 50141 50806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 50833 52497 gene locus_tag LOCUS_05920 50833 52497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 52522 53124 gene locus_tag LOCUS_05930 52522 53124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 53239 54711 gene locus_tag LOCUS_05940 53239 54711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 54708 56138 gene locus_tag LOCUS_05950 54708 56138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 57325 56219 gene locus_tag LOCUS_05960 57325 56219 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_05960 58650 57493 gene locus_tag LOCUS_05970 58650 57493 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_05970 58941 61001 gene locus_tag LOCUS_05980 58941 61001 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_05980 61833 61285 gene locus_tag LOCUS_05990 61833 61285 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 protein_id gnl|my_center|LOCUS_05990 62900 61830 gene locus_tag LOCUS_06000 62900 61830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 63140 64126 gene locus_tag LOCUS_06010 63140 64126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 64130 64894 gene locus_tag LOCUS_06020 gene fabL 64130 64894 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_06020 64942 65220 gene locus_tag LOCUS_06030 64942 65220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 65251 66564 gene locus_tag LOCUS_06040 65251 66564 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724359.1 protein_id gnl|my_center|LOCUS_06040 66584 67402 gene locus_tag LOCUS_06050 66584 67402 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839268.1 protein_id gnl|my_center|LOCUS_06050 68229 67423 gene locus_tag LOCUS_06060 68229 67423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 68361 68612 gene locus_tag LOCUS_06070 gene xseB 68361 68612 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418105.1 protein_id gnl|my_center|LOCUS_06070 68613 69059 gene locus_tag LOCUS_06080 68613 69059 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_06080 69314 70654 gene locus_tag LOCUS_06090 69314 70654 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_06090 71926 70733 gene locus_tag LOCUS_06100 71926 70733 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_06100 72410 74059 gene locus_tag LOCUS_06110 72410 74059 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339159.1 protein_id gnl|my_center|LOCUS_06110 74063 74998 gene locus_tag LOCUS_06120 74063 74998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723883.1 protein_id gnl|my_center|LOCUS_06120 75004 75927 gene locus_tag LOCUS_06130 75004 75927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528534.1 protein_id gnl|my_center|LOCUS_06130 75944 76903 gene locus_tag LOCUS_06140 75944 76903 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256581.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence009 884 240 gene locus_tag LOCUS_06150 884 240 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_06150 2849 987 gene locus_tag LOCUS_06160 gene htpG 2849 987 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257066.1 protein_id gnl|my_center|LOCUS_06160 3476 2961 gene locus_tag LOCUS_06170 3476 2961 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_06170 3704 3785 gene locus_tag LOCUS_t00140 3704 3785 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6340 3860 gene locus_tag LOCUS_06180 6340 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 7070 7648 gene locus_tag LOCUS_06190 7070 7648 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_06190 7658 8989 gene locus_tag LOCUS_06200 7658 8989 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_06200 10166 9027 gene locus_tag LOCUS_06210 10166 9027 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258191.1 protein_id gnl|my_center|LOCUS_06210 11622 10330 gene locus_tag LOCUS_06220 gene pepT 11622 10330 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384562.1 protein_id gnl|my_center|LOCUS_06220 12113 11769 gene locus_tag LOCUS_06230 12113 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 12367 13425 gene locus_tag LOCUS_06240 12367 13425 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_06240 13784 13446 gene locus_tag LOCUS_06250 13784 13446 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058130.1 protein_id gnl|my_center|LOCUS_06250 14658 13771 gene locus_tag LOCUS_06260 14658 13771 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170938.1 protein_id gnl|my_center|LOCUS_06260 15312 14875 gene locus_tag LOCUS_06270 15312 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 15534 16877 gene locus_tag LOCUS_06280 15534 16877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 16933 17883 gene locus_tag LOCUS_06290 16933 17883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 20087 17895 gene locus_tag LOCUS_06300 20087 17895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 21042 20209 gene locus_tag LOCUS_06310 21042 20209 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223226.1 protein_id gnl|my_center|LOCUS_06310 21985 21062 gene locus_tag LOCUS_06320 gene mvk 21985 21062 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_06320 22719 21982 gene locus_tag LOCUS_06330 22719 21982 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868825.1 protein_id gnl|my_center|LOCUS_06330 23350 22748 gene locus_tag LOCUS_06340 23350 22748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 23774 23355 gene locus_tag LOCUS_06350 23774 23355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 24175 23771 gene locus_tag LOCUS_06360 gene mce 24175 23771 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879707.1 protein_id gnl|my_center|LOCUS_06360 24974 24258 gene locus_tag LOCUS_06370 gene rpiA 24974 24258 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259045.1 protein_id gnl|my_center|LOCUS_06370 25980 24988 gene locus_tag LOCUS_06380 gene glk 25980 24988 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259043.1 protein_id gnl|my_center|LOCUS_06380 26289 27206 gene locus_tag LOCUS_06390 26289 27206 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016248.1 protein_id gnl|my_center|LOCUS_06390 27407 28207 gene locus_tag LOCUS_06400 27407 28207 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_06400 28292 28957 gene locus_tag LOCUS_06410 28292 28957 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811721.1 protein_id gnl|my_center|LOCUS_06410 29009 29806 gene locus_tag LOCUS_06420 29009 29806 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731387.1 protein_id gnl|my_center|LOCUS_06420 29806 30513 gene locus_tag LOCUS_06430 29806 30513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 30538 31338 gene locus_tag LOCUS_06440 30538 31338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06440 31455 32129 gene locus_tag LOCUS_06450 31455 32129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 32152 33105 gene locus_tag LOCUS_06460 32152 33105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 33478 34320 gene locus_tag LOCUS_06470 gene rhdA 33478 34320 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_06470 34338 35594 gene locus_tag LOCUS_06480 34338 35594 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391987.1 protein_id gnl|my_center|LOCUS_06480 35656 35889 gene locus_tag LOCUS_06490 35656 35889 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080581.1 protein_id gnl|my_center|LOCUS_06490 35910 36842 gene locus_tag LOCUS_06500 35910 36842 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_06500 36848 37453 gene locus_tag LOCUS_06510 36848 37453 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015893.1 protein_id gnl|my_center|LOCUS_06510 38826 37531 gene locus_tag LOCUS_06520 gene eno 38826 37531 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_06520 40075 38903 gene locus_tag LOCUS_06530 40075 38903 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_06530 41566 40298 gene locus_tag LOCUS_06540 gene fabF 41566 40298 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_06540 43088 41703 gene locus_tag LOCUS_06550 gene radA 43088 41703 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_06550 43461 43258 gene locus_tag LOCUS_06560 43461 43258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 44294 43530 gene locus_tag LOCUS_06570 44294 43530 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 protein_id gnl|my_center|LOCUS_06570 45772 44345 gene locus_tag LOCUS_06580 45772 44345 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259726.1 protein_id gnl|my_center|LOCUS_06580 46174 45818 gene locus_tag LOCUS_06590 46174 45818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 46280 47203 gene locus_tag LOCUS_06600 46280 47203 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259727.1 protein_id gnl|my_center|LOCUS_06600 47850 47242 gene locus_tag LOCUS_06610 47850 47242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 49107 47863 gene locus_tag LOCUS_06620 49107 47863 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_06620 49883 49104 gene locus_tag LOCUS_06630 49883 49104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_06630 51427 49928 gene locus_tag LOCUS_06640 51427 49928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 52504 51611 gene locus_tag LOCUS_06650 52504 51611 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_06650 55114 52592 gene locus_tag LOCUS_06660 55114 52592 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_06660 56630 55413 gene locus_tag LOCUS_06670 gene rpsA 56630 55413 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_06670 57069 56668 gene locus_tag LOCUS_06680 57069 56668 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_06680 58312 57287 gene locus_tag LOCUS_06690 58312 57287 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_06690 59004 58564 gene locus_tag LOCUS_06700 59004 58564 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019771.1 protein_id gnl|my_center|LOCUS_06700 60416 59016 gene locus_tag LOCUS_06710 gene atpD 60416 59016 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_06710 61459 60512 gene locus_tag LOCUS_06720 61459 60512 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_06720 62992 61475 gene locus_tag LOCUS_06730 gene atpA 62992 61475 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_06730 63673 63143 gene locus_tag LOCUS_06740 63673 63143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 64170 63670 gene locus_tag LOCUS_06750 64170 63670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 64594 64367 gene locus_tag LOCUS_06760 64594 64367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 65656 64658 gene locus_tag LOCUS_06770 gene atpB 65656 64658 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_06770 66010 65711 gene locus_tag LOCUS_06780 66010 65711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 66308 68263 gene locus_tag LOCUS_06790 66308 68263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 68256 68996 gene locus_tag LOCUS_06800 68256 68996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 69029 69763 gene locus_tag LOCUS_06810 69029 69763 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 protein_id gnl|my_center|LOCUS_06810 69776 71011 gene locus_tag LOCUS_06820 69776 71011 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_06820 71650 71555 gene locus_tag LOCUS_t00150 71650 71555 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 72997 71801 gene locus_tag LOCUS_06830 72997 71801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 73784 73002 gene locus_tag LOCUS_06840 73784 73002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 74979 73774 gene locus_tag LOCUS_06850 74979 73774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 75629 74982 gene locus_tag LOCUS_06860 75629 74982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 76185 75649 gene locus_tag LOCUS_06870 76185 75649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 76466 76182 gene locus_tag LOCUS_06880 76466 76182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 <77257 76556 gene locus_tag LOCUS_06890 <77257 76556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391779.1:YitT family protein >Feature sequence010 465 1802 gene locus_tag LOCUS_06900 465 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 1862 3565 gene locus_tag LOCUS_06910 1862 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3634 4422 gene locus_tag LOCUS_06920 gene srlD 3634 4422 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_06920 4422 5711 gene locus_tag LOCUS_06930 4422 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 5801 7303 gene locus_tag LOCUS_06940 5801 7303 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_06940 10257 7465 gene locus_tag LOCUS_06950 10257 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 10467 13013 gene locus_tag LOCUS_06960 10467 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 13010 15589 gene locus_tag LOCUS_06970 13010 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 15589 17640 gene locus_tag LOCUS_06980 15589 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 20836 18305 gene locus_tag LOCUS_06990 20836 18305 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_06990 21048 20845 gene locus_tag LOCUS_07000 21048 20845 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730261.1 protein_id gnl|my_center|LOCUS_07000 21393 21091 gene locus_tag LOCUS_07010 21393 21091 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_07010 21585 22442 gene locus_tag LOCUS_07020 21585 22442 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_07020 22461 23363 gene locus_tag LOCUS_07030 22461 23363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 23469 24059 gene locus_tag LOCUS_07040 gene pgiA 23469 24059 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250062.1 protein_id gnl|my_center|LOCUS_07040 25508 24135 gene locus_tag LOCUS_07050 25508 24135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 25680 27410 gene locus_tag LOCUS_07060 gene recJ 25680 27410 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_07060 28801 27434 gene locus_tag LOCUS_07070 28801 27434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 29685 29080 gene locus_tag LOCUS_07080 29685 29080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 30755 29646 gene locus_tag LOCUS_07090 30755 29646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 31240 30806 gene locus_tag LOCUS_07100 31240 30806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 36084 31237 gene locus_tag LOCUS_07110 36084 31237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 38268 36103 gene locus_tag LOCUS_07120 38268 36103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 39377 38727 gene locus_tag LOCUS_07130 39377 38727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 40131 39364 gene locus_tag LOCUS_07140 gene parA 40131 39364 CDS product chromosome partitioning ATPase ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731642.1 protein_id gnl|my_center|LOCUS_07140 40541 42448 gene locus_tag LOCUS_07150 40541 42448 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_07150 43801 42530 gene locus_tag LOCUS_07160 43801 42530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 44092 44910 gene locus_tag LOCUS_07170 44092 44910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 45456 44812 gene locus_tag LOCUS_07180 45456 44812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 45825 47504 gene locus_tag LOCUS_07190 45825 47504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 47497 48381 gene locus_tag LOCUS_07200 47497 48381 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_07200 49176 48403 gene locus_tag LOCUS_07210 49176 48403 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_07210 49535 49257 gene locus_tag LOCUS_07220 49535 49257 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630832.1 protein_id gnl|my_center|LOCUS_07220 50437 49739 gene locus_tag LOCUS_07230 50437 49739 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_07230 51660 50851 gene locus_tag LOCUS_07240 51660 50851 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_07240 55460 51675 gene locus_tag LOCUS_07250 55460 51675 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256600.1 protein_id gnl|my_center|LOCUS_07250 57812 55476 gene locus_tag LOCUS_07260 57812 55476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 60132 57835 gene locus_tag LOCUS_07270 60132 57835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 61877 60132 gene locus_tag LOCUS_07280 61877 60132 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_07280 62964 61870 gene locus_tag LOCUS_07290 62964 61870 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_07290 62947 63159 gene locus_tag LOCUS_07300 62947 63159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 63425 63141 gene locus_tag LOCUS_07310 63425 63141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 63578 63504 gene locus_tag LOCUS_t00160 63578 63504 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 64666 63692 gene locus_tag LOCUS_07320 gene arcC 64666 63692 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_07320 65890 64685 gene locus_tag LOCUS_07330 65890 64685 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_07330 67333 66023 gene locus_tag LOCUS_07340 gene murA 67333 66023 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257774.1 protein_id gnl|my_center|LOCUS_07340 67689 68573 gene locus_tag LOCUS_07350 67689 68573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 68631 70580 gene locus_tag LOCUS_07360 gene gyrB 68631 70580 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258861.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence011 <1 1920 gene locus_tag LOCUS_07370 <1 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531166.1:ASKHA domain-containing protein 2028 2717 gene locus_tag LOCUS_07380 2028 2717 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_07380 2755 3738 gene locus_tag LOCUS_07390 gene bmt 2755 3738 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240571.1 protein_id gnl|my_center|LOCUS_07390 3771 4271 gene locus_tag LOCUS_07400 3771 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 4223 5278 gene locus_tag LOCUS_07410 4223 5278 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530674.1 protein_id gnl|my_center|LOCUS_07410 5319 6212 gene locus_tag LOCUS_07420 5319 6212 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873494.1 protein_id gnl|my_center|LOCUS_07420 6209 6835 gene locus_tag LOCUS_07430 6209 6835 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531173.1 protein_id gnl|my_center|LOCUS_07430 6896 8791 gene locus_tag LOCUS_07440 6896 8791 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705499.1 protein_id gnl|my_center|LOCUS_07440 8952 9665 gene locus_tag LOCUS_07450 8952 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 9662 9862 gene locus_tag LOCUS_07460 9662 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 9914 12553 gene locus_tag LOCUS_07470 9914 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 14150 12789 gene locus_tag LOCUS_07480 14150 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 15151 14147 gene locus_tag LOCUS_07490 15151 14147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082591.1 protein_id gnl|my_center|LOCUS_07490 16229 15225 gene locus_tag LOCUS_07500 16229 15225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250752.1 protein_id gnl|my_center|LOCUS_07500 17479 16226 gene locus_tag LOCUS_07510 17479 16226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 18492 17482 gene locus_tag LOCUS_07520 18492 17482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082485.1 protein_id gnl|my_center|LOCUS_07520 20536 18566 gene locus_tag LOCUS_07530 20536 18566 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080066.1 protein_id gnl|my_center|LOCUS_07530 22515 21103 gene locus_tag LOCUS_07540 22515 21103 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_07540 23742 22582 gene locus_tag LOCUS_07550 23742 22582 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_07550 26220 23983 gene locus_tag LOCUS_07560 26220 23983 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256758.1 protein_id gnl|my_center|LOCUS_07560 26489 27445 gene locus_tag LOCUS_07570 26489 27445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 27448 28449 gene locus_tag LOCUS_07580 27448 28449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 28456 31236 gene locus_tag LOCUS_07590 28456 31236 CDS product interleukin-like EMT inducer domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141609734.1 protein_id gnl|my_center|LOCUS_07590 31309 32337 gene locus_tag LOCUS_07600 31309 32337 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_07600 32658 32347 gene locus_tag LOCUS_07610 32658 32347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 33245 36529 gene locus_tag LOCUS_07620 33245 36529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 36545 37855 gene locus_tag LOCUS_07630 36545 37855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 38398 39531 gene locus_tag LOCUS_07640 38398 39531 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_07640 39528 40502 gene locus_tag LOCUS_07650 39528 40502 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388760.1 protein_id gnl|my_center|LOCUS_07650 42551 40542 gene locus_tag LOCUS_07660 42551 40542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 43521 42544 gene locus_tag LOCUS_07670 43521 42544 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256056.1 protein_id gnl|my_center|LOCUS_07670 44602 43571 gene locus_tag LOCUS_07680 44602 43571 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_07680 45572 44607 gene locus_tag LOCUS_07690 45572 44607 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_07690 46397 45681 gene locus_tag LOCUS_07700 gene cmk 46397 45681 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_07700 47438 46461 gene locus_tag LOCUS_07710 47438 46461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 48515 47574 gene locus_tag LOCUS_07720 gene secF 48515 47574 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_07720 49916 48534 gene locus_tag LOCUS_07730 gene secD 49916 48534 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258879.1 protein_id gnl|my_center|LOCUS_07730 50191 51558 gene locus_tag LOCUS_07740 50191 51558 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_07740 51589 52599 gene locus_tag LOCUS_07750 51589 52599 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_07750 53854 52730 gene locus_tag LOCUS_07760 53854 52730 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_07760 54768 53887 gene locus_tag LOCUS_07770 54768 53887 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_07770 56230 54737 gene locus_tag LOCUS_07780 gene xylB 56230 54737 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 protein_id gnl|my_center|LOCUS_07780 56854 58281 gene locus_tag LOCUS_07790 56854 58281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 <66948 58336 gene locus_tag LOCUS_07800 <66948 58336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein >Feature sequence012 872 501 gene locus_tag LOCUS_07810 872 501 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 protein_id gnl|my_center|LOCUS_07810 2720 1089 gene locus_tag LOCUS_07820 2720 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 3289 2756 gene locus_tag LOCUS_07830 3289 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 3569 9535 gene locus_tag LOCUS_07840 3569 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 9803 11311 gene locus_tag LOCUS_07850 9803 11311 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_07850 11464 12084 gene locus_tag LOCUS_07860 11464 12084 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265685.1 protein_id gnl|my_center|LOCUS_07860 12081 13067 gene locus_tag LOCUS_07870 12081 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 13275 13054 gene locus_tag LOCUS_07880 13275 13054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 13996 13232 gene locus_tag LOCUS_07890 13996 13232 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256718.1 protein_id gnl|my_center|LOCUS_07890 15490 14051 gene locus_tag LOCUS_07900 gene lutB 15490 14051 CDS product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 protein_id gnl|my_center|LOCUS_07900 16405 15557 gene locus_tag LOCUS_07910 16405 15557 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_07910 17652 16414 gene locus_tag LOCUS_07920 17652 16414 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479553.1 protein_id gnl|my_center|LOCUS_07920 17928 18323 gene locus_tag LOCUS_07930 17928 18323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 18433 19650 gene locus_tag LOCUS_07940 18433 19650 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_07940 19647 20624 gene locus_tag LOCUS_07950 19647 20624 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_07950 20697 21083 gene locus_tag LOCUS_07960 20697 21083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 21390 22685 gene locus_tag LOCUS_07970 21390 22685 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137848.1 protein_id gnl|my_center|LOCUS_07970 22773 23999 gene locus_tag LOCUS_07980 22773 23999 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_07980 23996 24622 gene locus_tag LOCUS_07990 gene metW 23996 24622 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_07990 25593 24691 gene locus_tag LOCUS_08000 25593 24691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 27026 25647 gene locus_tag LOCUS_08010 gene der 27026 25647 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_08010 28420 27041 gene locus_tag LOCUS_08020 28420 27041 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257449.1 protein_id gnl|my_center|LOCUS_08020 29235 28459 gene locus_tag LOCUS_08030 gene cdaA 29235 28459 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_08030 30169 29237 gene locus_tag LOCUS_08040 gene argF 30169 29237 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_08040 30990 30166 gene locus_tag LOCUS_08050 30990 30166 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_08050 31751 31005 gene locus_tag LOCUS_08060 31751 31005 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_08060 32619 31765 gene locus_tag LOCUS_08070 32619 31765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 33153 34184 gene locus_tag LOCUS_08080 33153 34184 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_08080 34257 34739 gene locus_tag LOCUS_08090 34257 34739 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_08090 36461 34782 gene locus_tag LOCUS_08100 36461 34782 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056105.1 protein_id gnl|my_center|LOCUS_08100 37109 36486 gene locus_tag LOCUS_08110 37109 36486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056441.1 protein_id gnl|my_center|LOCUS_08110 38024 37176 gene locus_tag LOCUS_08120 38024 37176 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_08120 38966 38028 gene locus_tag LOCUS_08130 38966 38028 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_08130 40376 39039 gene locus_tag LOCUS_08140 40376 39039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 41859 40549 gene locus_tag LOCUS_08150 41859 40549 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_08150 41958 42728 gene locus_tag LOCUS_08160 41958 42728 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_08160 44297 43071 gene locus_tag LOCUS_08170 gene serB 44297 43071 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_08170 44679 45455 gene locus_tag LOCUS_08180 44679 45455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 45567 46718 gene locus_tag LOCUS_08190 45567 46718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 46757 47539 gene locus_tag LOCUS_08200 46757 47539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 47837 48043 gene locus_tag LOCUS_08210 47837 48043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 48053 49246 gene locus_tag LOCUS_08220 48053 49246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 49253 50170 gene locus_tag LOCUS_08230 49253 50170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 50167 51339 gene locus_tag LOCUS_08240 50167 51339 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_08240 51336 52580 gene locus_tag LOCUS_08250 51336 52580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 52708 53739 gene locus_tag LOCUS_08260 52708 53739 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_08260 53751 54449 gene locus_tag LOCUS_08270 53751 54449 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_08270 54492 56183 gene locus_tag LOCUS_08280 54492 56183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 56207 57337 gene locus_tag LOCUS_08290 56207 57337 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence013 551 354 gene locus_tag LOCUS_08300 551 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1209 697 gene locus_tag LOCUS_08310 1209 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4068 1345 gene locus_tag LOCUS_08320 4068 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5373 4099 gene locus_tag LOCUS_08330 5373 4099 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259142.1 protein_id gnl|my_center|LOCUS_08330 6465 5431 gene locus_tag LOCUS_08340 6465 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6726 9182 gene locus_tag LOCUS_08350 gene ppk1 6726 9182 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_08350 9225 9728 gene locus_tag LOCUS_08360 9225 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 11330 9786 gene locus_tag LOCUS_08370 11330 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 11481 12287 gene locus_tag LOCUS_08380 11481 12287 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383265.1 protein_id gnl|my_center|LOCUS_08380 12378 12785 gene locus_tag LOCUS_08390 12378 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 13345 12752 gene locus_tag LOCUS_08400 13345 12752 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258952.1 protein_id gnl|my_center|LOCUS_08400 15366 13342 gene locus_tag LOCUS_08410 15366 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 15608 17515 gene locus_tag LOCUS_08420 gene dnaK 15608 17515 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_08420 17646 18416 gene locus_tag LOCUS_08430 17646 18416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 18420 19346 gene locus_tag LOCUS_08440 18420 19346 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_08440 19451 20323 gene locus_tag LOCUS_08450 19451 20323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 20491 23085 gene locus_tag LOCUS_08460 gene clpB 20491 23085 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459822.1 protein_id gnl|my_center|LOCUS_08460 24388 23129 gene locus_tag LOCUS_08470 gene kynU 24388 23129 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257142.1 protein_id gnl|my_center|LOCUS_08470 25336 24395 gene locus_tag LOCUS_08480 25336 24395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 26263 25622 gene locus_tag LOCUS_08490 26263 25622 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 protein_id gnl|my_center|LOCUS_08490 26423 27400 gene locus_tag LOCUS_08500 gene corA 26423 27400 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_08500 27401 27919 gene locus_tag LOCUS_08510 27401 27919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 27941 28477 gene locus_tag LOCUS_08520 27941 28477 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909403.1 protein_id gnl|my_center|LOCUS_08520 29526 28468 gene locus_tag LOCUS_08530 29526 28468 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_08530 29759 30361 gene locus_tag LOCUS_08540 29759 30361 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258858.1 protein_id gnl|my_center|LOCUS_08540 31751 30495 gene locus_tag LOCUS_08550 31751 30495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 32572 31871 gene locus_tag LOCUS_08560 32572 31871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 34225 32621 gene locus_tag LOCUS_08570 34225 32621 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_08570 35786 34278 gene locus_tag LOCUS_08580 gene mttB 35786 34278 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_08580 37345 35795 gene locus_tag LOCUS_08590 37345 35795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 37388 38305 gene locus_tag LOCUS_08600 gene trmD 37388 38305 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256255.1 protein_id gnl|my_center|LOCUS_08600 38614 38976 gene locus_tag LOCUS_08610 gene rplS 38614 38976 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081989.1 protein_id gnl|my_center|LOCUS_08610 39148 40479 gene locus_tag LOCUS_08620 39148 40479 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_08620 40521 41675 gene locus_tag LOCUS_08630 40521 41675 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104091.1 protein_id gnl|my_center|LOCUS_08630 41698 42885 gene locus_tag LOCUS_08640 41698 42885 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259183.1 protein_id gnl|my_center|LOCUS_08640 43090 44715 gene locus_tag LOCUS_08650 43090 44715 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_08650 44728 45759 gene locus_tag LOCUS_08660 44728 45759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228819.1 protein_id gnl|my_center|LOCUS_08660 46691 45756 gene locus_tag LOCUS_08670 46691 45756 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_08670 47789 46713 gene locus_tag LOCUS_08680 47789 46713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_08680 49570 47882 gene locus_tag LOCUS_08690 49570 47882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 51317 49776 gene locus_tag LOCUS_08700 51317 49776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 51440 51742 gene locus_tag LOCUS_08710 51440 51742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 51798 52448 gene locus_tag LOCUS_08720 51798 52448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 53970 52453 gene locus_tag LOCUS_08730 gene rimO 53970 52453 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_08730 54653 53967 gene locus_tag LOCUS_08740 54653 53967 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence014 3048 352 gene locus_tag LOCUS_08750 3048 352 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869498.1 protein_id gnl|my_center|LOCUS_08750 6071 3075 gene locus_tag LOCUS_08760 6071 3075 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_08760 7400 6192 gene locus_tag LOCUS_08770 7400 6192 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257004.1 protein_id gnl|my_center|LOCUS_08770 7538 9409 gene locus_tag LOCUS_08780 7538 9409 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_08780 9739 9404 gene locus_tag LOCUS_08790 9739 9404 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_08790 10175 9732 gene locus_tag LOCUS_08800 gene acpS 10175 9732 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256379.1 protein_id gnl|my_center|LOCUS_08800 11458 10181 gene locus_tag LOCUS_08810 11458 10181 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164937423.1 protein_id gnl|my_center|LOCUS_08810 12750 11455 gene locus_tag LOCUS_08820 12750 11455 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421521.1 protein_id gnl|my_center|LOCUS_08820 14077 12758 gene locus_tag LOCUS_08830 14077 12758 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_08830 15150 14146 gene locus_tag LOCUS_08840 15150 14146 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_08840 15610 15359 gene locus_tag LOCUS_08850 15610 15359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 17120 15774 gene locus_tag LOCUS_08860 17120 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 17434 20652 gene locus_tag LOCUS_08870 17434 20652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 20817 22511 gene locus_tag LOCUS_08880 20817 22511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 22526 24145 gene locus_tag LOCUS_08890 22526 24145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 24204 26564 gene locus_tag LOCUS_08900 gene hypF 24204 26564 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_08900 27687 26515 gene locus_tag LOCUS_08910 gene mtnA 27687 26515 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_08910 29140 27746 gene locus_tag LOCUS_08920 29140 27746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 29889 29149 gene locus_tag LOCUS_08930 29889 29149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 31032 29896 gene locus_tag LOCUS_08940 31032 29896 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_08940 31749 31072 gene locus_tag LOCUS_08950 31749 31072 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_08950 32990 31857 gene locus_tag LOCUS_08960 32990 31857 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_08960 33529 33086 gene locus_tag LOCUS_08970 33529 33086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 35715 33676 gene locus_tag LOCUS_08980 35715 33676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 35967 37085 gene locus_tag LOCUS_08990 35967 37085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740065.1 protein_id gnl|my_center|LOCUS_08990 37085 38167 gene locus_tag LOCUS_09000 37085 38167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104697.1 protein_id gnl|my_center|LOCUS_09000 38224 39090 gene locus_tag LOCUS_09010 38224 39090 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810946.1 protein_id gnl|my_center|LOCUS_09010 39159 39974 gene locus_tag LOCUS_09020 39159 39974 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376266.1 protein_id gnl|my_center|LOCUS_09020 40006 40290 gene locus_tag LOCUS_09030 40006 40290 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267211.1 protein_id gnl|my_center|LOCUS_09030 40405 42228 gene locus_tag LOCUS_09040 40405 42228 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148771775.1 protein_id gnl|my_center|LOCUS_09040 44304 42397 gene locus_tag LOCUS_09050 44304 42397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 44786 45064 gene locus_tag LOCUS_09060 44786 45064 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_09060 45068 46288 gene locus_tag LOCUS_09070 45068 46288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 46304 47239 gene locus_tag LOCUS_09080 46304 47239 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_09080 47285 47743 gene locus_tag LOCUS_09090 47285 47743 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258477.1 protein_id gnl|my_center|LOCUS_09090 47757 48164 gene locus_tag LOCUS_09100 47757 48164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 50408 48213 gene locus_tag LOCUS_09110 50408 48213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 50679 51308 gene locus_tag LOCUS_09120 50679 51308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 51332 52984 gene locus_tag LOCUS_09130 51332 52984 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_09130 53208 54212 gene locus_tag LOCUS_09140 gene plsX 53208 54212 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence015 15 725 gene locus_tag LOCUS_09150 15 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 756 1577 gene locus_tag LOCUS_09160 gene mutM 756 1577 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_09160 1806 1594 gene locus_tag LOCUS_09170 1806 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2739 1948 gene locus_tag LOCUS_09180 2739 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2948 3886 gene locus_tag LOCUS_09190 2948 3886 CDS product UV damage repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256156.1 protein_id gnl|my_center|LOCUS_09190 6637 3923 gene locus_tag LOCUS_09200 6637 3923 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257792.1 protein_id gnl|my_center|LOCUS_09200 9184 6782 gene locus_tag LOCUS_09210 9184 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 10236 9232 gene locus_tag LOCUS_09220 10236 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 11374 10322 gene locus_tag LOCUS_09230 11374 10322 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_09230 12099 11524 gene locus_tag LOCUS_09240 12099 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 12721 12173 gene locus_tag LOCUS_09250 12721 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 14748 12760 gene locus_tag LOCUS_09260 14748 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 15544 14831 gene locus_tag LOCUS_09270 15544 14831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 16104 15541 gene locus_tag LOCUS_09280 16104 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 18923 16110 gene locus_tag LOCUS_09290 18923 16110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 20536 18920 gene locus_tag LOCUS_09300 20536 18920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 21280 20540 gene locus_tag LOCUS_09310 21280 20540 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_09310 21885 21301 gene locus_tag LOCUS_09320 21885 21301 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257866.1 protein_id gnl|my_center|LOCUS_09320 23578 22055 gene locus_tag LOCUS_09330 23578 22055 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_09330 23796 23722 gene locus_tag LOCUS_t00170 23796 23722 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24068 25864 gene locus_tag LOCUS_09340 24068 25864 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_09340 25937 26869 gene locus_tag LOCUS_09350 gene opp1B 25937 26869 CDS product oligopeptide ABC transporter permease Opp1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381304.1 protein_id gnl|my_center|LOCUS_09350 26866 27735 gene locus_tag LOCUS_09360 26866 27735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583498.1 protein_id gnl|my_center|LOCUS_09360 27743 29116 gene locus_tag LOCUS_09370 27743 29116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 29276 29836 gene locus_tag LOCUS_09380 29276 29836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 30223 29918 gene locus_tag LOCUS_09390 30223 29918 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087485.1 protein_id gnl|my_center|LOCUS_09390 32117 30378 gene locus_tag LOCUS_09400 32117 30378 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_09400 33190 32165 gene locus_tag LOCUS_09410 33190 32165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 34271 33204 gene locus_tag LOCUS_09420 gene appB 34271 33204 CDS product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 protein_id gnl|my_center|LOCUS_09420 35260 34274 gene locus_tag LOCUS_09430 35260 34274 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_09430 36360 35278 gene locus_tag LOCUS_09440 36360 35278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_09440 37446 36445 gene locus_tag LOCUS_09450 37446 36445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257498.1 protein_id gnl|my_center|LOCUS_09450 38649 37462 gene locus_tag LOCUS_09460 38649 37462 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257497.1 protein_id gnl|my_center|LOCUS_09460 40678 38780 gene locus_tag LOCUS_09470 40678 38780 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257496.1 protein_id gnl|my_center|LOCUS_09470 41811 40777 gene locus_tag LOCUS_09480 41811 40777 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_09480 42836 41808 gene locus_tag LOCUS_09490 42836 41808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_09490 44137 43028 gene locus_tag LOCUS_09500 44137 43028 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_09500 44972 44181 gene locus_tag LOCUS_09510 44972 44181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 47819 45114 gene locus_tag LOCUS_09520 47819 45114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 48996 47839 gene locus_tag LOCUS_09530 48996 47839 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257273.1 protein_id gnl|my_center|LOCUS_09530 49951 49049 gene locus_tag LOCUS_09540 49951 49049 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089091.1 protein_id gnl|my_center|LOCUS_09540 50836 49952 gene locus_tag LOCUS_09550 50836 49952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 52426 50846 gene locus_tag LOCUS_09560 52426 50846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence016 4817 597 gene locus_tag LOCUS_09570 4817 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5162 8524 gene locus_tag LOCUS_09580 5162 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 8547 9929 gene locus_tag LOCUS_09590 8547 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 11147 10194 gene locus_tag LOCUS_09600 11147 10194 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_09600 12329 11226 gene locus_tag LOCUS_09610 gene cobT 12329 11226 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_09610 13915 12326 gene locus_tag LOCUS_09620 13915 12326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 14063 15946 gene locus_tag LOCUS_09630 14063 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 16153 17025 gene locus_tag LOCUS_09640 gene htpX 16153 17025 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257483.1 protein_id gnl|my_center|LOCUS_09640 19416 17029 gene locus_tag LOCUS_09650 gene recJ 19416 17029 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057085.1 protein_id gnl|my_center|LOCUS_09650 20633 19416 gene locus_tag LOCUS_09660 20633 19416 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257466.1 protein_id gnl|my_center|LOCUS_09660 21562 20636 gene locus_tag LOCUS_09670 21562 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 22003 21572 gene locus_tag LOCUS_09680 22003 21572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 23241 22000 gene locus_tag LOCUS_09690 23241 22000 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061638.1 protein_id gnl|my_center|LOCUS_09690 24524 23238 gene locus_tag LOCUS_09700 24524 23238 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257129.1 protein_id gnl|my_center|LOCUS_09700 25266 24529 gene locus_tag LOCUS_09710 25266 24529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 27636 25339 gene locus_tag LOCUS_09720 27636 25339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 28948 27623 gene locus_tag LOCUS_09730 28948 27623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 31140 29002 gene locus_tag LOCUS_09740 31140 29002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 31931 31224 gene locus_tag LOCUS_09750 31931 31224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 34580 31968 gene locus_tag LOCUS_09760 34580 31968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 35890 34577 gene locus_tag LOCUS_09770 35890 34577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_09770 37420 35954 gene locus_tag LOCUS_09780 37420 35954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 39224 37542 gene locus_tag LOCUS_09790 39224 37542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 40671 39295 gene locus_tag LOCUS_09800 40671 39295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 41753 40668 gene locus_tag LOCUS_09810 41753 40668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 42625 41753 gene locus_tag LOCUS_09820 42625 41753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 43870 42635 gene locus_tag LOCUS_09830 43870 42635 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259083.1 protein_id gnl|my_center|LOCUS_09830 45402 43996 gene locus_tag LOCUS_09840 45402 43996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 46068 45529 gene locus_tag LOCUS_09850 46068 45529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 47034 46069 gene locus_tag LOCUS_09860 47034 46069 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_09860 48158 47031 gene locus_tag LOCUS_09870 48158 47031 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_09870 49931 48381 gene locus_tag LOCUS_09880 49931 48381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_09880 51305 50052 gene locus_tag LOCUS_09890 51305 50052 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064307.1 protein_id gnl|my_center|LOCUS_09890 51981 51655 gene locus_tag LOCUS_09900 51981 51655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence017 364 789 gene locus_tag LOCUS_09910 364 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 776 2977 gene locus_tag LOCUS_09920 776 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 4193 2874 gene locus_tag LOCUS_09930 4193 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4308 5711 gene locus_tag LOCUS_09940 4308 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 5811 6734 gene locus_tag LOCUS_09950 5811 6734 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098570.1 protein_id gnl|my_center|LOCUS_09950 6821 7627 gene locus_tag LOCUS_09960 6821 7627 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_09960 7664 9643 gene locus_tag LOCUS_09970 7664 9643 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226188.1 protein_id gnl|my_center|LOCUS_09970 10966 9707 gene locus_tag LOCUS_09980 gene glcF 10966 9707 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227984.1 protein_id gnl|my_center|LOCUS_09980 12065 10974 gene locus_tag LOCUS_09990 12065 10974 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227985.1 protein_id gnl|my_center|LOCUS_09990 13523 12075 gene locus_tag LOCUS_10000 13523 12075 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_10000 14032 13547 gene locus_tag LOCUS_10010 14032 13547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 14129 14045 gene locus_tag LOCUS_t00180 14129 14045 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15964 14213 gene locus_tag LOCUS_10020 15964 14213 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_10020 16226 16002 gene locus_tag LOCUS_10030 16226 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 16622 16413 gene locus_tag LOCUS_10040 16622 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 18902 16782 gene locus_tag LOCUS_10050 gene glgX 18902 16782 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_10050 19852 18899 gene locus_tag LOCUS_10060 19852 18899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 20541 19849 gene locus_tag LOCUS_10070 20541 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 21560 20547 gene locus_tag LOCUS_10080 21560 20547 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064349.1 protein_id gnl|my_center|LOCUS_10080 21687 22340 gene locus_tag LOCUS_10090 21687 22340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 22623 22354 gene locus_tag LOCUS_10100 22623 22354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 23582 22737 gene locus_tag LOCUS_10110 23582 22737 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525321.1 protein_id gnl|my_center|LOCUS_10110 24482 23586 gene locus_tag LOCUS_10120 24482 23586 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584089.1 protein_id gnl|my_center|LOCUS_10120 26307 24673 gene locus_tag LOCUS_10130 26307 24673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 28362 26758 gene locus_tag LOCUS_10140 gene murJ 28362 26758 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256387.1 protein_id gnl|my_center|LOCUS_10140 29406 28375 gene locus_tag LOCUS_10150 gene trxB 29406 28375 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_10150 30310 29501 gene locus_tag LOCUS_10160 30310 29501 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_10160 31286 30315 gene locus_tag LOCUS_10170 31286 30315 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_10170 32414 31290 gene locus_tag LOCUS_10180 gene dnaJ 32414 31290 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_10180 32632 32441 gene locus_tag LOCUS_10190 32632 32441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 33212 32637 gene locus_tag LOCUS_10200 gene coaE 33212 32637 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_10200 33626 34909 gene locus_tag LOCUS_10210 33626 34909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 35065 36213 gene locus_tag LOCUS_10220 35065 36213 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256819.1 protein_id gnl|my_center|LOCUS_10220 36224 37630 gene locus_tag LOCUS_10230 36224 37630 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256820.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10230 37667 38470 gene locus_tag LOCUS_10240 37667 38470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_10240 38473 39192 gene locus_tag LOCUS_10250 38473 39192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_10250 39900 39235 gene locus_tag LOCUS_10260 gene plsY 39900 39235 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_10260 40494 39982 gene locus_tag LOCUS_10270 gene tpx 40494 39982 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_10270 40985 40491 gene locus_tag LOCUS_10280 40985 40491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 41951 40995 gene locus_tag LOCUS_10290 41951 40995 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173595.1 protein_id gnl|my_center|LOCUS_10290 42134 42742 gene locus_tag LOCUS_10300 gene rdgB 42134 42742 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256394.1 protein_id gnl|my_center|LOCUS_10300 42930 43637 gene locus_tag LOCUS_10310 gene dhaL 42930 43637 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938279.1 protein_id gnl|my_center|LOCUS_10310 43625 45142 gene locus_tag LOCUS_10320 gene glpK 43625 45142 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_10320 45187 46917 gene locus_tag LOCUS_10330 gene glpA 45187 46917 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259132.1 protein_id gnl|my_center|LOCUS_10330 46910 48166 gene locus_tag LOCUS_10340 gene glpB 46910 48166 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259131.1 protein_id gnl|my_center|LOCUS_10340 48202 49506 gene locus_tag LOCUS_10350 48202 49506 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259130.1 protein_id gnl|my_center|LOCUS_10350 49599 49799 gene locus_tag LOCUS_10360 49599 49799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 49969 49721 gene locus_tag LOCUS_10370 49969 49721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 49940 50107 gene locus_tag LOCUS_10380 49940 50107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 50987 50154 gene locus_tag LOCUS_10390 gene yhfZ 50987 50154 CDS product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674092.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence018 1773 1000 gene locus_tag LOCUS_10400 1773 1000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202612.1 protein_id gnl|my_center|LOCUS_10400 2966 1815 gene locus_tag LOCUS_10410 2966 1815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889538.1 protein_id gnl|my_center|LOCUS_10410 4337 2970 gene locus_tag LOCUS_10420 4337 2970 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256713.1 protein_id gnl|my_center|LOCUS_10420 5698 4403 gene locus_tag LOCUS_10430 5698 4403 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_10430 6339 5695 gene locus_tag LOCUS_10440 6339 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 6684 6995 gene locus_tag LOCUS_10450 gene rplU 6684 6995 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_10450 7031 7294 gene locus_tag LOCUS_10460 gene rpmA 7031 7294 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_10460 7296 7643 gene locus_tag LOCUS_10470 7296 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7771 8391 gene locus_tag LOCUS_10480 7771 8391 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 protein_id gnl|my_center|LOCUS_10480 8363 9274 gene locus_tag LOCUS_10490 8363 9274 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_10490 11757 9298 gene locus_tag LOCUS_10500 11757 9298 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_10500 12704 11862 gene locus_tag LOCUS_10510 12704 11862 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_10510 12912 12697 gene locus_tag LOCUS_10520 12912 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 13046 13411 gene locus_tag LOCUS_10530 13046 13411 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393953.1 protein_id gnl|my_center|LOCUS_10530 15270 13456 gene locus_tag LOCUS_10540 gene ftsH 15270 13456 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_10540 15484 16635 gene locus_tag LOCUS_10550 gene rlmN 15484 16635 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_10550 16951 16772 gene locus_tag LOCUS_10560 gene rpmB 16951 16772 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256168.1 protein_id gnl|my_center|LOCUS_10560 17293 18153 gene locus_tag LOCUS_10570 17293 18153 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_10570 18156 20723 gene locus_tag LOCUS_10580 gene recG 18156 20723 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_10580 22062 20773 gene locus_tag LOCUS_10590 22062 20773 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909504.1 protein_id gnl|my_center|LOCUS_10590 22338 24731 gene locus_tag LOCUS_10600 gene ppsA 22338 24731 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_10600 24731 25546 gene locus_tag LOCUS_10610 24731 25546 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258817.1 protein_id gnl|my_center|LOCUS_10610 26947 25562 gene locus_tag LOCUS_10620 gene hflX 26947 25562 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_10620 27879 26977 gene locus_tag LOCUS_10630 27879 26977 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_10630 28986 27964 gene locus_tag LOCUS_10640 28986 27964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723195.1 protein_id gnl|my_center|LOCUS_10640 29995 28997 gene locus_tag LOCUS_10650 29995 28997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175050168.1 protein_id gnl|my_center|LOCUS_10650 31494 30001 gene locus_tag LOCUS_10660 31494 30001 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974214.1 protein_id gnl|my_center|LOCUS_10660 32707 31658 gene locus_tag LOCUS_10670 32707 31658 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969456.1 protein_id gnl|my_center|LOCUS_10670 33415 32786 gene locus_tag LOCUS_10680 gene dhaL 33415 32786 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533066.1 protein_id gnl|my_center|LOCUS_10680 34421 33417 gene locus_tag LOCUS_10690 34421 33417 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533065.1 protein_id gnl|my_center|LOCUS_10690 34922 35914 gene locus_tag LOCUS_10700 34922 35914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 36845 35991 gene locus_tag LOCUS_10710 36845 35991 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_10710 37277 38341 gene locus_tag LOCUS_10720 37277 38341 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262044.1 protein_id gnl|my_center|LOCUS_10720 38338 39108 gene locus_tag LOCUS_10730 gene rnc 38338 39108 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942868.1 protein_id gnl|my_center|LOCUS_10730 42761 39117 gene locus_tag LOCUS_10740 gene smc 42761 39117 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258775.1 protein_id gnl|my_center|LOCUS_10740 43489 42773 gene locus_tag LOCUS_10750 43489 42773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 44542 43646 gene locus_tag LOCUS_10760 44542 43646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 46165 44552 gene locus_tag LOCUS_10770 46165 44552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 47013 46219 gene locus_tag LOCUS_10780 47013 46219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence019 1598 1401 gene locus_tag LOCUS_10790 1598 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1507 3135 gene locus_tag LOCUS_10800 1507 3135 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901535.1 protein_id gnl|my_center|LOCUS_10800 3210 5948 gene locus_tag LOCUS_10810 3210 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8691 8389 gene locus_tag LOCUS_10820 8691 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 8937 9647 gene locus_tag LOCUS_10830 8937 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 9923 10804 gene locus_tag LOCUS_10840 9923 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 10929 11717 gene locus_tag LOCUS_10850 10929 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 11729 12808 gene locus_tag LOCUS_10860 11729 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 12808 13896 gene locus_tag LOCUS_10870 12808 13896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 14290 17646 gene locus_tag LOCUS_10880 14290 17646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 17750 18784 gene locus_tag LOCUS_10890 17750 18784 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250990.1 protein_id gnl|my_center|LOCUS_10890 19258 18929 gene locus_tag LOCUS_10900 19258 18929 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_10900 19437 22547 gene locus_tag LOCUS_10910 19437 22547 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_10910 22499 22744 gene locus_tag LOCUS_10920 22499 22744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 22839 23792 gene locus_tag LOCUS_10930 22839 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 23923 24180 gene locus_tag LOCUS_10940 23923 24180 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771148.1 protein_id gnl|my_center|LOCUS_10940 24177 24662 gene locus_tag LOCUS_10950 24177 24662 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_10950 24674 24997 gene locus_tag LOCUS_10960 24674 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 25064 26236 gene locus_tag LOCUS_10970 25064 26236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 26369 29227 gene locus_tag LOCUS_10980 26369 29227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 30457 29417 gene locus_tag LOCUS_10990 30457 29417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_10990 31274 30471 gene locus_tag LOCUS_11000 31274 30471 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028995.1 protein_id gnl|my_center|LOCUS_11000 32155 31271 gene locus_tag LOCUS_11010 32155 31271 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 protein_id gnl|my_center|LOCUS_11010 33404 32163 gene locus_tag LOCUS_11020 33404 32163 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940045.1 protein_id gnl|my_center|LOCUS_11020 33948 33469 gene locus_tag LOCUS_11030 33948 33469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 35015 33963 gene locus_tag LOCUS_11040 35015 33963 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257791.1 protein_id gnl|my_center|LOCUS_11040 36035 35067 gene locus_tag LOCUS_11050 gene kdgK1 36035 35067 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_11050 36248 36451 gene locus_tag LOCUS_11060 36248 36451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 36558 36998 gene locus_tag LOCUS_11070 gene aroH 36558 36998 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_11070 36995 37867 gene locus_tag LOCUS_11080 gene pheA 36995 37867 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_11080 37935 39002 gene locus_tag LOCUS_11090 gene aroF 37935 39002 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_11090 38999 40015 gene locus_tag LOCUS_11100 gene aroF 38999 40015 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_11100 40025 40900 gene locus_tag LOCUS_11110 40025 40900 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_11110 41000 42073 gene locus_tag LOCUS_11120 41000 42073 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067163.1 protein_id gnl|my_center|LOCUS_11120 42074 43330 gene locus_tag LOCUS_11130 gene trpB 42074 43330 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_11130 43327 44127 gene locus_tag LOCUS_11140 gene trpA 43327 44127 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_11140 44188 45198 gene locus_tag LOCUS_11150 44188 45198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence020 10791 769 gene locus_tag LOCUS_11160 10791 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 12218 11226 gene locus_tag LOCUS_11170 12218 11226 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_11170 14123 12312 gene locus_tag LOCUS_11180 14123 12312 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_11180 15270 14182 gene locus_tag LOCUS_11190 15270 14182 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894495.1 protein_id gnl|my_center|LOCUS_11190 16153 15317 gene locus_tag LOCUS_11200 16153 15317 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339519.1 protein_id gnl|my_center|LOCUS_11200 17082 16159 gene locus_tag LOCUS_11210 17082 16159 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396180.1 protein_id gnl|my_center|LOCUS_11210 18549 17197 gene locus_tag LOCUS_11220 18549 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 19725 18700 gene locus_tag LOCUS_11230 19725 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 20910 19768 gene locus_tag LOCUS_11240 20910 19768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11240 21690 20992 gene locus_tag LOCUS_11250 21690 20992 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869088.1 protein_id gnl|my_center|LOCUS_11250 21876 22691 gene locus_tag LOCUS_11260 21876 22691 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485387.1 protein_id gnl|my_center|LOCUS_11260 22932 26159 gene locus_tag LOCUS_11270 gene carB 22932 26159 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257643.1 protein_id gnl|my_center|LOCUS_11270 26168 26452 gene locus_tag LOCUS_11280 26168 26452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 26541 27695 gene locus_tag LOCUS_11290 26541 27695 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257135.1 protein_id gnl|my_center|LOCUS_11290 27805 28392 gene locus_tag LOCUS_11300 27805 28392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 28445 29860 gene locus_tag LOCUS_11310 28445 29860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 29885 30466 gene locus_tag LOCUS_11320 gene hpt 29885 30466 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_11320 30450 31700 gene locus_tag LOCUS_11330 30450 31700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 32775 31726 gene locus_tag LOCUS_11340 32775 31726 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256998.1 protein_id gnl|my_center|LOCUS_11340 33991 32819 gene locus_tag LOCUS_11350 gene nagA 33991 32819 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038508.1 protein_id gnl|my_center|LOCUS_11350 35003 33996 gene locus_tag LOCUS_11360 gene glcK 35003 33996 CDS product glucose kinase GlcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230132.1 protein_id gnl|my_center|LOCUS_11360 35094 35858 gene locus_tag LOCUS_11370 gene cobS 35094 35858 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140155.1 protein_id gnl|my_center|LOCUS_11370 37010 35874 gene locus_tag LOCUS_11380 37010 35874 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812857.1 protein_id gnl|my_center|LOCUS_11380 37855 37007 gene locus_tag LOCUS_11390 37855 37007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 39617 37863 gene locus_tag LOCUS_11400 39617 37863 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257153.1 protein_id gnl|my_center|LOCUS_11400 40882 39632 gene locus_tag LOCUS_11410 40882 39632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 41705 41025 gene locus_tag LOCUS_11420 41705 41025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence021 378 1418 gene locus_tag LOCUS_11430 378 1418 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_11430 2319 1555 gene locus_tag LOCUS_11440 2319 1555 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_11440 3838 2339 gene locus_tag LOCUS_11450 gene dhaS 3838 2339 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 protein_id gnl|my_center|LOCUS_11450 5351 3816 gene locus_tag LOCUS_11460 5351 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 6126 5338 gene locus_tag LOCUS_11470 6126 5338 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103979.1 protein_id gnl|my_center|LOCUS_11470 7128 6127 gene locus_tag LOCUS_11480 7128 6127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_11480 8026 7133 gene locus_tag LOCUS_11490 8026 7133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_11490 9801 8122 gene locus_tag LOCUS_11500 9801 8122 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_11500 10770 9970 gene locus_tag LOCUS_11510 10770 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 11021 10782 gene locus_tag LOCUS_11520 11021 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11520 12013 11024 gene locus_tag LOCUS_11530 gene acoB 12013 11024 CDS product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198886.1 protein_id gnl|my_center|LOCUS_11530 12984 12016 gene locus_tag LOCUS_11540 gene pdhA 12984 12016 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_11540 14302 13058 gene locus_tag LOCUS_11550 14302 13058 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392231.1 protein_id gnl|my_center|LOCUS_11550 14698 14309 gene locus_tag LOCUS_11560 14698 14309 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082421.1 protein_id gnl|my_center|LOCUS_11560 15382 14702 gene locus_tag LOCUS_11570 15382 14702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 15655 16491 gene locus_tag LOCUS_11580 15655 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 16539 17834 gene locus_tag LOCUS_11590 16539 17834 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_11590 17838 18920 gene locus_tag LOCUS_11600 gene queA 17838 18920 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_11600 19182 21341 gene locus_tag LOCUS_11610 19182 21341 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056504.1 protein_id gnl|my_center|LOCUS_11610 21338 30028 gene locus_tag LOCUS_11620 21338 30028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 32526 30142 gene locus_tag LOCUS_11630 32526 30142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 33193 32528 gene locus_tag LOCUS_11640 33193 32528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 33796 33197 gene locus_tag LOCUS_11650 33796 33197 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_11650 34036 35154 gene locus_tag LOCUS_11660 34036 35154 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929354.1 protein_id gnl|my_center|LOCUS_11660 35217 36194 gene locus_tag LOCUS_11670 gene pyrB 35217 36194 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251146.1 protein_id gnl|my_center|LOCUS_11670 36254 38158 gene locus_tag LOCUS_11680 36254 38158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 38738 38205 gene locus_tag LOCUS_11690 38738 38205 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_11690 39190 38801 gene locus_tag LOCUS_11700 39190 38801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 40565 39294 gene locus_tag LOCUS_11710 40565 39294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence022 463 1476 gene locus_tag LOCUS_11720 463 1476 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258589.1 protein_id gnl|my_center|LOCUS_11720 1729 3174 gene locus_tag LOCUS_11730 1729 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 3289 4236 gene locus_tag LOCUS_11740 3289 4236 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258533.1 protein_id gnl|my_center|LOCUS_11740 4254 5138 gene locus_tag LOCUS_11750 4254 5138 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_11750 5141 6517 gene locus_tag LOCUS_11760 5141 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6662 7993 gene locus_tag LOCUS_11770 6662 7993 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445845.1 protein_id gnl|my_center|LOCUS_11770 8088 9086 gene locus_tag LOCUS_11780 8088 9086 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_11780 9098 10192 gene locus_tag LOCUS_11790 9098 10192 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_11790 10212 12764 gene locus_tag LOCUS_11800 10212 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 14260 12824 gene locus_tag LOCUS_11810 14260 12824 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349804.1 protein_id gnl|my_center|LOCUS_11810 15555 14275 gene locus_tag LOCUS_11820 15555 14275 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_11820 17271 15724 gene locus_tag LOCUS_11830 gene xylB 17271 15724 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_11830 18095 17268 gene locus_tag LOCUS_11840 18095 17268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 18925 18092 gene locus_tag LOCUS_11850 18925 18092 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061489.1 protein_id gnl|my_center|LOCUS_11850 20457 19120 gene locus_tag LOCUS_11860 20457 19120 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894432.1 protein_id gnl|my_center|LOCUS_11860 21308 20535 gene locus_tag LOCUS_11870 21308 20535 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_11870 22063 21305 gene locus_tag LOCUS_11880 22063 21305 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292782.1 protein_id gnl|my_center|LOCUS_11880 23527 22136 gene locus_tag LOCUS_11890 23527 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 24413 23586 gene locus_tag LOCUS_11900 24413 23586 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082987.1 protein_id gnl|my_center|LOCUS_11900 25302 24415 gene locus_tag LOCUS_11910 25302 24415 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213188.1 protein_id gnl|my_center|LOCUS_11910 26863 25385 gene locus_tag LOCUS_11920 26863 25385 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528413.1 protein_id gnl|my_center|LOCUS_11920 28232 27066 gene locus_tag LOCUS_11930 28232 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 29567 28305 gene locus_tag LOCUS_11940 29567 28305 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256990.1 protein_id gnl|my_center|LOCUS_11940 30805 29765 gene locus_tag LOCUS_11950 30805 29765 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259552.1 protein_id gnl|my_center|LOCUS_11950 31823 30723 gene locus_tag LOCUS_11960 31823 30723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11960 32608 31934 gene locus_tag LOCUS_11970 32608 31934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 34027 32654 gene locus_tag LOCUS_11980 34027 32654 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967162.1 protein_id gnl|my_center|LOCUS_11980 34026 34232 gene locus_tag LOCUS_11990 34026 34232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 35243 34290 gene locus_tag LOCUS_12000 35243 34290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 37561 35282 gene locus_tag LOCUS_12010 37561 35282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 38789 37569 gene locus_tag LOCUS_12020 38789 37569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 <40766 38792 gene locus_tag LOCUS_12030 <40766 38792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918570.1:peptidase domain-containing ABC transporter >Feature sequence023 363 548 gene locus_tag LOCUS_12040 363 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 553 1344 gene locus_tag LOCUS_12050 553 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1341 2939 gene locus_tag LOCUS_12060 1341 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2950 3708 gene locus_tag LOCUS_12070 2950 3708 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256806.1 protein_id gnl|my_center|LOCUS_12070 3715 6495 gene locus_tag LOCUS_12080 3715 6495 CDS product interleukin-like EMT inducer domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141609734.1 protein_id gnl|my_center|LOCUS_12080 7293 6496 gene locus_tag LOCUS_12090 7293 6496 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_12090 7324 9234 gene locus_tag LOCUS_12100 7324 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 9231 11000 gene locus_tag LOCUS_12110 9231 11000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257645.1 protein_id gnl|my_center|LOCUS_12110 11543 10995 gene locus_tag LOCUS_12120 11543 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 12459 11560 gene locus_tag LOCUS_12130 12459 11560 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933177.1 protein_id gnl|my_center|LOCUS_12130 12791 15358 gene locus_tag LOCUS_12140 12791 15358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 15466 16497 gene locus_tag LOCUS_12150 15466 16497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868769.1 protein_id gnl|my_center|LOCUS_12150 16663 18903 gene locus_tag LOCUS_12160 16663 18903 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400877.1 protein_id gnl|my_center|LOCUS_12160 19011 20009 gene locus_tag LOCUS_12170 19011 20009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974056.1 protein_id gnl|my_center|LOCUS_12170 20028 21200 gene locus_tag LOCUS_12180 20028 21200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 protein_id gnl|my_center|LOCUS_12180 21259 22275 gene locus_tag LOCUS_12190 21259 22275 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_12190 22278 22838 gene locus_tag LOCUS_12200 22278 22838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 22921 24243 gene locus_tag LOCUS_12210 gene melA 22921 24243 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988031.1 protein_id gnl|my_center|LOCUS_12210 24263 25576 gene locus_tag LOCUS_12220 24263 25576 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_12220 25609 26838 gene locus_tag LOCUS_12230 25609 26838 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_12230 27969 26869 gene locus_tag LOCUS_12240 27969 26869 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_12240 29017 28337 gene locus_tag LOCUS_12250 29017 28337 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_12250 30483 29005 gene locus_tag LOCUS_12260 30483 29005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 31679 31098 gene locus_tag LOCUS_12270 31679 31098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 31810 32109 gene locus_tag LOCUS_12280 31810 32109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 32232 32627 gene locus_tag LOCUS_12290 32232 32627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 33033 32677 gene locus_tag LOCUS_12300 33033 32677 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256335.1 protein_id gnl|my_center|LOCUS_12300 33289 34347 gene locus_tag LOCUS_12310 33289 34347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 34460 35575 gene locus_tag LOCUS_12320 34460 35575 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_12320 35581 36630 gene locus_tag LOCUS_12330 35581 36630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 36665 38209 gene locus_tag LOCUS_12340 36665 38209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_12340 38236 39330 gene locus_tag LOCUS_12350 38236 39330 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_12350 39388 40188 gene locus_tag LOCUS_12360 39388 40188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 40276 40722 gene locus_tag LOCUS_12370 gene ndk 40276 40722 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence024 2063 2857 gene locus_tag LOCUS_12380 2063 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4580 2940 gene locus_tag LOCUS_12390 4580 2940 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256402.1 protein_id gnl|my_center|LOCUS_12390 5267 4761 gene locus_tag LOCUS_12400 5267 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 7120 5411 gene locus_tag LOCUS_12410 7120 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 7377 8924 gene locus_tag LOCUS_12420 gene murJ 7377 8924 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_12420 9123 9812 gene locus_tag LOCUS_12430 9123 9812 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_12430 9976 11163 gene locus_tag LOCUS_12440 9976 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 12307 11174 gene locus_tag LOCUS_12450 12307 11174 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_12450 13879 12326 gene locus_tag LOCUS_12460 13879 12326 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_12460 15071 13920 gene locus_tag LOCUS_12470 15071 13920 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_12470 16210 15068 gene locus_tag LOCUS_12480 16210 15068 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_12480 16362 17867 gene locus_tag LOCUS_12490 16362 17867 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_12490 17946 18890 gene locus_tag LOCUS_12500 17946 18890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 18881 19762 gene locus_tag LOCUS_12510 18881 19762 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976100.1 protein_id gnl|my_center|LOCUS_12510 19860 20582 gene locus_tag LOCUS_12520 19860 20582 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259307.1 protein_id gnl|my_center|LOCUS_12520 20638 21657 gene locus_tag LOCUS_12530 20638 21657 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257661.1 protein_id gnl|my_center|LOCUS_12530 21931 22386 gene locus_tag LOCUS_12540 21931 22386 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_12540 22429 24789 gene locus_tag LOCUS_12550 22429 24789 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_12550 24872 25726 gene locus_tag LOCUS_12560 24872 25726 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_12560 25881 26846 gene locus_tag LOCUS_12570 25881 26846 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_12570 26855 27979 gene locus_tag LOCUS_12580 26855 27979 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_12580 28011 28334 gene locus_tag LOCUS_12590 28011 28334 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088407.1 protein_id gnl|my_center|LOCUS_12590 28331 29068 gene locus_tag LOCUS_12600 28331 29068 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256663.1 protein_id gnl|my_center|LOCUS_12600 29203 29128 gene locus_tag LOCUS_t00190 29203 29128 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 30583 29273 gene locus_tag LOCUS_12610 gene rpoD 30583 29273 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_12610 32585 30606 gene locus_tag LOCUS_12620 32585 30606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 33120 32716 gene locus_tag LOCUS_12630 33120 32716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 34357 33140 gene locus_tag LOCUS_12640 34357 33140 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444448.1 protein_id gnl|my_center|LOCUS_12640 36101 34521 gene locus_tag LOCUS_12650 gene pruA 36101 34521 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 protein_id gnl|my_center|LOCUS_12650 38871 36112 gene locus_tag LOCUS_12660 38871 36112 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228172.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence025 <1 521 gene locus_tag LOCUS_12670 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840085.1:dehydrogenase E1 component subunit alpha/beta 540 1709 gene locus_tag LOCUS_12680 540 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2199 1762 gene locus_tag LOCUS_12690 2199 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 5034 2539 gene locus_tag LOCUS_12700 gene leuS 5034 2539 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_12700 5587 6681 gene locus_tag LOCUS_12710 5587 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 7330 6782 gene locus_tag LOCUS_12720 gene def 7330 6782 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279455.1 protein_id gnl|my_center|LOCUS_12720 7621 8859 gene locus_tag LOCUS_12730 7621 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 10936 8906 gene locus_tag LOCUS_12740 10936 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 11259 11528 gene locus_tag LOCUS_12750 gene rpsO 11259 11528 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257912.1 protein_id gnl|my_center|LOCUS_12750 11925 14195 gene locus_tag LOCUS_12760 gene pnp 11925 14195 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_12760 14092 15264 gene locus_tag LOCUS_12770 14092 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 16920 15382 gene locus_tag LOCUS_12780 16920 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 17998 17012 gene locus_tag LOCUS_12790 17998 17012 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_12790 19300 18113 gene locus_tag LOCUS_12800 19300 18113 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056882.1 protein_id gnl|my_center|LOCUS_12800 19357 19971 gene locus_tag LOCUS_12810 19357 19971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 20122 20754 gene locus_tag LOCUS_12820 20122 20754 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_12820 20794 22143 gene locus_tag LOCUS_12830 gene mtaB 20794 22143 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_12830 26097 22147 gene locus_tag LOCUS_12840 26097 22147 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_12840 26281 27003 gene locus_tag LOCUS_12850 26281 27003 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_12850 27050 27601 gene locus_tag LOCUS_12860 27050 27601 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_12860 27638 28735 gene locus_tag LOCUS_12870 gene prfA 27638 28735 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887065.1 protein_id gnl|my_center|LOCUS_12870 28819 29667 gene locus_tag LOCUS_12880 gene prmC 28819 29667 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_12880 29690 30556 gene locus_tag LOCUS_12890 29690 30556 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_12890 30669 31718 gene locus_tag LOCUS_12900 30669 31718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 31773 32504 gene locus_tag LOCUS_12910 31773 32504 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_12910 32569 32988 gene locus_tag LOCUS_12920 32569 32988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 33004 33765 gene locus_tag LOCUS_12930 33004 33765 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_12930 33825 34790 gene locus_tag LOCUS_12940 33825 34790 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_12940 34894 35748 gene locus_tag LOCUS_12950 34894 35748 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_12950 37634 35760 gene locus_tag LOCUS_12960 gene cysN 37634 35760 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403357.1 protein_id gnl|my_center|LOCUS_12960 38545 37634 gene locus_tag LOCUS_12970 gene cysD 38545 37634 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence026 299 1102 gene locus_tag LOCUS_12980 gene pgeF 299 1102 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839662.1 protein_id gnl|my_center|LOCUS_12980 5416 1412 gene locus_tag LOCUS_12990 5416 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 6361 5453 gene locus_tag LOCUS_13000 6361 5453 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_13000 7667 6402 gene locus_tag LOCUS_13010 gene rspA 7667 6402 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298659.1 protein_id gnl|my_center|LOCUS_13010 8549 7683 gene locus_tag LOCUS_13020 8549 7683 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969289.1 protein_id gnl|my_center|LOCUS_13020 9476 8685 gene locus_tag LOCUS_13030 9476 8685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 9415 9672 gene locus_tag LOCUS_13040 9415 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 11732 9762 gene locus_tag LOCUS_13050 11732 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257782.1 protein_id gnl|my_center|LOCUS_13050 12185 11847 gene locus_tag LOCUS_13060 12185 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 14054 12285 gene locus_tag LOCUS_13070 14054 12285 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 protein_id gnl|my_center|LOCUS_13070 14276 16303 gene locus_tag LOCUS_13080 gene yagF 14276 16303 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_13080 16439 16687 gene locus_tag LOCUS_13090 16439 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 18529 16814 gene locus_tag LOCUS_13100 18529 16814 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063696.1 protein_id gnl|my_center|LOCUS_13100 19971 18538 gene locus_tag LOCUS_13110 19971 18538 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257259.1 protein_id gnl|my_center|LOCUS_13110 21779 19971 gene locus_tag LOCUS_13120 21779 19971 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393370.1 protein_id gnl|my_center|LOCUS_13120 22897 21836 gene locus_tag LOCUS_13130 22897 21836 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_13130 23789 22941 gene locus_tag LOCUS_13140 23789 22941 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_13140 24657 23782 gene locus_tag LOCUS_13150 24657 23782 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085515.1 protein_id gnl|my_center|LOCUS_13150 26095 24794 gene locus_tag LOCUS_13160 26095 24794 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_13160 26394 27419 gene locus_tag LOCUS_13170 26394 27419 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_13170 27571 29340 gene locus_tag LOCUS_13180 27571 29340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 29337 30686 gene locus_tag LOCUS_13190 29337 30686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 30750 32084 gene locus_tag LOCUS_13200 30750 32084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 32273 33430 gene locus_tag LOCUS_13210 32273 33430 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976264.1 protein_id gnl|my_center|LOCUS_13210 33486 34364 gene locus_tag LOCUS_13220 33486 34364 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529194.1 protein_id gnl|my_center|LOCUS_13220 34383 35195 gene locus_tag LOCUS_13230 34383 35195 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720513.1 protein_id gnl|my_center|LOCUS_13230 35234 36298 gene locus_tag LOCUS_13240 35234 36298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529688.1 protein_id gnl|my_center|LOCUS_13240 36406 37056 gene locus_tag LOCUS_13250 36406 37056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence027 1033 1986 gene locus_tag LOCUS_13260 gene ftsY 1033 1986 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723863.1 protein_id gnl|my_center|LOCUS_13260 2079 3131 gene locus_tag LOCUS_13270 gene prfB 2079 3131 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_13270 4229 3213 gene locus_tag LOCUS_13280 gene mgrA 4229 3213 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_13280 5429 4278 gene locus_tag LOCUS_13290 5429 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 5652 6908 gene locus_tag LOCUS_13300 5652 6908 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_13300 7002 8141 gene locus_tag LOCUS_13310 7002 8141 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_13310 8147 9877 gene locus_tag LOCUS_13320 8147 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 9874 10671 gene locus_tag LOCUS_13330 9874 10671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_13330 10721 11425 gene locus_tag LOCUS_13340 10721 11425 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_13340 11461 14532 gene locus_tag LOCUS_13350 11461 14532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 14593 18462 gene locus_tag LOCUS_13360 14593 18462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 18486 19268 gene locus_tag LOCUS_13370 18486 19268 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259072.1 protein_id gnl|my_center|LOCUS_13370 20826 19273 gene locus_tag LOCUS_13380 gene miaB 20826 19273 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583438.1 protein_id gnl|my_center|LOCUS_13380 23330 21093 gene locus_tag LOCUS_13390 23330 21093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 24391 23387 gene locus_tag LOCUS_13400 gene mvaD 24391 23387 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921869.1 protein_id gnl|my_center|LOCUS_13400 24699 24388 gene locus_tag LOCUS_13410 24699 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 25962 24715 gene locus_tag LOCUS_13420 25962 24715 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_13420 26341 26021 gene locus_tag LOCUS_13430 26341 26021 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392756.1 protein_id gnl|my_center|LOCUS_13430 27042 26338 gene locus_tag LOCUS_13440 27042 26338 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368777.1 protein_id gnl|my_center|LOCUS_13440 27824 27039 gene locus_tag LOCUS_13450 27824 27039 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526329.1 protein_id gnl|my_center|LOCUS_13450 27979 29226 gene locus_tag LOCUS_13460 gene xseA 27979 29226 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259569.1 protein_id gnl|my_center|LOCUS_13460 29223 30302 gene locus_tag LOCUS_13470 29223 30302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 30741 30373 gene locus_tag LOCUS_13480 gene rbfA 30741 30373 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874334.1 protein_id gnl|my_center|LOCUS_13480 32285 30756 gene locus_tag LOCUS_13490 32285 30756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13490 32722 32258 gene locus_tag LOCUS_13500 32722 32258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13500 33458 33150 gene locus_tag LOCUS_13510 33458 33150 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258864.1 protein_id gnl|my_center|LOCUS_13510 35216 33510 gene locus_tag LOCUS_13520 35216 33510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 <37400 35408 gene locus_tag LOCUS_13530 <37400 35408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393885.1:peptidoglycan bridge formation glycyltransferase FemA/FemB family protein >Feature sequence028 2257 401 gene locus_tag LOCUS_13540 2257 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 4885 2351 gene locus_tag LOCUS_13550 4885 2351 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_13550 6070 4994 gene locus_tag LOCUS_13560 6070 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 7717 6248 gene locus_tag LOCUS_13570 7717 6248 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_13570 9214 7724 gene locus_tag LOCUS_13580 9214 7724 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_13580 9617 9315 gene locus_tag LOCUS_13590 9617 9315 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681558.1 protein_id gnl|my_center|LOCUS_13590 10017 9625 gene locus_tag LOCUS_13600 10017 9625 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881169.1 protein_id gnl|my_center|LOCUS_13600 10485 10108 gene locus_tag LOCUS_13610 gene erpA 10485 10108 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255939.1 protein_id gnl|my_center|LOCUS_13610 11670 10609 gene locus_tag LOCUS_13620 gene moaA 11670 10609 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257065.1 protein_id gnl|my_center|LOCUS_13620 12433 11678 gene locus_tag LOCUS_13630 12433 11678 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503330.1 protein_id gnl|my_center|LOCUS_13630 12836 12546 gene locus_tag LOCUS_13640 12836 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 13064 12858 gene locus_tag LOCUS_13650 13064 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 14470 13061 gene locus_tag LOCUS_13660 14470 13061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 14762 16474 gene locus_tag LOCUS_13670 gene ade 14762 16474 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338640.1 protein_id gnl|my_center|LOCUS_13670 20736 16588 gene locus_tag LOCUS_13680 20736 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 20906 21718 gene locus_tag LOCUS_13690 20906 21718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 22671 21619 gene locus_tag LOCUS_13700 22671 21619 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584091.1 protein_id gnl|my_center|LOCUS_13700 24641 22755 gene locus_tag LOCUS_13710 24641 22755 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_13710 25622 24699 gene locus_tag LOCUS_13720 25622 24699 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027191.1 protein_id gnl|my_center|LOCUS_13720 26577 25681 gene locus_tag LOCUS_13730 26577 25681 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_13730 27998 26658 gene locus_tag LOCUS_13740 27998 26658 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061827.1 protein_id gnl|my_center|LOCUS_13740 28329 29759 gene locus_tag LOCUS_13750 28329 29759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 29849 30010 gene locus_tag LOCUS_13760 29849 30010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 30025 31209 gene locus_tag LOCUS_13770 gene galK 30025 31209 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_13770 31408 31593 gene locus_tag LOCUS_13780 31408 31593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 31584 32717 gene locus_tag LOCUS_13790 31584 32717 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256474.1 protein_id gnl|my_center|LOCUS_13790 33937 32879 gene locus_tag LOCUS_13800 gene fabD 33937 32879 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147872.1 protein_id gnl|my_center|LOCUS_13800 34182 35498 gene locus_tag LOCUS_13810 34182 35498 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence029 79 2772 gene locus_tag LOCUS_13820 79 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4203 2830 gene locus_tag LOCUS_13830 4203 2830 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_13830 5226 4231 gene locus_tag LOCUS_13840 5226 4231 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_13840 5719 6486 gene locus_tag LOCUS_13850 5719 6486 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_13850 6929 8413 gene locus_tag LOCUS_13860 6929 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 8544 9404 gene locus_tag LOCUS_13870 8544 9404 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531801.1 protein_id gnl|my_center|LOCUS_13870 9417 10271 gene locus_tag LOCUS_13880 9417 10271 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267210.1 protein_id gnl|my_center|LOCUS_13880 10276 10503 gene locus_tag LOCUS_13890 10276 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 10510 11547 gene locus_tag LOCUS_13900 10510 11547 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975043.1 protein_id gnl|my_center|LOCUS_13900 11584 12390 gene locus_tag LOCUS_13910 11584 12390 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083016.1 protein_id gnl|my_center|LOCUS_13910 12423 13433 gene locus_tag LOCUS_13920 12423 13433 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976918.1 protein_id gnl|my_center|LOCUS_13920 13451 14542 gene locus_tag LOCUS_13930 gene gutB 13451 14542 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_13930 14762 16294 gene locus_tag LOCUS_13940 gene xylB 14762 16294 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_13940 16291 17472 gene locus_tag LOCUS_13950 16291 17472 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140504.1 protein_id gnl|my_center|LOCUS_13950 17469 18980 gene locus_tag LOCUS_13960 gene xylB 17469 18980 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_13960 18977 19909 gene locus_tag LOCUS_13970 gene pfkB 18977 19909 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_13970 19953 21038 gene locus_tag LOCUS_13980 19953 21038 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269064.1 protein_id gnl|my_center|LOCUS_13980 21083 21946 gene locus_tag LOCUS_13990 gene aroE 21083 21946 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973723.1 protein_id gnl|my_center|LOCUS_13990 21993 23789 gene locus_tag LOCUS_14000 21993 23789 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582799.1 protein_id gnl|my_center|LOCUS_14000 23865 26987 gene locus_tag LOCUS_14010 23865 26987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 27001 27741 gene locus_tag LOCUS_14020 27001 27741 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_14020 28194 28448 gene locus_tag LOCUS_14030 28194 28448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 29598 28570 gene locus_tag LOCUS_14040 29598 28570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_14040 31160 29610 gene locus_tag LOCUS_14050 gene gguA 31160 29610 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_14050 32255 31239 gene locus_tag LOCUS_14060 32255 31239 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_14060 33565 32519 gene locus_tag LOCUS_14070 33565 32519 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 protein_id gnl|my_center|LOCUS_14070 34657 33611 gene locus_tag LOCUS_14080 34657 33611 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence030 1373 1867 gene locus_tag LOCUS_14090 1373 1867 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257597.1 protein_id gnl|my_center|LOCUS_14090 1864 4098 gene locus_tag LOCUS_14100 1864 4098 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257598.1 protein_id gnl|my_center|LOCUS_14100 5234 4140 gene locus_tag LOCUS_14110 5234 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 5620 5243 gene locus_tag LOCUS_14120 5620 5243 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404257.1 protein_id gnl|my_center|LOCUS_14120 6633 5608 gene locus_tag LOCUS_14130 6633 5608 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404258.1 protein_id gnl|my_center|LOCUS_14130 7973 6630 gene locus_tag LOCUS_14140 gene ribA 7973 6630 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404259.1 protein_id gnl|my_center|LOCUS_14140 8350 7970 gene locus_tag LOCUS_14150 8350 7970 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_14150 8593 9681 gene locus_tag LOCUS_14160 8593 9681 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_14160 9683 10681 gene locus_tag LOCUS_14170 9683 10681 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_14170 10988 12910 gene locus_tag LOCUS_14180 10988 12910 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257042.1 protein_id gnl|my_center|LOCUS_14180 13059 14063 gene locus_tag LOCUS_14190 13059 14063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257041.1 protein_id gnl|my_center|LOCUS_14190 14078 15334 gene locus_tag LOCUS_14200 14078 15334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257040.1 protein_id gnl|my_center|LOCUS_14200 15343 16353 gene locus_tag LOCUS_14210 15343 16353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257039.1 protein_id gnl|my_center|LOCUS_14210 16343 17164 gene locus_tag LOCUS_14220 16343 17164 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257038.1 protein_id gnl|my_center|LOCUS_14220 17379 18254 gene locus_tag LOCUS_14230 17379 18254 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404420.1 protein_id gnl|my_center|LOCUS_14230 18273 19586 gene locus_tag LOCUS_14240 gene lysA 18273 19586 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256477.1 protein_id gnl|my_center|LOCUS_14240 21089 19710 gene locus_tag LOCUS_14250 21089 19710 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258666.1 protein_id gnl|my_center|LOCUS_14250 22066 21086 gene locus_tag LOCUS_14260 22066 21086 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258665.1 protein_id gnl|my_center|LOCUS_14260 22549 22175 gene locus_tag LOCUS_14270 22549 22175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 22822 24081 gene locus_tag LOCUS_14280 gene recA 22822 24081 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388318.1 protein_id gnl|my_center|LOCUS_14280 24113 25081 gene locus_tag LOCUS_14290 24113 25081 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_14290 25167 25931 gene locus_tag LOCUS_14300 25167 25931 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 protein_id gnl|my_center|LOCUS_14300 26033 26812 gene locus_tag LOCUS_14310 26033 26812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_14310 26802 27926 gene locus_tag LOCUS_14320 26802 27926 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_14320 28725 27910 gene locus_tag LOCUS_14330 28725 27910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 28886 31348 gene locus_tag LOCUS_14340 28886 31348 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_14340 32190 34058 gene locus_tag LOCUS_14350 32190 34058 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_14350 <34869 34264 gene locus_tag LOCUS_14360 <34869 34264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113143.1:non-ribosomal peptide synthetase >Feature sequence031 5289 3469 gene locus_tag LOCUS_14370 5289 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 5351 5686 gene locus_tag LOCUS_14380 5351 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 6050 5763 gene locus_tag LOCUS_14390 6050 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 6147 6329 gene locus_tag LOCUS_14400 6147 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 6549 7424 gene locus_tag LOCUS_14410 6549 7424 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922304.1 protein_id gnl|my_center|LOCUS_14410 7450 8451 gene locus_tag LOCUS_14420 7450 8451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389117.1 protein_id gnl|my_center|LOCUS_14420 8511 9518 gene locus_tag LOCUS_14430 8511 9518 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975106.1 protein_id gnl|my_center|LOCUS_14430 9672 10724 gene locus_tag LOCUS_14440 9672 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 10839 11630 gene locus_tag LOCUS_14450 10839 11630 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731543.1 protein_id gnl|my_center|LOCUS_14450 11640 12473 gene locus_tag LOCUS_14460 gene fabG 11640 12473 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_14460 12514 14235 gene locus_tag LOCUS_14470 12514 14235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 14244 14918 gene locus_tag LOCUS_14480 gene fsa 14244 14918 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_14480 14915 15700 gene locus_tag LOCUS_14490 14915 15700 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_14490 15741 16820 gene locus_tag LOCUS_14500 15741 16820 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970710.1 protein_id gnl|my_center|LOCUS_14500 16836 17639 gene locus_tag LOCUS_14510 16836 17639 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066668.1 protein_id gnl|my_center|LOCUS_14510 17688 18677 gene locus_tag LOCUS_14520 17688 18677 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_14520 18690 19439 gene locus_tag LOCUS_14530 18690 19439 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085757.1 protein_id gnl|my_center|LOCUS_14530 20344 19505 gene locus_tag LOCUS_14540 20344 19505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 21568 20348 gene locus_tag LOCUS_14550 21568 20348 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_14550 22480 21605 gene locus_tag LOCUS_14560 22480 21605 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256603.1 protein_id gnl|my_center|LOCUS_14560 23429 22482 gene locus_tag LOCUS_14570 23429 22482 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971595.1 protein_id gnl|my_center|LOCUS_14570 24812 23487 gene locus_tag LOCUS_14580 24812 23487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 25832 25008 gene locus_tag LOCUS_14590 25832 25008 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_14590 27007 25829 gene locus_tag LOCUS_14600 27007 25829 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_14600 28367 27021 gene locus_tag LOCUS_14610 28367 27021 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922239.1 protein_id gnl|my_center|LOCUS_14610 29353 28376 gene locus_tag LOCUS_14620 29353 28376 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_14620 30381 29362 gene locus_tag LOCUS_14630 gene pdhA 30381 29362 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_14630 31214 30483 gene locus_tag LOCUS_14640 31214 30483 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480641.1 protein_id gnl|my_center|LOCUS_14640 32308 31229 gene locus_tag LOCUS_14650 32308 31229 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 protein_id gnl|my_center|LOCUS_14650 32808 32518 gene locus_tag LOCUS_14660 32808 32518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence032 1841 2710 gene locus_tag LOCUS_14670 1841 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2723 3229 gene locus_tag LOCUS_14680 2723 3229 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_14680 3781 4671 gene locus_tag LOCUS_14690 3781 4671 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_14690 4684 5571 gene locus_tag LOCUS_14700 4684 5571 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257156.1 protein_id gnl|my_center|LOCUS_14700 5637 6974 gene locus_tag LOCUS_14710 5637 6974 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257157.1 protein_id gnl|my_center|LOCUS_14710 8072 7215 gene locus_tag LOCUS_14720 8072 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 9516 8218 gene locus_tag LOCUS_14730 9516 8218 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_14730 9825 11843 gene locus_tag LOCUS_14740 9825 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 11779 12726 gene locus_tag LOCUS_14750 11779 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 12836 13255 gene locus_tag LOCUS_14760 12836 13255 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_14760 13373 14296 gene locus_tag LOCUS_14770 13373 14296 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_14770 14818 14492 gene locus_tag LOCUS_14780 14818 14492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 17845 15125 gene locus_tag LOCUS_14790 17845 15125 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126630202.1 protein_id gnl|my_center|LOCUS_14790 18062 19540 gene locus_tag LOCUS_14800 gene mttB 18062 19540 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_14800 19596 21776 gene locus_tag LOCUS_14810 19596 21776 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943374.1 protein_id gnl|my_center|LOCUS_14810 21770 22999 gene locus_tag LOCUS_14820 21770 22999 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124942.1 protein_id gnl|my_center|LOCUS_14820 23144 23452 gene locus_tag LOCUS_14830 23144 23452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 23543 25036 gene locus_tag LOCUS_14840 23543 25036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 25046 25972 gene locus_tag LOCUS_14850 gene galE1 25046 25972 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419610.1 protein_id gnl|my_center|LOCUS_14850 25988 27124 gene locus_tag LOCUS_14860 25988 27124 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_14860 27136 27795 gene locus_tag LOCUS_14870 27136 27795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 27780 28709 gene locus_tag LOCUS_14880 27780 28709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_14880 28706 29623 gene locus_tag LOCUS_14890 28706 29623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_14890 30754 29651 gene locus_tag LOCUS_14900 30754 29651 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775736.1 protein_id gnl|my_center|LOCUS_14900 31671 30754 gene locus_tag LOCUS_14910 31671 30754 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732615.1 protein_id gnl|my_center|LOCUS_14910 32038 33123 gene locus_tag LOCUS_14920 32038 33123 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911638.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence033 4958 2625 gene locus_tag LOCUS_14930 4958 2625 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183692.1 protein_id gnl|my_center|LOCUS_14930 7452 4963 gene locus_tag LOCUS_14940 7452 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 10317 7549 gene locus_tag LOCUS_14950 10317 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 10880 10362 gene locus_tag LOCUS_14960 10880 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 11544 10939 gene locus_tag LOCUS_14970 11544 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 13880 11742 gene locus_tag LOCUS_14980 13880 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 14261 15826 gene locus_tag LOCUS_14990 gene gnd 14261 15826 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_14990 15833 17359 gene locus_tag LOCUS_15000 15833 17359 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777065.1 protein_id gnl|my_center|LOCUS_15000 17392 18834 gene locus_tag LOCUS_15010 17392 18834 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_15010 18831 21365 gene locus_tag LOCUS_15020 18831 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 21411 22973 gene locus_tag LOCUS_15030 21411 22973 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_15030 24161 23013 gene locus_tag LOCUS_15040 24161 23013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 24933 24328 gene locus_tag LOCUS_15050 24933 24328 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_15050 25609 24935 gene locus_tag LOCUS_15060 25609 24935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 26157 25660 gene locus_tag LOCUS_15070 26157 25660 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107788.1 protein_id gnl|my_center|LOCUS_15070 27668 26151 gene locus_tag LOCUS_15080 gene accC 27668 26151 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790279.1 protein_id gnl|my_center|LOCUS_15080 28266 27691 gene locus_tag LOCUS_15090 28266 27691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 29853 28306 gene locus_tag LOCUS_15100 29853 28306 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_15100 30248 29889 gene locus_tag LOCUS_15110 30248 29889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 30426 31274 gene locus_tag LOCUS_15120 30426 31274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence034 674 1837 gene locus_tag LOCUS_15130 674 1837 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_15130 2247 2552 gene locus_tag LOCUS_15140 2247 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2564 4399 gene locus_tag LOCUS_15150 2564 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4418 7186 gene locus_tag LOCUS_15160 4418 7186 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_15160 7376 9175 gene locus_tag LOCUS_15170 7376 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 9284 10147 gene locus_tag LOCUS_15180 9284 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 11128 10163 gene locus_tag LOCUS_15190 11128 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026802.1 protein_id gnl|my_center|LOCUS_15190 11852 11109 gene locus_tag LOCUS_15200 11852 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 12004 13782 gene locus_tag LOCUS_15210 12004 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 13875 14570 gene locus_tag LOCUS_15220 13875 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 14589 15482 gene locus_tag LOCUS_15230 14589 15482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 15512 16285 gene locus_tag LOCUS_15240 15512 16285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 16287 16868 gene locus_tag LOCUS_15250 gene pth 16287 16868 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_15250 16912 20631 gene locus_tag LOCUS_15260 gene mfd 16912 20631 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_15260 21865 20813 gene locus_tag LOCUS_15270 21865 20813 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256144.1 protein_id gnl|my_center|LOCUS_15270 23205 21877 gene locus_tag LOCUS_15280 23205 21877 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_15280 24687 23251 gene locus_tag LOCUS_15290 24687 23251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 25469 24684 gene locus_tag LOCUS_15300 25469 24684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 27160 25469 gene locus_tag LOCUS_15310 27160 25469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 27277 27810 gene locus_tag LOCUS_15320 27277 27810 CDS product glycine/sarcosine/betaine reductase selenoprotein B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255959.1 protein_id gnl|my_center|LOCUS_15320 27916 28119 gene locus_tag LOCUS_15330 27916 28119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 28126 28515 gene locus_tag LOCUS_15340 28126 28515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 28520 30391 gene locus_tag LOCUS_15350 28520 30391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_15350 30891 30457 gene locus_tag LOCUS_15360 30891 30457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence035 324 2312 gene locus_tag LOCUS_15370 324 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 2294 3520 gene locus_tag LOCUS_15380 2294 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 3529 4431 gene locus_tag LOCUS_15390 3529 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 4365 5309 gene locus_tag LOCUS_15400 4365 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 5306 6064 gene locus_tag LOCUS_15410 5306 6064 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324116.1 protein_id gnl|my_center|LOCUS_15410 6057 6665 gene locus_tag LOCUS_15420 6057 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 6662 7369 gene locus_tag LOCUS_15430 6662 7369 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 protein_id gnl|my_center|LOCUS_15430 7347 8480 gene locus_tag LOCUS_15440 7347 8480 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_15440 8477 9607 gene locus_tag LOCUS_15450 8477 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_15450 9627 11594 gene locus_tag LOCUS_15460 9627 11594 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_15460 11649 14537 gene locus_tag LOCUS_15470 11649 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 15597 14728 gene locus_tag LOCUS_15480 15597 14728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 15939 16715 gene locus_tag LOCUS_15490 gene phnF 15939 16715 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_15490 16836 17942 gene locus_tag LOCUS_15500 16836 17942 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_15500 17952 18800 gene locus_tag LOCUS_15510 17952 18800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 18813 19781 gene locus_tag LOCUS_15520 18813 19781 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804460.1 protein_id gnl|my_center|LOCUS_15520 19825 20673 gene locus_tag LOCUS_15530 19825 20673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 20732 22123 gene locus_tag LOCUS_15540 20732 22123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 22190 23104 gene locus_tag LOCUS_15550 22190 23104 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_15550 23163 23999 gene locus_tag LOCUS_15560 23163 23999 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_15560 24006 25076 gene locus_tag LOCUS_15570 24006 25076 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086176.1 protein_id gnl|my_center|LOCUS_15570 25161 26306 gene locus_tag LOCUS_15580 25161 26306 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_15580 26430 28409 gene locus_tag LOCUS_15590 26430 28409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 28406 29905 gene locus_tag LOCUS_15600 28406 29905 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence036 1077 277 gene locus_tag LOCUS_15610 1077 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1222 1830 gene locus_tag LOCUS_15620 1222 1830 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068762.1 protein_id gnl|my_center|LOCUS_15620 4900 1790 gene locus_tag LOCUS_15630 4900 1790 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928763.1 protein_id gnl|my_center|LOCUS_15630 5450 4917 gene locus_tag LOCUS_15640 5450 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 6114 5548 gene locus_tag LOCUS_15650 6114 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 6360 7796 gene locus_tag LOCUS_15660 6360 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257256.1 protein_id gnl|my_center|LOCUS_15660 9090 7840 gene locus_tag LOCUS_15670 9090 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 10553 9093 gene locus_tag LOCUS_15680 10553 9093 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_15680 11760 10564 gene locus_tag LOCUS_15690 11760 10564 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257254.1 protein_id gnl|my_center|LOCUS_15690 13055 11757 gene locus_tag LOCUS_15700 gene wcaK 13055 11757 CDS product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602263.1 protein_id gnl|my_center|LOCUS_15700 14230 13052 gene locus_tag LOCUS_15710 14230 13052 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257254.1 protein_id gnl|my_center|LOCUS_15710 15507 14227 gene locus_tag LOCUS_15720 15507 14227 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_15720 16555 15500 gene locus_tag LOCUS_15730 16555 15500 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_15730 17516 16518 gene locus_tag LOCUS_15740 17516 16518 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_15740 18105 17563 gene locus_tag LOCUS_15750 18105 17563 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259071.1 protein_id gnl|my_center|LOCUS_15750 18886 18170 gene locus_tag LOCUS_15760 18886 18170 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_15760 19133 20248 gene locus_tag LOCUS_15770 19133 20248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258216.1 protein_id gnl|my_center|LOCUS_15770 20248 21075 gene locus_tag LOCUS_15780 20248 21075 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_15780 21145 23610 gene locus_tag LOCUS_15790 21145 23610 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_15790 23660 24466 gene locus_tag LOCUS_15800 23660 24466 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890682.1 protein_id gnl|my_center|LOCUS_15800 26779 24494 gene locus_tag LOCUS_15810 26779 24494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 28743 26776 gene locus_tag LOCUS_15820 28743 26776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 29923 28943 gene locus_tag LOCUS_15830 29923 28943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence037 1477 2400 gene locus_tag LOCUS_15840 1477 2400 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259109.1 protein_id gnl|my_center|LOCUS_15840 2492 4210 gene locus_tag LOCUS_15850 2492 4210 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_15850 4305 5510 gene locus_tag LOCUS_15860 4305 5510 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530099.1 protein_id gnl|my_center|LOCUS_15860 5637 6401 gene locus_tag LOCUS_15870 5637 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 6504 8339 gene locus_tag LOCUS_15880 6504 8339 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_15880 8355 9398 gene locus_tag LOCUS_15890 8355 9398 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_15890 10091 9438 gene locus_tag LOCUS_15900 10091 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 10705 10088 gene locus_tag LOCUS_15910 10705 10088 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_15910 12583 10793 gene locus_tag LOCUS_15920 12583 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_15920 13564 12719 gene locus_tag LOCUS_15930 13564 12719 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088387.1 protein_id gnl|my_center|LOCUS_15930 15069 13561 gene locus_tag LOCUS_15940 gene xylB 15069 13561 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208806.1 protein_id gnl|my_center|LOCUS_15940 16107 15148 gene locus_tag LOCUS_15950 16107 15148 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383771.1 protein_id gnl|my_center|LOCUS_15950 17140 16175 gene locus_tag LOCUS_15960 17140 16175 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383769.1 protein_id gnl|my_center|LOCUS_15960 18680 17127 gene locus_tag LOCUS_15970 18680 17127 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_15970 19039 19911 gene locus_tag LOCUS_15980 19039 19911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 21280 19952 gene locus_tag LOCUS_15990 21280 19952 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_15990 22099 22374 gene locus_tag LOCUS_16000 22099 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 22377 22793 gene locus_tag LOCUS_16010 22377 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 23332 24372 gene locus_tag LOCUS_16020 gene glmD 23332 24372 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250706.1 protein_id gnl|my_center|LOCUS_16020 24384 25373 gene locus_tag LOCUS_16030 24384 25373 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_16030 25444 26673 gene locus_tag LOCUS_16040 25444 26673 CDS product class II D-tagatose-bisphosphate aldolase, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839470.1 protein_id gnl|my_center|LOCUS_16040 26719 28422 gene locus_tag LOCUS_16050 26719 28422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 28479 29354 gene locus_tag LOCUS_16060 28479 29354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence038 1074 2291 gene locus_tag LOCUS_16070 1074 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258134.1 protein_id gnl|my_center|LOCUS_16070 2308 3918 gene locus_tag LOCUS_16080 2308 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258135.1 protein_id gnl|my_center|LOCUS_16080 3905 4567 gene locus_tag LOCUS_16090 3905 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258136.1 protein_id gnl|my_center|LOCUS_16090 4564 6210 gene locus_tag LOCUS_16100 gene csx10 4564 6210 CDS product CRISPR-associated RAMP protein Csx10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258137.1 protein_id gnl|my_center|LOCUS_16100 6207 7673 gene locus_tag LOCUS_16110 6207 7673 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258138.1 protein_id gnl|my_center|LOCUS_16110 7670 8248 gene locus_tag LOCUS_16120 gene csx19 7670 8248 CDS product CRISPR-associated protein Csx19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258139.1 protein_id gnl|my_center|LOCUS_16120 8245 10656 gene locus_tag LOCUS_16130 8245 10656 CDS product TIGR03986 family CRISPR-associated RAMP protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258140.1 protein_id gnl|my_center|LOCUS_16130 11219 11620 gene locus_tag LOCUS_16140 11219 11620 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_16140 11821 12327 gene locus_tag LOCUS_16150 gene rplI 11821 12327 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256838.1 protein_id gnl|my_center|LOCUS_16150 13757 12357 gene locus_tag LOCUS_16160 13757 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 14977 13754 gene locus_tag LOCUS_16170 gene aroA 14977 13754 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_16170 15305 16123 gene locus_tag LOCUS_16180 15305 16123 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_16180 16477 18252 gene locus_tag LOCUS_16190 16477 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 19328 18219 gene locus_tag LOCUS_16200 19328 18219 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_16200 20240 19359 gene locus_tag LOCUS_16210 20240 19359 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256104.1 protein_id gnl|my_center|LOCUS_16210 21072 20275 gene locus_tag LOCUS_16220 21072 20275 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_16220 22018 21059 gene locus_tag LOCUS_16230 22018 21059 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_16230 22195 22932 gene locus_tag LOCUS_16240 22195 22932 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804409.1 protein_id gnl|my_center|LOCUS_16240 23236 24456 gene locus_tag LOCUS_16250 23236 24456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 24551 27271 gene locus_tag LOCUS_16260 24551 27271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence039 176 1006 gene locus_tag LOCUS_16270 176 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1099 3300 gene locus_tag LOCUS_16280 1099 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 5156 3351 gene locus_tag LOCUS_16290 5156 3351 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_16290 6159 5275 gene locus_tag LOCUS_16300 6159 5275 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976274.1 protein_id gnl|my_center|LOCUS_16300 7110 6187 gene locus_tag LOCUS_16310 7110 6187 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530525.1 protein_id gnl|my_center|LOCUS_16310 8471 7182 gene locus_tag LOCUS_16320 8471 7182 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530526.1 protein_id gnl|my_center|LOCUS_16320 9592 8582 gene locus_tag LOCUS_16330 9592 8582 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498680.1 protein_id gnl|my_center|LOCUS_16330 10765 9695 gene locus_tag LOCUS_16340 10765 9695 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_16340 12101 10770 gene locus_tag LOCUS_16350 12101 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 14002 12098 gene locus_tag LOCUS_16360 14002 12098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257581.1 protein_id gnl|my_center|LOCUS_16360 15924 13999 gene locus_tag LOCUS_16370 15924 13999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_16370 16159 17517 gene locus_tag LOCUS_16380 16159 17517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 18223 17525 gene locus_tag LOCUS_16390 18223 17525 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_16390 18398 19393 gene locus_tag LOCUS_16400 18398 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 19400 21355 gene locus_tag LOCUS_16410 19400 21355 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256605.1 protein_id gnl|my_center|LOCUS_16410 21372 22700 gene locus_tag LOCUS_16420 21372 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257476.1 protein_id gnl|my_center|LOCUS_16420 22700 23701 gene locus_tag LOCUS_16430 22700 23701 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258568.1 protein_id gnl|my_center|LOCUS_16430 23759 24535 gene locus_tag LOCUS_16440 23759 24535 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258938.1 protein_id gnl|my_center|LOCUS_16440 27210 24502 gene locus_tag LOCUS_16450 27210 24502 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055983.1 protein_id gnl|my_center|LOCUS_16450 28592 27222 gene locus_tag LOCUS_16460 28592 27222 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055915.1 protein_id gnl|my_center|LOCUS_16460 <29466 28644 gene locus_tag LOCUS_16470 <29466 28644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196365.1:GNAT family protein >Feature sequence040 2494 668 gene locus_tag LOCUS_16480 2494 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3358 2543 gene locus_tag LOCUS_16490 3358 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 4827 3403 gene locus_tag LOCUS_16500 4827 3403 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812304.1 protein_id gnl|my_center|LOCUS_16500 6027 5044 gene locus_tag LOCUS_16510 6027 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 7096 6041 gene locus_tag LOCUS_16520 7096 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 8271 7111 gene locus_tag LOCUS_16530 8271 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 10512 8443 gene locus_tag LOCUS_16540 10512 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 10888 10682 gene locus_tag LOCUS_16550 10888 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 11548 11000 gene locus_tag LOCUS_16560 11548 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 13807 11576 gene locus_tag LOCUS_16570 13807 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 14698 13925 gene locus_tag LOCUS_16580 14698 13925 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945815.1 protein_id gnl|my_center|LOCUS_16580 15837 14752 gene locus_tag LOCUS_16590 15837 14752 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614684.1 protein_id gnl|my_center|LOCUS_16590 16772 15894 gene locus_tag LOCUS_16600 16772 15894 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226328.1 protein_id gnl|my_center|LOCUS_16600 21924 16756 gene locus_tag LOCUS_16610 21924 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 22643 21972 gene locus_tag LOCUS_16620 22643 21972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 23931 22645 gene locus_tag LOCUS_16630 23931 22645 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_16630 24237 23950 gene locus_tag LOCUS_16640 24237 23950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 25644 24388 gene locus_tag LOCUS_16650 25644 24388 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731523.1 protein_id gnl|my_center|LOCUS_16650 26802 25678 gene locus_tag LOCUS_16660 26802 25678 CDS product TLR2-mediated response inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419222.1 protein_id gnl|my_center|LOCUS_16660 28591 26825 gene locus_tag LOCUS_16670 28591 26825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 29027 28653 gene locus_tag LOCUS_16680 29027 28653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence041 68 1474 gene locus_tag LOCUS_16690 68 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2606 1494 gene locus_tag LOCUS_16700 gene mltG 2606 1494 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_16700 3553 2606 gene locus_tag LOCUS_16710 3553 2606 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_16710 4498 3608 gene locus_tag LOCUS_16720 4498 3608 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228241.1 protein_id gnl|my_center|LOCUS_16720 5022 4537 gene locus_tag LOCUS_16730 5022 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 6424 4991 gene locus_tag LOCUS_16740 gene lpdA 6424 4991 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085912.1 protein_id gnl|my_center|LOCUS_16740 7609 6443 gene locus_tag LOCUS_16750 7609 6443 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969740.1 protein_id gnl|my_center|LOCUS_16750 8575 7619 gene locus_tag LOCUS_16760 8575 7619 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102952112.1 protein_id gnl|my_center|LOCUS_16760 8993 8616 gene locus_tag LOCUS_16770 8993 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 9761 9009 gene locus_tag LOCUS_16780 9761 9009 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_16780 11014 9767 gene locus_tag LOCUS_16790 11014 9767 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_16790 12466 11033 gene locus_tag LOCUS_16800 12466 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 13716 12598 gene locus_tag LOCUS_16810 13716 12598 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_16810 14205 15230 gene locus_tag LOCUS_16820 14205 15230 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_16820 15295 17232 gene locus_tag LOCUS_16830 15295 17232 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082579.1 protein_id gnl|my_center|LOCUS_16830 17332 18336 gene locus_tag LOCUS_16840 17332 18336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082581.1 protein_id gnl|my_center|LOCUS_16840 18351 19205 gene locus_tag LOCUS_16850 18351 19205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584068.1 protein_id gnl|my_center|LOCUS_16850 19211 20218 gene locus_tag LOCUS_16860 19211 20218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041426669.1 protein_id gnl|my_center|LOCUS_16860 20202 21164 gene locus_tag LOCUS_16870 20202 21164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082591.1 protein_id gnl|my_center|LOCUS_16870 21288 22268 gene locus_tag LOCUS_16880 21288 22268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257044.1 protein_id gnl|my_center|LOCUS_16880 22252 23325 gene locus_tag LOCUS_16890 22252 23325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887741.1 protein_id gnl|my_center|LOCUS_16890 23334 24947 gene locus_tag LOCUS_16900 23334 24947 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529813.1 protein_id gnl|my_center|LOCUS_16900 24974 26584 gene locus_tag LOCUS_16910 24974 26584 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 protein_id gnl|my_center|LOCUS_16910 26639 27565 gene locus_tag LOCUS_16920 26639 27565 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence042 1581 199 gene locus_tag LOCUS_16930 gene argH 1581 199 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938393.1 protein_id gnl|my_center|LOCUS_16930 2570 1593 gene locus_tag LOCUS_16940 2570 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3857 2610 gene locus_tag LOCUS_16950 3857 2610 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_16950 5530 4076 gene locus_tag LOCUS_16960 gene gatA 5530 4076 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_16960 5822 5532 gene locus_tag LOCUS_16970 gene gatC 5822 5532 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257310.1 protein_id gnl|my_center|LOCUS_16970 6180 7061 gene locus_tag LOCUS_16980 gene focA 6180 7061 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263633.1 protein_id gnl|my_center|LOCUS_16980 7232 7525 gene locus_tag LOCUS_16990 7232 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 7605 8051 gene locus_tag LOCUS_17000 7605 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 8058 10385 gene locus_tag LOCUS_17010 8058 10385 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143631.1 protein_id gnl|my_center|LOCUS_17010 10624 10974 gene locus_tag LOCUS_17020 10624 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 12155 10956 gene locus_tag LOCUS_17030 12155 10956 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_17030 13212 12244 gene locus_tag LOCUS_17040 13212 12244 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227995.1 protein_id gnl|my_center|LOCUS_17040 13483 14022 gene locus_tag LOCUS_17050 13483 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 14019 14246 gene locus_tag LOCUS_17060 14019 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 14402 15001 gene locus_tag LOCUS_17070 14402 15001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 15584 15072 gene locus_tag LOCUS_17080 15584 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 17001 15550 gene locus_tag LOCUS_17090 gene tilS 17001 15550 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_17090 17399 18466 gene locus_tag LOCUS_17100 17399 18466 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_17100 18494 19420 gene locus_tag LOCUS_17110 gene mreC 18494 19420 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_17110 19417 19932 gene locus_tag LOCUS_17120 19417 19932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 19955 22159 gene locus_tag LOCUS_17130 19955 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 22170 23321 gene locus_tag LOCUS_17140 22170 23321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 23323 24114 gene locus_tag LOCUS_17150 gene minD 23323 24114 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_17150 24115 25296 gene locus_tag LOCUS_17160 24115 25296 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256594.1 protein_id gnl|my_center|LOCUS_17160 26018 25293 gene locus_tag LOCUS_17170 26018 25293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 26233 26943 gene locus_tag LOCUS_17180 gene radC 26233 26943 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_17180 27437 26982 gene locus_tag LOCUS_17190 27437 26982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence043 332 997 gene locus_tag LOCUS_17200 332 997 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257401.1 protein_id gnl|my_center|LOCUS_17200 1022 2443 gene locus_tag LOCUS_17210 gene clpX 1022 2443 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056361.1 protein_id gnl|my_center|LOCUS_17210 3600 2482 gene locus_tag LOCUS_17220 gene mutY 3600 2482 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_17220 4581 4198 gene locus_tag LOCUS_17230 4581 4198 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227852.1 protein_id gnl|my_center|LOCUS_17230 4744 6300 gene locus_tag LOCUS_17240 4744 6300 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_17240 6356 7006 gene locus_tag LOCUS_17250 6356 7006 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970384.1 protein_id gnl|my_center|LOCUS_17250 7057 8142 gene locus_tag LOCUS_17260 7057 8142 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_17260 9416 8259 gene locus_tag LOCUS_17270 9416 8259 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392231.1 protein_id gnl|my_center|LOCUS_17270 10758 9427 gene locus_tag LOCUS_17280 10758 9427 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897229.1 protein_id gnl|my_center|LOCUS_17280 11788 10769 gene locus_tag LOCUS_17290 11788 10769 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101156.1 protein_id gnl|my_center|LOCUS_17290 12854 11808 gene locus_tag LOCUS_17300 gene mer 12854 11808 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_17300 13200 12910 gene locus_tag LOCUS_17310 13200 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 13969 13238 gene locus_tag LOCUS_17320 gene fabG 13969 13238 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_17320 14963 13974 gene locus_tag LOCUS_17330 gene mch 14963 13974 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871160.1 protein_id gnl|my_center|LOCUS_17330 15755 14973 gene locus_tag LOCUS_17340 15755 14973 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522426.1 protein_id gnl|my_center|LOCUS_17340 16873 15881 gene locus_tag LOCUS_17350 16873 15881 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_17350 17853 16870 gene locus_tag LOCUS_17360 17853 16870 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105362.1 protein_id gnl|my_center|LOCUS_17360 20799 17866 gene locus_tag LOCUS_17370 20799 17866 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817476.1 protein_id gnl|my_center|LOCUS_17370 21606 20812 gene locus_tag LOCUS_17380 21606 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 21950 22561 gene locus_tag LOCUS_17390 21950 22561 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393500.1 protein_id gnl|my_center|LOCUS_17390 22578 23981 gene locus_tag LOCUS_17400 22578 23981 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_17400 24120 26384 gene locus_tag LOCUS_17410 24120 26384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 26487 26684 gene locus_tag LOCUS_17420 26487 26684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 26681 26920 gene locus_tag LOCUS_17430 26681 26920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence044 1141 347 gene locus_tag LOCUS_17440 1141 347 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542174.1 protein_id gnl|my_center|LOCUS_17440 1470 1138 gene locus_tag LOCUS_17450 1470 1138 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393501.1 protein_id gnl|my_center|LOCUS_17450 2260 1511 gene locus_tag LOCUS_17460 2260 1511 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250757.1 protein_id gnl|my_center|LOCUS_17460 3093 2323 gene locus_tag LOCUS_17470 3093 2323 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_17470 4801 3164 gene locus_tag LOCUS_17480 4801 3164 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258651.1 protein_id gnl|my_center|LOCUS_17480 4960 5847 gene locus_tag LOCUS_17490 4960 5847 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_17490 5975 7375 gene locus_tag LOCUS_17500 gene purD 5975 7375 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_17500 7372 8010 gene locus_tag LOCUS_17510 gene purN 7372 8010 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037918.1 protein_id gnl|my_center|LOCUS_17510 8018 9130 gene locus_tag LOCUS_17520 8018 9130 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_17520 11497 9170 gene locus_tag LOCUS_17530 11497 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 12413 11541 gene locus_tag LOCUS_17540 gene sucD 12413 11541 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256597.1 protein_id gnl|my_center|LOCUS_17540 13552 12410 gene locus_tag LOCUS_17550 gene sucC 13552 12410 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_17550 14218 13703 gene locus_tag LOCUS_17560 14218 13703 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_17560 15408 14215 gene locus_tag LOCUS_17570 15408 14215 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_17570 15740 16954 gene locus_tag LOCUS_17580 15740 16954 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564393.1 protein_id gnl|my_center|LOCUS_17580 17091 19334 gene locus_tag LOCUS_17590 17091 19334 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_17590 19450 20721 gene locus_tag LOCUS_17600 19450 20721 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103048.1 protein_id gnl|my_center|LOCUS_17600 20759 21544 gene locus_tag LOCUS_17610 20759 21544 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_17610 22265 21573 gene locus_tag LOCUS_17620 22265 21573 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_17620 22499 23845 gene locus_tag LOCUS_17630 gene hisZ 22499 23845 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_17630 23842 24552 gene locus_tag LOCUS_17640 gene hisG 23842 24552 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_17640 24536 25072 gene locus_tag LOCUS_17650 gene rfbC 24536 25072 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228846.1 protein_id gnl|my_center|LOCUS_17650 25197 26084 gene locus_tag LOCUS_17660 gene mtnP 25197 26084 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_17660 26207 26368 gene locus_tag LOCUS_17670 gene rpmG 26207 26368 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256375.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence045 3390 7661 gene locus_tag LOCUS_17680 3390 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 8424 7720 gene locus_tag LOCUS_17690 gene cysE 8424 7720 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_17690 9242 8463 gene locus_tag LOCUS_17700 9242 8463 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528365.1 protein_id gnl|my_center|LOCUS_17700 10265 9273 gene locus_tag LOCUS_17710 gene iolG 10265 9273 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919173.1 protein_id gnl|my_center|LOCUS_17710 11192 10356 gene locus_tag LOCUS_17720 gene iolI 11192 10356 CDS product 2-keto-myo-inositol isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244546.1 protein_id gnl|my_center|LOCUS_17720 12232 11222 gene locus_tag LOCUS_17730 gene iolG 12232 11222 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 protein_id gnl|my_center|LOCUS_17730 13180 12272 gene locus_tag LOCUS_17740 gene iolE 13180 12272 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192432.1 protein_id gnl|my_center|LOCUS_17740 14379 13207 gene locus_tag LOCUS_17750 14379 13207 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_17750 15687 14467 gene locus_tag LOCUS_17760 15687 14467 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970271.1 protein_id gnl|my_center|LOCUS_17760 16559 15684 gene locus_tag LOCUS_17770 16559 15684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 17602 16598 gene locus_tag LOCUS_17780 17602 16598 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209904.1 protein_id gnl|my_center|LOCUS_17780 19234 17726 gene locus_tag LOCUS_17790 19234 17726 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972980.1 protein_id gnl|my_center|LOCUS_17790 20354 19368 gene locus_tag LOCUS_17800 20354 19368 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969895.1 protein_id gnl|my_center|LOCUS_17800 22077 20605 gene locus_tag LOCUS_17810 22077 20605 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_17810 24005 22116 gene locus_tag LOCUS_17820 gene iolD 24005 22116 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_17820 24951 24037 gene locus_tag LOCUS_17830 gene iolB 24951 24037 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196071.1 protein_id gnl|my_center|LOCUS_17830 26059 24986 gene locus_tag LOCUS_17840 26059 24986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 26769 26323 gene locus_tag LOCUS_17850 26769 26323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 26671 26937 gene locus_tag LOCUS_17860 26671 26937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence046 <1 1081 gene locus_tag LOCUS_17870 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028423.1:S41 family peptidase 1272 3434 gene locus_tag LOCUS_17880 1272 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4556 3330 gene locus_tag LOCUS_17890 4556 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4862 6199 gene locus_tag LOCUS_17900 4862 6199 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_17900 6267 7172 gene locus_tag LOCUS_17910 6267 7172 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 protein_id gnl|my_center|LOCUS_17910 7175 8071 gene locus_tag LOCUS_17920 gene araQ 7175 8071 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_17920 8087 9553 gene locus_tag LOCUS_17930 8087 9553 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082990.1 protein_id gnl|my_center|LOCUS_17930 9926 11197 gene locus_tag LOCUS_17940 9926 11197 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259268.1 protein_id gnl|my_center|LOCUS_17940 11402 15424 gene locus_tag LOCUS_17950 11402 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 15421 17277 gene locus_tag LOCUS_17960 15421 17277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 17264 22231 gene locus_tag LOCUS_17970 17264 22231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 22296 23528 gene locus_tag LOCUS_17980 22296 23528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 24530 23682 gene locus_tag LOCUS_17990 24530 23682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence047 552 2231 gene locus_tag LOCUS_18000 gene ettA 552 2231 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_18000 3203 2277 gene locus_tag LOCUS_18010 3203 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3964 3272 gene locus_tag LOCUS_18020 3964 3272 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_18020 5556 3961 gene locus_tag LOCUS_18030 5556 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 6852 5617 gene locus_tag LOCUS_18040 6852 5617 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062121.1 protein_id gnl|my_center|LOCUS_18040 8125 6884 gene locus_tag LOCUS_18050 8125 6884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223277.1 protein_id gnl|my_center|LOCUS_18050 8478 9476 gene locus_tag LOCUS_18060 8478 9476 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 protein_id gnl|my_center|LOCUS_18060 9575 11026 gene locus_tag LOCUS_18070 9575 11026 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173996.1 protein_id gnl|my_center|LOCUS_18070 11196 12269 gene locus_tag LOCUS_18080 11196 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 12259 13125 gene locus_tag LOCUS_18090 12259 13125 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888075.1 protein_id gnl|my_center|LOCUS_18090 13915 13115 gene locus_tag LOCUS_18100 13915 13115 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_18100 15038 13899 gene locus_tag LOCUS_18110 15038 13899 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_18110 15195 15542 gene locus_tag LOCUS_18120 15195 15542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 15535 17151 gene locus_tag LOCUS_18130 15535 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 17155 17961 gene locus_tag LOCUS_18140 17155 17961 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_18140 18612 18004 gene locus_tag LOCUS_18150 gene xpt 18612 18004 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888255.1 protein_id gnl|my_center|LOCUS_18150 20756 18633 gene locus_tag LOCUS_18160 20756 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 21759 20773 gene locus_tag LOCUS_18170 21759 20773 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_18170 22771 21785 gene locus_tag LOCUS_18180 gene truB 22771 21785 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_18180 23775 22783 gene locus_tag LOCUS_18190 23775 22783 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_18190 24551 23775 gene locus_tag LOCUS_18200 24551 23775 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394731.1 protein_id gnl|my_center|LOCUS_18200 24758 24555 gene locus_tag LOCUS_18210 24758 24555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 24983 25056 gene locus_tag LOCUS_t00200 24983 25056 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 818 306 gene locus_tag LOCUS_18220 818 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1196 2536 gene locus_tag LOCUS_18230 1196 2536 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_18230 3130 2597 gene locus_tag LOCUS_18240 3130 2597 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947340.1 protein_id gnl|my_center|LOCUS_18240 4134 3127 gene locus_tag LOCUS_18250 4134 3127 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228820.1 protein_id gnl|my_center|LOCUS_18250 4307 7252 gene locus_tag LOCUS_18260 4307 7252 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_18260 9145 7262 gene locus_tag LOCUS_18270 9145 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 9402 11633 gene locus_tag LOCUS_18280 9402 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 11667 12635 gene locus_tag LOCUS_18290 11667 12635 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067691.1 protein_id gnl|my_center|LOCUS_18290 13672 12728 gene locus_tag LOCUS_18300 gene mmuM 13672 12728 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909348.1 protein_id gnl|my_center|LOCUS_18300 14175 13669 gene locus_tag LOCUS_18310 14175 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 14912 14322 gene locus_tag LOCUS_18320 14912 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 16174 14909 gene locus_tag LOCUS_18330 16174 14909 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_18330 16358 17218 gene locus_tag LOCUS_18340 16358 17218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 17240 18034 gene locus_tag LOCUS_18350 17240 18034 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 protein_id gnl|my_center|LOCUS_18350 18647 19777 gene locus_tag LOCUS_18360 18647 19777 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886737.1 protein_id gnl|my_center|LOCUS_18360 19767 21263 gene locus_tag LOCUS_18370 gene crtI 19767 21263 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_18370 21474 22106 gene locus_tag LOCUS_18380 21474 22106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 22114 22557 gene locus_tag LOCUS_18390 22114 22557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256633.1 protein_id gnl|my_center|LOCUS_18390 22541 23593 gene locus_tag LOCUS_18400 22541 23593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 24926 23553 gene locus_tag LOCUS_18410 24926 23553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence049 452 3037 gene locus_tag LOCUS_18420 452 3037 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257113.1 protein_id gnl|my_center|LOCUS_18420 3131 4507 gene locus_tag LOCUS_18430 gene hydA 3131 4507 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895004.1 protein_id gnl|my_center|LOCUS_18430 4504 6027 gene locus_tag LOCUS_18440 gene murJ 4504 6027 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392512.1 protein_id gnl|my_center|LOCUS_18440 6211 6606 gene locus_tag LOCUS_18450 6211 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 6685 8379 gene locus_tag LOCUS_18460 gene ilvD 6685 8379 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 protein_id gnl|my_center|LOCUS_18460 8642 8875 gene locus_tag LOCUS_18470 8642 8875 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_18470 8945 10018 gene locus_tag LOCUS_18480 8945 10018 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_18480 10085 10834 gene locus_tag LOCUS_18490 10085 10834 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_18490 10844 11404 gene locus_tag LOCUS_18500 10844 11404 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_18500 11488 12336 gene locus_tag LOCUS_18510 11488 12336 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331327.1 protein_id gnl|my_center|LOCUS_18510 12460 13497 gene locus_tag LOCUS_18520 gene ilvC 12460 13497 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_18520 13494 14267 gene locus_tag LOCUS_18530 13494 14267 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_18530 14303 15616 gene locus_tag LOCUS_18540 14303 15616 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_18540 17028 15817 gene locus_tag LOCUS_18550 17028 15817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 17878 17201 gene locus_tag LOCUS_18560 17878 17201 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_18560 18643 18002 gene locus_tag LOCUS_18570 18643 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 18821 21457 gene locus_tag LOCUS_18580 18821 21457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 21445 23334 gene locus_tag LOCUS_18590 21445 23334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 23394 24203 gene locus_tag LOCUS_18600 23394 24203 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258201.1 protein_id gnl|my_center|LOCUS_18600 24288 24740 gene locus_tag LOCUS_18610 gene dtd 24288 24740 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence050 1102 479 gene locus_tag LOCUS_18620 1102 479 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_18620 2552 3124 gene locus_tag LOCUS_18630 2552 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 3237 4361 gene locus_tag LOCUS_18640 3237 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 4514 5302 gene locus_tag LOCUS_18650 4514 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 5295 6515 gene locus_tag LOCUS_18660 5295 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 6520 7326 gene locus_tag LOCUS_18670 6520 7326 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_18670 7374 8396 gene locus_tag LOCUS_18680 7374 8396 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_18680 9901 8423 gene locus_tag LOCUS_18690 9901 8423 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_18690 10850 9945 gene locus_tag LOCUS_18700 10850 9945 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_18700 10984 11727 gene locus_tag LOCUS_18710 10984 11727 CDS product putative folate metabolism gamma-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883397.1 protein_id gnl|my_center|LOCUS_18710 13113 11755 gene locus_tag LOCUS_18720 13113 11755 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_18720 14511 13144 gene locus_tag LOCUS_18730 14511 13144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 15033 15632 gene locus_tag LOCUS_18740 15033 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 15674 16414 gene locus_tag LOCUS_18750 15674 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 16641 17531 gene locus_tag LOCUS_18760 16641 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 17855 19144 gene locus_tag LOCUS_18770 17855 19144 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_18770 19158 19637 gene locus_tag LOCUS_18780 gene smpB 19158 19637 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_18780 19627 20325 gene locus_tag LOCUS_18790 19627 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18790 20322 20720 gene locus_tag LOCUS_18800 20322 20720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18800 20713 21552 gene locus_tag LOCUS_18810 20713 21552 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258699.1 protein_id gnl|my_center|LOCUS_18810 21549 22466 gene locus_tag LOCUS_18820 21549 22466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence051 446 928 gene locus_tag LOCUS_18830 446 928 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_18830 3901 986 gene locus_tag LOCUS_18840 3901 986 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_18840 4685 3939 gene locus_tag LOCUS_18850 4685 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 6089 4713 gene locus_tag LOCUS_18860 6089 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 6348 6794 gene locus_tag LOCUS_18870 6348 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 8042 7098 gene locus_tag LOCUS_18880 8042 7098 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_18880 8253 9266 gene locus_tag LOCUS_18890 8253 9266 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009927050.1 protein_id gnl|my_center|LOCUS_18890 9357 10745 gene locus_tag LOCUS_18900 9357 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 10851 11723 gene locus_tag LOCUS_18910 10851 11723 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030240.1 protein_id gnl|my_center|LOCUS_18910 11735 12619 gene locus_tag LOCUS_18920 11735 12619 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976934.1 protein_id gnl|my_center|LOCUS_18920 12653 13678 gene locus_tag LOCUS_18930 12653 13678 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_18930 13705 15051 gene locus_tag LOCUS_18940 13705 15051 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_18940 15055 15804 gene locus_tag LOCUS_18950 15055 15804 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_18950 15825 16601 gene locus_tag LOCUS_18960 15825 16601 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973645.1 protein_id gnl|my_center|LOCUS_18960 16942 16673 gene locus_tag LOCUS_18970 16942 16673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 16941 19007 gene locus_tag LOCUS_18980 16941 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 19052 20041 gene locus_tag LOCUS_18990 19052 20041 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_18990 20038 21258 gene locus_tag LOCUS_19000 20038 21258 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257931.1 protein_id gnl|my_center|LOCUS_19000 21283 21747 gene locus_tag LOCUS_19010 21283 21747 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597552.1 protein_id gnl|my_center|LOCUS_19010 21902 22999 gene locus_tag LOCUS_19020 21902 22999 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_19020 24304 23726 gene locus_tag LOCUS_19030 24304 23726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence052 77 280 gene locus_tag LOCUS_19040 77 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1067 315 gene locus_tag LOCUS_19050 1067 315 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_19050 1300 1073 gene locus_tag LOCUS_19060 1300 1073 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909342.1 protein_id gnl|my_center|LOCUS_19060 2169 1339 gene locus_tag LOCUS_19070 2169 1339 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052303786.1 protein_id gnl|my_center|LOCUS_19070 2419 3888 gene locus_tag LOCUS_19080 2419 3888 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_19080 3922 4245 gene locus_tag LOCUS_19090 3922 4245 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258148.1 protein_id gnl|my_center|LOCUS_19090 4410 4802 gene locus_tag LOCUS_19100 4410 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 5596 4799 gene locus_tag LOCUS_19110 5596 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 6600 5608 gene locus_tag LOCUS_19120 6600 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 7435 6644 gene locus_tag LOCUS_19130 7435 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 8883 7483 gene locus_tag LOCUS_19140 gene betC 8883 7483 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114636.1 protein_id gnl|my_center|LOCUS_19140 9734 8940 gene locus_tag LOCUS_19150 9734 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 10823 9750 gene locus_tag LOCUS_19160 10823 9750 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_19160 11494 10820 gene locus_tag LOCUS_19170 11494 10820 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222360.1 protein_id gnl|my_center|LOCUS_19170 12520 11522 gene locus_tag LOCUS_19180 12520 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 14639 12552 gene locus_tag LOCUS_19190 14639 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 15612 14581 gene locus_tag LOCUS_19200 15612 14581 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_19200 16646 15609 gene locus_tag LOCUS_19210 16646 15609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 protein_id gnl|my_center|LOCUS_19210 17871 16687 gene locus_tag LOCUS_19220 17871 16687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082547.1 protein_id gnl|my_center|LOCUS_19220 18866 17868 gene locus_tag LOCUS_19230 18866 17868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970413.1 protein_id gnl|my_center|LOCUS_19230 18850 19065 gene locus_tag LOCUS_19240 18850 19065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 21059 19014 gene locus_tag LOCUS_19250 21059 19014 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080420.1 protein_id gnl|my_center|LOCUS_19250 22450 21509 gene locus_tag LOCUS_19260 22450 21509 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_19260 23223 22450 gene locus_tag LOCUS_19270 23223 22450 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804151.1 protein_id gnl|my_center|LOCUS_19270 <24234 23455 gene locus_tag LOCUS_19280 <24234 23455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530916.1:ABC transporter substrate-binding protein >Feature sequence053 1395 496 gene locus_tag LOCUS_19290 1395 496 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257667.1 protein_id gnl|my_center|LOCUS_19290 2079 1402 gene locus_tag LOCUS_19300 2079 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2406 3440 gene locus_tag LOCUS_19310 gene argC 2406 3440 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259290.1 protein_id gnl|my_center|LOCUS_19310 3452 4240 gene locus_tag LOCUS_19320 gene argB 3452 4240 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259245.1 protein_id gnl|my_center|LOCUS_19320 4302 5528 gene locus_tag LOCUS_19330 4302 5528 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257809.1 protein_id gnl|my_center|LOCUS_19330 5556 6140 gene locus_tag LOCUS_19340 5556 6140 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038039476.1 protein_id gnl|my_center|LOCUS_19340 6868 6149 gene locus_tag LOCUS_19350 6868 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979847.1 protein_id gnl|my_center|LOCUS_19350 7077 8186 gene locus_tag LOCUS_19360 gene menC 7077 8186 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_19360 8262 9092 gene locus_tag LOCUS_19370 gene yqeB 8262 9092 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_19370 9089 9856 gene locus_tag LOCUS_19380 gene cofE 9089 9856 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_19380 10205 9861 gene locus_tag LOCUS_19390 gene rsfS 10205 9861 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_19390 12336 10327 gene locus_tag LOCUS_19400 gene uvrB 12336 10327 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_19400 13501 12464 gene locus_tag LOCUS_19410 13501 12464 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 protein_id gnl|my_center|LOCUS_19410 15964 13562 gene locus_tag LOCUS_19420 15964 13562 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256869.1 protein_id gnl|my_center|LOCUS_19420 16183 17742 gene locus_tag LOCUS_19430 gene gatB 16183 17742 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_19430 17813 20488 gene locus_tag LOCUS_19440 17813 20488 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_19440 20490 21365 gene locus_tag LOCUS_19450 20490 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 21385 22362 gene locus_tag LOCUS_19460 21385 22362 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence054 2 559 gene locus_tag LOCUS_19470 2 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 565 948 gene locus_tag LOCUS_19480 565 948 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_19480 965 1360 gene locus_tag LOCUS_19490 965 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1392 1706 gene locus_tag LOCUS_19500 1392 1706 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258652.1 protein_id gnl|my_center|LOCUS_19500 1789 2430 gene locus_tag LOCUS_19510 1789 2430 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_19510 2485 3951 gene locus_tag LOCUS_19520 2485 3951 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_19520 4980 4000 gene locus_tag LOCUS_19530 4980 4000 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_19530 5936 5046 gene locus_tag LOCUS_19540 gene speB 5936 5046 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_19540 6485 5940 gene locus_tag LOCUS_19550 6485 5940 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_19550 7306 6620 gene locus_tag LOCUS_19560 7306 6620 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_19560 8277 7444 gene locus_tag LOCUS_19570 8277 7444 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_19570 9054 8317 gene locus_tag LOCUS_19580 9054 8317 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227690.1 protein_id gnl|my_center|LOCUS_19580 9755 9042 gene locus_tag LOCUS_19590 9755 9042 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_19590 10952 9792 gene locus_tag LOCUS_19600 10952 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 11167 10955 gene locus_tag LOCUS_19610 11167 10955 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_19610 11365 12132 gene locus_tag LOCUS_19620 gene larB 11365 12132 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_19620 12185 13066 gene locus_tag LOCUS_19630 gene larE 12185 13066 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_19630 13063 14256 gene locus_tag LOCUS_19640 gene larC 13063 14256 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_19640 14604 14422 gene locus_tag LOCUS_19650 14604 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 15782 14802 gene locus_tag LOCUS_19660 15782 14802 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259384.1 protein_id gnl|my_center|LOCUS_19660 16569 15793 gene locus_tag LOCUS_19670 16569 15793 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_19670 17407 16610 gene locus_tag LOCUS_19680 17407 16610 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_19680 18328 17432 gene locus_tag LOCUS_19690 18328 17432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 19125 18325 gene locus_tag LOCUS_19700 gene surE 19125 18325 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_19700 22208 19137 gene locus_tag LOCUS_19710 22208 19137 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_19710 23004 22231 gene locus_tag LOCUS_19720 23004 22231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence055 3905 273 gene locus_tag LOCUS_19730 gene nifJ 3905 273 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_19730 4576 3929 gene locus_tag LOCUS_19740 4576 3929 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_19740 5215 4742 gene locus_tag LOCUS_19750 5215 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173734.1 protein_id gnl|my_center|LOCUS_19750 6231 5320 gene locus_tag LOCUS_19760 6231 5320 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_19760 7617 6307 gene locus_tag LOCUS_19770 7617 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 7707 8363 gene locus_tag LOCUS_19780 7707 8363 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_19780 8556 8999 gene locus_tag LOCUS_19790 8556 8999 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_19790 9411 9995 gene locus_tag LOCUS_19800 gene hoxE 9411 9995 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943357.1 protein_id gnl|my_center|LOCUS_19800 9982 11670 gene locus_tag LOCUS_19810 9982 11670 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943356.1 protein_id gnl|my_center|LOCUS_19810 11667 12398 gene locus_tag LOCUS_19820 gene hoxU 11667 12398 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943355.1 protein_id gnl|my_center|LOCUS_19820 12405 12938 gene locus_tag LOCUS_19830 12405 12938 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943354.1 protein_id gnl|my_center|LOCUS_19830 12952 14418 gene locus_tag LOCUS_19840 12952 14418 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_19840 14419 14940 gene locus_tag LOCUS_19850 14419 14940 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943352.1 protein_id gnl|my_center|LOCUS_19850 15020 15718 gene locus_tag LOCUS_19860 15020 15718 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258285.1 protein_id gnl|my_center|LOCUS_19860 15727 16362 gene locus_tag LOCUS_19870 15727 16362 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_19870 16466 16585 gene locus_tag LOCUS_19880 16466 16585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 16585 17181 gene locus_tag LOCUS_19890 16585 17181 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258287.1 protein_id gnl|my_center|LOCUS_19890 17201 18919 gene locus_tag LOCUS_19900 17201 18919 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258288.1 protein_id gnl|my_center|LOCUS_19900 21379 19133 gene locus_tag LOCUS_19910 21379 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 22468 21503 gene locus_tag LOCUS_19920 22468 21503 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909136.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence056 936 793 gene locus_tag LOCUS_19930 936 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2049 1087 gene locus_tag LOCUS_19940 2049 1087 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046798190.1 protein_id gnl|my_center|LOCUS_19940 2192 3046 gene locus_tag LOCUS_19950 2192 3046 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_19950 3024 3998 gene locus_tag LOCUS_19960 3024 3998 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 protein_id gnl|my_center|LOCUS_19960 4166 5584 gene locus_tag LOCUS_19970 4166 5584 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103985.1 protein_id gnl|my_center|LOCUS_19970 5726 7696 gene locus_tag LOCUS_19980 5726 7696 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582578.1 protein_id gnl|my_center|LOCUS_19980 7839 8840 gene locus_tag LOCUS_19990 7839 8840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582577.1 protein_id gnl|my_center|LOCUS_19990 8840 9700 gene locus_tag LOCUS_20000 8840 9700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582576.1 protein_id gnl|my_center|LOCUS_20000 9697 10740 gene locus_tag LOCUS_20010 9697 10740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582510.1 protein_id gnl|my_center|LOCUS_20010 10737 11564 gene locus_tag LOCUS_20020 10737 11564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582574.1 protein_id gnl|my_center|LOCUS_20020 11638 12948 gene locus_tag LOCUS_20030 11638 12948 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_20030 13049 14551 gene locus_tag LOCUS_20040 13049 14551 CDS product DUF5605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080612.1 protein_id gnl|my_center|LOCUS_20040 14641 16191 gene locus_tag LOCUS_20050 14641 16191 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922209.1 protein_id gnl|my_center|LOCUS_20050 16319 17728 gene locus_tag LOCUS_20060 16319 17728 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167413.1 protein_id gnl|my_center|LOCUS_20060 17943 18788 gene locus_tag LOCUS_20070 17943 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 20021 18816 gene locus_tag LOCUS_20080 20021 18816 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_20080 21210 20236 gene locus_tag LOCUS_20090 21210 20236 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123535.1 protein_id gnl|my_center|LOCUS_20090 21811 22056 gene locus_tag LOCUS_20100 21811 22056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 22146 22409 gene locus_tag LOCUS_20110 22146 22409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence057 820 314 gene locus_tag LOCUS_20120 820 314 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256302.1 protein_id gnl|my_center|LOCUS_20120 3156 820 gene locus_tag LOCUS_20130 3156 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 3803 3213 gene locus_tag LOCUS_20140 3803 3213 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114949.1 protein_id gnl|my_center|LOCUS_20140 5826 3853 gene locus_tag LOCUS_20150 5826 3853 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_20150 6164 7021 gene locus_tag LOCUS_20160 gene catE 6164 7021 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 protein_id gnl|my_center|LOCUS_20160 7032 8537 gene locus_tag LOCUS_20170 7032 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 10198 8462 gene locus_tag LOCUS_20180 10198 8462 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256346.1 protein_id gnl|my_center|LOCUS_20180 10323 11228 gene locus_tag LOCUS_20190 10323 11228 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_20190 12951 11329 gene locus_tag LOCUS_20200 gene pgi 12951 11329 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_20200 13713 12973 gene locus_tag LOCUS_20210 13713 12973 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350585.1 protein_id gnl|my_center|LOCUS_20210 14838 13723 gene locus_tag LOCUS_20220 14838 13723 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_20220 15134 15757 gene locus_tag LOCUS_20230 15134 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 19715 15744 gene locus_tag LOCUS_20240 19715 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 20833 19835 gene locus_tag LOCUS_20250 20833 19835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 <22533 20860 gene locus_tag LOCUS_20260 <22533 20860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258680.1:formylglycine-generating enzyme family protein >Feature sequence058 518 1381 gene locus_tag LOCUS_20270 518 1381 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584123.1 protein_id gnl|my_center|LOCUS_20270 1541 2827 gene locus_tag LOCUS_20280 1541 2827 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532948.1 protein_id gnl|my_center|LOCUS_20280 2852 3898 gene locus_tag LOCUS_20290 2852 3898 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532947.1 protein_id gnl|my_center|LOCUS_20290 3891 4742 gene locus_tag LOCUS_20300 3891 4742 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 protein_id gnl|my_center|LOCUS_20300 4897 5772 gene locus_tag LOCUS_20310 4897 5772 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431312.1 protein_id gnl|my_center|LOCUS_20310 5858 7042 gene locus_tag LOCUS_20320 5858 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 7405 7052 gene locus_tag LOCUS_20330 7405 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 7659 7426 gene locus_tag LOCUS_20340 7659 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 7887 8732 gene locus_tag LOCUS_20350 7887 8732 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_20350 8756 9811 gene locus_tag LOCUS_20360 gene tsaD 8756 9811 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_20360 10666 9827 gene locus_tag LOCUS_20370 10666 9827 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_20370 10857 11480 gene locus_tag LOCUS_20380 10857 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 12095 11493 gene locus_tag LOCUS_20390 gene pdxT 12095 11493 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258094.1 protein_id gnl|my_center|LOCUS_20390 13082 12150 gene locus_tag LOCUS_20400 gene pdxS 13082 12150 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_20400 13280 14233 gene locus_tag LOCUS_20410 gene rnz 13280 14233 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086661.1 protein_id gnl|my_center|LOCUS_20410 16007 14373 gene locus_tag LOCUS_20420 gene groL 16007 14373 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_20420 16409 16122 gene locus_tag LOCUS_20430 gene groES 16409 16122 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817319.1 protein_id gnl|my_center|LOCUS_20430 18734 16557 gene locus_tag LOCUS_20440 18734 16557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 19093 18764 gene locus_tag LOCUS_20450 19093 18764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 20603 19179 gene locus_tag LOCUS_20460 20603 19179 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879947.1 protein_id gnl|my_center|LOCUS_20460 21953 20814 gene locus_tag LOCUS_20470 21953 20814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence059 <1 974 gene locus_tag LOCUS_20480 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937589.1:glycosyltransferase 1068 1808 gene locus_tag LOCUS_20490 1068 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1805 2497 gene locus_tag LOCUS_20500 1805 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2578 4938 gene locus_tag LOCUS_20510 2578 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 4935 5549 gene locus_tag LOCUS_20520 4935 5549 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256018.1 protein_id gnl|my_center|LOCUS_20520 5575 6642 gene locus_tag LOCUS_20530 5575 6642 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_20530 6644 7387 gene locus_tag LOCUS_20540 6644 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 7423 8451 gene locus_tag LOCUS_20550 gene rfbB 7423 8451 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889301.1 protein_id gnl|my_center|LOCUS_20550 8467 9405 gene locus_tag LOCUS_20560 8467 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 9783 12671 gene locus_tag LOCUS_20570 gene gcvP 9783 12671 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_20570 12831 14345 gene locus_tag LOCUS_20580 12831 14345 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_20580 14876 15694 gene locus_tag LOCUS_20590 14876 15694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_20590 15808 16818 gene locus_tag LOCUS_20600 15808 16818 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_20600 16826 17623 gene locus_tag LOCUS_20610 16826 17623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723717.1 protein_id gnl|my_center|LOCUS_20610 17755 20124 gene locus_tag LOCUS_20620 17755 20124 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404537.1 protein_id gnl|my_center|LOCUS_20620 20121 21620 gene locus_tag LOCUS_20630 gene gltX 20121 21620 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257408.1 protein_id gnl|my_center|LOCUS_20630 21708 21780 gene locus_tag LOCUS_t00210 21708 21780 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence060 1735 821 gene locus_tag LOCUS_20640 1735 821 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_20640 2616 1732 gene locus_tag LOCUS_20650 gene rsmA 2616 1732 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256787.1 protein_id gnl|my_center|LOCUS_20650 4463 2664 gene locus_tag LOCUS_20660 gene lepA 4463 2664 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_20660 5468 4533 gene locus_tag LOCUS_20670 5468 4533 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_20670 5558 6289 gene locus_tag LOCUS_20680 5558 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 6981 6331 gene locus_tag LOCUS_20690 6981 6331 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_20690 7759 7013 gene locus_tag LOCUS_20700 7759 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 8031 7762 gene locus_tag LOCUS_20710 8031 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 8631 8137 gene locus_tag LOCUS_20720 8631 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 9892 8606 gene locus_tag LOCUS_20730 9892 8606 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257321.1 protein_id gnl|my_center|LOCUS_20730 10177 11025 gene locus_tag LOCUS_20740 10177 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 11108 12451 gene locus_tag LOCUS_20750 11108 12451 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_20750 12514 13524 gene locus_tag LOCUS_20760 gene gap 12514 13524 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_20760 13616 14797 gene locus_tag LOCUS_20770 13616 14797 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_20770 14905 15315 gene locus_tag LOCUS_20780 14905 15315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 15322 16086 gene locus_tag LOCUS_20790 gene tpiA 15322 16086 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231038.1 protein_id gnl|my_center|LOCUS_20790 16165 17013 gene locus_tag LOCUS_20800 16165 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 17013 17729 gene locus_tag LOCUS_20810 17013 17729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 17740 18261 gene locus_tag LOCUS_20820 17740 18261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 18276 19040 gene locus_tag LOCUS_20830 18276 19040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 19111 19449 gene locus_tag LOCUS_20840 gene trxA 19111 19449 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_20840 19972 19451 gene locus_tag LOCUS_20850 19972 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 20438 20049 gene locus_tag LOCUS_20860 gene rpsI 20438 20049 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_20860 20901 20467 gene locus_tag LOCUS_20870 gene rplM 20901 20467 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939788.1 protein_id gnl|my_center|LOCUS_20870 <21841 20978 gene locus_tag LOCUS_20880 <21841 20978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118979.1:tRNA pseudouridine(38-40) synthase TruA >Feature sequence061 1986 1273 gene locus_tag LOCUS_20890 1986 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2903 1983 gene locus_tag LOCUS_20900 2903 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3136 4299 gene locus_tag LOCUS_20910 3136 4299 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166720.1 protein_id gnl|my_center|LOCUS_20910 5476 4472 gene locus_tag LOCUS_20920 5476 4472 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259392.1 protein_id gnl|my_center|LOCUS_20920 5864 6982 gene locus_tag LOCUS_20930 gene mtnA 5864 6982 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_20930 6979 7578 gene locus_tag LOCUS_20940 6979 7578 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_20940 7590 8585 gene locus_tag LOCUS_20950 7590 8585 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_20950 8633 9430 gene locus_tag LOCUS_20960 8633 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 9492 10775 gene locus_tag LOCUS_20970 gene ahcY 9492 10775 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_20970 10796 12016 gene locus_tag LOCUS_20980 gene metK 10796 12016 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258872.1 protein_id gnl|my_center|LOCUS_20980 13068 12097 gene locus_tag LOCUS_20990 13068 12097 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_20990 14424 13102 gene locus_tag LOCUS_21000 14424 13102 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_21000 14606 14980 gene locus_tag LOCUS_21010 14606 14980 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338472.1 protein_id gnl|my_center|LOCUS_21010 15960 14989 gene locus_tag LOCUS_21020 15960 14989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 16835 16008 gene locus_tag LOCUS_21030 16835 16008 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256115.1 protein_id gnl|my_center|LOCUS_21030 17410 16847 gene locus_tag LOCUS_21040 17410 16847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 18312 17407 gene locus_tag LOCUS_21050 18312 17407 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525137.1 protein_id gnl|my_center|LOCUS_21050 19075 18416 gene locus_tag LOCUS_21060 19075 18416 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_21060 19276 19079 gene locus_tag LOCUS_21070 19276 19079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 21227 19365 gene locus_tag LOCUS_21080 gene ctaD 21227 19365 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence062 2188 848 gene locus_tag LOCUS_21090 gene sufD 2188 848 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_21090 3678 2263 gene locus_tag LOCUS_21100 gene sufB 3678 2263 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_21100 4554 3748 gene locus_tag LOCUS_21110 gene sufC 4554 3748 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_21110 5341 4679 gene locus_tag LOCUS_21120 5341 4679 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257063.1 protein_id gnl|my_center|LOCUS_21120 6640 5459 gene locus_tag LOCUS_21130 6640 5459 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258460.1 protein_id gnl|my_center|LOCUS_21130 6809 8056 gene locus_tag LOCUS_21140 gene queG 6809 8056 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528621.1 protein_id gnl|my_center|LOCUS_21140 8195 8902 gene locus_tag LOCUS_21150 8195 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 8963 10276 gene locus_tag LOCUS_21160 gene hemL 8963 10276 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228305.1 protein_id gnl|my_center|LOCUS_21160 10495 10617 gene locus_tag LOCUS_21170 10495 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 11908 10787 gene locus_tag LOCUS_21180 11908 10787 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_21180 12759 11926 gene locus_tag LOCUS_21190 12759 11926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_21190 13658 12756 gene locus_tag LOCUS_21200 13658 12756 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141403.1 protein_id gnl|my_center|LOCUS_21200 14764 13664 gene locus_tag LOCUS_21210 14764 13664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_21210 17185 14915 gene locus_tag LOCUS_21220 17185 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 18008 17214 gene locus_tag LOCUS_21230 18008 17214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 19974 18028 gene locus_tag LOCUS_21240 19974 18028 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_21240 <21166 20542 gene locus_tag LOCUS_21250 <21166 20542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882798.1:SUMF1/EgtB/PvdO family nonheme iron enzyme >Feature sequence063 <1 1840 gene locus_tag LOCUS_21260 <1 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258398.1:alpha-amylase family glycosyl hydrolase 2122 3402 gene locus_tag LOCUS_21270 2122 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3623 5725 gene locus_tag LOCUS_21280 3623 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 5896 8361 gene locus_tag LOCUS_21290 5896 8361 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928558.1 protein_id gnl|my_center|LOCUS_21290 8450 9484 gene locus_tag LOCUS_21300 gene pheS 8450 9484 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_21300 10853 9495 gene locus_tag LOCUS_21310 gene mocA 10853 9495 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393499.1 protein_id gnl|my_center|LOCUS_21310 10923 11348 gene locus_tag LOCUS_21320 10923 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 12500 11352 gene locus_tag LOCUS_21330 12500 11352 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392231.1 protein_id gnl|my_center|LOCUS_21330 14505 12547 gene locus_tag LOCUS_21340 14505 12547 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_21340 14638 15885 gene locus_tag LOCUS_21350 14638 15885 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479765.1 protein_id gnl|my_center|LOCUS_21350 17138 15882 gene locus_tag LOCUS_21360 17138 15882 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062420975.1 protein_id gnl|my_center|LOCUS_21360 17770 17135 gene locus_tag LOCUS_21370 17770 17135 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_21370 18341 17814 gene locus_tag LOCUS_21380 gene cas4 18341 17814 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259413.1 protein_id gnl|my_center|LOCUS_21380 18848 18378 gene locus_tag LOCUS_21390 18848 18378 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_21390 19210 20187 gene locus_tag LOCUS_21400 gene argF 19210 20187 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_21400 <20942 20184 gene locus_tag LOCUS_21410 <20942 20184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062284418.1:(2Fe-2S)-binding protein >Feature sequence064 846 121 gene locus_tag LOCUS_21420 gene ubiE 846 121 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_21420 1378 851 gene locus_tag LOCUS_21430 1378 851 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244797.1 protein_id gnl|my_center|LOCUS_21430 2542 1391 gene locus_tag LOCUS_21440 2542 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2759 3739 gene locus_tag LOCUS_21450 2759 3739 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_21450 3780 6278 gene locus_tag LOCUS_21460 3780 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 7575 6268 gene locus_tag LOCUS_21470 7575 6268 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_21470 7765 9021 gene locus_tag LOCUS_21480 7765 9021 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_21480 9034 10293 gene locus_tag LOCUS_21490 9034 10293 CDS product glucose-1-phosphate adenylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258381.1 protein_id gnl|my_center|LOCUS_21490 12908 10329 gene locus_tag LOCUS_21500 12908 10329 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_21500 13675 12905 gene locus_tag LOCUS_21510 13675 12905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405129.1 protein_id gnl|my_center|LOCUS_21510 13960 14631 gene locus_tag LOCUS_21520 13960 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 14754 16145 gene locus_tag LOCUS_21530 14754 16145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 16159 18957 gene locus_tag LOCUS_21540 16159 18957 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_21540 19090 20019 gene locus_tag LOCUS_21550 19090 20019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 20230 20157 gene locus_tag LOCUS_t00220 20230 20157 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence065 1377 967 gene locus_tag LOCUS_21560 1377 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1334 1522 gene locus_tag LOCUS_21570 1334 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 1890 1639 gene locus_tag LOCUS_21580 1890 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2264 1887 gene locus_tag LOCUS_21590 2264 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2608 2267 gene locus_tag LOCUS_21600 2608 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3058 2711 gene locus_tag LOCUS_21610 3058 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 3526 3702 gene locus_tag LOCUS_21620 3526 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 5210 3858 gene locus_tag LOCUS_21630 5210 3858 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 protein_id gnl|my_center|LOCUS_21630 5433 7499 gene locus_tag LOCUS_21640 5433 7499 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228453.1 protein_id gnl|my_center|LOCUS_21640 8994 7420 gene locus_tag LOCUS_21650 8994 7420 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015845.1 protein_id gnl|my_center|LOCUS_21650 9143 9832 gene locus_tag LOCUS_21660 9143 9832 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257526.1 protein_id gnl|my_center|LOCUS_21660 9795 10490 gene locus_tag LOCUS_21670 9795 10490 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_21670 10503 11234 gene locus_tag LOCUS_21680 10503 11234 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_21680 11398 13929 gene locus_tag LOCUS_21690 11398 13929 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258812.1 protein_id gnl|my_center|LOCUS_21690 13936 14460 gene locus_tag LOCUS_21700 13936 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 14527 14603 gene locus_tag LOCUS_t00230 14527 14603 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14674 16101 gene locus_tag LOCUS_21710 gene selA 14674 16101 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_21710 16086 16886 gene locus_tag LOCUS_21720 16086 16886 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_21720 16991 18346 gene locus_tag LOCUS_21730 gene rseP 16991 18346 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063746.1 protein_id gnl|my_center|LOCUS_21730 18352 19908 gene locus_tag LOCUS_21740 18352 19908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence066 786 1679 gene locus_tag LOCUS_21750 786 1679 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393454.1 protein_id gnl|my_center|LOCUS_21750 1700 4636 gene locus_tag LOCUS_21760 gene xdh 1700 4636 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_21760 5108 6688 gene locus_tag LOCUS_21770 5108 6688 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_21770 6761 7717 gene locus_tag LOCUS_21780 6761 7717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095722.1 protein_id gnl|my_center|LOCUS_21780 7714 8559 gene locus_tag LOCUS_21790 7714 8559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811978.1 protein_id gnl|my_center|LOCUS_21790 8562 9569 gene locus_tag LOCUS_21800 8562 9569 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_21800 9562 10590 gene locus_tag LOCUS_21810 9562 10590 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892059.1 protein_id gnl|my_center|LOCUS_21810 10650 11387 gene locus_tag LOCUS_21820 10650 11387 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_21820 11717 13114 gene locus_tag LOCUS_21830 11717 13114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 13189 15066 gene locus_tag LOCUS_21840 13189 15066 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_21840 15786 15130 gene locus_tag LOCUS_21850 15786 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 17459 15864 gene locus_tag LOCUS_21860 17459 15864 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223376.1 protein_id gnl|my_center|LOCUS_21860 18691 17456 gene locus_tag LOCUS_21870 18691 17456 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_21870 19809 18727 gene locus_tag LOCUS_21880 19809 18727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223374.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence067 3612 1039 gene locus_tag LOCUS_21890 gene lon 3612 1039 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_21890 3774 4412 gene locus_tag LOCUS_21900 3774 4412 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836510.1 protein_id gnl|my_center|LOCUS_21900 4409 5266 gene locus_tag LOCUS_21910 4409 5266 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259122.1 protein_id gnl|my_center|LOCUS_21910 5269 7473 gene locus_tag LOCUS_21920 5269 7473 CDS product interleukin-like EMT inducer domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141609734.1 protein_id gnl|my_center|LOCUS_21920 8180 7479 gene locus_tag LOCUS_21930 8180 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 9085 8231 gene locus_tag LOCUS_21940 9085 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 9564 9217 gene locus_tag LOCUS_21950 9564 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 11004 9574 gene locus_tag LOCUS_21960 11004 9574 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_21960 11392 13668 gene locus_tag LOCUS_21970 11392 13668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 13692 15509 gene locus_tag LOCUS_21980 gene aspS 13692 15509 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_21980 15904 19137 gene locus_tag LOCUS_21990 15904 19137 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence068 <1 2707 gene locus_tag LOCUS_22000 <1 2707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990858.1:SBBP repeat-containing protein 2940 4049 gene locus_tag LOCUS_22010 gene proB 2940 4049 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707186.1 protein_id gnl|my_center|LOCUS_22010 4051 5814 gene locus_tag LOCUS_22020 4051 5814 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_22020 5811 6641 gene locus_tag LOCUS_22030 5811 6641 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_22030 6744 7769 gene locus_tag LOCUS_22040 6744 7769 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383326.1 protein_id gnl|my_center|LOCUS_22040 7847 9235 gene locus_tag LOCUS_22050 7847 9235 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383327.1 protein_id gnl|my_center|LOCUS_22050 9408 10322 gene locus_tag LOCUS_22060 9408 10322 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383328.1 protein_id gnl|my_center|LOCUS_22060 10324 11157 gene locus_tag LOCUS_22070 10324 11157 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383329.1 protein_id gnl|my_center|LOCUS_22070 11183 13318 gene locus_tag LOCUS_22080 11183 13318 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_22080 13427 15862 gene locus_tag LOCUS_22090 13427 15862 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_22090 15927 16901 gene locus_tag LOCUS_22100 15927 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 16920 17954 gene locus_tag LOCUS_22110 16920 17954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 17951 18586 gene locus_tag LOCUS_22120 17951 18586 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_22120 19007 18597 gene locus_tag LOCUS_22130 19007 18597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence069 424 1530 gene locus_tag LOCUS_22140 424 1530 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228931.1 protein_id gnl|my_center|LOCUS_22140 1575 3173 gene locus_tag LOCUS_22150 1575 3173 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_22150 3173 4228 gene locus_tag LOCUS_22160 3173 4228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030362.1 protein_id gnl|my_center|LOCUS_22160 5137 4265 gene locus_tag LOCUS_22170 5137 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 5543 5145 gene locus_tag LOCUS_22180 5543 5145 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_22180 5911 5555 gene locus_tag LOCUS_22190 5911 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 6168 5908 gene locus_tag LOCUS_22200 6168 5908 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056384.1 protein_id gnl|my_center|LOCUS_22200 7009 6152 gene locus_tag LOCUS_22210 gene proC 7009 6152 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_22210 7722 7006 gene locus_tag LOCUS_22220 7722 7006 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_22220 8967 7789 gene locus_tag LOCUS_22230 8967 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 9444 8992 gene locus_tag LOCUS_22240 9444 8992 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967283.1 protein_id gnl|my_center|LOCUS_22240 9614 9931 gene locus_tag LOCUS_22250 9614 9931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 10870 10034 gene locus_tag LOCUS_22260 10870 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 12511 10877 gene locus_tag LOCUS_22270 gene groL 12511 10877 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_22270 13912 12689 gene locus_tag LOCUS_22280 13912 12689 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_22280 14289 16463 gene locus_tag LOCUS_22290 14289 16463 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966127.1 protein_id gnl|my_center|LOCUS_22290 16494 17735 gene locus_tag LOCUS_22300 16494 17735 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926512.1 protein_id gnl|my_center|LOCUS_22300 18068 17748 gene locus_tag LOCUS_22310 18068 17748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence070 5043 1327 gene locus_tag LOCUS_22320 5043 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 5240 6064 gene locus_tag LOCUS_22330 5240 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 6961 6071 gene locus_tag LOCUS_22340 6961 6071 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_22340 7285 9048 gene locus_tag LOCUS_22350 7285 9048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_22350 9087 10949 gene locus_tag LOCUS_22360 9087 10949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_22360 10999 11658 gene locus_tag LOCUS_22370 10999 11658 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769285.1 protein_id gnl|my_center|LOCUS_22370 12776 11802 gene locus_tag LOCUS_22380 12776 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 13168 13653 gene locus_tag LOCUS_22390 13168 13653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 14755 13679 gene locus_tag LOCUS_22400 14755 13679 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_22400 15324 14770 gene locus_tag LOCUS_22410 15324 14770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 15660 16052 gene locus_tag LOCUS_22420 15660 16052 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014431504.1 protein_id gnl|my_center|LOCUS_22420 16877 16026 gene locus_tag LOCUS_22430 16877 16026 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_22430 16953 17867 gene locus_tag LOCUS_22440 16953 17867 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_22440 <19100 17908 gene locus_tag LOCUS_22450 <19100 17908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257480.1:putative DNA binding domain-containing protein >Feature sequence071 4503 3019 gene locus_tag LOCUS_22460 4503 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 4688 7186 gene locus_tag LOCUS_22470 4688 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 7373 8278 gene locus_tag LOCUS_22480 7373 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 9333 8335 gene locus_tag LOCUS_22490 9333 8335 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_22490 10069 9389 gene locus_tag LOCUS_22500 10069 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 10233 10721 gene locus_tag LOCUS_22510 10233 10721 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259311.1 protein_id gnl|my_center|LOCUS_22510 12282 10795 gene locus_tag LOCUS_22520 12282 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 12666 13880 gene locus_tag LOCUS_22530 gene dnaN 12666 13880 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_22530 15019 13958 gene locus_tag LOCUS_22540 15019 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 16205 15237 gene locus_tag LOCUS_22550 16205 15237 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479988.1 protein_id gnl|my_center|LOCUS_22550 16432 16794 gene locus_tag LOCUS_22560 16432 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 16950 18428 gene locus_tag LOCUS_22570 16950 18428 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence072 1276 5 gene locus_tag LOCUS_22580 1276 5 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021916.1 protein_id gnl|my_center|LOCUS_22580 2048 1296 gene locus_tag LOCUS_22590 2048 1296 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_22590 3618 2092 gene locus_tag LOCUS_22600 gene guaB 3618 2092 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_22600 3950 5149 gene locus_tag LOCUS_22610 3950 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5157 5945 gene locus_tag LOCUS_22620 gene hisF 5157 5945 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144298.1 protein_id gnl|my_center|LOCUS_22620 5942 6280 gene locus_tag LOCUS_22630 gene hisI 5942 6280 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646591.1 protein_id gnl|my_center|LOCUS_22630 6307 6585 gene locus_tag LOCUS_22640 gene hisE 6307 6585 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964261.1 protein_id gnl|my_center|LOCUS_22640 6585 7451 gene locus_tag LOCUS_22650 gene nudC 6585 7451 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_22650 7485 8522 gene locus_tag LOCUS_22660 7485 8522 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090946.1 protein_id gnl|my_center|LOCUS_22660 8590 9456 gene locus_tag LOCUS_22670 8590 9456 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_22670 9477 10664 gene locus_tag LOCUS_22680 gene dgoD 9477 10664 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705012.1 protein_id gnl|my_center|LOCUS_22680 10674 11342 gene locus_tag LOCUS_22690 10674 11342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 12621 11389 gene locus_tag LOCUS_22700 gene mtnK 12621 11389 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033250.1 protein_id gnl|my_center|LOCUS_22700 13638 12655 gene locus_tag LOCUS_22710 13638 12655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168379.1 protein_id gnl|my_center|LOCUS_22710 15132 13642 gene locus_tag LOCUS_22720 15132 13642 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816711.1 protein_id gnl|my_center|LOCUS_22720 16486 15347 gene locus_tag LOCUS_22730 16486 15347 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097620.1 protein_id gnl|my_center|LOCUS_22730 <17689 16684 gene locus_tag LOCUS_22740 <17689 16684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001100037.1:SNF2-related protein >Feature sequence073 1600 2601 gene locus_tag LOCUS_22750 1600 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 3102 3782 gene locus_tag LOCUS_22760 3102 3782 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_22760 3786 4631 gene locus_tag LOCUS_22770 gene rfbD 3786 4631 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256315.1 protein_id gnl|my_center|LOCUS_22770 4641 5870 gene locus_tag LOCUS_22780 4641 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 5921 8485 gene locus_tag LOCUS_22790 5921 8485 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_22790 9502 8594 gene locus_tag LOCUS_22800 9502 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 11256 9520 gene locus_tag LOCUS_22810 11256 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 11749 11261 gene locus_tag LOCUS_22820 11749 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 12856 11789 gene locus_tag LOCUS_22830 12856 11789 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257470.1 protein_id gnl|my_center|LOCUS_22830 13274 14248 gene locus_tag LOCUS_22840 13274 14248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 15039 14281 gene locus_tag LOCUS_22850 15039 14281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 15305 16750 gene locus_tag LOCUS_22860 15305 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence074 731 1810 gene locus_tag LOCUS_22870 731 1810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148691226.1 protein_id gnl|my_center|LOCUS_22870 1853 2728 gene locus_tag LOCUS_22880 1853 2728 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_22880 2797 3900 gene locus_tag LOCUS_22890 2797 3900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_22890 3900 4895 gene locus_tag LOCUS_22900 3900 4895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_22900 4899 5081 gene locus_tag LOCUS_22910 4899 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 5193 6992 gene locus_tag LOCUS_22920 5193 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 7050 8264 gene locus_tag LOCUS_22930 7050 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 8342 9352 gene locus_tag LOCUS_22940 8342 9352 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_22940 9357 10364 gene locus_tag LOCUS_22950 9357 10364 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_22950 10452 11783 gene locus_tag LOCUS_22960 10452 11783 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_22960 11820 13016 gene locus_tag LOCUS_22970 11820 13016 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143735.1 protein_id gnl|my_center|LOCUS_22970 13013 13987 gene locus_tag LOCUS_22980 13013 13987 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_22980 13984 14529 gene locus_tag LOCUS_22990 gene msrA 13984 14529 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence075 1392 367 gene locus_tag LOCUS_23000 1392 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 5001 1549 gene locus_tag LOCUS_23010 5001 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 5214 6296 gene locus_tag LOCUS_23020 5214 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 6306 7445 gene locus_tag LOCUS_23030 gene hisC 6306 7445 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017744.1 protein_id gnl|my_center|LOCUS_23030 9653 7551 gene locus_tag LOCUS_23040 9653 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 9904 11268 gene locus_tag LOCUS_23050 gene mazG 9904 11268 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014253.1 protein_id gnl|my_center|LOCUS_23050 11344 11420 gene locus_tag LOCUS_t00240 11344 11420 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11785 11495 gene locus_tag LOCUS_23060 11785 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 13349 11796 gene locus_tag LOCUS_23070 13349 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 <16987 13588 gene locus_tag LOCUS_23080 <16987 13588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206819627.1:zinc-dependent metalloprotease family protein >Feature sequence076 1147 2 gene locus_tag LOCUS_23090 1147 2 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_23090 3170 1140 gene locus_tag LOCUS_23100 3170 1140 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 protein_id gnl|my_center|LOCUS_23100 4978 3167 gene locus_tag LOCUS_23110 gene acsA 4978 3167 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 protein_id gnl|my_center|LOCUS_23110 6372 5155 gene locus_tag LOCUS_23120 6372 5155 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975127.1 protein_id gnl|my_center|LOCUS_23120 7486 6386 gene locus_tag LOCUS_23130 7486 6386 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_23130 8642 7539 gene locus_tag LOCUS_23140 8642 7539 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_23140 9711 8710 gene locus_tag LOCUS_23150 9711 8710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582574.1 protein_id gnl|my_center|LOCUS_23150 10709 9708 gene locus_tag LOCUS_23160 10709 9708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584067.1 protein_id gnl|my_center|LOCUS_23160 11533 10706 gene locus_tag LOCUS_23170 11533 10706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582576.1 protein_id gnl|my_center|LOCUS_23170 12643 11645 gene locus_tag LOCUS_23180 12643 11645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082581.1 protein_id gnl|my_center|LOCUS_23180 14691 12769 gene locus_tag LOCUS_23190 14691 12769 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582578.1 protein_id gnl|my_center|LOCUS_23190 16056 14983 gene locus_tag LOCUS_23200 16056 14983 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267463.1 protein_id gnl|my_center|LOCUS_23200 16538 16104 gene locus_tag LOCUS_23210 16538 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence077 155 1867 gene locus_tag LOCUS_23220 155 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 1891 2364 gene locus_tag LOCUS_23230 1891 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2361 5120 gene locus_tag LOCUS_23240 2361 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 5249 5446 gene locus_tag LOCUS_23250 5249 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 5453 7600 gene locus_tag LOCUS_23260 5453 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 7703 8569 gene locus_tag LOCUS_23270 7703 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 8632 9825 gene locus_tag LOCUS_23280 8632 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 9889 11982 gene locus_tag LOCUS_23290 9889 11982 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877752.1 protein_id gnl|my_center|LOCUS_23290 12038 13576 gene locus_tag LOCUS_23300 12038 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 13573 14754 gene locus_tag LOCUS_23310 13573 14754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 14751 15878 gene locus_tag LOCUS_23320 14751 15878 CDS product proton-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144181.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence078 496 2025 gene locus_tag LOCUS_23330 496 2025 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926111.1 protein_id gnl|my_center|LOCUS_23330 2301 2537 gene locus_tag LOCUS_23340 2301 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 3833 4615 gene locus_tag LOCUS_23350 3833 4615 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_23350 5474 4629 gene locus_tag LOCUS_23360 5474 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 7548 5491 gene locus_tag LOCUS_23370 7548 5491 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542452.1 protein_id gnl|my_center|LOCUS_23370 8842 7652 gene locus_tag LOCUS_23380 8842 7652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941437.1 protein_id gnl|my_center|LOCUS_23380 9003 9341 gene locus_tag LOCUS_23390 9003 9341 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125076.1 protein_id gnl|my_center|LOCUS_23390 10269 9373 gene locus_tag LOCUS_23400 10269 9373 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_23400 11353 10325 gene locus_tag LOCUS_23410 11353 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 11509 12423 gene locus_tag LOCUS_23420 gene rbsK 11509 12423 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 protein_id gnl|my_center|LOCUS_23420 13164 12427 gene locus_tag LOCUS_23430 13164 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 14299 13181 gene locus_tag LOCUS_23440 14299 13181 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_23440 14806 14330 gene locus_tag LOCUS_23450 14806 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 16021 14852 gene locus_tag LOCUS_23460 16021 14852 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence079 1301 861 gene locus_tag LOCUS_23470 gene aroQ 1301 861 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_23470 1467 2063 gene locus_tag LOCUS_23480 1467 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 3228 2233 gene locus_tag LOCUS_23490 3228 2233 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_23490 3956 3225 gene locus_tag LOCUS_23500 3956 3225 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974661.1 protein_id gnl|my_center|LOCUS_23500 4381 4773 gene locus_tag LOCUS_23510 4381 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 4969 6063 gene locus_tag LOCUS_23520 4969 6063 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803989.1 protein_id gnl|my_center|LOCUS_23520 6075 6908 gene locus_tag LOCUS_23530 6075 6908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803987.1 protein_id gnl|my_center|LOCUS_23530 6905 7702 gene locus_tag LOCUS_23540 6905 7702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803988.1 protein_id gnl|my_center|LOCUS_23540 7824 10181 gene locus_tag LOCUS_23550 7824 10181 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791356.1 protein_id gnl|my_center|LOCUS_23550 10730 11365 gene locus_tag LOCUS_23560 10730 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 11362 12786 gene locus_tag LOCUS_23570 11362 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23570 12805 13617 gene locus_tag LOCUS_23580 12805 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 13735 14139 gene locus_tag LOCUS_23590 13735 14139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 14426 14136 gene locus_tag LOCUS_23600 14426 14136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 <16505 14622 gene locus_tag LOCUS_23610 <16505 14622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083687.1:N-6 DNA methylase >Feature sequence080 220 2331 gene locus_tag LOCUS_23620 220 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2312 3967 gene locus_tag LOCUS_23630 2312 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 3995 5581 gene locus_tag LOCUS_23640 3995 5581 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967162.1 protein_id gnl|my_center|LOCUS_23640 5647 6591 gene locus_tag LOCUS_23650 5647 6591 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257249.1 protein_id gnl|my_center|LOCUS_23650 6599 7450 gene locus_tag LOCUS_23660 6599 7450 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257247.1 protein_id gnl|my_center|LOCUS_23660 7476 8300 gene locus_tag LOCUS_23670 7476 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 10005 8326 gene locus_tag LOCUS_23680 10005 8326 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_23680 10682 10077 gene locus_tag LOCUS_23690 gene recR 10682 10077 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_23690 11115 10729 gene locus_tag LOCUS_23700 11115 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 12826 11198 gene locus_tag LOCUS_23710 12826 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 15282 12922 gene locus_tag LOCUS_23720 15282 12922 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_23720 <16378 15279 gene locus_tag LOCUS_23730 <16378 15279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257484.1:immune inhibitor A >Feature sequence081 164 2350 gene locus_tag LOCUS_23740 164 2350 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_23740 3008 2400 gene locus_tag LOCUS_23750 gene sodA 3008 2400 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_23750 4233 3214 gene locus_tag LOCUS_23760 4233 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 4371 6422 gene locus_tag LOCUS_23770 gene tkt 4371 6422 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_23770 6425 6931 gene locus_tag LOCUS_23780 6425 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 6968 8029 gene locus_tag LOCUS_23790 gene holA 6968 8029 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_23790 8035 9246 gene locus_tag LOCUS_23800 gene recF 8035 9246 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_23800 9253 12420 gene locus_tag LOCUS_23810 9253 12420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 13491 12442 gene locus_tag LOCUS_23820 13491 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 13757 15031 gene locus_tag LOCUS_23830 13757 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 15075 15821 gene locus_tag LOCUS_23840 gene gpmA 15075 15821 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence082 797 1480 gene locus_tag LOCUS_23850 797 1480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081034.1 protein_id gnl|my_center|LOCUS_23850 1496 5551 gene locus_tag LOCUS_23860 1496 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 6642 5542 gene locus_tag LOCUS_23870 6642 5542 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870425.1 protein_id gnl|my_center|LOCUS_23870 6721 8823 gene locus_tag LOCUS_23880 6721 8823 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_23880 8990 9370 gene locus_tag LOCUS_23890 8990 9370 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660364.1 protein_id gnl|my_center|LOCUS_23890 9456 10523 gene locus_tag LOCUS_23900 gene arsB 9456 10523 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_23900 10594 11052 gene locus_tag LOCUS_23910 10594 11052 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869593.1 protein_id gnl|my_center|LOCUS_23910 11426 13423 gene locus_tag LOCUS_23920 11426 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence083 365 1759 gene locus_tag LOCUS_23930 gene ffh 365 1759 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257918.1 protein_id gnl|my_center|LOCUS_23930 1821 2114 gene locus_tag LOCUS_23940 gene rpsP 1821 2114 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257919.1 protein_id gnl|my_center|LOCUS_23940 2128 2355 gene locus_tag LOCUS_23950 2128 2355 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257920.1 protein_id gnl|my_center|LOCUS_23950 2433 3041 gene locus_tag LOCUS_23960 gene rimM 2433 3041 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_23960 3102 4181 gene locus_tag LOCUS_23970 gene dprA 3102 4181 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_23970 4208 5281 gene locus_tag LOCUS_23980 4208 5281 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_23980 5327 6646 gene locus_tag LOCUS_23990 5327 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 8219 7062 gene locus_tag LOCUS_24000 8219 7062 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227919.1 protein_id gnl|my_center|LOCUS_24000 7868 7956 gene locus_tag LOCUS_t00250 7868 7956 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 9014 8283 gene locus_tag LOCUS_24010 9014 8283 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_24010 10101 9190 gene locus_tag LOCUS_24020 10101 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 10427 11959 gene locus_tag LOCUS_24030 10427 11959 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_24030 11983 12873 gene locus_tag LOCUS_24040 11983 12873 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_24040 12915 13628 gene locus_tag LOCUS_24050 12915 13628 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_24050 13937 15307 gene locus_tag LOCUS_24060 13937 15307 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence084 1621 1860 gene locus_tag LOCUS_24070 1621 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2110 3561 gene locus_tag LOCUS_24080 2110 3561 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940347.1 protein_id gnl|my_center|LOCUS_24080 3668 4513 gene locus_tag LOCUS_24090 3668 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 5779 4568 gene locus_tag LOCUS_24100 5779 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 6087 7217 gene locus_tag LOCUS_24110 6087 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 7246 8844 gene locus_tag LOCUS_24120 7246 8844 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_24120 8866 9531 gene locus_tag LOCUS_24130 gene tmk 8866 9531 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_24130 9579 9908 gene locus_tag LOCUS_24140 9579 9908 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781979.1 protein_id gnl|my_center|LOCUS_24140 10343 9945 gene locus_tag LOCUS_24150 10343 9945 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_24150 10484 11137 gene locus_tag LOCUS_24160 10484 11137 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_24160 11134 11922 gene locus_tag LOCUS_24170 11134 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 11970 13529 gene locus_tag LOCUS_24180 gene malQ 11970 13529 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479885.1 protein_id gnl|my_center|LOCUS_24180 14459 13548 gene locus_tag LOCUS_24190 14459 13548 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258190.1 protein_id gnl|my_center|LOCUS_24190 14849 14469 gene locus_tag LOCUS_24200 14849 14469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 15643 14855 gene locus_tag LOCUS_24210 15643 14855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence085 354 857 gene locus_tag LOCUS_24220 354 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 1083 2417 gene locus_tag LOCUS_24230 1083 2417 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_24230 2469 3374 gene locus_tag LOCUS_24240 2469 3374 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434865.1 protein_id gnl|my_center|LOCUS_24240 3371 4201 gene locus_tag LOCUS_24250 3371 4201 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_24250 4678 4214 gene locus_tag LOCUS_24260 gene bcp 4678 4214 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_24260 4815 6353 gene locus_tag LOCUS_24270 4815 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 6470 7042 gene locus_tag LOCUS_24280 6470 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 8079 6964 gene locus_tag LOCUS_24290 8079 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 8894 8136 gene locus_tag LOCUS_24300 8894 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 9499 8891 gene locus_tag LOCUS_24310 9499 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 10735 9641 gene locus_tag LOCUS_24320 10735 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 10857 10773 gene locus_tag LOCUS_t00260 10857 10773 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11040 11795 gene locus_tag LOCUS_24330 11040 11795 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227819.1 protein_id gnl|my_center|LOCUS_24330 11802 13550 gene locus_tag LOCUS_24340 11802 13550 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_24340 13957 13568 gene locus_tag LOCUS_24350 13957 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 15071 13950 gene locus_tag LOCUS_24360 15071 13950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence086 324 1277 gene locus_tag LOCUS_24370 324 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 1296 2588 gene locus_tag LOCUS_24380 1296 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2585 4921 gene locus_tag LOCUS_24390 2585 4921 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256605.1 protein_id gnl|my_center|LOCUS_24390 5020 5370 gene locus_tag LOCUS_24400 5020 5370 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020391.1 protein_id gnl|my_center|LOCUS_24400 5402 6064 gene locus_tag LOCUS_24410 5402 6064 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_24410 6057 6434 gene locus_tag LOCUS_24420 6057 6434 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886888.1 protein_id gnl|my_center|LOCUS_24420 6418 6807 gene locus_tag LOCUS_24430 6418 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 6804 7289 gene locus_tag LOCUS_24440 6804 7289 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_24440 7329 8033 gene locus_tag LOCUS_24450 7329 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 8089 8844 gene locus_tag LOCUS_24460 8089 8844 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_24460 8856 9602 gene locus_tag LOCUS_24470 8856 9602 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_24470 9602 9745 gene locus_tag LOCUS_24480 9602 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 9818 10693 gene locus_tag LOCUS_24490 9818 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 10690 10962 gene locus_tag LOCUS_24500 10690 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 10955 11599 gene locus_tag LOCUS_24510 10955 11599 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871015.1 protein_id gnl|my_center|LOCUS_24510 11835 12101 gene locus_tag LOCUS_24520 gene rpsT 11835 12101 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258282.1 protein_id gnl|my_center|LOCUS_24520 12901 12203 gene locus_tag LOCUS_24530 12901 12203 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_24530 14082 12913 gene locus_tag LOCUS_24540 14082 12913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 <15026 14117 gene locus_tag LOCUS_24550 <15026 14117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403827.1:PHP domain-containing protein >Feature sequence087 1786 1124 gene locus_tag LOCUS_24560 1786 1124 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969699.1 protein_id gnl|my_center|LOCUS_24560 2427 1963 gene locus_tag LOCUS_24570 2427 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 4236 2431 gene locus_tag LOCUS_24580 gene polX 4236 2431 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_24580 5672 4395 gene locus_tag LOCUS_24590 5672 4395 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_24590 6774 5752 gene locus_tag LOCUS_24600 6774 5752 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_24600 7764 6784 gene locus_tag LOCUS_24610 gene pdhA 7764 6784 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_24610 8573 7773 gene locus_tag LOCUS_24620 gene nagR 8573 7773 CDS product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 protein_id gnl|my_center|LOCUS_24620 8761 9645 gene locus_tag LOCUS_24630 8761 9645 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142528.1 protein_id gnl|my_center|LOCUS_24630 9652 10638 gene locus_tag LOCUS_24640 9652 10638 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211128.1 protein_id gnl|my_center|LOCUS_24640 10753 11064 gene locus_tag LOCUS_24650 10753 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 11981 11076 gene locus_tag LOCUS_24660 11981 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 13099 12071 gene locus_tag LOCUS_24670 13099 12071 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706765.1 protein_id gnl|my_center|LOCUS_24670 14979 13168 gene locus_tag LOCUS_24680 14979 13168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence088 57 761 gene locus_tag LOCUS_24690 57 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1106 2521 gene locus_tag LOCUS_24700 1106 2521 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582870.1 protein_id gnl|my_center|LOCUS_24700 2635 3522 gene locus_tag LOCUS_24710 2635 3522 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584089.1 protein_id gnl|my_center|LOCUS_24710 3519 4355 gene locus_tag LOCUS_24720 3519 4355 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525321.1 protein_id gnl|my_center|LOCUS_24720 4435 5460 gene locus_tag LOCUS_24730 4435 5460 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046798190.1 protein_id gnl|my_center|LOCUS_24730 6584 5490 gene locus_tag LOCUS_24740 6584 5490 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_24740 9942 6571 gene locus_tag LOCUS_24750 9942 6571 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_24750 10970 9933 gene locus_tag LOCUS_24760 gene purR 10970 9933 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190982.1 protein_id gnl|my_center|LOCUS_24760 11333 13303 gene locus_tag LOCUS_24770 11333 13303 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582684.1 protein_id gnl|my_center|LOCUS_24770 13369 14379 gene locus_tag LOCUS_24780 13369 14379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582577.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence089 1190 1047 gene locus_tag LOCUS_24790 1190 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1978 1187 gene locus_tag LOCUS_24800 1978 1187 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890440.1 protein_id gnl|my_center|LOCUS_24800 4628 2439 gene locus_tag LOCUS_24810 4628 2439 CDS product VIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_24810 8186 4743 gene locus_tag LOCUS_24820 8186 4743 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257778.1 protein_id gnl|my_center|LOCUS_24820 9651 8326 gene locus_tag LOCUS_24830 9651 8326 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256713.1 protein_id gnl|my_center|LOCUS_24830 10336 9632 gene locus_tag LOCUS_24840 10336 9632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_24840 11623 10403 gene locus_tag LOCUS_24850 11623 10403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_24850 12874 11642 gene locus_tag LOCUS_24860 12874 11642 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_24860 13701 13105 gene locus_tag LOCUS_24870 13701 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 <14635 13772 gene locus_tag LOCUS_24880 <14635 13772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968596.1:aldo/keto reductase >Feature sequence090 643 71 gene locus_tag LOCUS_24890 643 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 954 640 gene locus_tag LOCUS_24900 954 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1432 1136 gene locus_tag LOCUS_24910 1432 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1918 1574 gene locus_tag LOCUS_24920 1918 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2917 1922 gene locus_tag LOCUS_24930 gene xerD 2917 1922 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_24930 3041 2965 gene locus_tag LOCUS_t00270 3041 2965 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3154 3082 gene locus_tag LOCUS_t00280 3154 3082 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3977 3414 gene locus_tag LOCUS_24940 3977 3414 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_24940 5608 3965 gene locus_tag LOCUS_24950 5608 3965 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_24950 6669 5605 gene locus_tag LOCUS_24960 6669 5605 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257083.1 protein_id gnl|my_center|LOCUS_24960 7559 6666 gene locus_tag LOCUS_24970 7559 6666 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256891.1 protein_id gnl|my_center|LOCUS_24970 8134 7556 gene locus_tag LOCUS_24980 8134 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 9692 8295 gene locus_tag LOCUS_24990 9692 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 11058 10024 gene locus_tag LOCUS_25000 gene aztC 11058 10024 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532309.1 protein_id gnl|my_center|LOCUS_25000 11302 11922 gene locus_tag LOCUS_25010 11302 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 14282 12318 gene locus_tag LOCUS_25020 14282 12318 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence091 3968 2781 gene locus_tag LOCUS_25030 3968 2781 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880142.1 protein_id gnl|my_center|LOCUS_25030 4722 4132 gene locus_tag LOCUS_25040 gene leuD 4722 4132 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_25040 6180 4777 gene locus_tag LOCUS_25050 gene leuC 6180 4777 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_25050 8375 6636 gene locus_tag LOCUS_25060 8375 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 8727 8407 gene locus_tag LOCUS_25070 8727 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 10580 8748 gene locus_tag LOCUS_25080 10580 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 12038 10926 gene locus_tag LOCUS_25090 12038 10926 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_25090 12179 13618 gene locus_tag LOCUS_25100 12179 13618 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence092 3 645 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcacccccacgcatgtggggaacac 949 647 gene locus_tag LOCUS_25110 949 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1895 930 gene locus_tag LOCUS_25120 gene cas1e 1895 930 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_25120 2573 1944 gene locus_tag LOCUS_25130 gene cas6e 2573 1944 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 protein_id gnl|my_center|LOCUS_25130 3252 2587 gene locus_tag LOCUS_25140 gene cas5e 3252 2587 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_25140 4397 3249 gene locus_tag LOCUS_25150 gene cas7e 4397 3249 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227612.1 protein_id gnl|my_center|LOCUS_25150 5010 4465 gene locus_tag LOCUS_25160 5010 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 6579 5035 gene locus_tag LOCUS_25170 gene casA 6579 5035 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 protein_id gnl|my_center|LOCUS_25170 10314 6631 gene locus_tag LOCUS_25180 10314 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 10653 10444 gene locus_tag LOCUS_25190 10653 10444 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258795.1 protein_id gnl|my_center|LOCUS_25190 11515 10766 gene locus_tag LOCUS_25200 11515 10766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_25200 12385 11564 gene locus_tag LOCUS_25210 gene modA 12385 11564 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_25210 12948 12382 gene locus_tag LOCUS_25220 12948 12382 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258349.1 protein_id gnl|my_center|LOCUS_25220 13215 14156 gene locus_tag LOCUS_25230 13215 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence093 553 161 gene locus_tag LOCUS_25240 553 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 1968 628 gene locus_tag LOCUS_25250 1968 628 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_25250 3770 2004 gene locus_tag LOCUS_25260 3770 2004 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_25260 3881 6178 gene locus_tag LOCUS_25270 3881 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 6248 7684 gene locus_tag LOCUS_25280 6248 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 7870 9255 gene locus_tag LOCUS_25290 7870 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 9420 10316 gene locus_tag LOCUS_25300 9420 10316 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_25300 10318 11250 gene locus_tag LOCUS_25310 10318 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 12358 11240 gene locus_tag LOCUS_25320 gene chrA 12358 11240 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_25320 13475 12492 gene locus_tag LOCUS_25330 13475 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence094 437 1045 gene locus_tag LOCUS_25340 437 1045 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_25340 2158 1094 gene locus_tag LOCUS_25350 2158 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3049 2165 gene locus_tag LOCUS_25360 3049 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 3161 3598 gene locus_tag LOCUS_25370 3161 3598 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_25370 3725 4750 gene locus_tag LOCUS_25380 3725 4750 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_25380 4766 5650 gene locus_tag LOCUS_25390 4766 5650 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458882.1 protein_id gnl|my_center|LOCUS_25390 5634 6482 gene locus_tag LOCUS_25400 5634 6482 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_25400 6634 7821 gene locus_tag LOCUS_25410 6634 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 11025 7954 gene locus_tag LOCUS_25420 11025 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 12008 11166 gene locus_tag LOCUS_25430 12008 11166 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330131.1 protein_id gnl|my_center|LOCUS_25430 13367 12015 gene locus_tag LOCUS_25440 gene trmFO 13367 12015 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence095 717 1484 gene locus_tag LOCUS_25450 717 1484 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063718.1 protein_id gnl|my_center|LOCUS_25450 1788 3851 gene locus_tag LOCUS_25460 gene fusA 1788 3851 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258549.1 protein_id gnl|my_center|LOCUS_25460 3999 5519 gene locus_tag LOCUS_25470 3999 5519 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530067.1 protein_id gnl|my_center|LOCUS_25470 5564 7102 gene locus_tag LOCUS_25480 5564 7102 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_25480 7174 8328 gene locus_tag LOCUS_25490 7174 8328 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_25490 8466 9248 gene locus_tag LOCUS_25500 8466 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 9356 10954 gene locus_tag LOCUS_25510 9356 10954 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_25510 11077 11997 gene locus_tag LOCUS_25520 11077 11997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_25520 12008 12919 gene locus_tag LOCUS_25530 12008 12919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328129.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence096 <1 790 gene locus_tag LOCUS_25540 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882798.1:SUMF1/EgtB/PvdO family nonheme iron enzyme 1514 939 gene locus_tag LOCUS_25550 1514 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 3709 1559 gene locus_tag LOCUS_25560 3709 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 4316 3711 gene locus_tag LOCUS_25570 4316 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 4774 4427 gene locus_tag LOCUS_25580 4774 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 5038 4811 gene locus_tag LOCUS_25590 5038 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 7327 5126 gene locus_tag LOCUS_25600 7327 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 8723 7311 gene locus_tag LOCUS_25610 8723 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 9111 8905 gene locus_tag LOCUS_25620 9111 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence097 152 2593 gene locus_tag LOCUS_25630 152 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25630 2596 4089 gene locus_tag LOCUS_25640 2596 4089 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_25640 4086 5123 gene locus_tag LOCUS_25650 4086 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 5187 5873 gene locus_tag LOCUS_25660 5187 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 5949 6920 gene locus_tag LOCUS_25670 5949 6920 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967414.1 protein_id gnl|my_center|LOCUS_25670 7099 12282 gene locus_tag LOCUS_25680 7099 12282 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_25680 12999 12526 gene locus_tag LOCUS_25690 12999 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence098 <1 1430 gene locus_tag LOCUS_25700 <1 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243243.1:PEP/pyruvate-binding domain-containing protein 1432 3558 gene locus_tag LOCUS_25710 1432 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 4001 4462 gene locus_tag LOCUS_25720 4001 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 4568 4849 gene locus_tag LOCUS_25730 4568 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 5913 4954 gene locus_tag LOCUS_25740 5913 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 6279 9065 gene locus_tag LOCUS_25750 6279 9065 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262972.1 protein_id gnl|my_center|LOCUS_25750 9082 9753 gene locus_tag LOCUS_25760 9082 9753 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262971.1 protein_id gnl|my_center|LOCUS_25760 9750 10451 gene locus_tag LOCUS_25770 9750 10451 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262970.1 protein_id gnl|my_center|LOCUS_25770 11427 10459 gene locus_tag LOCUS_25780 11427 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence099 490 1617 gene locus_tag LOCUS_25790 490 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1626 3791 gene locus_tag LOCUS_25800 1626 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 3796 6150 gene locus_tag LOCUS_25810 3796 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 6189 6956 gene locus_tag LOCUS_25820 6189 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 6967 7584 gene locus_tag LOCUS_25830 gene rsmD 6967 7584 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_25830 7581 8999 gene locus_tag LOCUS_25840 7581 8999 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_25840 9319 9555 gene locus_tag LOCUS_25850 9319 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 9552 10013 gene locus_tag LOCUS_25860 9552 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence100 94 2469 gene locus_tag LOCUS_25870 94 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 3552 2752 gene locus_tag LOCUS_25880 3552 2752 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947788.1 protein_id gnl|my_center|LOCUS_25880 6729 3679 gene locus_tag LOCUS_25890 6729 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 6936 9470 gene locus_tag LOCUS_25900 6936 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 11907 9436 gene locus_tag LOCUS_25910 11907 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence101 501 1802 gene locus_tag LOCUS_25920 501 1802 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_25920 1799 2773 gene locus_tag LOCUS_25930 1799 2773 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_25930 2770 3903 gene locus_tag LOCUS_25940 2770 3903 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976168.1 protein_id gnl|my_center|LOCUS_25940 3958 5034 gene locus_tag LOCUS_25950 3958 5034 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119268.1 protein_id gnl|my_center|LOCUS_25950 5054 5236 gene locus_tag LOCUS_25960 5054 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 5233 6159 gene locus_tag LOCUS_25970 5233 6159 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989852.1 protein_id gnl|my_center|LOCUS_25970 6399 7481 gene locus_tag LOCUS_25980 6399 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 7551 9020 gene locus_tag LOCUS_25990 7551 9020 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140810.1 protein_id gnl|my_center|LOCUS_25990 9017 10018 gene locus_tag LOCUS_26000 9017 10018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530865.1 protein_id gnl|my_center|LOCUS_26000 10015 11004 gene locus_tag LOCUS_26010 10015 11004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969744.1 protein_id gnl|my_center|LOCUS_26010 12073 11030 gene locus_tag LOCUS_26020 12073 11030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence102 1609 239 gene locus_tag LOCUS_26030 1609 239 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_26030 3476 1866 gene locus_tag LOCUS_26040 3476 1866 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 protein_id gnl|my_center|LOCUS_26040 4060 3479 gene locus_tag LOCUS_26050 4060 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 5313 4069 gene locus_tag LOCUS_26060 5313 4069 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121116.1 protein_id gnl|my_center|LOCUS_26060 7281 5443 gene locus_tag LOCUS_26070 7281 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 7493 9481 gene locus_tag LOCUS_26080 gene uvrC 7493 9481 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_26080 9478 12069 gene locus_tag LOCUS_26090 9478 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 <12706 12086 gene locus_tag LOCUS_26100 <12706 12086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259632.1:metallophosphoesterase family protein >Feature sequence103 1028 3 gene locus_tag LOCUS_26110 1028 3 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_26110 3893 1233 gene locus_tag LOCUS_26120 3893 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 5409 3898 gene locus_tag LOCUS_26130 5409 3898 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975886.1 protein_id gnl|my_center|LOCUS_26130 6345 5467 gene locus_tag LOCUS_26140 6345 5467 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_26140 7285 6359 gene locus_tag LOCUS_26150 7285 6359 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582771.1 protein_id gnl|my_center|LOCUS_26150 8877 7480 gene locus_tag LOCUS_26160 8877 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 10004 9006 gene locus_tag LOCUS_26170 gene cytR 10004 9006 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 protein_id gnl|my_center|LOCUS_26170 11394 10243 gene locus_tag LOCUS_26180 11394 10243 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257396.1 protein_id gnl|my_center|LOCUS_26180 12107 11391 gene locus_tag LOCUS_26190 12107 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 12700 12149 gene locus_tag LOCUS_26200 12700 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence104 1596 562 gene locus_tag LOCUS_26210 1596 562 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625202.1 protein_id gnl|my_center|LOCUS_26210 1951 3333 gene locus_tag LOCUS_26220 1951 3333 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_26220 3407 5617 gene locus_tag LOCUS_26230 3407 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 5668 6078 gene locus_tag LOCUS_26240 5668 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 6082 7023 gene locus_tag LOCUS_26250 6082 7023 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_26250 7150 9345 gene locus_tag LOCUS_26260 7150 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 10564 9251 gene locus_tag LOCUS_26270 10564 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 10920 12161 gene locus_tag LOCUS_26280 10920 12161 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776807.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence105 404 177 gene locus_tag LOCUS_26290 404 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 1821 973 gene locus_tag LOCUS_26300 1821 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2398 4191 gene locus_tag LOCUS_26310 gene ilvB 2398 4191 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256073.1 protein_id gnl|my_center|LOCUS_26310 4217 4789 gene locus_tag LOCUS_26320 gene ilvN 4217 4789 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_26320 4903 5907 gene locus_tag LOCUS_26330 gene ilvC 4903 5907 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256075.1 protein_id gnl|my_center|LOCUS_26330 5937 7712 gene locus_tag LOCUS_26340 5937 7712 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256076.1 protein_id gnl|my_center|LOCUS_26340 9030 7756 gene locus_tag LOCUS_26350 gene solA 9030 7756 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_26350 10286 9027 gene locus_tag LOCUS_26360 10286 9027 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528560.1 protein_id gnl|my_center|LOCUS_26360 11824 10298 gene locus_tag LOCUS_26370 11824 10298 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence106 660 1481 gene locus_tag LOCUS_26380 660 1481 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_26380 1600 3024 gene locus_tag LOCUS_26390 1600 3024 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_26390 3148 4017 gene locus_tag LOCUS_26400 3148 4017 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895851.1 protein_id gnl|my_center|LOCUS_26400 3977 5095 gene locus_tag LOCUS_26410 gene sds 3977 5095 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_26410 5189 6727 gene locus_tag LOCUS_26420 5189 6727 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259273.1 protein_id gnl|my_center|LOCUS_26420 6783 7121 gene locus_tag LOCUS_26430 6783 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 7135 7563 gene locus_tag LOCUS_26440 7135 7563 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263230.1 protein_id gnl|my_center|LOCUS_26440 7566 8717 gene locus_tag LOCUS_26450 7566 8717 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259270.1 protein_id gnl|my_center|LOCUS_26450 9634 8732 gene locus_tag LOCUS_26460 9634 8732 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_26460 9736 10557 gene locus_tag LOCUS_26470 9736 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_26470 10644 12128 gene locus_tag LOCUS_26480 10644 12128 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258284.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence107 611 2152 gene locus_tag LOCUS_26490 611 2152 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164830003.1 protein_id gnl|my_center|LOCUS_26490 2158 3174 gene locus_tag LOCUS_26500 2158 3174 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_26500 4346 3165 gene locus_tag LOCUS_26510 4346 3165 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337640.1 protein_id gnl|my_center|LOCUS_26510 5441 4377 gene locus_tag LOCUS_26520 5441 4377 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066908.1 protein_id gnl|my_center|LOCUS_26520 7522 5474 gene locus_tag LOCUS_26530 7522 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 8632 7607 gene locus_tag LOCUS_26540 8632 7607 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_26540 8878 9297 gene locus_tag LOCUS_26550 8878 9297 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_26550 9667 9281 gene locus_tag LOCUS_26560 gene crcB 9667 9281 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258331.1 protein_id gnl|my_center|LOCUS_26560 10516 9683 gene locus_tag LOCUS_26570 10516 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 12122 10554 gene locus_tag LOCUS_26580 12122 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence108 473 1498 gene locus_tag LOCUS_26590 473 1498 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_26590 1495 1980 gene locus_tag LOCUS_26600 1495 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2039 2518 gene locus_tag LOCUS_26610 2039 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2534 4165 gene locus_tag LOCUS_26620 2534 4165 CDS product DUF5671 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259395.1 protein_id gnl|my_center|LOCUS_26620 4952 4206 gene locus_tag LOCUS_26630 4952 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 5164 5394 gene locus_tag LOCUS_26640 5164 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 5417 7174 gene locus_tag LOCUS_26650 gene metG 5417 7174 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259302.1 protein_id gnl|my_center|LOCUS_26650 7177 8865 gene locus_tag LOCUS_26660 7177 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 8878 10620 gene locus_tag LOCUS_26670 8878 10620 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257185.1 protein_id gnl|my_center|LOCUS_26670 10684 11448 gene locus_tag LOCUS_26680 10684 11448 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329339.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence109 1293 331 gene locus_tag LOCUS_26690 1293 331 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227915.1 protein_id gnl|my_center|LOCUS_26690 2496 1297 gene locus_tag LOCUS_26700 2496 1297 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155697526.1 protein_id gnl|my_center|LOCUS_26700 3843 2620 gene locus_tag LOCUS_26710 3843 2620 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_26710 5380 3851 gene locus_tag LOCUS_26720 5380 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 8187 5359 gene locus_tag LOCUS_26730 8187 5359 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_26730 9124 8993 gene locus_tag LOCUS_26740 9124 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 9583 9179 gene locus_tag LOCUS_26750 9583 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 9834 9580 gene locus_tag LOCUS_26760 9834 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 10344 10033 gene locus_tag LOCUS_26770 10344 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 10975 11451 gene locus_tag LOCUS_26780 10975 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 11473 11637 gene locus_tag LOCUS_26790 11473 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence110 62 580 gene locus_tag LOCUS_26800 gene ruvC 62 580 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_26800 632 1222 gene locus_tag LOCUS_26810 gene ruvA 632 1222 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_26810 1309 1875 gene locus_tag LOCUS_26820 gene efp 1309 1875 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699839.1 protein_id gnl|my_center|LOCUS_26820 1947 2019 gene locus_tag LOCUS_t00290 1947 2019 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3068 2043 gene locus_tag LOCUS_26830 3068 2043 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066950.1 protein_id gnl|my_center|LOCUS_26830 3922 3104 gene locus_tag LOCUS_26840 3922 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 4911 3919 gene locus_tag LOCUS_26850 4911 3919 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640552.1 protein_id gnl|my_center|LOCUS_26850 5812 5018 gene locus_tag LOCUS_26860 5812 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 6800 5832 gene locus_tag LOCUS_26870 6800 5832 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_26870 7738 6830 gene locus_tag LOCUS_26880 7738 6830 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_26880 8636 7740 gene locus_tag LOCUS_26890 8636 7740 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434865.1 protein_id gnl|my_center|LOCUS_26890 8823 8581 gene locus_tag LOCUS_26900 8823 8581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 10181 8778 gene locus_tag LOCUS_26910 10181 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 11141 10254 gene locus_tag LOCUS_26920 11141 10254 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767091.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence111 <1 778 gene locus_tag LOCUS_26930 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530648.1:xanthine dehydrogenase family protein subunit M 793 1266 gene locus_tag LOCUS_26940 793 1266 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_26940 1301 3541 gene locus_tag LOCUS_26950 1301 3541 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_26950 3544 3837 gene locus_tag LOCUS_26960 3544 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 3851 5749 gene locus_tag LOCUS_26970 gene mutL 3851 5749 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_26970 7039 5774 gene locus_tag LOCUS_26980 7039 5774 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117040.1 protein_id gnl|my_center|LOCUS_26980 8233 7046 gene locus_tag LOCUS_26990 8233 7046 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257433.1 protein_id gnl|my_center|LOCUS_26990 8845 8387 gene locus_tag LOCUS_27000 8845 8387 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_27000 9809 8976 gene locus_tag LOCUS_27010 9809 8976 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876426.1 protein_id gnl|my_center|LOCUS_27010 9972 10469 gene locus_tag LOCUS_27020 9972 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 10473 10784 gene locus_tag LOCUS_27030 10473 10784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence112 631 3759 gene locus_tag LOCUS_27040 631 3759 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466704.1 protein_id gnl|my_center|LOCUS_27040 4478 3777 gene locus_tag LOCUS_27050 4478 3777 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480283.1 protein_id gnl|my_center|LOCUS_27050 5603 4521 gene locus_tag LOCUS_27060 5603 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 7620 5614 gene locus_tag LOCUS_27070 7620 5614 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_27070 8654 7620 gene locus_tag LOCUS_27080 8654 7620 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_27080 9656 8691 gene locus_tag LOCUS_27090 9656 8691 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066803.1 protein_id gnl|my_center|LOCUS_27090 <11476 9747 gene locus_tag LOCUS_27100 <11476 9747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532991.1:LuxR C-terminal-related transcriptional regulator >Feature sequence113 613 816 gene locus_tag LOCUS_27110 613 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 880 1449 gene locus_tag LOCUS_27120 880 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 1446 2591 gene locus_tag LOCUS_27130 1446 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 3019 3816 gene locus_tag LOCUS_27140 3019 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_27140 3809 4354 gene locus_tag LOCUS_27150 3809 4354 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_27150 4369 7812 gene locus_tag LOCUS_27160 gene brxC 4369 7812 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_27160 7889 8416 gene locus_tag LOCUS_27170 7889 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 8406 9836 gene locus_tag LOCUS_27180 8406 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 9784 10005 gene locus_tag LOCUS_27190 9784 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence114 328 789 gene locus_tag LOCUS_27200 328 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 822 2378 gene locus_tag LOCUS_27210 822 2378 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931874.1 protein_id gnl|my_center|LOCUS_27210 2432 3838 gene locus_tag LOCUS_27220 2432 3838 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_27220 3835 5322 gene locus_tag LOCUS_27230 3835 5322 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_27230 5342 5905 gene locus_tag LOCUS_27240 5342 5905 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015893.1 protein_id gnl|my_center|LOCUS_27240 5902 6396 gene locus_tag LOCUS_27250 5902 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 6410 8077 gene locus_tag LOCUS_27260 6410 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 9862 8285 gene locus_tag LOCUS_27270 9862 8285 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967162.1 protein_id gnl|my_center|LOCUS_27270 <11306 9965 gene locus_tag LOCUS_27280 <11306 9965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681568.1:heavy metal translocating P-type ATPase >Feature sequence115 19 2430 gene locus_tag LOCUS_27290 19 2430 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258076.1 protein_id gnl|my_center|LOCUS_27290 2423 2875 gene locus_tag LOCUS_27300 2423 2875 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958317.1 protein_id gnl|my_center|LOCUS_27300 2872 3378 gene locus_tag LOCUS_27310 2872 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3375 4973 gene locus_tag LOCUS_27320 3375 4973 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258079.1 protein_id gnl|my_center|LOCUS_27320 4980 5465 gene locus_tag LOCUS_27330 4980 5465 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_27330 5469 5759 gene locus_tag LOCUS_27340 5469 5759 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258081.1 protein_id gnl|my_center|LOCUS_27340 5766 6107 gene locus_tag LOCUS_27350 5766 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 6161 7318 gene locus_tag LOCUS_27360 6161 7318 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 protein_id gnl|my_center|LOCUS_27360 7315 8700 gene locus_tag LOCUS_27370 7315 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 8845 9615 gene locus_tag LOCUS_27380 8845 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence116 783 1361 gene locus_tag LOCUS_27390 783 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2080 1385 gene locus_tag LOCUS_27400 2080 1385 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967389.1 protein_id gnl|my_center|LOCUS_27400 2636 3739 gene locus_tag LOCUS_27410 2636 3739 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_27410 5922 3829 gene locus_tag LOCUS_27420 5922 3829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 protein_id gnl|my_center|LOCUS_27420 6870 5947 gene locus_tag LOCUS_27430 6870 5947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532882.1 protein_id gnl|my_center|LOCUS_27430 8196 6898 gene locus_tag LOCUS_27440 8196 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 9975 8314 gene locus_tag LOCUS_27450 9975 8314 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528697.1 protein_id gnl|my_center|LOCUS_27450 10175 10612 gene locus_tag LOCUS_27460 gene fur 10175 10612 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732028.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence117 1059 133 gene locus_tag LOCUS_27470 1059 133 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_27470 2510 1113 gene locus_tag LOCUS_27480 2510 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 2811 3749 gene locus_tag LOCUS_27490 2811 3749 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258542.1 protein_id gnl|my_center|LOCUS_27490 3790 5862 gene locus_tag LOCUS_27500 gene ligA 3790 5862 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_27500 5878 6435 gene locus_tag LOCUS_27510 5878 6435 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929177.1 protein_id gnl|my_center|LOCUS_27510 7351 6470 gene locus_tag LOCUS_27520 7351 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 7503 8750 gene locus_tag LOCUS_27530 7503 8750 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 protein_id gnl|my_center|LOCUS_27530 8905 10140 gene locus_tag LOCUS_27540 8905 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 10621 10133 gene locus_tag LOCUS_27550 10621 10133 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence118 432 1250 gene locus_tag LOCUS_27560 432 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1401 4718 gene locus_tag LOCUS_27570 1401 4718 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_27570 4722 7598 gene locus_tag LOCUS_27580 4722 7598 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_27580 7991 8599 gene locus_tag LOCUS_27590 7991 8599 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 protein_id gnl|my_center|LOCUS_27590 8587 9210 gene locus_tag LOCUS_27600 8587 9210 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence119 2113 659 gene locus_tag LOCUS_27610 2113 659 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_27610 3525 2140 gene locus_tag LOCUS_27620 3525 2140 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083032.1 protein_id gnl|my_center|LOCUS_27620 5616 3574 gene locus_tag LOCUS_27630 5616 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 6967 5687 gene locus_tag LOCUS_27640 6967 5687 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256133.1 protein_id gnl|my_center|LOCUS_27640 7912 7019 gene locus_tag LOCUS_27650 7912 7019 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532486.1 protein_id gnl|my_center|LOCUS_27650 8879 7953 gene locus_tag LOCUS_27660 8879 7953 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_27660 10290 8947 gene locus_tag LOCUS_27670 10290 8947 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122964585.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence120 >Feature sequence121 <1 650 gene locus_tag LOCUS_27680 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108530.1:non-lysosomal glucosylceramidase 962 729 gene locus_tag LOCUS_27690 962 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1078 1151 gene locus_tag LOCUS_t00300 1078 1151 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1749 1210 gene locus_tag LOCUS_27700 1749 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 3526 1742 gene locus_tag LOCUS_27710 3526 1742 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_27710 5782 3602 gene locus_tag LOCUS_27720 5782 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 6580 5810 gene locus_tag LOCUS_27730 6580 5810 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_27730 6793 8013 gene locus_tag LOCUS_27740 6793 8013 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_27740 8016 9746 gene locus_tag LOCUS_27750 gene menD 8016 9746 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence122 11 104 gene locus_tag LOCUS_t00310 11 104 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 154 230 gene locus_tag LOCUS_t00320 154 230 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 312 1307 gene locus_tag LOCUS_27760 312 1307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812302.1 protein_id gnl|my_center|LOCUS_27760 1421 2212 gene locus_tag LOCUS_27770 1421 2212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_27770 2462 4459 gene locus_tag LOCUS_27780 2462 4459 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144035.1 protein_id gnl|my_center|LOCUS_27780 4476 4733 gene locus_tag LOCUS_27790 4476 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 4717 5517 gene locus_tag LOCUS_27800 gene sgcQ 4717 5517 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118614.1 protein_id gnl|my_center|LOCUS_27800 5545 6621 gene locus_tag LOCUS_27810 5545 6621 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228989.1 protein_id gnl|my_center|LOCUS_27810 6751 8022 gene locus_tag LOCUS_27820 6751 8022 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181452.1 protein_id gnl|my_center|LOCUS_27820 8130 9410 gene locus_tag LOCUS_27830 8130 9410 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707185.1 protein_id gnl|my_center|LOCUS_27830 9407 10276 gene locus_tag LOCUS_27840 gene ilvE 9407 10276 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence123 1085 3721 gene locus_tag LOCUS_27850 gene gyrA 1085 3721 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_27850 3724 5091 gene locus_tag LOCUS_27860 3724 5091 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_27860 5301 5939 gene locus_tag LOCUS_27870 gene lepB 5301 5939 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257166.1 protein_id gnl|my_center|LOCUS_27870 6001 6786 gene locus_tag LOCUS_27880 gene deoC 6001 6786 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256596.1 protein_id gnl|my_center|LOCUS_27880 6790 7086 gene locus_tag LOCUS_27890 6790 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 7150 7863 gene locus_tag LOCUS_27900 7150 7863 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964695.1 protein_id gnl|my_center|LOCUS_27900 9509 7845 gene locus_tag LOCUS_27910 9509 7845 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_27910 9657 9782 gene locus_tag LOCUS_27920 9657 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 9801 10196 gene locus_tag LOCUS_27930 9801 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27930 10370 10443 gene locus_tag LOCUS_t00330 10370 10443 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence124 1073 927 gene locus_tag LOCUS_27940 1073 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 1967 1161 gene locus_tag LOCUS_27950 1967 1161 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259577.1 protein_id gnl|my_center|LOCUS_27950 2818 2120 gene locus_tag LOCUS_27960 gene ureG 2818 2120 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055912.1 protein_id gnl|my_center|LOCUS_27960 4554 2839 gene locus_tag LOCUS_27970 gene ureC 4554 2839 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186033.1 protein_id gnl|my_center|LOCUS_27970 4880 4551 gene locus_tag LOCUS_27980 4880 4551 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 protein_id gnl|my_center|LOCUS_27980 5229 4924 gene locus_tag LOCUS_27990 5229 4924 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832402.1 protein_id gnl|my_center|LOCUS_27990 6130 5243 gene locus_tag LOCUS_28000 6130 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 6836 6144 gene locus_tag LOCUS_28010 6836 6144 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 protein_id gnl|my_center|LOCUS_28010 7151 9283 gene locus_tag LOCUS_28020 7151 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 >Feature sequence125 865 35 gene locus_tag LOCUS_28030 865 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 2671 887 gene locus_tag LOCUS_28040 2671 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 3505 2726 gene locus_tag LOCUS_28050 3505 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 4769 3783 gene locus_tag LOCUS_28060 4769 3783 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_28060 4978 7128 gene locus_tag LOCUS_28070 4978 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 7258 7854 gene locus_tag LOCUS_28080 7258 7854 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064451.1 protein_id gnl|my_center|LOCUS_28080 7885 8475 gene locus_tag LOCUS_28090 7885 8475 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence126 2194 341 gene locus_tag LOCUS_28100 2194 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2916 2422 gene locus_tag LOCUS_28110 2916 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 3144 4091 gene locus_tag LOCUS_28120 3144 4091 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227993.1 protein_id gnl|my_center|LOCUS_28120 4242 5918 gene locus_tag LOCUS_28130 4242 5918 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255963.1 protein_id gnl|my_center|LOCUS_28130 6033 6959 gene locus_tag LOCUS_28140 6033 6959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_28140 6943 7758 gene locus_tag LOCUS_28150 6943 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 7808 8242 gene locus_tag LOCUS_28160 7808 8242 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049420.1 protein_id gnl|my_center|LOCUS_28160 8484 8239 gene locus_tag LOCUS_28170 8484 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 9625 8585 gene locus_tag LOCUS_28180 9625 8585 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522370.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence127 661 588 gene locus_tag LOCUS_t00340 661 588 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 788 715 gene locus_tag LOCUS_t00350 788 715 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 883 809 gene locus_tag LOCUS_t00360 883 809 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 999 927 gene locus_tag LOCUS_t00370 999 927 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1090 1018 gene locus_tag LOCUS_t00380 1090 1018 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1193 1109 gene locus_tag LOCUS_t00390 1193 1109 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2272 1265 gene locus_tag LOCUS_28190 2272 1265 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_28190 2504 3502 gene locus_tag LOCUS_28200 2504 3502 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_28200 3504 5024 gene locus_tag LOCUS_28210 3504 5024 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_28210 5048 6049 gene locus_tag LOCUS_28220 5048 6049 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210221.1 protein_id gnl|my_center|LOCUS_28220 6070 7044 gene locus_tag LOCUS_28230 gene rbsC 6070 7044 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_28230 7196 8194 gene locus_tag LOCUS_28240 7196 8194 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661512.1 protein_id gnl|my_center|LOCUS_28240 8320 9273 gene locus_tag LOCUS_28250 8320 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 >Feature sequence128 558 1574 gene locus_tag LOCUS_28260 gene recA 558 1574 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392593.1 protein_id gnl|my_center|LOCUS_28260 1751 3319 gene locus_tag LOCUS_28270 gene rny 1751 3319 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965122.1 protein_id gnl|my_center|LOCUS_28270 3537 3824 gene locus_tag LOCUS_28280 3537 3824 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080441.1 protein_id gnl|my_center|LOCUS_28280 4933 3905 gene locus_tag LOCUS_28290 4933 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 6095 4992 gene locus_tag LOCUS_28300 gene holB 6095 4992 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_28300 6577 6197 gene locus_tag LOCUS_28310 gene rplL 6577 6197 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 protein_id gnl|my_center|LOCUS_28310 7207 6677 gene locus_tag LOCUS_28320 gene rplJ 7207 6677 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291634.1 protein_id gnl|my_center|LOCUS_28320 8343 7462 gene locus_tag LOCUS_28330 gene hslO 8343 7462 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656366.1 protein_id gnl|my_center|LOCUS_28330 9180 8461 gene locus_tag LOCUS_28340 gene rplA 9180 8461 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258051.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence129 188 454 gene locus_tag LOCUS_28350 188 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 697 512 gene locus_tag LOCUS_28360 697 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 976 1662 gene locus_tag LOCUS_28370 976 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1659 2132 gene locus_tag LOCUS_28380 1659 2132 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037424.1 protein_id gnl|my_center|LOCUS_28380 3811 2129 gene locus_tag LOCUS_28390 3811 2129 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_28390 4218 3829 gene locus_tag LOCUS_28400 4218 3829 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656695.1 protein_id gnl|my_center|LOCUS_28400 5546 4215 gene locus_tag LOCUS_28410 5546 4215 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_28410 6923 5556 gene locus_tag LOCUS_28420 6923 5556 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_28420 7369 7259 gene locus_tag LOCUS_r00010 7369 7259 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence130 125 3220 gene locus_tag LOCUS_28430 125 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 4412 3381 gene locus_tag LOCUS_28440 4412 3381 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_28440 4606 7197 gene locus_tag LOCUS_28450 4606 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 >Feature sequence131 603 328 gene locus_tag LOCUS_28460 603 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 909 628 gene locus_tag LOCUS_28470 909 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 1347 961 gene locus_tag LOCUS_28480 1347 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1563 1351 gene locus_tag LOCUS_28490 1563 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3740 1563 gene locus_tag LOCUS_28500 3740 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 5210 3753 gene locus_tag LOCUS_28510 5210 3753 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985923.1 protein_id gnl|my_center|LOCUS_28510 5785 5213 gene locus_tag LOCUS_28520 5785 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 7683 5794 gene locus_tag LOCUS_28530 7683 5794 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_28530 8344 7700 gene locus_tag LOCUS_28540 8344 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 9090 8701 gene locus_tag LOCUS_28550 9090 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence132 4816 3965 gene locus_tag LOCUS_28560 4816 3965 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_28560 5012 5350 gene locus_tag LOCUS_28570 5012 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 5347 5838 gene locus_tag LOCUS_28580 5347 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 6166 5843 gene locus_tag LOCUS_28590 6166 5843 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105201.1 protein_id gnl|my_center|LOCUS_28590 6202 7083 gene locus_tag LOCUS_28600 6202 7083 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133938067.1 protein_id gnl|my_center|LOCUS_28600 8471 7080 gene locus_tag LOCUS_28610 8471 7080 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_28610 8722 8510 gene locus_tag LOCUS_28620 8722 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence133 319 1209 gene locus_tag LOCUS_28630 319 1209 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_28630 1216 1503 gene locus_tag LOCUS_28640 1216 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 1512 2912 gene locus_tag LOCUS_28650 1512 2912 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 protein_id gnl|my_center|LOCUS_28650 2909 3982 gene locus_tag LOCUS_28660 2909 3982 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_28660 3970 4905 gene locus_tag LOCUS_28670 3970 4905 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707438.1 protein_id gnl|my_center|LOCUS_28670 5105 6511 gene locus_tag LOCUS_28680 5105 6511 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_28680 6666 7616 gene locus_tag LOCUS_28690 6666 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 8720 7776 gene locus_tag LOCUS_28700 8720 7776 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence134 1251 1132 gene locus_tag LOCUS_28710 1251 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 1792 2961 gene locus_tag LOCUS_28720 1792 2961 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_28720 2977 3900 gene locus_tag LOCUS_28730 2977 3900 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_28730 4872 4117 gene locus_tag LOCUS_28740 4872 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 5311 8088 gene locus_tag LOCUS_28750 gene ppdK 5311 8088 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258815.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence135 <1 745 gene locus_tag LOCUS_28760 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109491.1:FGGY-family carbohydrate kinase 878 3703 gene locus_tag LOCUS_28770 gene gyrA 878 3703 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_28770 5540 3783 gene locus_tag LOCUS_28780 gene pyk 5540 3783 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232673.1 protein_id gnl|my_center|LOCUS_28780 6697 5594 gene locus_tag LOCUS_28790 6697 5594 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_28790 7898 6855 gene locus_tag LOCUS_28800 7898 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 8742 7933 gene locus_tag LOCUS_28810 8742 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence136 2920 485 gene locus_tag LOCUS_28820 2920 485 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_28820 4001 2967 gene locus_tag LOCUS_28830 gene rsgA 4001 2967 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_28830 4223 5803 gene locus_tag LOCUS_28840 gene guaA 4223 5803 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256861.1 protein_id gnl|my_center|LOCUS_28840 5819 7426 gene locus_tag LOCUS_28850 5819 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 7740 8360 gene locus_tag LOCUS_28860 7740 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence137 <1 1017 gene locus_tag LOCUS_28870 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233927.1:DUF3048 domain-containing protein 1082 3997 gene locus_tag LOCUS_28880 1082 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 4000 5493 gene locus_tag LOCUS_28890 4000 5493 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259158.1 protein_id gnl|my_center|LOCUS_28890 5538 6509 gene locus_tag LOCUS_28900 gene lipA 5538 6509 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_28900 6506 7660 gene locus_tag LOCUS_28910 6506 7660 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_28910 7724 8224 gene locus_tag LOCUS_28920 7724 8224 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence138 2194 323 gene locus_tag LOCUS_28930 2194 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 2511 3863 gene locus_tag LOCUS_28940 2511 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 3981 4898 gene locus_tag LOCUS_28950 3981 4898 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582825.1 protein_id gnl|my_center|LOCUS_28950 4895 5812 gene locus_tag LOCUS_28960 4895 5812 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803781.1 protein_id gnl|my_center|LOCUS_28960 5822 6736 gene locus_tag LOCUS_28970 5822 6736 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803678.1 protein_id gnl|my_center|LOCUS_28970 6755 8425 gene locus_tag LOCUS_28980 6755 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence139 165 437 gene locus_tag LOCUS_28990 165 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 506 2026 gene locus_tag LOCUS_29000 506 2026 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259717.1 protein_id gnl|my_center|LOCUS_29000 3383 2055 gene locus_tag LOCUS_29010 3383 2055 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_29010 4463 3480 gene locus_tag LOCUS_29020 4463 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 5150 4473 gene locus_tag LOCUS_29030 5150 4473 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_29030 5410 6798 gene locus_tag LOCUS_29040 5410 6798 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105011.1 protein_id gnl|my_center|LOCUS_29040 8214 6919 gene locus_tag LOCUS_29050 8214 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence140 293 1327 gene locus_tag LOCUS_29060 293 1327 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173431.1 protein_id gnl|my_center|LOCUS_29060 1418 1603 gene locus_tag LOCUS_29070 gene lysW 1418 1603 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256239.1 protein_id gnl|my_center|LOCUS_29070 1605 2540 gene locus_tag LOCUS_29080 gene lysX 1605 2540 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_29080 2540 3595 gene locus_tag LOCUS_29090 gene argC 2540 3595 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_29090 3701 4504 gene locus_tag LOCUS_29100 3701 4504 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_29100 4529 5464 gene locus_tag LOCUS_29110 4529 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 5499 6704 gene locus_tag LOCUS_29120 5499 6704 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909458.1 protein_id gnl|my_center|LOCUS_29120 6701 7909 gene locus_tag LOCUS_29130 6701 7909 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence141 >Feature sequence142 <1 626 gene locus_tag LOCUS_29140 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020489.1:IS5-like element ISMac11 family transposase 655 2556 gene locus_tag LOCUS_29150 655 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 4171 2588 gene locus_tag LOCUS_29160 gene aceB 4171 2588 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227987.1 protein_id gnl|my_center|LOCUS_29160 6216 4336 gene locus_tag LOCUS_29170 gene acs 6216 4336 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228547.1 protein_id gnl|my_center|LOCUS_29170 8170 6257 gene locus_tag LOCUS_29180 gene acs 8170 6257 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence143 340 1434 gene locus_tag LOCUS_29190 340 1434 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383470.1 protein_id gnl|my_center|LOCUS_29190 1486 2307 gene locus_tag LOCUS_29200 1486 2307 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031700.1 protein_id gnl|my_center|LOCUS_29200 2646 3977 gene locus_tag LOCUS_29210 2646 3977 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129728335.1 protein_id gnl|my_center|LOCUS_29210 4115 4990 gene locus_tag LOCUS_29220 4115 4990 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270459.1 protein_id gnl|my_center|LOCUS_29220 5001 5834 gene locus_tag LOCUS_29230 5001 5834 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225176.1 protein_id gnl|my_center|LOCUS_29230 5886 6986 gene locus_tag LOCUS_29240 5886 6986 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256068.1 protein_id gnl|my_center|LOCUS_29240 7393 7827 gene locus_tag LOCUS_29250 7393 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 7842 8162 gene locus_tag LOCUS_29260 7842 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence144 <1 198 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccacatgcgtgggggtgaaccg 2683 485 gene locus_tag LOCUS_29270 2683 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 8001 2683 gene locus_tag LOCUS_29280 8001 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence145 775 227 gene locus_tag LOCUS_29290 775 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 2791 794 gene locus_tag LOCUS_29300 2791 794 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_29300 3407 2823 gene locus_tag LOCUS_29310 3407 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 3990 3400 gene locus_tag LOCUS_29320 3990 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 5503 4058 gene locus_tag LOCUS_29330 5503 4058 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114931.1 protein_id gnl|my_center|LOCUS_29330 <8084 5547 gene locus_tag LOCUS_29340 <8084 5547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080135.1:beta-galactosidase LacZ >Feature sequence146 1046 2068 gene locus_tag LOCUS_29350 1046 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 2129 2503 gene locus_tag LOCUS_29360 2129 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 2707 4536 gene locus_tag LOCUS_29370 2707 4536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257644.1 protein_id gnl|my_center|LOCUS_29370 4584 6125 gene locus_tag LOCUS_29380 gene purH 4584 6125 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence147 1110 703 gene locus_tag LOCUS_29390 1110 703 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978131.1 protein_id gnl|my_center|LOCUS_29390 1341 2525 gene locus_tag LOCUS_29400 1341 2525 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171553.1 protein_id gnl|my_center|LOCUS_29400 3520 2522 gene locus_tag LOCUS_29410 gene era 3520 2522 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_29410 4932 3589 gene locus_tag LOCUS_29420 4932 3589 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349521.1 protein_id gnl|my_center|LOCUS_29420 6719 4938 gene locus_tag LOCUS_29430 6719 4938 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_29430 7152 6736 gene locus_tag LOCUS_29440 7152 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence148 2569 4962 gene locus_tag LOCUS_29450 2569 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence149 1081 248 gene locus_tag LOCUS_29460 1081 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 1809 1144 gene locus_tag LOCUS_29470 1809 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 2850 1825 gene locus_tag LOCUS_29480 2850 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 6131 2910 gene locus_tag LOCUS_29490 6131 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 <7687 6148 gene locus_tag LOCUS_29500 <7687 6148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929022.1:type I-D CRISPR-associated helicase Cas3' >Feature sequence150 2353 2030 gene locus_tag LOCUS_29510 2353 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 2454 2639 gene locus_tag LOCUS_29520 2454 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2700 3602 gene locus_tag LOCUS_29530 2700 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3670 4683 gene locus_tag LOCUS_29540 3670 4683 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_29540 6118 4766 gene locus_tag LOCUS_29550 gene mgtE 6118 4766 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_29550 7276 6317 gene locus_tag LOCUS_29560 7276 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence151 2599 47 gene locus_tag LOCUS_29570 2599 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 2753 2679 gene locus_tag LOCUS_t00400 2753 2679 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2987 3511 gene locus_tag LOCUS_29580 2987 3511 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_29580 3653 5449 gene locus_tag LOCUS_29590 gene dnaB 3653 5449 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957860.1 protein_id gnl|my_center|LOCUS_29590 5454 6206 gene locus_tag LOCUS_29600 5454 6206 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_29600 6280 7551 gene locus_tag LOCUS_29610 6280 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence152 2355 304 gene locus_tag LOCUS_29620 gene brxL 2355 304 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_29620 4721 2352 gene locus_tag LOCUS_29630 gene pglZ 4721 2352 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_29630 5404 4793 gene locus_tag LOCUS_29640 5404 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 6702 5401 gene locus_tag LOCUS_29650 6702 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence153 506 1402 gene locus_tag LOCUS_29660 gene ftcD 506 1402 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080786.1 protein_id gnl|my_center|LOCUS_29660 2241 1399 gene locus_tag LOCUS_29670 2241 1399 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_29670 2697 3653 gene locus_tag LOCUS_29680 2697 3653 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_29680 3643 5136 gene locus_tag LOCUS_29690 3643 5136 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_29690 5140 6189 gene locus_tag LOCUS_29700 gene hrcA 5140 6189 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_29700 6221 6865 gene locus_tag LOCUS_29710 gene grpE 6221 6865 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 protein_id gnl|my_center|LOCUS_29710 >Feature sequence154 701 426 gene locus_tag LOCUS_29720 701 426 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527114.1 protein_id gnl|my_center|LOCUS_29720 1342 737 gene locus_tag LOCUS_29730 1342 737 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028021.1 protein_id gnl|my_center|LOCUS_29730 1929 1339 gene locus_tag LOCUS_29740 gene aac(6') 1929 1339 CDS product aminoglycoside N-acetyltransferase AAC(6')-Ii inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289795.1 protein_id gnl|my_center|LOCUS_29740 2855 1926 gene locus_tag LOCUS_29750 2855 1926 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030398.1 protein_id gnl|my_center|LOCUS_29750 2991 4217 gene locus_tag LOCUS_29760 gene fabF 2991 4217 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_29760 5699 4224 gene locus_tag LOCUS_29770 5699 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 6970 5744 gene locus_tag LOCUS_29780 6970 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 >Feature sequence155 811 3438 gene locus_tag LOCUS_29790 811 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 4163 3435 gene locus_tag LOCUS_29800 4163 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 4450 4160 gene locus_tag LOCUS_29810 4450 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 4745 5191 gene locus_tag LOCUS_29820 4745 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 7059 5248 gene locus_tag LOCUS_29830 gene pepF 7059 5248 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256129.1 protein_id gnl|my_center|LOCUS_29830 >Feature sequence156 2247 298 gene locus_tag LOCUS_29840 2247 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 2144 2356 gene locus_tag LOCUS_29850 2144 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 2585 3505 gene locus_tag LOCUS_29860 2585 3505 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258346.1 protein_id gnl|my_center|LOCUS_29860 3495 4268 gene locus_tag LOCUS_29870 3495 4268 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033687802.1 protein_id gnl|my_center|LOCUS_29870 5184 4279 gene locus_tag LOCUS_29880 gene rarD 5184 4279 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_29880 5625 5254 gene locus_tag LOCUS_29890 5625 5254 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 protein_id gnl|my_center|LOCUS_29890 >Feature sequence157 98 280 gene locus_tag LOCUS_29900 98 280 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258244.1 protein_id gnl|my_center|LOCUS_29900 402 797 gene locus_tag LOCUS_29910 gene rpsH 402 797 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_29910 806 1363 gene locus_tag LOCUS_29920 gene rplF 806 1363 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086558.1 protein_id gnl|my_center|LOCUS_29920 1379 1744 gene locus_tag LOCUS_29930 gene rplR 1379 1744 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624044.1 protein_id gnl|my_center|LOCUS_29930 1770 2330 gene locus_tag LOCUS_29940 gene rpsE 1770 2330 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_29940 2323 2517 gene locus_tag LOCUS_29950 gene rpmD 2323 2517 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_29950 2566 3045 gene locus_tag LOCUS_29960 gene rplO 2566 3045 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_29960 3129 4475 gene locus_tag LOCUS_29970 gene secY 3129 4475 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_29970 4590 5249 gene locus_tag LOCUS_29980 4590 5249 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_29980 5330 6049 gene locus_tag LOCUS_29990 gene map 5330 6049 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_29990 6326 6706 gene locus_tag LOCUS_30000 gene rpsM 6326 6706 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence158 2572 806 gene locus_tag LOCUS_30010 2572 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 3838 2594 gene locus_tag LOCUS_30020 3838 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 4738 5754 gene locus_tag LOCUS_30030 4738 5754 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227073.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence159 26 162 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cagagacagccccagaggcgaccccagag 1306 2535 gene locus_tag LOCUS_30040 1306 2535 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_30040 2914 4140 gene locus_tag LOCUS_30050 2914 4140 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_30050 4213 4611 gene locus_tag LOCUS_30060 4213 4611 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_30060 6279 4693 gene locus_tag LOCUS_30070 6279 4693 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967162.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence160 1485 223 gene locus_tag LOCUS_30080 1485 223 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_30080 2536 1526 gene locus_tag LOCUS_30090 2536 1526 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833199.1 protein_id gnl|my_center|LOCUS_30090 3737 2601 gene locus_tag LOCUS_30100 3737 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615347.1 protein_id gnl|my_center|LOCUS_30100 4579 3734 gene locus_tag LOCUS_30110 4579 3734 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947356.1 protein_id gnl|my_center|LOCUS_30110 5608 4598 gene locus_tag LOCUS_30120 5608 4598 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 protein_id gnl|my_center|LOCUS_30120 <6890 5605 gene locus_tag LOCUS_30130 <6890 5605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259368.1:fatty acid CoA ligase family protein >Feature sequence161 2317 458 gene locus_tag LOCUS_30140 2317 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 4653 2314 gene locus_tag LOCUS_30150 4653 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence162 <1 1387 gene locus_tag LOCUS_30160 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258188.1:CCA tRNA nucleotidyltransferase 1388 2926 gene locus_tag LOCUS_30170 1388 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 2923 3243 gene locus_tag LOCUS_30180 2923 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 4005 3259 gene locus_tag LOCUS_30190 4005 3259 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_30190 4552 4067 gene locus_tag LOCUS_30200 gene moaC 4552 4067 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_30200 5829 4567 gene locus_tag LOCUS_30210 5829 4567 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_30210 6325 5891 gene locus_tag LOCUS_30220 6325 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence163 359 850 gene locus_tag LOCUS_30230 gene rimI 359 850 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_30230 3074 882 gene locus_tag LOCUS_30240 gene katG 3074 882 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391529.1 protein_id gnl|my_center|LOCUS_30240 3805 3119 gene locus_tag LOCUS_30250 3805 3119 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_30250 5361 4312 gene locus_tag LOCUS_30260 5361 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence164 <1 619 gene locus_tag LOCUS_30270 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005693153.1:N-acetylmuramic acid 6-phosphate etherase 665 2560 gene locus_tag LOCUS_30280 665 2560 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_30280 2567 3325 gene locus_tag LOCUS_30290 gene rsmI 2567 3325 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166903.1 protein_id gnl|my_center|LOCUS_30290 3430 4806 gene locus_tag LOCUS_30300 3430 4806 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_30300 6378 4813 gene locus_tag LOCUS_30310 6378 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence165 347 859 gene locus_tag LOCUS_30320 347 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 875 1210 gene locus_tag LOCUS_30330 875 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 1728 2513 gene locus_tag LOCUS_30340 1728 2513 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256951.1 protein_id gnl|my_center|LOCUS_30340 3547 2666 gene locus_tag LOCUS_30350 3547 2666 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969293.1 protein_id gnl|my_center|LOCUS_30350 4578 3544 gene locus_tag LOCUS_30360 4578 3544 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_30360 6166 4571 gene locus_tag LOCUS_30370 6166 4571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249609.1 protein_id gnl|my_center|LOCUS_30370 >Feature sequence166 1577 2530 gene locus_tag LOCUS_30380 1577 2530 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_30380 2606 3874 gene locus_tag LOCUS_30390 2606 3874 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_30390 4605 3883 gene locus_tag LOCUS_30400 4605 3883 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 protein_id gnl|my_center|LOCUS_30400 4759 4686 gene locus_tag LOCUS_t00410 4759 4686 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4916 4843 gene locus_tag LOCUS_t00420 4916 4843 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5160 5831 gene locus_tag LOCUS_30410 gene phoU 5160 5831 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965016.1 protein_id gnl|my_center|LOCUS_30410 >Feature sequence167 681 756 gene locus_tag LOCUS_t00430 681 756 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 874 1419 gene locus_tag LOCUS_30420 874 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 1484 2311 gene locus_tag LOCUS_30430 1484 2311 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_30430 3034 2357 gene locus_tag LOCUS_30440 3034 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3619 4497 gene locus_tag LOCUS_30450 3619 4497 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 protein_id gnl|my_center|LOCUS_30450 6151 4622 gene locus_tag LOCUS_30460 6151 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence168 821 480 gene locus_tag LOCUS_30470 821 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 1138 4332 gene locus_tag LOCUS_30480 1138 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 4552 6429 gene locus_tag LOCUS_30490 4552 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 >Feature sequence169 1138 302 gene locus_tag LOCUS_30500 1138 302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_30500 2454 1135 gene locus_tag LOCUS_30510 2454 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 4713 2476 gene locus_tag LOCUS_30520 4713 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 4943 5665 gene locus_tag LOCUS_30530 4943 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 5665 6129 gene locus_tag LOCUS_30540 5665 6129 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736634.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence170 658 1056 gene locus_tag LOCUS_30550 658 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 1565 1380 gene locus_tag LOCUS_30560 1565 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 1675 2034 gene locus_tag LOCUS_30570 1675 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 2610 2927 gene locus_tag LOCUS_30580 2610 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 2971 3324 gene locus_tag LOCUS_30590 2971 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 5512 4196 gene locus_tag LOCUS_30600 gene rpoD 5512 4196 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence171 1073 210 gene locus_tag LOCUS_30610 1073 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 2603 1245 gene locus_tag LOCUS_30620 2603 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 2899 3969 gene locus_tag LOCUS_30630 2899 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 4014 5246 gene locus_tag LOCUS_30640 gene tyrS 4014 5246 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889364.1 protein_id gnl|my_center|LOCUS_30640 5333 6136 gene locus_tag LOCUS_30650 gene fabI 5333 6136 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719509.1 protein_id gnl|my_center|LOCUS_30650 >Feature sequence172 19 1041 gene locus_tag LOCUS_30660 19 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 1555 1139 gene locus_tag LOCUS_30670 1555 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 3212 1977 gene locus_tag LOCUS_30680 3212 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 3983 3219 gene locus_tag LOCUS_30690 gene rlmB 3983 3219 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_30690 5389 3980 gene locus_tag LOCUS_30700 gene cysS 5389 3980 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257711.1 protein_id gnl|my_center|LOCUS_30700 <6253 5463 gene locus_tag LOCUS_30710 <6253 5463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393965.1:PIN/TRAM domain-containing protein >Feature sequence173 2067 205 gene locus_tag LOCUS_30720 2067 205 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479947.1 protein_id gnl|my_center|LOCUS_30720 2206 3318 gene locus_tag LOCUS_30730 gene ald 2206 3318 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_30730 3380 4744 gene locus_tag LOCUS_30740 gene hisS 3380 4744 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142552.1 protein_id gnl|my_center|LOCUS_30740 4782 5876 gene locus_tag LOCUS_30750 4782 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728696.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence174 301 1257 gene locus_tag LOCUS_30760 301 1257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_30760 1259 2005 gene locus_tag LOCUS_30770 1259 2005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_30770 3982 1991 gene locus_tag LOCUS_30780 3982 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 4217 4999 gene locus_tag LOCUS_30790 4217 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 5028 5747 gene locus_tag LOCUS_30800 5028 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 >Feature sequence175 1026 1700 gene locus_tag LOCUS_30810 1026 1700 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259201.1 protein_id gnl|my_center|LOCUS_30810 1813 3780 gene locus_tag LOCUS_30820 1813 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3785 4942 gene locus_tag LOCUS_30830 3785 4942 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_30830 4996 5766 gene locus_tag LOCUS_30840 4996 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence176 513 776 gene locus_tag LOCUS_30850 513 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 776 958 gene locus_tag LOCUS_30860 776 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 2512 1259 gene locus_tag LOCUS_30870 2512 1259 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545533.1 protein_id gnl|my_center|LOCUS_30870 3123 2575 gene locus_tag LOCUS_30880 3123 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 3607 3095 gene locus_tag LOCUS_30890 3607 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3606 3935 gene locus_tag LOCUS_30900 3606 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 4186 4533 gene locus_tag LOCUS_30910 4186 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 4661 4948 gene locus_tag LOCUS_30920 4661 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 5520 4882 gene locus_tag LOCUS_30930 5520 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 >Feature sequence177 1404 310 gene locus_tag LOCUS_30940 1404 310 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_30940 2537 1422 gene locus_tag LOCUS_30950 2537 1422 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311988.1 protein_id gnl|my_center|LOCUS_30950 4082 2541 gene locus_tag LOCUS_30960 4082 2541 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086022.1 protein_id gnl|my_center|LOCUS_30960 5141 4167 gene locus_tag LOCUS_30970 5141 4167 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_30970 <5962 5147 gene locus_tag LOCUS_30980 <5962 5147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081442.1:ABC transporter ATP-binding protein >Feature sequence178 <1 1218 gene locus_tag LOCUS_30990 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941017.1:NADH-quinone oxidoreductase subunit L 1293 2870 gene locus_tag LOCUS_31000 1293 2870 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_31000 2889 4379 gene locus_tag LOCUS_31010 2889 4379 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460435.1 protein_id gnl|my_center|LOCUS_31010 >Feature sequence179 1661 963 gene locus_tag LOCUS_31020 1661 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 2555 1665 gene locus_tag LOCUS_31030 2555 1665 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_31030 3520 2573 gene locus_tag LOCUS_31040 3520 2573 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258533.1 protein_id gnl|my_center|LOCUS_31040 5036 3621 gene locus_tag LOCUS_31050 5036 3621 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_31050 5797 5102 gene locus_tag LOCUS_31060 5797 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 >Feature sequence180 1 426 gene locus_tag LOCUS_31070 1 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 1115 531 gene locus_tag LOCUS_31080 1115 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 1594 1112 gene locus_tag LOCUS_31090 1594 1112 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256843.1 protein_id gnl|my_center|LOCUS_31090 3054 1786 gene locus_tag LOCUS_31100 3054 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 4049 3063 gene locus_tag LOCUS_31110 4049 3063 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_31110 4377 4679 gene locus_tag LOCUS_31120 gene rpsF 4377 4679 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777139.1 protein_id gnl|my_center|LOCUS_31120 4711 5145 gene locus_tag LOCUS_31130 4711 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence181 2045 390 gene locus_tag LOCUS_31140 2045 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 2544 4421 gene locus_tag LOCUS_31150 2544 4421 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258194.1 protein_id gnl|my_center|LOCUS_31150 >Feature sequence182 <1 1774 gene locus_tag LOCUS_31160 <1 1774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256976.1:C25 family cysteine peptidase 1976 2752 gene locus_tag LOCUS_31170 1976 2752 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903333.1 protein_id gnl|my_center|LOCUS_31170 2982 4028 gene locus_tag LOCUS_31180 2982 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 4109 4498 gene locus_tag LOCUS_31190 4109 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence183 <1 582 gene locus_tag LOCUS_31200 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228835.1:maltose ABC transporter substrate-binding protein 585 1613 gene locus_tag LOCUS_31210 585 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 1629 2669 gene locus_tag LOCUS_31220 1629 2669 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948101.1 protein_id gnl|my_center|LOCUS_31220 2650 3090 gene locus_tag LOCUS_31230 2650 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 3142 4038 gene locus_tag LOCUS_31240 3142 4038 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_31240 4029 4910 gene locus_tag LOCUS_31250 4029 4910 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727156.1 protein_id gnl|my_center|LOCUS_31250 <5477 4917 gene locus_tag LOCUS_31260 <5477 4917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002674428.1:copper homeostasis protein CutC >Feature sequence184 168 470 gene locus_tag LOCUS_31270 168 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 662 889 gene locus_tag LOCUS_31280 662 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 894 3692 gene locus_tag LOCUS_31290 gene polA 894 3692 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256248.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence185 <1 1398 gene locus_tag LOCUS_31300 <1 1398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257164.1:U32 family peptidase 1511 2881 gene locus_tag LOCUS_31310 1511 2881 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_31310 4137 2908 gene locus_tag LOCUS_31320 4137 2908 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228462.1 protein_id gnl|my_center|LOCUS_31320 4385 4741 gene locus_tag LOCUS_31330 gene ndhC 4385 4741 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_31330 >Feature sequence186 1153 338 gene locus_tag LOCUS_31340 gene pstB 1153 338 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_31340 3276 1153 gene locus_tag LOCUS_31350 3276 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 4247 3279 gene locus_tag LOCUS_31360 gene pstC 4247 3279 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_31360 5257 4415 gene locus_tag LOCUS_31370 5257 4415 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_31370 >Feature sequence187 >Feature sequence188 454 1773 gene locus_tag LOCUS_31380 454 1773 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_31380 1880 3496 gene locus_tag LOCUS_31390 1880 3496 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_31390 4793 3552 gene locus_tag LOCUS_31400 gene fabF 4793 3552 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence189 1124 315 gene locus_tag LOCUS_31410 gene rpe 1124 315 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259044.1 protein_id gnl|my_center|LOCUS_31410 2197 1130 gene locus_tag LOCUS_31420 gene gutB 2197 1130 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_31420 3183 2197 gene locus_tag LOCUS_31430 3183 2197 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422467.1 protein_id gnl|my_center|LOCUS_31430 3904 3374 gene locus_tag LOCUS_31440 3904 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 5188 3935 gene locus_tag LOCUS_31450 5188 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence190 <1 733 gene locus_tag LOCUS_31460 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257764.1:methionine aminotransferase 772 2289 gene locus_tag LOCUS_31470 772 2289 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_31470 2286 3026 gene locus_tag LOCUS_31480 2286 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 3046 4872 gene locus_tag LOCUS_31490 3046 4872 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence191 1588 410 gene locus_tag LOCUS_31500 1588 410 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259731.1 protein_id gnl|my_center|LOCUS_31500 2602 1598 gene locus_tag LOCUS_31510 gene manA 2602 1598 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896007.1 protein_id gnl|my_center|LOCUS_31510 <5168 3022 gene locus_tag LOCUS_31520 <5168 3022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000907046.1:HTH-type transcriptional regulator MalT >Feature sequence192 504 755 gene locus_tag LOCUS_31530 504 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 840 962 gene locus_tag LOCUS_31540 840 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 1181 1723 gene locus_tag LOCUS_31550 1181 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 1728 4094 gene locus_tag LOCUS_31560 1728 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038875.1 protein_id gnl|my_center|LOCUS_31560 4242 4712 gene locus_tag LOCUS_31570 4242 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence193 2546 36 gene locus_tag LOCUS_31580 2546 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 4113 2533 gene locus_tag LOCUS_31590 gene lysS 4113 2533 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257111.1 protein_id gnl|my_center|LOCUS_31590 4593 4117 gene locus_tag LOCUS_31600 gene greA 4593 4117 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_31600 >Feature sequence194 <1 502 gene locus_tag LOCUS_31610 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209237.1:bifunctional aspartate kinase/homoserine dehydrogenase I 530 1627 gene locus_tag LOCUS_31620 gene asd 530 1627 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_31620 1674 2834 gene locus_tag LOCUS_31630 1674 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2999 4894 gene locus_tag LOCUS_31640 gene ftsH 2999 4894 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_31640 >Feature sequence195 <1 640 gene locus_tag LOCUS_31650 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584068.1:ABC transporter permease 644 1633 gene locus_tag LOCUS_31660 644 1633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041426669.1 protein_id gnl|my_center|LOCUS_31660 1633 2628 gene locus_tag LOCUS_31670 1633 2628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582574.1 protein_id gnl|my_center|LOCUS_31670 2656 4170 gene locus_tag LOCUS_31680 gene abfB 2656 4170 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_31680 >Feature sequence196 620 1102 gene locus_tag LOCUS_31690 620 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 1090 4584 gene locus_tag LOCUS_31700 1090 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence197 <1 1102 gene locus_tag LOCUS_31710 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256461.1:type III-A CRISPR-associated RAMP protein Csm5 1519 1370 gene locus_tag LOCUS_31720 1519 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 1808 2887 gene locus_tag LOCUS_31730 1808 2887 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229155.1 protein_id gnl|my_center|LOCUS_31730 2884 3777 gene locus_tag LOCUS_31740 2884 3777 CDS product DUF1887 family CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258165.1 protein_id gnl|my_center|LOCUS_31740 >Feature sequence198 <1 669 gene locus_tag LOCUS_31750 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258532.1:sugar ABC transporter substrate-binding protein 813 2489 gene locus_tag LOCUS_31760 813 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 2505 3776 gene locus_tag LOCUS_31770 2505 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 4091 4363 gene locus_tag LOCUS_31780 4091 4363 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_31780 4335 4823 gene locus_tag LOCUS_31790 4335 4823 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_31790 >Feature sequence199 2917 224 gene locus_tag LOCUS_31800 gene acnA 2917 224 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118669.1 protein_id gnl|my_center|LOCUS_31800 1938 2037 gene locus_tag LOCUS_t00440 1938 2037 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4023 3100 gene locus_tag LOCUS_31810 4023 3100 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_31810 4296 4087 gene locus_tag LOCUS_31820 4296 4087 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_31820 <4847 4297 gene locus_tag LOCUS_31830 <4847 4297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256055.1:ABC transporter permease >Feature sequence200 2621 588 gene locus_tag LOCUS_31840 2621 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 2900 4432 gene locus_tag LOCUS_31850 2900 4432 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_31850 >Feature sequence201 294 1250 gene locus_tag LOCUS_31860 294 1250 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_31860 1296 2285 gene locus_tag LOCUS_31870 gene gmd 1296 2285 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_31870 2305 3153 gene locus_tag LOCUS_31880 2305 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 3265 3924 gene locus_tag LOCUS_31890 3265 3924 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392491.1 protein_id gnl|my_center|LOCUS_31890 3917 4339 gene locus_tag LOCUS_31900 3917 4339 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_31900 >Feature sequence202 46 912 gene locus_tag LOCUS_31910 46 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 1121 2137 gene locus_tag LOCUS_31920 1121 2137 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369595.1 protein_id gnl|my_center|LOCUS_31920 3125 2040 gene locus_tag LOCUS_31930 gene galT 3125 2040 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 protein_id gnl|my_center|LOCUS_31930 4030 3140 gene locus_tag LOCUS_31940 4030 3140 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_31940 <4717 4083 gene locus_tag LOCUS_31950 <4717 4083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939589.1:YigZ family protein >Feature sequence203 393 956 gene locus_tag LOCUS_31960 393 956 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778948.1 protein_id gnl|my_center|LOCUS_31960 1131 1424 gene locus_tag LOCUS_31970 1131 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 1421 1885 gene locus_tag LOCUS_31980 1421 1885 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229164.1 protein_id gnl|my_center|LOCUS_31980 2176 1916 gene locus_tag LOCUS_31990 2176 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 <4576 2870 gene locus_tag LOCUS_32000 <4576 2870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532991.1:LuxR C-terminal-related transcriptional regulator >Feature sequence204 <1 828 gene locus_tag LOCUS_32010 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000823432.1:peptidylprolyl isomerase 2968 944 gene locus_tag LOCUS_32020 2968 944 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_32020 <4537 3035 gene locus_tag LOCUS_32030 <4537 3035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256762.1:DNA-directed RNA polymerase subunit beta' >Feature sequence205 1564 146 gene locus_tag LOCUS_32040 gene dnaA 1564 146 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255915.1 protein_id gnl|my_center|LOCUS_32040 2516 2854 gene locus_tag LOCUS_32050 2516 2854 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123488.1 protein_id gnl|my_center|LOCUS_32050 2885 4042 gene locus_tag LOCUS_32060 2885 4042 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence206 >Feature sequence207 673 131 gene locus_tag LOCUS_32070 673 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 1173 2156 gene locus_tag LOCUS_32080 1173 2156 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338610.1 protein_id gnl|my_center|LOCUS_32080 2323 3066 gene locus_tag LOCUS_32090 2323 3066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_32090 3066 3866 gene locus_tag LOCUS_32100 3066 3866 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816301.1 protein_id gnl|my_center|LOCUS_32100 >Feature sequence208 564 2531 gene locus_tag LOCUS_32110 564 2531 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258668.1 protein_id gnl|my_center|LOCUS_32110 >Feature sequence209 480 1814 gene locus_tag LOCUS_32120 gene ssnA 480 1814 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_32120 1826 3106 gene locus_tag LOCUS_32130 1826 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 3202 3870 gene locus_tag LOCUS_32140 gene npdG 3202 3870 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence210 517 1422 gene locus_tag LOCUS_32150 517 1422 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_32150 1415 2488 gene locus_tag LOCUS_32160 1415 2488 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398629.1 protein_id gnl|my_center|LOCUS_32160 2661 3683 gene locus_tag LOCUS_32170 2661 3683 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_32170 >Feature sequence211 83 892 gene locus_tag LOCUS_32180 83 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 3389 927 gene locus_tag LOCUS_32190 3389 927 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 protein_id gnl|my_center|LOCUS_32190 <4246 3449 gene locus_tag LOCUS_32200 <4246 3449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000257804.1:dihydrolipoamide acetyltransferase family protein >Feature sequence212 650 528 gene locus_tag LOCUS_32210 650 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 702 926 gene locus_tag LOCUS_32220 702 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 1814 2467 gene locus_tag LOCUS_32230 1814 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3298 3089 gene locus_tag LOCUS_32240 3298 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 3636 3328 gene locus_tag LOCUS_32250 3636 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 >Feature sequence213 467 2062 gene locus_tag LOCUS_32260 gene serA 467 2062 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256188.1 protein_id gnl|my_center|LOCUS_32260 2246 2971 gene locus_tag LOCUS_32270 2246 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 3268 3516 gene locus_tag LOCUS_32280 3268 3516 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203723.1 protein_id gnl|my_center|LOCUS_32280 <4213 3617 gene locus_tag LOCUS_32290 <4213 3617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256381.1:transcriptional repressor LexA >Feature sequence214 1909 554 gene locus_tag LOCUS_32300 gene hisD 1909 554 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888771.1 protein_id gnl|my_center|LOCUS_32300 2558 1938 gene locus_tag LOCUS_32310 2558 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 2622 3515 gene locus_tag LOCUS_32320 gene recO 2622 3515 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_32320 3496 3885 gene locus_tag LOCUS_32330 3496 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence215 1956 43 gene locus_tag LOCUS_32340 1956 43 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530523.1 protein_id gnl|my_center|LOCUS_32340 2866 1973 gene locus_tag LOCUS_32350 2866 1973 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_32350 3785 2868 gene locus_tag LOCUS_32360 3785 2868 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 protein_id gnl|my_center|LOCUS_32360 >Feature sequence216 335 859 gene locus_tag LOCUS_32370 335 859 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_32370 1586 912 gene locus_tag LOCUS_32380 1586 912 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_32380 2368 1610 gene locus_tag LOCUS_32390 2368 1610 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_32390 3058 2408 gene locus_tag LOCUS_32400 3058 2408 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_32400 3958 3146 gene locus_tag LOCUS_32410 3958 3146 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837379.1 protein_id gnl|my_center|LOCUS_32410 >Feature sequence217 2147 801 gene locus_tag LOCUS_32420 gene glnA 2147 801 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259233.1 protein_id gnl|my_center|LOCUS_32420 3706 2291 gene locus_tag LOCUS_32430 gene glnA 3706 2291 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence218 1106 2563 gene locus_tag LOCUS_32440 1106 2563 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257833.1 protein_id gnl|my_center|LOCUS_32440 2781 3896 gene locus_tag LOCUS_32450 2781 3896 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259177.1 protein_id gnl|my_center|LOCUS_32450 >Feature sequence219 >Feature sequence220 2117 1767 gene locus_tag LOCUS_32460 2117 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 2489 2169 gene locus_tag LOCUS_32470 gene nuoK 2489 2169 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100078.1 protein_id gnl|my_center|LOCUS_32470 3103 2579 gene locus_tag LOCUS_32480 3103 2579 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257850.1 protein_id gnl|my_center|LOCUS_32480 <3880 3119 gene locus_tag LOCUS_32490 <3880 3119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257851.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence221 509 718 gene locus_tag LOCUS_32500 509 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 773 1075 gene locus_tag LOCUS_32510 773 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 1724 1242 gene locus_tag LOCUS_32520 1724 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 2140 1721 gene locus_tag LOCUS_32530 2140 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403361.1 protein_id gnl|my_center|LOCUS_32530 2449 2198 gene locus_tag LOCUS_32540 2449 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence222 2 457 gene locus_tag LOCUS_32550 2 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 587 1543 gene locus_tag LOCUS_32560 587 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 1728 3110 gene locus_tag LOCUS_32570 1728 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence223 2584 491 gene locus_tag LOCUS_32580 gene fusA 2584 491 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459098.1 protein_id gnl|my_center|LOCUS_32580 3313 2846 gene locus_tag LOCUS_32590 gene rpsG 3313 2846 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_32590 3794 3330 gene locus_tag LOCUS_32600 gene rpsL 3794 3330 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_32600 >Feature sequence224 <1 748 gene locus_tag LOCUS_32610 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525290.1:type VI secretion system tip protein TssI/VgrG 748 1107 gene locus_tag LOCUS_32620 748 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 1109 1597 gene locus_tag LOCUS_32630 1109 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence225 <1 2217 gene locus_tag LOCUS_32640 <1 2217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582633.1:glycoside hydrolase family 3 C-terminal domain-containing protein 3115 2489 gene locus_tag LOCUS_32650 3115 2489 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_32650 3304 3720 gene locus_tag LOCUS_32660 3304 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32660 >Feature sequence226 3518 2289 gene locus_tag LOCUS_32670 3518 2289 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766782.1 protein_id gnl|my_center|LOCUS_32670 >Feature sequence227 3692 2544 gene locus_tag LOCUS_32680 3692 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence228 1283 630 gene locus_tag LOCUS_32690 gene nth 1283 630 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_32690 1793 1293 gene locus_tag LOCUS_32700 1793 1293 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762550.1 protein_id gnl|my_center|LOCUS_32700 <3793 1790 gene locus_tag LOCUS_32710 <3793 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929446.1:ExeM/NucH family extracellular endonuclease >Feature sequence229 2923 230 gene locus_tag LOCUS_32720 2923 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32720 3310 3098 gene locus_tag LOCUS_32730 3310 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 >Feature sequence230 225 2306 gene locus_tag LOCUS_32740 225 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 <3782 2343 gene locus_tag LOCUS_32750 <3782 2343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256922.1:AAA family ATPase >Feature sequence231 118 792 gene locus_tag LOCUS_32760 118 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 1178 1579 gene locus_tag LOCUS_32770 1178 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32770 1584 1952 gene locus_tag LOCUS_32780 1584 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32780 1976 3412 gene locus_tag LOCUS_32790 1976 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence232 957 580 gene locus_tag LOCUS_32800 957 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 1100 2017 gene locus_tag LOCUS_32810 gene lgt 1100 2017 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_32810 3215 2052 gene locus_tag LOCUS_32820 3215 2052 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887673.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence233 191 2320 gene locus_tag LOCUS_32830 191 2320 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909087.1 protein_id gnl|my_center|LOCUS_32830 2338 2853 gene locus_tag LOCUS_32840 gene ybeY 2338 2853 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_32840 2877 3293 gene locus_tag LOCUS_32850 2877 3293 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888724.1 protein_id gnl|my_center|LOCUS_32850 >Feature sequence234 <1 685 gene locus_tag LOCUS_32860 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173924.1:homocitrate synthase 721 1290 gene locus_tag LOCUS_32870 721 1290 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723131.1 protein_id gnl|my_center|LOCUS_32870 1287 1790 gene locus_tag LOCUS_32880 1287 1790 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400458.1 protein_id gnl|my_center|LOCUS_32880 1795 3114 gene locus_tag LOCUS_32890 1795 3114 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870108.1 protein_id gnl|my_center|LOCUS_32890 3118 3612 gene locus_tag LOCUS_32900 3118 3612 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_32900 >Feature sequence235 >Feature sequence236 406 1563 gene locus_tag LOCUS_32910 406 1563 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259009.1 protein_id gnl|my_center|LOCUS_32910 1662 2204 gene locus_tag LOCUS_32920 gene fldA 1662 2204 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140318.1 protein_id gnl|my_center|LOCUS_32920 >Feature sequence237 1220 234 gene locus_tag LOCUS_32930 1220 234 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257879.1 protein_id gnl|my_center|LOCUS_32930 2755 1271 gene locus_tag LOCUS_32940 2755 1271 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_32940 3222 2818 gene locus_tag LOCUS_32950 3222 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence238 3114 187 gene locus_tag LOCUS_32960 3114 187 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256785.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence239 127 1110 gene locus_tag LOCUS_32970 127 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 1214 1417 gene locus_tag LOCUS_32980 1214 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 1439 1615 gene locus_tag LOCUS_32990 1439 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 2056 2298 gene locus_tag LOCUS_33000 2056 2298 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_33000 2292 2639 gene locus_tag LOCUS_33010 gene mazF 2292 2639 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_33010 >Feature sequence240 >Feature sequence241 >Feature sequence242 560 51 gene locus_tag LOCUS_33020 560 51 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_33020 773 2179 gene locus_tag LOCUS_33030 773 2179 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705630.1 protein_id gnl|my_center|LOCUS_33030 >Feature sequence243 <1 598 gene locus_tag LOCUS_33040 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140150.1:IS4-like element ISGvi2 family transposase 751 1401 gene locus_tag LOCUS_33050 751 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 3312 1462 gene locus_tag LOCUS_33060 3312 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence244 1756 1058 gene locus_tag LOCUS_33070 1756 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 2982 3287 gene locus_tag LOCUS_33080 2982 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence245 975 250 gene locus_tag LOCUS_33090 975 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 1632 1318 gene locus_tag LOCUS_33100 1632 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 1829 1644 gene locus_tag LOCUS_33110 1829 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 2042 1905 gene locus_tag LOCUS_33120 2042 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 3127 2342 gene locus_tag LOCUS_33130 3127 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence246 <1 1225 gene locus_tag LOCUS_33140 <1 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870232.1:DUF6079 family protein 1229 2455 gene locus_tag LOCUS_33150 1229 2455 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942570.1 protein_id gnl|my_center|LOCUS_33150 2452 3057 gene locus_tag LOCUS_33160 2452 3057 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141152.1 protein_id gnl|my_center|LOCUS_33160 >Feature sequence247 2852 432 gene locus_tag LOCUS_33170 2852 432 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357079.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence248 731 1240 gene locus_tag LOCUS_33180 731 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 1249 1572 gene locus_tag LOCUS_33190 1249 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 1708 2817 gene locus_tag LOCUS_33200 1708 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 >Feature sequence249 889 245 gene locus_tag LOCUS_33210 gene rpe 889 245 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564711.1 protein_id gnl|my_center|LOCUS_33210 2454 904 gene locus_tag LOCUS_33220 2454 904 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067242.1 protein_id gnl|my_center|LOCUS_33220 <3212 2544 gene locus_tag LOCUS_33230 <3212 2544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035257454.1:sensor domain-containing diguanylate cyclase >Feature sequence250 1737 361 gene locus_tag LOCUS_33240 1737 361 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_33240 2474 2001 gene locus_tag LOCUS_33250 2474 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 >Feature sequence251 <1 920 gene locus_tag LOCUS_33260 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257878.1:transglutaminase family protein 2152 935 gene locus_tag LOCUS_33270 2152 935 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_33270 <3188 2223 gene locus_tag LOCUS_33280 <3188 2223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161951924.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence252 >Feature sequence253 97 696 gene locus_tag LOCUS_33290 97 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 693 1484 gene locus_tag LOCUS_33300 gene tatC 693 1484 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227900.1 protein_id gnl|my_center|LOCUS_33300 <3180 1631 gene locus_tag LOCUS_33310 <3180 1631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660601.1:long-chain fatty acid--CoA ligase >Feature sequence254 812 1240 gene locus_tag LOCUS_33320 812 1240 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259266.1 protein_id gnl|my_center|LOCUS_33320 2815 1247 gene locus_tag LOCUS_33330 2815 1247 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256102.1 protein_id gnl|my_center|LOCUS_33330 >Feature sequence255 1285 344 gene locus_tag LOCUS_33340 1285 344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_33340 2456 1335 gene locus_tag LOCUS_33350 2456 1335 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_33350 <3073 2449 gene locus_tag LOCUS_33360 <3073 2449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583514.1:ABC transporter ATP-binding protein >Feature sequence256 2575 1190 gene locus_tag LOCUS_33370 2575 1190 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400906.1 protein_id gnl|my_center|LOCUS_33370 >Feature sequence257 1130 327 gene locus_tag LOCUS_33380 1130 327 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_33380 1501 1301 gene locus_tag LOCUS_33390 1501 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 2889 1585 gene locus_tag LOCUS_33400 2889 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence258 1177 170 gene locus_tag LOCUS_33410 gene cas1 1177 170 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_33410 2100 1285 gene locus_tag LOCUS_33420 gene cas6 2100 1285 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256458.1 protein_id gnl|my_center|LOCUS_33420 2576 2196 gene locus_tag LOCUS_33430 gene csx15 2576 2196 CDS product CRISPR-associated protein Csx15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257334.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence259 1263 346 gene locus_tag LOCUS_33440 1263 346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 protein_id gnl|my_center|LOCUS_33440 2278 1271 gene locus_tag LOCUS_33450 2278 1271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385674.1 protein_id gnl|my_center|LOCUS_33450 <2995 2359 gene locus_tag LOCUS_33460 <2995 2359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538149.1:ABC transporter substrate-binding protein >Feature sequence260 189 404 gene locus_tag LOCUS_33470 189 404 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_33470 969 1457 gene locus_tag LOCUS_33480 969 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 1714 1842 gene locus_tag LOCUS_33490 1714 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 2384 1968 gene locus_tag LOCUS_33500 2384 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 2752 2381 gene locus_tag LOCUS_33510 2752 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 >Feature sequence261 61 900 gene locus_tag LOCUS_33520 61 900 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972030.1 protein_id gnl|my_center|LOCUS_33520 897 1598 gene locus_tag LOCUS_33530 gene rpe 897 1598 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174250.1 protein_id gnl|my_center|LOCUS_33530 2443 1577 gene locus_tag LOCUS_33540 2443 1577 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259407.1 protein_id gnl|my_center|LOCUS_33540 >Feature sequence262 890 123 gene locus_tag LOCUS_33550 890 123 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256931.1 protein_id gnl|my_center|LOCUS_33550 2684 1038 gene locus_tag LOCUS_33560 2684 1038 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_33560 >Feature sequence263 295 1332 gene locus_tag LOCUS_33570 295 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 1360 1806 gene locus_tag LOCUS_33580 1360 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 1853 2767 gene locus_tag LOCUS_33590 1853 2767 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence264 308 667 gene locus_tag LOCUS_33600 308 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 >Feature sequence265 <1 1059 gene locus_tag LOCUS_33610 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256439.1:NAD(P)/FAD-dependent oxidoreductase 1068 2660 gene locus_tag LOCUS_33620 1068 2660 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_33620 >Feature sequence266 642 223 gene locus_tag LOCUS_33630 gene nusB 642 223 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_33630 1504 758 gene locus_tag LOCUS_33640 gene fabG 1504 758 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_33640 2599 1538 gene locus_tag LOCUS_33650 gene fabD 2599 1538 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532517.1 protein_id gnl|my_center|LOCUS_33650 2867 2667 gene locus_tag LOCUS_33660 gene rpmF 2867 2667 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_33660 >Feature sequence267 2096 1584 gene locus_tag LOCUS_33670 2096 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 <2807 2108 gene locus_tag LOCUS_33680 <2807 2108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229838.1:cystathionine gamma-synthase >Feature sequence268 <1 1523 gene locus_tag LOCUS_33690 <1 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990858.1:SBBP repeat-containing protein 1576 2379 gene locus_tag LOCUS_33700 1576 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence269 1 885 gene locus_tag LOCUS_33710 1 885 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_33710 885 1946 gene locus_tag LOCUS_33720 885 1946 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_33720 1967 2596 gene locus_tag LOCUS_33730 1967 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 >Feature sequence270 2437 1352 gene locus_tag LOCUS_33740 2437 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 >Feature sequence271 >Feature sequence272 205 624 gene locus_tag LOCUS_33750 205 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 841 2028 gene locus_tag LOCUS_33760 gene galK 841 2028 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_33760 2676 2035 gene locus_tag LOCUS_33770 2676 2035 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_33770 >Feature sequence273 777 652 gene locus_tag LOCUS_33780 777 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 1369 809 gene locus_tag LOCUS_33790 1369 809 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704403.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence274 931 77 gene locus_tag LOCUS_33800 931 77 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660848.1 protein_id gnl|my_center|LOCUS_33800 >Feature sequence275 1390 488 gene locus_tag LOCUS_33810 1390 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257677.1 protein_id gnl|my_center|LOCUS_33810 >Feature sequence276 2651 333 gene locus_tag LOCUS_33820 2651 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence277 1328 564 gene locus_tag LOCUS_33830 1328 564 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_33830 2381 1449 gene locus_tag LOCUS_33840 gene cysK 2381 1449 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence278 88 252 gene locus_tag LOCUS_33850 gene rpmH 88 252 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227941.1 protein_id gnl|my_center|LOCUS_33850 316 726 gene locus_tag LOCUS_33860 gene rnpA 316 726 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832522.1 protein_id gnl|my_center|LOCUS_33860 743 940 gene locus_tag LOCUS_33870 gene yidD 743 940 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393999.1 protein_id gnl|my_center|LOCUS_33870 976 1923 gene locus_tag LOCUS_33880 976 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 >Feature sequence279 1404 118 gene locus_tag LOCUS_33890 1404 118 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_33890 >Feature sequence280 279 587 gene locus_tag LOCUS_33900 gene rpsJ 279 587 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_33900 757 1407 gene locus_tag LOCUS_33910 gene rplC 757 1407 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_33910 1439 2107 gene locus_tag LOCUS_33920 gene rplD 1439 2107 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_33920 2112 2402 gene locus_tag LOCUS_33930 2112 2402 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_33930 >Feature sequence281 338 1933 gene locus_tag LOCUS_33940 338 1933 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_33940 >Feature sequence282 >Feature sequence283 137 1126 gene locus_tag LOCUS_33950 137 1126 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_33950 1199 2455 gene locus_tag LOCUS_33960 gene rifK 1199 2455 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence284 <1 2271 gene locus_tag LOCUS_33970 <1 2271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259111.1:M4 family metallopeptidase >Feature sequence285 >Feature sequence286 2 730 gene locus_tag LOCUS_33980 2 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 909 1448 gene locus_tag LOCUS_33990 909 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 1484 2074 gene locus_tag LOCUS_34000 gene hisB 1484 2074 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257804.1 protein_id gnl|my_center|LOCUS_34000 >Feature sequence287 2320 1289 gene locus_tag LOCUS_34010 2320 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023621.1 protein_id gnl|my_center|LOCUS_34010 >Feature sequence288 1615 500 gene locus_tag LOCUS_34020 1615 500 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_34020 1914 1651 gene locus_tag LOCUS_34030 1914 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 >Feature sequence289 800 576 gene locus_tag LOCUS_34040 gene secE 800 576 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630510.1 protein_id gnl|my_center|LOCUS_34040 946 872 gene locus_tag LOCUS_t00450 946 872 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2249 1050 gene locus_tag LOCUS_34050 gene tuf 2249 1050 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258047.1 protein_id gnl|my_center|LOCUS_34050 2437 2364 gene locus_tag LOCUS_t00460 2437 2364 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence290 >Feature sequence291 >Feature sequence292 <2411 1800 gene locus_tag LOCUS_34060 <2411 1800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070484.1:alpha/beta fold hydrolase >Feature sequence293 <1 817 gene locus_tag LOCUS_34070 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147443659.1:non-ribosomal peptide synthetase 2144 1083 gene locus_tag LOCUS_34080 2144 1083 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_34080 >Feature sequence294 1261 248 gene locus_tag LOCUS_34090 1261 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 1536 2165 gene locus_tag LOCUS_34100 1536 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 >Feature sequence295 1185 373 gene locus_tag LOCUS_34110 1185 373 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179067.1 protein_id gnl|my_center|LOCUS_34110 1387 1599 gene locus_tag LOCUS_34120 1387 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 <2397 1812 gene locus_tag LOCUS_34130 <2397 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143844.1:transposase >Feature sequence296 224 514 gene locus_tag LOCUS_34140 224 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 644 793 gene locus_tag LOCUS_34150 644 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 >Feature sequence297 401 1006 gene locus_tag LOCUS_34160 401 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 1003 1644 gene locus_tag LOCUS_34170 1003 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 1847 1605 gene locus_tag LOCUS_34180 1847 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 >Feature sequence298 >Feature sequence299 1049 270 gene locus_tag LOCUS_34190 1049 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 2232 1231 gene locus_tag LOCUS_34200 2232 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 >Feature sequence300 520 1014 gene locus_tag LOCUS_34210 520 1014 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111658546.1 protein_id gnl|my_center|LOCUS_34210 2275 1034 gene locus_tag LOCUS_34220 2275 1034 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_34220 >Feature sequence301 142 1314 gene locus_tag LOCUS_34230 142 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 1209 1511 gene locus_tag LOCUS_34240 1209 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence302 >Feature sequence303 >Feature sequence304 1576 389 gene locus_tag LOCUS_34250 gene tgt 1576 389 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_34250 >Feature sequence305 169 80 gene locus_tag LOCUS_t00470 169 80 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1205 303 gene locus_tag LOCUS_34260 1205 303 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258072.1 protein_id gnl|my_center|LOCUS_34260 2062 1454 gene locus_tag LOCUS_34270 2062 1454 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338057.1 protein_id gnl|my_center|LOCUS_34270 >Feature sequence306 1089 370 gene locus_tag LOCUS_34280 gene pyrH 1089 370 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810668.1 protein_id gnl|my_center|LOCUS_34280 1803 1204 gene locus_tag LOCUS_34290 gene tsf 1803 1204 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_34290 2238 1816 gene locus_tag LOCUS_34300 2238 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 >Feature sequence307 <1 1720 gene locus_tag LOCUS_34310 <1 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942518.1:M3 family oligoendopeptidase >Feature sequence308 940 856 gene locus_tag LOCUS_t00480 940 856 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1010 1651 gene locus_tag LOCUS_34320 1010 1651 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_34320 >Feature sequence309 309 1010 gene locus_tag LOCUS_34330 309 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 1010 1780 gene locus_tag LOCUS_34340 1010 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence310 >Feature sequence311 1137 169 gene locus_tag LOCUS_34350 1137 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 >Feature sequence312 >Feature sequence313 2 574 gene locus_tag LOCUS_34360 2 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 657 1133 gene locus_tag LOCUS_34370 657 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 >Feature sequence314 1984 1505 gene locus_tag LOCUS_34380 1984 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 >Feature sequence315 <1997 172 gene locus_tag LOCUS_34390 <1997 172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943350.1:fibronectin type III >Feature sequence316 470 1687 gene locus_tag LOCUS_34400 470 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_34400 >Feature sequence317 1988 1398 gene locus_tag LOCUS_34410 1988 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 >Feature sequence318 >Feature sequence319 1089 901 gene locus_tag LOCUS_34420 1089 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence320 246 1457 gene locus_tag LOCUS_34430 gene hemW 246 1457 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256118.1 protein_id gnl|my_center|LOCUS_34430 >Feature sequence321 <1 586 gene locus_tag LOCUS_34440 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932021.1:undecaprenyl-diphosphate phosphatase 684 1442 gene locus_tag LOCUS_34450 684 1442 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence322 <1 519 gene locus_tag LOCUS_34460 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919360.1:sugar transferase >Feature sequence323 >Feature sequence324 1105 191 gene locus_tag LOCUS_34470 1105 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 1733 1185 gene locus_tag LOCUS_34480 1733 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence325 46 738 gene locus_tag LOCUS_34490 46 738 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_34490 754 984 gene locus_tag LOCUS_34500 754 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 1090 1458 gene locus_tag LOCUS_34510 1090 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 >Feature sequence326 >Feature sequence327 1014 475 gene locus_tag LOCUS_34520 1014 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 <1846 1033 gene locus_tag LOCUS_34530 <1846 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384741.1:ABC transporter permease >Feature sequence328 220 993 gene locus_tag LOCUS_34540 220 993 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259399.1 protein_id gnl|my_center|LOCUS_34540 1622 975 gene locus_tag LOCUS_34550 gene upp 1622 975 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_34550 >Feature sequence329 1156 422 gene locus_tag LOCUS_34560 1156 422 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969952.1 protein_id gnl|my_center|LOCUS_34560 <1827 1284 gene locus_tag LOCUS_34570 <1827 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972284.1:ABC transporter ATP-binding protein >Feature sequence330 664 134 gene locus_tag LOCUS_34580 664 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 >Feature sequence331 492 1577 gene locus_tag LOCUS_34590 492 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence332 >Feature sequence333 688 329 gene locus_tag LOCUS_34600 688 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 931 1662 gene locus_tag LOCUS_34610 931 1662 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_34610 >Feature sequence334 1440 523 gene locus_tag LOCUS_34620 1440 523 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_34620 >Feature sequence335 246 485 gene locus_tag LOCUS_34630 246 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 847 707 gene locus_tag LOCUS_34640 847 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 1010 1168 gene locus_tag LOCUS_34650 1010 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 >Feature sequence336 750 157 gene locus_tag LOCUS_34660 750 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 1360 893 gene locus_tag LOCUS_34670 1360 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 >Feature sequence337 >Feature sequence338 1647 784 gene locus_tag LOCUS_34680 gene rarD 1647 784 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_34680 >Feature sequence339 764 1576 gene locus_tag LOCUS_34690 764 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence340 >Feature sequence341 483 1556 gene locus_tag LOCUS_34700 483 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence342 >Feature sequence343 413 1285 gene locus_tag LOCUS_34710 413 1285 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350041.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence344 950 114 gene locus_tag LOCUS_34720 950 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 >Feature sequence345 >Feature sequence346 1573 1037 gene locus_tag LOCUS_34730 1573 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence347 1314 427 gene locus_tag LOCUS_34740 1314 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 >Feature sequence348 210 770 gene locus_tag LOCUS_34750 210 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 >Feature sequence349 <1628 728 gene locus_tag LOCUS_34760 <1628 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257947.1:dihydroorotate dehydrogenase-like protein >Feature sequence350 >Feature sequence351 60 785 gene locus_tag LOCUS_34770 60 785 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_34770 >Feature sequence352 <1598 526 gene locus_tag LOCUS_34780 <1598 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037398629.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence353 >Feature sequence354 >Feature sequence355 <1 628 gene locus_tag LOCUS_34790 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460483.1:alpha/beta hydrolase 1222 644 gene locus_tag LOCUS_34800 1222 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 >Feature sequence356 1 1062 gene locus_tag LOCUS_34810 1 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence357