>Feature sequence001 718 1977 gene locus_tag LOCUS_00010 718 1977 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463782.1 protein_id gnl|my_center|LOCUS_00010 2100 2861 gene locus_tag LOCUS_00020 2100 2861 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_00020 2861 4321 gene locus_tag LOCUS_00030 2861 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4318 4647 gene locus_tag LOCUS_00040 4318 4647 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257356.1 protein_id gnl|my_center|LOCUS_00040 4719 5222 gene locus_tag LOCUS_00050 4719 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5219 6364 gene locus_tag LOCUS_00060 5219 6364 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_00060 6367 7515 gene locus_tag LOCUS_00070 6367 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7654 9174 gene locus_tag LOCUS_00080 7654 9174 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_00080 9389 9802 gene locus_tag LOCUS_00090 9389 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9799 11022 gene locus_tag LOCUS_00100 9799 11022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11006 12169 gene locus_tag LOCUS_00110 11006 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12166 13314 gene locus_tag LOCUS_00120 12166 13314 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956987.1 protein_id gnl|my_center|LOCUS_00120 13402 14277 gene locus_tag LOCUS_00130 13402 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14270 16597 gene locus_tag LOCUS_00140 14270 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16689 17645 gene locus_tag LOCUS_00150 16689 17645 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331371.1 protein_id gnl|my_center|LOCUS_00150 18680 20557 gene locus_tag LOCUS_00160 18680 20557 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_00160 21311 20574 gene locus_tag LOCUS_00170 gene vpsK 21311 20574 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_00170 22533 23837 gene locus_tag LOCUS_00180 22533 23837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23834 24724 gene locus_tag LOCUS_00190 23834 24724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24711 25892 gene locus_tag LOCUS_00200 24711 25892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26075 26308 gene locus_tag LOCUS_00210 26075 26308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26448 27974 gene locus_tag LOCUS_00220 26448 27974 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 protein_id gnl|my_center|LOCUS_00220 28147 28680 gene locus_tag LOCUS_00230 28147 28680 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266736.1 protein_id gnl|my_center|LOCUS_00230 28692 30383 gene locus_tag LOCUS_00240 28692 30383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30394 30717 gene locus_tag LOCUS_00250 30394 30717 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_00250 30717 31313 gene locus_tag LOCUS_00260 gene recR 30717 31313 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521324.1 protein_id gnl|my_center|LOCUS_00260 31310 32272 gene locus_tag LOCUS_00270 31310 32272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32329 33639 gene locus_tag LOCUS_00280 32329 33639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33673 34932 gene locus_tag LOCUS_00290 33673 34932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34952 35365 gene locus_tag LOCUS_00300 34952 35365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36939 35359 gene locus_tag LOCUS_00310 gene nadB 36939 35359 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_00310 37118 37717 gene locus_tag LOCUS_00320 gene rpoE 37118 37717 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_00320 37720 38208 gene locus_tag LOCUS_00330 37720 38208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38205 39149 gene locus_tag LOCUS_00340 38205 39149 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192760.1 protein_id gnl|my_center|LOCUS_00340 39152 39586 gene locus_tag LOCUS_00350 39152 39586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39627 41012 gene locus_tag LOCUS_00360 39627 41012 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_00360 41517 41059 gene locus_tag LOCUS_00370 41517 41059 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_00370 43157 41517 gene locus_tag LOCUS_00380 gene pgi 43157 41517 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_00380 45364 43214 gene locus_tag LOCUS_00390 gene glgB 45364 43214 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_00390 45467 46792 gene locus_tag LOCUS_00400 gene glgC 45467 46792 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_00400 46838 48547 gene locus_tag LOCUS_00410 46838 48547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 48593 50104 gene locus_tag LOCUS_00420 gene malQ 48593 50104 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094267720.1 protein_id gnl|my_center|LOCUS_00420 50884 50261 gene locus_tag LOCUS_00430 50884 50261 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243804.1 protein_id gnl|my_center|LOCUS_00430 52598 50877 gene locus_tag LOCUS_00440 52598 50877 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481667.1 protein_id gnl|my_center|LOCUS_00440 52969 53457 gene locus_tag LOCUS_00450 52969 53457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 53611 53928 gene locus_tag LOCUS_00460 gene soxZ 53611 53928 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881177.1 protein_id gnl|my_center|LOCUS_00460 53971 54777 gene locus_tag LOCUS_00470 gene soxA 53971 54777 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228664.1 protein_id gnl|my_center|LOCUS_00470 54790 55410 gene locus_tag LOCUS_00480 gene soxX 54790 55410 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_00480 55483 57198 gene locus_tag LOCUS_00490 gene soxB 55483 57198 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_00490 57210 57716 gene locus_tag LOCUS_00500 57210 57716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 57770 58489 gene locus_tag LOCUS_00510 57770 58489 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 protein_id gnl|my_center|LOCUS_00510 58508 59434 gene locus_tag LOCUS_00520 58508 59434 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103565.1 protein_id gnl|my_center|LOCUS_00520 59482 59910 gene locus_tag LOCUS_00530 59482 59910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 59959 60867 gene locus_tag LOCUS_00540 59959 60867 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966742.1 protein_id gnl|my_center|LOCUS_00540 61119 61871 gene locus_tag LOCUS_00550 gene surE 61119 61871 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_00550 61862 62536 gene locus_tag LOCUS_00560 61862 62536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 62533 63522 gene locus_tag LOCUS_00570 62533 63522 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065597567.1 protein_id gnl|my_center|LOCUS_00570 63622 64464 gene locus_tag LOCUS_00580 63622 64464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 64548 65006 gene locus_tag LOCUS_00590 64548 65006 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521823.1 protein_id gnl|my_center|LOCUS_00590 65056 66450 gene locus_tag LOCUS_00600 gene atpD 65056 66450 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_00600 66447 66836 gene locus_tag LOCUS_00610 66447 66836 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_00610 66829 67152 gene locus_tag LOCUS_00620 66829 67152 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_00620 67145 67432 gene locus_tag LOCUS_00630 67145 67432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 67423 68097 gene locus_tag LOCUS_00640 67423 68097 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_00640 68116 68394 gene locus_tag LOCUS_00650 68116 68394 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022407.1 protein_id gnl|my_center|LOCUS_00650 68781 69530 gene locus_tag LOCUS_00660 68781 69530 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_00660 69533 71047 gene locus_tag LOCUS_00670 69533 71047 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_00670 71044 71910 gene locus_tag LOCUS_00680 71044 71910 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_00680 72217 72435 gene locus_tag LOCUS_00690 72217 72435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 72610 72915 gene locus_tag LOCUS_00700 gene mazE 72610 72915 CDS product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581937.1 protein_id gnl|my_center|LOCUS_00700 72915 73268 gene locus_tag LOCUS_00710 gene mazF 72915 73268 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887062.1 protein_id gnl|my_center|LOCUS_00710 73302 73829 gene locus_tag LOCUS_00720 73302 73829 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_00720 73909 74223 gene locus_tag LOCUS_00730 73909 74223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 74672 74175 gene locus_tag LOCUS_00740 74672 74175 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_00740 74950 74672 gene locus_tag LOCUS_00750 74950 74672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 75171 75034 gene locus_tag LOCUS_00760 75171 75034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 76058 77239 gene locus_tag LOCUS_00770 76058 77239 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_00770 77217 77741 gene locus_tag LOCUS_00780 77217 77741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 78103 78408 gene locus_tag LOCUS_00790 78103 78408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 78522 81332 gene locus_tag LOCUS_00800 78522 81332 CDS product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014158.1 protein_id gnl|my_center|LOCUS_00800 81851 81761 gene locus_tag LOCUS_t00010 81851 81761 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 1119 307 gene locus_tag LOCUS_00810 gene cpoB 1119 307 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097528.1 protein_id gnl|my_center|LOCUS_00810 1648 1124 gene locus_tag LOCUS_00820 gene pal 1648 1124 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_00820 2938 1676 gene locus_tag LOCUS_00830 gene tolB 2938 1676 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_00830 3789 2950 gene locus_tag LOCUS_00840 3789 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 4205 3786 gene locus_tag LOCUS_00850 gene tolR 4205 3786 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_00850 4916 4239 gene locus_tag LOCUS_00860 gene tolQ 4916 4239 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_00860 5467 5057 gene locus_tag LOCUS_00870 gene ybgC 5467 5057 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 protein_id gnl|my_center|LOCUS_00870 6769 5708 gene locus_tag LOCUS_00880 gene ruvB 6769 5708 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_00880 7539 6802 gene locus_tag LOCUS_00890 7539 6802 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933923.1 protein_id gnl|my_center|LOCUS_00890 8154 7573 gene locus_tag LOCUS_00900 gene ruvA 8154 7573 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_00900 9145 8207 gene locus_tag LOCUS_00910 9145 8207 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_00910 9792 9172 gene locus_tag LOCUS_00920 gene ruvC 9792 9172 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_00920 10528 9803 gene locus_tag LOCUS_00930 10528 9803 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216723.1 protein_id gnl|my_center|LOCUS_00930 10682 11293 gene locus_tag LOCUS_00940 10682 11293 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_00940 11540 11316 gene locus_tag LOCUS_00950 11540 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 13817 11541 gene locus_tag LOCUS_00960 13817 11541 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_00960 15493 13862 gene locus_tag LOCUS_00970 15493 13862 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939525.1 protein_id gnl|my_center|LOCUS_00970 16584 15502 gene locus_tag LOCUS_00980 16584 15502 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289197.1 protein_id gnl|my_center|LOCUS_00980 17437 16703 gene locus_tag LOCUS_00990 17437 16703 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188685.1 protein_id gnl|my_center|LOCUS_00990 17638 18489 gene locus_tag LOCUS_01000 17638 18489 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_01000 18482 19552 gene locus_tag LOCUS_01010 18482 19552 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256083.1 protein_id gnl|my_center|LOCUS_01010 19562 20554 gene locus_tag LOCUS_01020 19562 20554 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 protein_id gnl|my_center|LOCUS_01020 24393 20623 gene locus_tag LOCUS_01030 gene hrpA 24393 20623 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_01030 24757 24458 gene locus_tag LOCUS_01040 24757 24458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 24970 24894 gene locus_tag LOCUS_t00020 24970 24894 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27018 25042 gene locus_tag LOCUS_01050 gene rpoD 27018 25042 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930783.1 protein_id gnl|my_center|LOCUS_01050 28984 27257 gene locus_tag LOCUS_01060 gene dnaG 28984 27257 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940969.1 protein_id gnl|my_center|LOCUS_01060 29538 29092 gene locus_tag LOCUS_01070 29538 29092 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_01070 29790 29578 gene locus_tag LOCUS_01080 gene rpsU 29790 29578 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_01080 31099 29894 gene locus_tag LOCUS_01090 gene tyrS 31099 29894 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957422.1 protein_id gnl|my_center|LOCUS_01090 31293 32591 gene locus_tag LOCUS_01100 31293 32591 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_01100 32592 33698 gene locus_tag LOCUS_01110 32592 33698 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455827.1 protein_id gnl|my_center|LOCUS_01110 33904 35631 gene locus_tag LOCUS_01120 33904 35631 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_01120 35647 36258 gene locus_tag LOCUS_01130 35647 36258 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_01130 36301 37014 gene locus_tag LOCUS_01140 36301 37014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 37204 38496 gene locus_tag LOCUS_01150 37204 38496 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038711081.1 protein_id gnl|my_center|LOCUS_01150 39060 38656 gene locus_tag LOCUS_01160 39060 38656 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_01160 39751 39050 gene locus_tag LOCUS_01170 39751 39050 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206673.1 protein_id gnl|my_center|LOCUS_01170 40082 39795 gene locus_tag LOCUS_01180 40082 39795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 41382 40243 gene locus_tag LOCUS_01190 gene cydB 41382 40243 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168027.1 protein_id gnl|my_center|LOCUS_01190 42970 41411 gene locus_tag LOCUS_01200 42970 41411 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195345.1 protein_id gnl|my_center|LOCUS_01200 43424 44716 gene locus_tag LOCUS_01210 43424 44716 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038711081.1 protein_id gnl|my_center|LOCUS_01210 45311 44946 gene locus_tag LOCUS_01220 gene erpA 45311 44946 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_01220 45734 45327 gene locus_tag LOCUS_01230 45734 45327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 46413 45766 gene locus_tag LOCUS_01240 46413 45766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 47594 46566 gene locus_tag LOCUS_01250 gene argC 47594 46566 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_01250 48065 47673 gene locus_tag LOCUS_01260 gene rpsI 48065 47673 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549989.1 protein_id gnl|my_center|LOCUS_01260 48511 48068 gene locus_tag LOCUS_01270 gene rplM 48511 48068 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_01270 48709 49485 gene locus_tag LOCUS_01280 48709 49485 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 protein_id gnl|my_center|LOCUS_01280 49487 49906 gene locus_tag LOCUS_01290 49487 49906 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 protein_id gnl|my_center|LOCUS_01290 50550 49936 gene locus_tag LOCUS_01300 gene ubiX 50550 49936 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_01300 51182 50664 gene locus_tag LOCUS_01310 51182 50664 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869101.1 protein_id gnl|my_center|LOCUS_01310 51752 51378 gene locus_tag LOCUS_01320 51752 51378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 52591 51755 gene locus_tag LOCUS_01330 gene rapZ 52591 51755 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530937.1 protein_id gnl|my_center|LOCUS_01330 53531 52593 gene locus_tag LOCUS_01340 gene hprK 53531 52593 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195225.1 protein_id gnl|my_center|LOCUS_01340 53989 53528 gene locus_tag LOCUS_01350 gene ptsN 53989 53528 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_01350 54371 54045 gene locus_tag LOCUS_01360 gene raiA 54371 54045 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 protein_id gnl|my_center|LOCUS_01360 55790 54387 gene locus_tag LOCUS_01370 55790 54387 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_01370 56553 55831 gene locus_tag LOCUS_01380 gene lptB 56553 55831 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040602.1 protein_id gnl|my_center|LOCUS_01380 57095 56550 gene locus_tag LOCUS_01390 gene lptA 57095 56550 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_01390 57660 57085 gene locus_tag LOCUS_01400 57660 57085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 58175 57657 gene locus_tag LOCUS_01410 58175 57657 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_01410 59213 58218 gene locus_tag LOCUS_01420 59213 58218 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence003 85 1323 gene locus_tag LOCUS_01430 85 1323 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_01430 1371 2876 gene locus_tag LOCUS_01440 1371 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3343 2939 gene locus_tag LOCUS_01450 3343 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 4975 3548 gene locus_tag LOCUS_01460 gene opmB 4975 3548 CDS product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_01460 8070 4972 gene locus_tag LOCUS_01470 gene mdtC 8070 4972 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667525.1 protein_id gnl|my_center|LOCUS_01470 11198 8067 gene locus_tag LOCUS_01480 gene muxB 11198 8067 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_01480 12421 11195 gene locus_tag LOCUS_01490 gene muxA 12421 11195 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MuxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113320.1 protein_id gnl|my_center|LOCUS_01490 12704 13207 gene locus_tag LOCUS_01500 12704 13207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 13434 13595 gene locus_tag LOCUS_01510 13434 13595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 13592 14071 gene locus_tag LOCUS_01520 13592 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 14339 14533 gene locus_tag LOCUS_01530 14339 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 14591 14953 gene locus_tag LOCUS_01540 14591 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 15020 15589 gene locus_tag LOCUS_01550 15020 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 15823 16479 gene locus_tag LOCUS_01560 15823 16479 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529073.1 protein_id gnl|my_center|LOCUS_01560 16623 17486 gene locus_tag LOCUS_01570 16623 17486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 17576 18463 gene locus_tag LOCUS_01580 gene cysM 17576 18463 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_01580 18537 19421 gene locus_tag LOCUS_01590 gene argB 18537 19421 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_01590 19435 20097 gene locus_tag LOCUS_01600 19435 20097 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 protein_id gnl|my_center|LOCUS_01600 20094 21206 gene locus_tag LOCUS_01610 gene aroF 20094 21206 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363948.1 protein_id gnl|my_center|LOCUS_01610 21358 21795 gene locus_tag LOCUS_01620 21358 21795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 22533 22162 gene locus_tag LOCUS_01630 gene sirB2 22533 22162 CDS product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367107.1 protein_id gnl|my_center|LOCUS_01630 23797 22535 gene locus_tag LOCUS_01640 23797 22535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_01640 24009 23794 gene locus_tag LOCUS_01650 24009 23794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 24497 24012 gene locus_tag LOCUS_01660 24497 24012 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_01660 24569 24829 gene locus_tag LOCUS_01670 24569 24829 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 protein_id gnl|my_center|LOCUS_01670 24861 25790 gene locus_tag LOCUS_01680 24861 25790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 25793 26257 gene locus_tag LOCUS_01690 gene nsrR 25793 26257 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_01690 26205 26462 gene locus_tag LOCUS_01700 26205 26462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 26440 27459 gene locus_tag LOCUS_01710 26440 27459 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456528.1 protein_id gnl|my_center|LOCUS_01710 28126 29778 gene locus_tag LOCUS_01720 28126 29778 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943967.1 protein_id gnl|my_center|LOCUS_01720 30710 29922 gene locus_tag LOCUS_01730 gene fabI 30710 29922 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223367.1 protein_id gnl|my_center|LOCUS_01730 30745 31434 gene locus_tag LOCUS_01740 gene ccmA 30745 31434 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815896.1 protein_id gnl|my_center|LOCUS_01740 31436 32119 gene locus_tag LOCUS_01750 gene ccmB 31436 32119 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_01750 32129 32863 gene locus_tag LOCUS_01760 gene ccmC 32129 32863 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_01760 32863 33036 gene locus_tag LOCUS_01770 32863 33036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 33038 33499 gene locus_tag LOCUS_01780 gene ccmE 33038 33499 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_01780 33530 35518 gene locus_tag LOCUS_01790 33530 35518 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_01790 35515 36042 gene locus_tag LOCUS_01800 35515 36042 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_01800 36039 36551 gene locus_tag LOCUS_01810 36039 36551 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085912.1 protein_id gnl|my_center|LOCUS_01810 36548 37792 gene locus_tag LOCUS_01820 gene ccmI 36548 37792 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_01820 38512 38036 gene locus_tag LOCUS_01830 38512 38036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 38994 38662 gene locus_tag LOCUS_01840 38994 38662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 40355 39003 gene locus_tag LOCUS_01850 40355 39003 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185874.1 protein_id gnl|my_center|LOCUS_01850 40836 40375 gene locus_tag LOCUS_01860 40836 40375 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008612795.1 protein_id gnl|my_center|LOCUS_01860 41031 42821 gene locus_tag LOCUS_01870 gene lepA 41031 42821 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_01870 42983 43783 gene locus_tag LOCUS_01880 gene lepB 42983 43783 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 protein_id gnl|my_center|LOCUS_01880 43796 44158 gene locus_tag LOCUS_01890 43796 44158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 44166 44822 gene locus_tag LOCUS_01900 gene rnc 44166 44822 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853248.1 protein_id gnl|my_center|LOCUS_01900 44822 45772 gene locus_tag LOCUS_01910 gene era 44822 45772 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_01910 45820 46545 gene locus_tag LOCUS_01920 gene recO 45820 46545 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524618.1 protein_id gnl|my_center|LOCUS_01920 46542 47267 gene locus_tag LOCUS_01930 gene pdxJ 46542 47267 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550143.1 protein_id gnl|my_center|LOCUS_01930 47269 47649 gene locus_tag LOCUS_01940 gene acpS 47269 47649 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_01940 48008 47685 gene locus_tag LOCUS_01950 48008 47685 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_01950 48288 48028 gene locus_tag LOCUS_01960 48288 48028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_01960 48540 48358 gene locus_tag LOCUS_01970 48540 48358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 49393 48806 gene locus_tag LOCUS_01980 49393 48806 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_01980 49971 49549 gene locus_tag LOCUS_01990 49971 49549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 50154 49972 gene locus_tag LOCUS_02000 50154 49972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 50410 50114 gene locus_tag LOCUS_02010 50410 50114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 50637 50395 gene locus_tag LOCUS_02020 50637 50395 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_02020 51170 50988 gene locus_tag LOCUS_02030 51170 50988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 51790 51281 gene locus_tag LOCUS_02040 51790 51281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 52036 51878 gene locus_tag LOCUS_02050 52036 51878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 52316 53296 gene locus_tag LOCUS_02060 52316 53296 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_02060 53345 54394 gene locus_tag LOCUS_02070 gene nagZ 53345 54394 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_02070 >Feature sequence004 124 882 gene locus_tag LOCUS_02080 124 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 969 1310 gene locus_tag LOCUS_02090 969 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 1314 1598 gene locus_tag LOCUS_02100 1314 1598 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811141.1 protein_id gnl|my_center|LOCUS_02100 2306 2602 gene locus_tag LOCUS_02110 2306 2602 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211161.1 protein_id gnl|my_center|LOCUS_02110 2599 2961 gene locus_tag LOCUS_02120 2599 2961 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216048.1 protein_id gnl|my_center|LOCUS_02120 4075 3245 gene locus_tag LOCUS_02130 4075 3245 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040246.1 protein_id gnl|my_center|LOCUS_02130 4349 4086 gene locus_tag LOCUS_02140 4349 4086 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_02140 4648 4346 gene locus_tag LOCUS_02150 4648 4346 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967595.1 protein_id gnl|my_center|LOCUS_02150 5190 4648 gene locus_tag LOCUS_02160 5190 4648 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_02160 5583 5194 gene locus_tag LOCUS_02170 gene msrB 5583 5194 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943090.1 protein_id gnl|my_center|LOCUS_02170 6987 5584 gene locus_tag LOCUS_02180 6987 5584 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_02180 7455 6997 gene locus_tag LOCUS_02190 7455 6997 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_02190 7881 7579 gene locus_tag LOCUS_02200 7881 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 8079 8714 gene locus_tag LOCUS_02210 gene tadA 8079 8714 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191221.1 protein_id gnl|my_center|LOCUS_02210 8705 9184 gene locus_tag LOCUS_02220 8705 9184 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_02220 9203 9640 gene locus_tag LOCUS_02230 9203 9640 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143392.1 protein_id gnl|my_center|LOCUS_02230 10294 9626 gene locus_tag LOCUS_02240 10294 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925885.1 protein_id gnl|my_center|LOCUS_02240 11316 10291 gene locus_tag LOCUS_02250 11316 10291 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_02250 11932 12102 gene locus_tag LOCUS_02260 11932 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 12129 12485 gene locus_tag LOCUS_02270 12129 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 13010 12543 gene locus_tag LOCUS_02280 13010 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 13628 13035 gene locus_tag LOCUS_02290 13628 13035 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_02290 14785 14078 gene locus_tag LOCUS_02300 14785 14078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_02300 15952 14789 gene locus_tag LOCUS_02310 15952 14789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_02310 17160 15949 gene locus_tag LOCUS_02320 17160 15949 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383345.1 protein_id gnl|my_center|LOCUS_02320 17273 18097 gene locus_tag LOCUS_02330 17273 18097 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929219.1 protein_id gnl|my_center|LOCUS_02330 18790 18113 gene locus_tag LOCUS_02340 gene ung 18790 18113 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977484.1 protein_id gnl|my_center|LOCUS_02340 21077 18783 gene locus_tag LOCUS_02350 gene copA 21077 18783 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_02350 21371 21180 gene locus_tag LOCUS_02360 21371 21180 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_02360 24187 21884 gene locus_tag LOCUS_02370 24187 21884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 27236 24231 gene locus_tag LOCUS_02380 27236 24231 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_02380 29959 27362 gene locus_tag LOCUS_02390 29959 27362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 30434 30865 gene locus_tag LOCUS_02400 30434 30865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 33386 30930 gene locus_tag LOCUS_02410 33386 30930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 33789 33598 gene locus_tag LOCUS_02420 33789 33598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 34523 33858 gene locus_tag LOCUS_02430 34523 33858 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_02430 36199 34649 gene locus_tag LOCUS_02440 gene lysS 36199 34649 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192783.1 protein_id gnl|my_center|LOCUS_02440 37593 36277 gene locus_tag LOCUS_02450 gene hpnE 37593 36277 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_02450 38434 37601 gene locus_tag LOCUS_02460 gene hpnD 38434 37601 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_02460 39353 38436 gene locus_tag LOCUS_02470 gene hpnC 39353 38436 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_02470 40342 39434 gene locus_tag LOCUS_02480 gene prmB 40342 39434 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_02480 41463 40333 gene locus_tag LOCUS_02490 gene dapE 41463 40333 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521179.1 protein_id gnl|my_center|LOCUS_02490 41923 41474 gene locus_tag LOCUS_02500 41923 41474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 43077 41920 gene locus_tag LOCUS_02510 43077 41920 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_02510 43994 43173 gene locus_tag LOCUS_02520 gene dapD 43994 43173 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_02520 45165 44218 gene locus_tag LOCUS_02530 45165 44218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 46535 45189 gene locus_tag LOCUS_02540 46535 45189 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_02540 47023 46517 gene locus_tag LOCUS_02550 gene tsaE 47023 46517 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020035.1 protein_id gnl|my_center|LOCUS_02550 47158 48171 gene locus_tag LOCUS_02560 gene queG 47158 48171 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037446.1 protein_id gnl|my_center|LOCUS_02560 49784 48885 gene locus_tag LOCUS_02570 49784 48885 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_02570 50357 49791 gene locus_tag LOCUS_02580 50357 49791 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_02580 51124 50369 gene locus_tag LOCUS_02590 51124 50369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 52000 51161 gene locus_tag LOCUS_02600 52000 51161 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931396.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence005 4942 2945 gene locus_tag LOCUS_02610 gene pilJ 4942 2945 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_02610 5462 4971 gene locus_tag LOCUS_02620 5462 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 5837 5472 gene locus_tag LOCUS_02630 gene pilH 5837 5472 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_02630 6237 5839 gene locus_tag LOCUS_02640 gene pilG 6237 5839 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084583.1 protein_id gnl|my_center|LOCUS_02640 7858 6398 gene locus_tag LOCUS_02650 7858 6398 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_02650 9231 7858 gene locus_tag LOCUS_02660 gene trkA 9231 7858 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_02660 10055 9267 gene locus_tag LOCUS_02670 10055 9267 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_02670 10687 10139 gene locus_tag LOCUS_02680 10687 10139 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_02680 10811 11491 gene locus_tag LOCUS_02690 10811 11491 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 protein_id gnl|my_center|LOCUS_02690 11712 13034 gene locus_tag LOCUS_02700 gene argA 11712 13034 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930879.1 protein_id gnl|my_center|LOCUS_02700 14421 13159 gene locus_tag LOCUS_02710 14421 13159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 protein_id gnl|my_center|LOCUS_02710 15032 14418 gene locus_tag LOCUS_02720 gene metW 15032 14418 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 protein_id gnl|my_center|LOCUS_02720 16158 15037 gene locus_tag LOCUS_02730 16158 15037 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951153.1 protein_id gnl|my_center|LOCUS_02730 16536 17288 gene locus_tag LOCUS_02740 16536 17288 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_02740 17302 18414 gene locus_tag LOCUS_02750 gene ald 17302 18414 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_02750 18480 20594 gene locus_tag LOCUS_02760 18480 20594 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_02760 22059 20611 gene locus_tag LOCUS_02770 22059 20611 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_02770 24031 22307 gene locus_tag LOCUS_02780 gene ptsP 24031 22307 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_02780 24326 24060 gene locus_tag LOCUS_02790 24326 24060 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_02790 24714 24328 gene locus_tag LOCUS_02800 24714 24328 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_02800 25762 24725 gene locus_tag LOCUS_02810 25762 24725 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527101.1 protein_id gnl|my_center|LOCUS_02810 27030 25759 gene locus_tag LOCUS_02820 gene gshA 27030 25759 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_02820 27590 29188 gene locus_tag LOCUS_02830 27590 29188 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_02830 29255 30052 gene locus_tag LOCUS_02840 gene murI 29255 30052 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_02840 30056 30439 gene locus_tag LOCUS_02850 30056 30439 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 protein_id gnl|my_center|LOCUS_02850 30470 31180 gene locus_tag LOCUS_02860 30470 31180 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_02860 31208 32056 gene locus_tag LOCUS_02870 gene purU 31208 32056 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_02870 32595 32131 gene locus_tag LOCUS_02880 32595 32131 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458568.1 protein_id gnl|my_center|LOCUS_02880 33368 32592 gene locus_tag LOCUS_02890 33368 32592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 34194 33361 gene locus_tag LOCUS_02900 34194 33361 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508789.1 protein_id gnl|my_center|LOCUS_02900 34478 34194 gene locus_tag LOCUS_02910 34478 34194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 35283 34687 gene locus_tag LOCUS_02920 gene msrA 35283 34687 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928865.1 protein_id gnl|my_center|LOCUS_02920 36977 35301 gene locus_tag LOCUS_02930 36977 35301 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252802.1 protein_id gnl|my_center|LOCUS_02930 37633 36980 gene locus_tag LOCUS_02940 37633 36980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 37747 38286 gene locus_tag LOCUS_02950 37747 38286 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529420.1 protein_id gnl|my_center|LOCUS_02950 38286 38921 gene locus_tag LOCUS_02960 38286 38921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 39076 40017 gene locus_tag LOCUS_02970 39076 40017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 41504 40023 gene locus_tag LOCUS_02980 41504 40023 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_02980 42366 41509 gene locus_tag LOCUS_02990 gene rsmI 42366 41509 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525682.1 protein_id gnl|my_center|LOCUS_02990 42499 43497 gene locus_tag LOCUS_03000 42499 43497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 43494 43832 gene locus_tag LOCUS_03010 43494 43832 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098898.1 protein_id gnl|my_center|LOCUS_03010 44020 44697 gene locus_tag LOCUS_03020 44020 44697 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_03020 44698 45258 gene locus_tag LOCUS_03030 44698 45258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 45248 45739 gene locus_tag LOCUS_03040 gene rfaE2 45248 45739 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 protein_id gnl|my_center|LOCUS_03040 45736 46101 gene locus_tag LOCUS_03050 45736 46101 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_03050 46112 46846 gene locus_tag LOCUS_03060 gene ubiE 46112 46846 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189973.1 protein_id gnl|my_center|LOCUS_03060 46987 47274 gene locus_tag LOCUS_03070 46987 47274 CDS product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312252.1 protein_id gnl|my_center|LOCUS_03070 47271 47570 gene locus_tag LOCUS_03080 47271 47570 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036266.1 protein_id gnl|my_center|LOCUS_03080 47613 47954 gene locus_tag LOCUS_03090 47613 47954 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_03090 47961 48149 gene locus_tag LOCUS_03100 47961 48149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 48139 48759 gene locus_tag LOCUS_03110 gene rluA 48139 48759 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073570.1 protein_id gnl|my_center|LOCUS_03110 48809 49174 gene locus_tag LOCUS_03120 48809 49174 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_03120 >Feature sequence006 2813 225 gene locus_tag LOCUS_03130 2813 225 CDS product TraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331477.1 protein_id gnl|my_center|LOCUS_03130 3336 2815 gene locus_tag LOCUS_03140 3336 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4061 3336 gene locus_tag LOCUS_03150 4061 3336 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207575.1 protein_id gnl|my_center|LOCUS_03150 5287 4076 gene locus_tag LOCUS_03160 5287 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5961 5287 gene locus_tag LOCUS_03170 5961 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6511 5918 gene locus_tag LOCUS_03180 6511 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 6805 6515 gene locus_tag LOCUS_03190 6805 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 7150 6854 gene locus_tag LOCUS_03200 7150 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 7632 7240 gene locus_tag LOCUS_03210 7632 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 8504 7995 gene locus_tag LOCUS_03220 8504 7995 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942768.1 protein_id gnl|my_center|LOCUS_03220 9234 8959 gene locus_tag LOCUS_03230 9234 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 10650 9739 gene locus_tag LOCUS_03240 10650 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 10975 10781 gene locus_tag LOCUS_03250 10975 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 10967 11434 gene locus_tag LOCUS_03260 10967 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 11676 11849 gene locus_tag LOCUS_03270 11676 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 11917 12180 gene locus_tag LOCUS_03280 11917 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 13418 12237 gene locus_tag LOCUS_03290 13418 12237 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039727.1 protein_id gnl|my_center|LOCUS_03290 15383 13803 gene locus_tag LOCUS_03300 gene guaA 15383 13803 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_03300 15814 15449 gene locus_tag LOCUS_03310 15814 15449 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_03310 17316 15856 gene locus_tag LOCUS_03320 gene guaB 17316 15856 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_03320 17756 17418 gene locus_tag LOCUS_03330 17756 17418 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_03330 18551 18012 gene locus_tag LOCUS_03340 gene greB 18551 18012 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_03340 19386 18772 gene locus_tag LOCUS_03350 gene rnhB 19386 18772 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 protein_id gnl|my_center|LOCUS_03350 20528 19386 gene locus_tag LOCUS_03360 gene lpxB 20528 19386 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192608.1 protein_id gnl|my_center|LOCUS_03360 21308 20541 gene locus_tag LOCUS_03370 gene lpxA 21308 20541 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690038.1 protein_id gnl|my_center|LOCUS_03370 21778 21308 gene locus_tag LOCUS_03380 gene fabZ 21778 21308 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_03380 22824 21775 gene locus_tag LOCUS_03390 gene lpxD 22824 21775 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771660.1 protein_id gnl|my_center|LOCUS_03390 23323 22826 gene locus_tag LOCUS_03400 23323 22826 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_03400 25639 23366 gene locus_tag LOCUS_03410 gene bamA 25639 23366 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_03410 27001 25646 gene locus_tag LOCUS_03420 gene rseP 27001 25646 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063746.1 protein_id gnl|my_center|LOCUS_03420 28179 26998 gene locus_tag LOCUS_03430 gene ispC 28179 26998 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266975.1 protein_id gnl|my_center|LOCUS_03430 29036 28182 gene locus_tag LOCUS_03440 29036 28182 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690029.1 protein_id gnl|my_center|LOCUS_03440 29808 29029 gene locus_tag LOCUS_03450 29808 29029 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690027.1 protein_id gnl|my_center|LOCUS_03450 30472 29915 gene locus_tag LOCUS_03460 gene frr 30472 29915 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_03460 31329 30610 gene locus_tag LOCUS_03470 gene pyrH 31329 30610 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_03470 32234 31335 gene locus_tag LOCUS_03480 gene tsf 32234 31335 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_03480 33041 32307 gene locus_tag LOCUS_03490 gene rpsB 33041 32307 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_03490 34582 33356 gene locus_tag LOCUS_03500 34582 33356 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259357.1 protein_id gnl|my_center|LOCUS_03500 35491 34916 gene locus_tag LOCUS_03510 35491 34916 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_03510 38996 35928 gene locus_tag LOCUS_03520 38996 35928 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 protein_id gnl|my_center|LOCUS_03520 40108 38993 gene locus_tag LOCUS_03530 40108 38993 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328247.1 protein_id gnl|my_center|LOCUS_03530 40843 40172 gene locus_tag LOCUS_03540 40843 40172 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_03540 41029 40953 gene locus_tag LOCUS_t00030 41029 40953 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 41498 41073 gene locus_tag LOCUS_03550 41498 41073 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812822.1 protein_id gnl|my_center|LOCUS_03550 41790 41479 gene locus_tag LOCUS_03560 41790 41479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 44152 41801 gene locus_tag LOCUS_03570 gene pheT 44152 41801 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225459.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence007 4093 2945 gene locus_tag LOCUS_03580 4093 2945 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810338.1 protein_id gnl|my_center|LOCUS_03580 4509 5312 gene locus_tag LOCUS_03590 4509 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 5452 5700 gene locus_tag LOCUS_03600 5452 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 5726 6964 gene locus_tag LOCUS_03610 5726 6964 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226185.1 protein_id gnl|my_center|LOCUS_03610 6975 7346 gene locus_tag LOCUS_03620 6975 7346 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 protein_id gnl|my_center|LOCUS_03620 7479 8678 gene locus_tag LOCUS_03630 7479 8678 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_03630 8726 9289 gene locus_tag LOCUS_03640 8726 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 9840 9220 gene locus_tag LOCUS_03650 9840 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 11435 9918 gene locus_tag LOCUS_03660 gene mqo 11435 9918 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099345.1 protein_id gnl|my_center|LOCUS_03660 12657 11635 gene locus_tag LOCUS_03670 12657 11635 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_03670 12706 13605 gene locus_tag LOCUS_03680 12706 13605 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 protein_id gnl|my_center|LOCUS_03680 15622 13724 gene locus_tag LOCUS_03690 gene htpG 15622 13724 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929604.1 protein_id gnl|my_center|LOCUS_03690 15765 16940 gene locus_tag LOCUS_03700 gene ubiH 15765 16940 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_03700 16985 17920 gene locus_tag LOCUS_03710 gene lpxC 16985 17920 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035967.1 protein_id gnl|my_center|LOCUS_03710 17942 18142 gene locus_tag LOCUS_03720 17942 18142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 18618 18190 gene locus_tag LOCUS_03730 18618 18190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 18643 19551 gene locus_tag LOCUS_03740 18643 19551 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814565.1 protein_id gnl|my_center|LOCUS_03740 19629 22352 gene locus_tag LOCUS_03750 gene secA 19629 22352 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814564.1 protein_id gnl|my_center|LOCUS_03750 22366 22851 gene locus_tag LOCUS_03760 22366 22851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 22965 24188 gene locus_tag LOCUS_03770 gene argJ 22965 24188 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202972.1 protein_id gnl|my_center|LOCUS_03770 24340 25230 gene locus_tag LOCUS_03780 24340 25230 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_03780 25362 26585 gene locus_tag LOCUS_03790 25362 26585 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_03790 26635 27513 gene locus_tag LOCUS_03800 26635 27513 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815515.1 protein_id gnl|my_center|LOCUS_03800 27625 29568 gene locus_tag LOCUS_03810 27625 29568 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209484109.1 protein_id gnl|my_center|LOCUS_03810 29587 30303 gene locus_tag LOCUS_03820 29587 30303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_03820 30346 30660 gene locus_tag LOCUS_03830 30346 30660 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_03830 30915 33416 gene locus_tag LOCUS_03840 30915 33416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 33657 34625 gene locus_tag LOCUS_03850 33657 34625 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_03850 34577 34876 gene locus_tag LOCUS_03860 34577 34876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 35565 34804 gene locus_tag LOCUS_03870 gene zapD 35565 34804 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_03870 36229 35642 gene locus_tag LOCUS_03880 gene coaE 36229 35642 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_03880 37125 36259 gene locus_tag LOCUS_03890 37125 36259 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_03890 38425 37214 gene locus_tag LOCUS_03900 38425 37214 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_03900 39845 38571 gene locus_tag LOCUS_03910 39845 38571 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194395.1 protein_id gnl|my_center|LOCUS_03910 40683 39901 gene locus_tag LOCUS_03920 gene lgt 40683 39901 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191241.1 protein_id gnl|my_center|LOCUS_03920 40738 42582 gene locus_tag LOCUS_03930 gene ilvD 40738 42582 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244135.1 protein_id gnl|my_center|LOCUS_03930 42634 43539 gene locus_tag LOCUS_03940 42634 43539 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269392.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence008 42 497 gene locus_tag LOCUS_03950 gene hpaR 42 497 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523778.1 protein_id gnl|my_center|LOCUS_03950 522 1469 gene locus_tag LOCUS_03960 522 1469 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706023.1 protein_id gnl|my_center|LOCUS_03960 1653 2834 gene locus_tag LOCUS_03970 1653 2834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037397.1 protein_id gnl|my_center|LOCUS_03970 2972 3373 gene locus_tag LOCUS_03980 2972 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 3543 3866 gene locus_tag LOCUS_03990 3543 3866 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_03990 3885 4382 gene locus_tag LOCUS_04000 3885 4382 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398896.1 protein_id gnl|my_center|LOCUS_04000 4391 4759 gene locus_tag LOCUS_04010 gene arsD 4391 4759 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540111.1 protein_id gnl|my_center|LOCUS_04010 4797 6548 gene locus_tag LOCUS_04020 gene arsA 4797 6548 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095196.1 protein_id gnl|my_center|LOCUS_04020 6552 7571 gene locus_tag LOCUS_04030 gene arsB 6552 7571 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 protein_id gnl|my_center|LOCUS_04030 7989 8864 gene locus_tag LOCUS_04040 gene hslO 7989 8864 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550203.1 protein_id gnl|my_center|LOCUS_04040 9248 8973 gene locus_tag LOCUS_04050 9248 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 10947 9433 gene locus_tag LOCUS_04060 gene amt 10947 9433 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_04060 11296 10958 gene locus_tag LOCUS_04070 11296 10958 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_04070 12148 11342 gene locus_tag LOCUS_04080 12148 11342 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930529.1 protein_id gnl|my_center|LOCUS_04080 12411 12683 gene locus_tag LOCUS_04090 12411 12683 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198021.1 protein_id gnl|my_center|LOCUS_04090 12688 14184 gene locus_tag LOCUS_04100 12688 14184 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697442.1 protein_id gnl|my_center|LOCUS_04100 14249 15295 gene locus_tag LOCUS_04110 14249 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 15455 19180 gene locus_tag LOCUS_04120 gene metH 15455 19180 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_04120 19229 19915 gene locus_tag LOCUS_04130 19229 19915 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256749.1 protein_id gnl|my_center|LOCUS_04130 19997 20227 gene locus_tag LOCUS_04140 19997 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 20214 20594 gene locus_tag LOCUS_04150 20214 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 20758 21105 gene locus_tag LOCUS_04160 20758 21105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 21126 21611 gene locus_tag LOCUS_04170 21126 21611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 21608 21772 gene locus_tag LOCUS_04180 21608 21772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 21773 22381 gene locus_tag LOCUS_04190 21773 22381 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_04190 22374 23627 gene locus_tag LOCUS_04200 gene porA 22374 23627 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_04200 23637 24638 gene locus_tag LOCUS_04210 gene porB 23637 24638 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_04210 24640 26262 gene locus_tag LOCUS_04220 24640 26262 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_04220 26262 26615 gene locus_tag LOCUS_04230 26262 26615 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 protein_id gnl|my_center|LOCUS_04230 26756 28138 gene locus_tag LOCUS_04240 gene mpl 26756 28138 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_04240 31727 28260 gene locus_tag LOCUS_04250 31727 28260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 32104 32394 gene locus_tag LOCUS_04260 32104 32394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 32376 32774 gene locus_tag LOCUS_04270 32376 32774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 34176 32779 gene locus_tag LOCUS_04280 gene ntrC 34176 32779 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413458.1 protein_id gnl|my_center|LOCUS_04280 35294 34254 gene locus_tag LOCUS_04290 gene glnL 35294 34254 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_04290 35767 35330 gene locus_tag LOCUS_04300 35767 35330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 37304 35889 gene locus_tag LOCUS_04310 gene glnA 37304 35889 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 protein_id gnl|my_center|LOCUS_04310 38556 37471 gene locus_tag LOCUS_04320 38556 37471 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525685.1 protein_id gnl|my_center|LOCUS_04320 38737 39189 gene locus_tag LOCUS_04330 38737 39189 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_04330 39953 39186 gene locus_tag LOCUS_04340 39953 39186 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_04340 39992 40672 gene locus_tag LOCUS_04350 gene pyrE 39992 40672 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_04350 40662 41288 gene locus_tag LOCUS_04360 40662 41288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence009 1510 260 gene locus_tag LOCUS_04370 1510 260 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933883.1 protein_id gnl|my_center|LOCUS_04370 2069 1599 gene locus_tag LOCUS_04380 2069 1599 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_04380 2346 2119 gene locus_tag LOCUS_04390 2346 2119 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_04390 4398 2614 gene locus_tag LOCUS_04400 4398 2614 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447544.1 protein_id gnl|my_center|LOCUS_04400 5374 4403 gene locus_tag LOCUS_04410 5374 4403 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 protein_id gnl|my_center|LOCUS_04410 6115 5384 gene locus_tag LOCUS_04420 6115 5384 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187972.1 protein_id gnl|my_center|LOCUS_04420 9048 6112 gene locus_tag LOCUS_04430 9048 6112 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_04430 9097 9252 gene locus_tag LOCUS_04440 9097 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 9405 10619 gene locus_tag LOCUS_04450 gene sat 9405 10619 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_04450 10690 11166 gene locus_tag LOCUS_04460 gene aprB 10690 11166 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_04460 11196 13235 gene locus_tag LOCUS_04470 gene aprA 11196 13235 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_04470 13313 14218 gene locus_tag LOCUS_04480 13313 14218 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_04480 14682 14380 gene locus_tag LOCUS_04490 14682 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 14890 16806 gene locus_tag LOCUS_04500 14890 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 17666 17139 gene locus_tag LOCUS_04510 17666 17139 CDS product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940855.1 protein_id gnl|my_center|LOCUS_04510 17786 18712 gene locus_tag LOCUS_04520 17786 18712 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_04520 18705 21503 gene locus_tag LOCUS_04530 gene ileS 18705 21503 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699451.1 protein_id gnl|my_center|LOCUS_04530 21472 21972 gene locus_tag LOCUS_04540 gene lspA 21472 21972 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039646.1 protein_id gnl|my_center|LOCUS_04540 21953 22891 gene locus_tag LOCUS_04550 gene ispH 21953 22891 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_04550 22905 23972 gene locus_tag LOCUS_04560 gene thiO 22905 23972 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_04560 24004 24079 gene locus_tag LOCUS_t00040 24004 24079 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24243 26078 gene locus_tag LOCUS_04570 gene recQ 24243 26078 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_04570 27402 26083 gene locus_tag LOCUS_04580 27402 26083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974736.1 protein_id gnl|my_center|LOCUS_04580 29403 27535 gene locus_tag LOCUS_04590 29403 27535 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207874.1 protein_id gnl|my_center|LOCUS_04590 31012 29501 gene locus_tag LOCUS_04600 31012 29501 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_04600 31222 31713 gene locus_tag LOCUS_04610 31222 31713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 31971 31705 gene locus_tag LOCUS_04620 31971 31705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 32718 31975 gene locus_tag LOCUS_04630 gene fabG 32718 31975 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008530.1 protein_id gnl|my_center|LOCUS_04630 33777 32845 gene locus_tag LOCUS_04640 gene fabD 33777 32845 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951418.1 protein_id gnl|my_center|LOCUS_04640 34829 33870 gene locus_tag LOCUS_04650 34829 33870 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524613.1 protein_id gnl|my_center|LOCUS_04650 35875 34829 gene locus_tag LOCUS_04660 gene plsX 35875 34829 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_04660 36207 36028 gene locus_tag LOCUS_04670 gene rpmF 36207 36028 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 protein_id gnl|my_center|LOCUS_04670 36748 36233 gene locus_tag LOCUS_04680 gene yceD 36748 36233 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072716.1 protein_id gnl|my_center|LOCUS_04680 36923 37507 gene locus_tag LOCUS_04690 36923 37507 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 protein_id gnl|my_center|LOCUS_04690 37521 38243 gene locus_tag LOCUS_04700 37521 38243 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_04700 38330 38752 gene locus_tag LOCUS_04710 gene dksA 38330 38752 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095632.1 protein_id gnl|my_center|LOCUS_04710 39589 39047 gene locus_tag LOCUS_04720 gene mog 39589 39047 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707146.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence010 3033 1072 gene locus_tag LOCUS_04730 gene parE 3033 1072 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185934.1 protein_id gnl|my_center|LOCUS_04730 3353 4294 gene locus_tag LOCUS_04740 3353 4294 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815989.1 protein_id gnl|my_center|LOCUS_04740 5104 4298 gene locus_tag LOCUS_04750 5104 4298 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191514.1 protein_id gnl|my_center|LOCUS_04750 7095 5101 gene locus_tag LOCUS_04760 7095 5101 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 protein_id gnl|my_center|LOCUS_04760 8929 7307 gene locus_tag LOCUS_04770 8929 7307 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198600.1 protein_id gnl|my_center|LOCUS_04770 10105 9029 gene locus_tag LOCUS_04780 10105 9029 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731531.1 protein_id gnl|my_center|LOCUS_04780 11335 10232 gene locus_tag LOCUS_04790 11335 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 12268 11525 gene locus_tag LOCUS_04800 gene rlmB 12268 11525 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812973.1 protein_id gnl|my_center|LOCUS_04800 14492 12261 gene locus_tag LOCUS_04810 gene rnr 14492 12261 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931522.1 protein_id gnl|my_center|LOCUS_04810 14547 14631 gene locus_tag LOCUS_t00050 14547 14631 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15477 15184 gene locus_tag LOCUS_04820 15477 15184 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_04820 16587 15493 gene locus_tag LOCUS_04830 gene apbC 16587 15493 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_04830 17185 16748 gene locus_tag LOCUS_04840 17185 16748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 17454 17197 gene locus_tag LOCUS_04850 17454 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 18040 17462 gene locus_tag LOCUS_04860 18040 17462 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056672.1 protein_id gnl|my_center|LOCUS_04860 18860 18216 gene locus_tag LOCUS_04870 18860 18216 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388115.1 protein_id gnl|my_center|LOCUS_04870 20104 18863 gene locus_tag LOCUS_04880 20104 18863 CDS product cytochrome b/b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388116.1 protein_id gnl|my_center|LOCUS_04880 20626 20114 gene locus_tag LOCUS_04890 gene petA 20626 20114 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388117.1 protein_id gnl|my_center|LOCUS_04890 22303 20825 gene locus_tag LOCUS_04900 22303 20825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 23229 22333 gene locus_tag LOCUS_04910 23229 22333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 24657 23278 gene locus_tag LOCUS_04920 gene cysG 24657 23278 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005618952.1 protein_id gnl|my_center|LOCUS_04920 25256 24657 gene locus_tag LOCUS_04930 25256 24657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 26601 25270 gene locus_tag LOCUS_04940 gene cobB 26601 25270 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_04940 27932 26751 gene locus_tag LOCUS_04950 gene hmeB 27932 26751 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_04950 28650 27934 gene locus_tag LOCUS_04960 gene hmeA 28650 27934 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_04960 29015 28647 gene locus_tag LOCUS_04970 gene dsrJ 29015 28647 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810493.1 protein_id gnl|my_center|LOCUS_04970 30772 29024 gene locus_tag LOCUS_04980 30772 29024 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_04980 32545 31016 gene locus_tag LOCUS_04990 32545 31016 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_04990 33272 32547 gene locus_tag LOCUS_05000 gene dsrM 33272 32547 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878008.1 protein_id gnl|my_center|LOCUS_05000 33629 33294 gene locus_tag LOCUS_05010 33629 33294 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_05010 33952 33656 gene locus_tag LOCUS_05020 gene tusB 33952 33656 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_05020 34334 33963 gene locus_tag LOCUS_05030 gene tusC 34334 33963 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_05030 34703 34344 gene locus_tag LOCUS_05040 gene tusD 34703 34344 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_05040 35807 34719 gene locus_tag LOCUS_05050 gene dsrB 35807 34719 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_05050 37114 35819 gene locus_tag LOCUS_05060 gene dsrA 37114 35819 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_05060 37436 37651 gene locus_tag LOCUS_05070 37436 37651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 37648 38250 gene locus_tag LOCUS_05080 37648 38250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 38290 38619 gene locus_tag LOCUS_05090 gene tusE 38290 38619 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097245.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence011 341 123 gene locus_tag LOCUS_05100 341 123 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_05100 2391 565 gene locus_tag LOCUS_05110 gene dnaK 2391 565 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_05110 3497 2394 gene locus_tag LOCUS_05120 3497 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3908 3516 gene locus_tag LOCUS_05130 3908 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 5338 3920 gene locus_tag LOCUS_05140 5338 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05140 6261 5431 gene locus_tag LOCUS_05150 6261 5431 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027276.1 protein_id gnl|my_center|LOCUS_05150 8422 6254 gene locus_tag LOCUS_05160 8422 6254 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_05160 9009 8425 gene locus_tag LOCUS_05170 9009 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 10615 9002 gene locus_tag LOCUS_05180 10615 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 11202 10603 gene locus_tag LOCUS_05190 11202 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 11593 11402 gene locus_tag LOCUS_05200 11593 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 12183 18665 gene locus_tag LOCUS_05210 12183 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 21320 18723 gene locus_tag LOCUS_05220 21320 18723 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544413.1 protein_id gnl|my_center|LOCUS_05220 22085 21330 gene locus_tag LOCUS_05230 gene map 22085 21330 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_05230 22623 22396 gene locus_tag LOCUS_05240 22623 22396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 22529 22762 gene locus_tag LOCUS_05250 22529 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 22904 23116 gene locus_tag LOCUS_05260 22904 23116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 24491 23202 gene locus_tag LOCUS_05270 24491 23202 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338587.1 protein_id gnl|my_center|LOCUS_05270 25006 24488 gene locus_tag LOCUS_05280 25006 24488 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391424.1 protein_id gnl|my_center|LOCUS_05280 26156 25083 gene locus_tag LOCUS_05290 26156 25083 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_05290 26500 26865 gene locus_tag LOCUS_05300 26500 26865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 26917 28068 gene locus_tag LOCUS_05310 26917 28068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 28068 28865 gene locus_tag LOCUS_05320 28068 28865 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266520.1 protein_id gnl|my_center|LOCUS_05320 28799 30034 gene locus_tag LOCUS_05330 28799 30034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 30047 30622 gene locus_tag LOCUS_05340 30047 30622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 30682 32262 gene locus_tag LOCUS_05350 30682 32262 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388628.1 protein_id gnl|my_center|LOCUS_05350 32432 32923 gene locus_tag LOCUS_05360 32432 32923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 32914 33192 gene locus_tag LOCUS_05370 32914 33192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 33189 33665 gene locus_tag LOCUS_05380 33189 33665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 33678 34553 gene locus_tag LOCUS_05390 33678 34553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 34564 34869 gene locus_tag LOCUS_05400 34564 34869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 34838 35161 gene locus_tag LOCUS_05410 34838 35161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 35152 35730 gene locus_tag LOCUS_05420 35152 35730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 35764 36078 gene locus_tag LOCUS_05430 35764 36078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 36094 36435 gene locus_tag LOCUS_05440 36094 36435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence012 2 394 gene locus_tag LOCUS_05450 2 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1042 833 gene locus_tag LOCUS_05460 1042 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2171 1089 gene locus_tag LOCUS_05470 2171 1089 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103575.1 protein_id gnl|my_center|LOCUS_05470 2370 2294 gene locus_tag LOCUS_t00060 2370 2294 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2498 2423 gene locus_tag LOCUS_t00070 2498 2423 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4358 2505 gene locus_tag LOCUS_05480 4358 2505 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191640.1 protein_id gnl|my_center|LOCUS_05480 4535 4459 gene locus_tag LOCUS_t00080 4535 4459 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4695 4620 gene locus_tag LOCUS_t00090 4695 4620 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4980 4708 gene locus_tag LOCUS_05490 4980 4708 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261491.1 protein_id gnl|my_center|LOCUS_05490 7529 5115 gene locus_tag LOCUS_05500 gene lon 7529 5115 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_05500 8928 7675 gene locus_tag LOCUS_05510 gene clpX 8928 7675 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_05510 9563 8955 gene locus_tag LOCUS_05520 gene clpP 9563 8955 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071916.1 protein_id gnl|my_center|LOCUS_05520 10863 9565 gene locus_tag LOCUS_05530 gene tig 10863 9565 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 protein_id gnl|my_center|LOCUS_05530 11540 11456 gene locus_tag LOCUS_t00100 11540 11456 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12596 11598 gene locus_tag LOCUS_05540 12596 11598 CDS product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989567.1 protein_id gnl|my_center|LOCUS_05540 13787 12597 gene locus_tag LOCUS_05550 gene odhB 13787 12597 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192735.1 protein_id gnl|my_center|LOCUS_05550 16626 13774 gene locus_tag LOCUS_05560 16626 13774 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065166.1 protein_id gnl|my_center|LOCUS_05560 17935 16634 gene locus_tag LOCUS_05570 gene gltA 17935 16634 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213761.1 protein_id gnl|my_center|LOCUS_05570 18310 17978 gene locus_tag LOCUS_05580 18310 17978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 19002 18307 gene locus_tag LOCUS_05590 19002 18307 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_05590 20785 19022 gene locus_tag LOCUS_05600 gene sdhA 20785 19022 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980875.1 protein_id gnl|my_center|LOCUS_05600 21136 20789 gene locus_tag LOCUS_05610 gene sdhD 21136 20789 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_05610 21504 21130 gene locus_tag LOCUS_05620 gene sdhC 21504 21130 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813654.1 protein_id gnl|my_center|LOCUS_05620 21615 22598 gene locus_tag LOCUS_05630 21615 22598 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036142.1 protein_id gnl|my_center|LOCUS_05630 22713 23531 gene locus_tag LOCUS_05640 gene amrB 22713 23531 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_05640 23518 24072 gene locus_tag LOCUS_05650 23518 24072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 24074 25162 gene locus_tag LOCUS_05660 gene amrS 24074 25162 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_05660 25335 26675 gene locus_tag LOCUS_05670 25335 26675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 27598 26693 gene locus_tag LOCUS_05680 27598 26693 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040596.1 protein_id gnl|my_center|LOCUS_05680 27690 28532 gene locus_tag LOCUS_05690 27690 28532 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_05690 28532 29053 gene locus_tag LOCUS_05700 28532 29053 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_05700 29050 29616 gene locus_tag LOCUS_05710 29050 29616 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202184.1 protein_id gnl|my_center|LOCUS_05710 29645 30211 gene locus_tag LOCUS_05720 29645 30211 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_05720 30254 31321 gene locus_tag LOCUS_05730 30254 31321 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_05730 31802 32953 gene locus_tag LOCUS_05740 31802 32953 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_05740 32960 33847 gene locus_tag LOCUS_05750 32960 33847 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_05750 33844 34131 gene locus_tag LOCUS_05760 33844 34131 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_05760 34142 34879 gene locus_tag LOCUS_05770 gene lipB 34142 34879 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313884.1 protein_id gnl|my_center|LOCUS_05770 34866 35396 gene locus_tag LOCUS_05780 34866 35396 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_05780 35393 35578 gene locus_tag LOCUS_05790 35393 35578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence013 754 392 gene locus_tag LOCUS_05800 754 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3600 856 gene locus_tag LOCUS_05810 3600 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4444 3611 gene locus_tag LOCUS_05820 4444 3611 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_05820 4857 5336 gene locus_tag LOCUS_05830 4857 5336 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267699.1 protein_id gnl|my_center|LOCUS_05830 5855 5460 gene locus_tag LOCUS_05840 5855 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 6306 5920 gene locus_tag LOCUS_05850 6306 5920 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196360.1 protein_id gnl|my_center|LOCUS_05850 7311 6412 gene locus_tag LOCUS_05860 7311 6412 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_05860 7961 7335 gene locus_tag LOCUS_05870 7961 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 10337 8091 gene locus_tag LOCUS_05880 10337 8091 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545086.1 protein_id gnl|my_center|LOCUS_05880 11621 10341 gene locus_tag LOCUS_05890 11621 10341 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_05890 12188 11661 gene locus_tag LOCUS_05900 12188 11661 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111658546.1 protein_id gnl|my_center|LOCUS_05900 12466 13662 gene locus_tag LOCUS_05910 12466 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 13655 14329 gene locus_tag LOCUS_05920 gene narL 13655 14329 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_05920 14412 15683 gene locus_tag LOCUS_05930 14412 15683 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_05930 15855 17402 gene locus_tag LOCUS_05940 15855 17402 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275161.1 protein_id gnl|my_center|LOCUS_05940 18919 17471 gene locus_tag LOCUS_05950 18919 17471 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_05950 20001 19135 gene locus_tag LOCUS_05960 20001 19135 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 protein_id gnl|my_center|LOCUS_05960 21137 20082 gene locus_tag LOCUS_05970 gene miaA 21137 20082 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266496.1 protein_id gnl|my_center|LOCUS_05970 22408 21134 gene locus_tag LOCUS_05980 22408 21134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113829.1 protein_id gnl|my_center|LOCUS_05980 22995 23765 gene locus_tag LOCUS_05990 22995 23765 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_05990 23762 24646 gene locus_tag LOCUS_06000 23762 24646 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706486.1 protein_id gnl|my_center|LOCUS_06000 24661 25323 gene locus_tag LOCUS_06010 24661 25323 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 protein_id gnl|my_center|LOCUS_06010 25299 26618 gene locus_tag LOCUS_06020 25299 26618 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931889.1 protein_id gnl|my_center|LOCUS_06020 28206 26641 gene locus_tag LOCUS_06030 28206 26641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 28757 28461 gene locus_tag LOCUS_06040 28757 28461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546304.1 protein_id gnl|my_center|LOCUS_06040 30966 29041 gene locus_tag LOCUS_06050 gene mutL 30966 29041 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194266.1 protein_id gnl|my_center|LOCUS_06050 31111 32682 gene locus_tag LOCUS_06060 gene pntA 31111 32682 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705256.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence014 1239 748 gene locus_tag LOCUS_06070 gene ilvN 1239 748 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_06070 2948 1239 gene locus_tag LOCUS_06080 2948 1239 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_06080 3262 3855 gene locus_tag LOCUS_06090 3262 3855 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_06090 3852 4196 gene locus_tag LOCUS_06100 3852 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4201 4635 gene locus_tag LOCUS_06110 4201 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4880 7396 gene locus_tag LOCUS_06120 gene mutS 4880 7396 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_06120 7403 8479 gene locus_tag LOCUS_06130 7403 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_06130 8533 8943 gene locus_tag LOCUS_06140 8533 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 9608 9123 gene locus_tag LOCUS_06150 9608 9123 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_06150 9792 10916 gene locus_tag LOCUS_06160 9792 10916 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 protein_id gnl|my_center|LOCUS_06160 10932 11411 gene locus_tag LOCUS_06170 10932 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 11589 11759 gene locus_tag LOCUS_06180 11589 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 12687 11920 gene locus_tag LOCUS_06190 12687 11920 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_06190 13865 12762 gene locus_tag LOCUS_06200 gene bamC 13865 12762 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_06200 14761 13880 gene locus_tag LOCUS_06210 gene dapA 14761 13880 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_06210 14925 15158 gene locus_tag LOCUS_06220 14925 15158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 15146 16942 gene locus_tag LOCUS_06230 gene feoB 15146 16942 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057288.1 protein_id gnl|my_center|LOCUS_06230 17499 16939 gene locus_tag LOCUS_06240 17499 16939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 18244 17792 gene locus_tag LOCUS_06250 18244 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 20508 18241 gene locus_tag LOCUS_06260 20508 18241 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543968.1 protein_id gnl|my_center|LOCUS_06260 21290 20724 gene locus_tag LOCUS_06270 21290 20724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 22052 21501 gene locus_tag LOCUS_06280 22052 21501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 22846 22622 gene locus_tag LOCUS_06290 22846 22622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 22882 23517 gene locus_tag LOCUS_06300 22882 23517 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_06300 26203 23615 gene locus_tag LOCUS_06310 gene clpB 26203 23615 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_06310 26446 27279 gene locus_tag LOCUS_06320 gene nadC 26446 27279 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_06320 27366 27800 gene locus_tag LOCUS_06330 gene trxC 27366 27800 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_06330 28598 27819 gene locus_tag LOCUS_06340 28598 27819 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173829.1 protein_id gnl|my_center|LOCUS_06340 29354 28752 gene locus_tag LOCUS_06350 29354 28752 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_06350 30169 29351 gene locus_tag LOCUS_06360 gene asd 30169 29351 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357921.1 protein_id gnl|my_center|LOCUS_06360 31105 30245 gene locus_tag LOCUS_06370 31105 30245 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence015 1334 270 gene locus_tag LOCUS_06380 gene hemE 1334 270 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222724.1 protein_id gnl|my_center|LOCUS_06380 2838 1384 gene locus_tag LOCUS_06390 2838 1384 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448901.1 protein_id gnl|my_center|LOCUS_06390 7466 2838 gene locus_tag LOCUS_06400 7466 2838 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_06400 7763 8389 gene locus_tag LOCUS_06410 7763 8389 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405053.1 protein_id gnl|my_center|LOCUS_06410 9033 8413 gene locus_tag LOCUS_06420 9033 8413 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_06420 9990 9070 gene locus_tag LOCUS_06430 gene hemF 9990 9070 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703138.1 protein_id gnl|my_center|LOCUS_06430 10624 10079 gene locus_tag LOCUS_06440 gene tsaC 10624 10079 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174593.1 protein_id gnl|my_center|LOCUS_06440 11908 10628 gene locus_tag LOCUS_06450 gene purD 11908 10628 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_06450 13554 11989 gene locus_tag LOCUS_06460 gene purH 13554 11989 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980881.1 protein_id gnl|my_center|LOCUS_06460 13853 13602 gene locus_tag LOCUS_06470 13853 13602 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_06470 14857 13850 gene locus_tag LOCUS_06480 gene dusB 14857 13850 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_06480 14933 16117 gene locus_tag LOCUS_06490 14933 16117 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_06490 16350 17108 gene locus_tag LOCUS_06500 gene dsbC 16350 17108 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931379.1 protein_id gnl|my_center|LOCUS_06500 18419 17151 gene locus_tag LOCUS_06510 18419 17151 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_06510 18825 18448 gene locus_tag LOCUS_06520 gene apaG 18825 18448 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_06520 19165 20673 gene locus_tag LOCUS_06530 gene ilvA 19165 20673 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815155.1 protein_id gnl|my_center|LOCUS_06530 20691 21314 gene locus_tag LOCUS_06540 20691 21314 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_06540 21391 24045 gene locus_tag LOCUS_06550 gene aceE 21391 24045 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_06550 24085 25350 gene locus_tag LOCUS_06560 gene aceF 24085 25350 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_06560 25353 26006 gene locus_tag LOCUS_06570 gene nadD 25353 26006 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_06570 26000 26362 gene locus_tag LOCUS_06580 26000 26362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 26393 26863 gene locus_tag LOCUS_06590 gene rlmH 26393 26863 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_06590 26872 27492 gene locus_tag LOCUS_06600 26872 27492 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_06600 27561 29015 gene locus_tag LOCUS_06610 gene rng 27561 29015 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence016 805 1080 gene locus_tag LOCUS_06620 805 1080 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142529.1 protein_id gnl|my_center|LOCUS_06620 1080 1376 gene locus_tag LOCUS_06630 1080 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 1662 1922 gene locus_tag LOCUS_06640 1662 1922 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180943360.1 protein_id gnl|my_center|LOCUS_06640 1922 2197 gene locus_tag LOCUS_06650 1922 2197 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 protein_id gnl|my_center|LOCUS_06650 2359 2493 gene locus_tag LOCUS_06660 2359 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2622 3032 gene locus_tag LOCUS_06670 2622 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3029 3253 gene locus_tag LOCUS_06680 3029 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4044 5246 gene locus_tag LOCUS_06690 4044 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5383 5577 gene locus_tag LOCUS_06700 5383 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 5675 5845 gene locus_tag LOCUS_06710 5675 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 6045 7943 gene locus_tag LOCUS_06720 6045 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 8081 8320 gene locus_tag LOCUS_06730 8081 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 8465 8593 gene locus_tag LOCUS_06740 8465 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 9116 9454 gene locus_tag LOCUS_06750 9116 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 12230 9831 gene locus_tag LOCUS_06760 12230 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 13065 13721 gene locus_tag LOCUS_06770 13065 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 15347 15691 gene locus_tag LOCUS_06780 15347 15691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 16201 15956 gene locus_tag LOCUS_06790 16201 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 16816 16262 gene locus_tag LOCUS_06800 16816 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 17370 16792 gene locus_tag LOCUS_06810 17370 16792 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815273.1 protein_id gnl|my_center|LOCUS_06810 17919 17389 gene locus_tag LOCUS_06820 17919 17389 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082631.1 protein_id gnl|my_center|LOCUS_06820 18202 19095 gene locus_tag LOCUS_06830 gene carH 18202 19095 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_06830 20291 19122 gene locus_tag LOCUS_06840 20291 19122 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_06840 22399 20288 gene locus_tag LOCUS_06850 gene ovoA 22399 20288 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_06850 22905 23876 gene locus_tag LOCUS_06860 22905 23876 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_06860 24499 25659 gene locus_tag LOCUS_06870 24499 25659 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807138.1 protein_id gnl|my_center|LOCUS_06870 25698 26354 gene locus_tag LOCUS_06880 25698 26354 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_06880 26520 27344 gene locus_tag LOCUS_06890 gene tehA 26520 27344 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966370.1 protein_id gnl|my_center|LOCUS_06890 27583 28329 gene locus_tag LOCUS_06900 27583 28329 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114755.1 protein_id gnl|my_center|LOCUS_06900 28557 28835 gene locus_tag LOCUS_06910 28557 28835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence017 1155 397 gene locus_tag LOCUS_06920 gene pgeF 1155 397 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_06920 2131 1136 gene locus_tag LOCUS_06930 gene rluD 2131 1136 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079097.1 protein_id gnl|my_center|LOCUS_06930 2130 2930 gene locus_tag LOCUS_06940 2130 2930 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813594.1 protein_id gnl|my_center|LOCUS_06940 2909 3472 gene locus_tag LOCUS_06950 2909 3472 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_06950 3555 4424 gene locus_tag LOCUS_06960 3555 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 5854 4490 gene locus_tag LOCUS_06970 gene pmbA 5854 4490 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 protein_id gnl|my_center|LOCUS_06970 5959 6711 gene locus_tag LOCUS_06980 5959 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 7370 6801 gene locus_tag LOCUS_06990 7370 6801 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390063.1 protein_id gnl|my_center|LOCUS_06990 7796 8179 gene locus_tag LOCUS_07000 7796 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 8229 9686 gene locus_tag LOCUS_07010 8229 9686 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_07010 10385 9969 gene locus_tag LOCUS_07020 10385 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 10498 11163 gene locus_tag LOCUS_07030 10498 11163 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_07030 11610 11272 gene locus_tag LOCUS_07040 11610 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 11744 11577 gene locus_tag LOCUS_07050 11744 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 12023 11799 gene locus_tag LOCUS_07060 12023 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 12867 12130 gene locus_tag LOCUS_07070 12867 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 13387 13070 gene locus_tag LOCUS_07080 13387 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 13490 13912 gene locus_tag LOCUS_07090 gene fur 13490 13912 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_07090 15432 13930 gene locus_tag LOCUS_07100 15432 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 15523 16290 gene locus_tag LOCUS_07110 gene aat 15523 16290 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_07110 16287 17018 gene locus_tag LOCUS_07120 16287 17018 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521637.1 protein_id gnl|my_center|LOCUS_07120 17026 17919 gene locus_tag LOCUS_07130 17026 17919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 17922 18941 gene locus_tag LOCUS_07140 17922 18941 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193208.1 protein_id gnl|my_center|LOCUS_07140 18955 19335 gene locus_tag LOCUS_07150 18955 19335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 19562 20137 gene locus_tag LOCUS_07160 gene rsxA 19562 20137 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_07160 20137 20703 gene locus_tag LOCUS_07170 gene rsxB 20137 20703 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072472.1 protein_id gnl|my_center|LOCUS_07170 20700 22376 gene locus_tag LOCUS_07180 20700 22376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 22554 23585 gene locus_tag LOCUS_07190 gene rsxD 22554 23585 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231916.1 protein_id gnl|my_center|LOCUS_07190 23582 24238 gene locus_tag LOCUS_07200 gene rsxG 23582 24238 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072475.1 protein_id gnl|my_center|LOCUS_07200 24235 24942 gene locus_tag LOCUS_07210 24235 24942 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944880.1 protein_id gnl|my_center|LOCUS_07210 25097 26128 gene locus_tag LOCUS_07220 25097 26128 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195580.1 protein_id gnl|my_center|LOCUS_07220 26475 26191 gene locus_tag LOCUS_07230 26475 26191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 27534 27776 gene locus_tag LOCUS_07240 27534 27776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence018 <1 2250 gene locus_tag LOCUS_07250 <1 2250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813877.1:chromosome segregation protein SMC 2366 3034 gene locus_tag LOCUS_07260 2366 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3536 3024 gene locus_tag LOCUS_07270 3536 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4518 3556 gene locus_tag LOCUS_07280 gene trxB 4518 3556 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186294.1 protein_id gnl|my_center|LOCUS_07280 4658 5650 gene locus_tag LOCUS_07290 gene mltB 4658 5650 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_07290 6436 5699 gene locus_tag LOCUS_07300 6436 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 8429 6780 gene locus_tag LOCUS_07310 8429 6780 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269292.1 protein_id gnl|my_center|LOCUS_07310 8750 8517 gene locus_tag LOCUS_07320 8750 8517 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190152.1 protein_id gnl|my_center|LOCUS_07320 9583 8741 gene locus_tag LOCUS_07330 gene fdhD 9583 8741 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 protein_id gnl|my_center|LOCUS_07330 12428 9588 gene locus_tag LOCUS_07340 gene fdhF 12428 9588 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 protein_id gnl|my_center|LOCUS_07340 13971 12421 gene locus_tag LOCUS_07350 13971 12421 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 protein_id gnl|my_center|LOCUS_07350 14408 13968 gene locus_tag LOCUS_07360 14408 13968 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064347.1 protein_id gnl|my_center|LOCUS_07360 14532 15593 gene locus_tag LOCUS_07370 14532 15593 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151633682.1 protein_id gnl|my_center|LOCUS_07370 18658 15827 gene locus_tag LOCUS_07380 18658 15827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 18943 19323 gene locus_tag LOCUS_07390 gene rpsF 18943 19323 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980921.1 protein_id gnl|my_center|LOCUS_07390 19392 19667 gene locus_tag LOCUS_07400 gene rpsR 19392 19667 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193360.1 protein_id gnl|my_center|LOCUS_07400 19679 20122 gene locus_tag LOCUS_07410 gene rplI 19679 20122 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 protein_id gnl|my_center|LOCUS_07410 20433 21782 gene locus_tag LOCUS_07420 20433 21782 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 protein_id gnl|my_center|LOCUS_07420 21858 22856 gene locus_tag LOCUS_07430 21858 22856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193226.1 protein_id gnl|my_center|LOCUS_07430 22867 24396 gene locus_tag LOCUS_07440 22867 24396 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_07440 24521 25489 gene locus_tag LOCUS_07450 24521 25489 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980898.1 protein_id gnl|my_center|LOCUS_07450 25476 26828 gene locus_tag LOCUS_07460 gene tilS 25476 26828 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence019 5351 3198 gene locus_tag LOCUS_07470 5351 3198 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_07470 8339 5493 gene locus_tag LOCUS_07480 8339 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 9560 8352 gene locus_tag LOCUS_07490 9560 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_07490 9876 9529 gene locus_tag LOCUS_07500 9876 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 10465 12129 gene locus_tag LOCUS_07510 10465 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 13325 12684 gene locus_tag LOCUS_07520 13325 12684 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_07520 14446 13328 gene locus_tag LOCUS_07530 gene mtnA 14446 13328 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_07530 14903 14481 gene locus_tag LOCUS_07540 14903 14481 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205242.1 protein_id gnl|my_center|LOCUS_07540 15630 14950 gene locus_tag LOCUS_07550 15630 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 16267 15632 gene locus_tag LOCUS_07560 16267 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 16736 18136 gene locus_tag LOCUS_07570 16736 18136 CDS product TolC family type I secretion outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938786.1 protein_id gnl|my_center|LOCUS_07570 18145 19341 gene locus_tag LOCUS_07580 18145 19341 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_07580 19341 20045 gene locus_tag LOCUS_07590 19341 20045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_07590 20042 21262 gene locus_tag LOCUS_07600 20042 21262 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_07600 22091 21264 gene locus_tag LOCUS_07610 22091 21264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 22938 22114 gene locus_tag LOCUS_07620 22938 22114 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537097.1 protein_id gnl|my_center|LOCUS_07620 23075 24874 gene locus_tag LOCUS_07630 23075 24874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 24971 25201 gene locus_tag LOCUS_07640 24971 25201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 25468 25752 gene locus_tag LOCUS_07650 25468 25752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 25870 26556 gene locus_tag LOCUS_07660 25870 26556 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521332.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence020 <1 1242 gene locus_tag LOCUS_07670 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037428.1:YdiU family protein 1913 2173 gene locus_tag LOCUS_07680 1913 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2185 2439 gene locus_tag LOCUS_07690 2185 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4157 2745 gene locus_tag LOCUS_07700 gene der 4157 2745 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_07700 5392 4241 gene locus_tag LOCUS_07710 gene bamB 5392 4241 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_07710 6027 5389 gene locus_tag LOCUS_07720 6027 5389 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_07720 7307 6033 gene locus_tag LOCUS_07730 gene hisS 7307 6033 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_07730 8600 7362 gene locus_tag LOCUS_07740 gene ispG 8600 7362 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_07740 9484 8603 gene locus_tag LOCUS_07750 9484 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 10227 9484 gene locus_tag LOCUS_07760 gene pilW 10227 9484 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227268.1 protein_id gnl|my_center|LOCUS_07760 11321 10224 gene locus_tag LOCUS_07770 gene rlmN 11321 10224 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688948.1 protein_id gnl|my_center|LOCUS_07770 11759 11334 gene locus_tag LOCUS_07780 gene ndk 11759 11334 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_07780 12198 12123 gene locus_tag LOCUS_t00110 12198 12123 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12302 12227 gene locus_tag LOCUS_t00120 12302 12227 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12397 12322 gene locus_tag LOCUS_t00130 12397 12322 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13850 12459 gene locus_tag LOCUS_07790 gene gltX 13850 12459 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197094.1 protein_id gnl|my_center|LOCUS_07790 14582 14028 gene locus_tag LOCUS_07800 gene efp 14582 14028 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_07800 15742 14588 gene locus_tag LOCUS_07810 gene earP 15742 14588 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 protein_id gnl|my_center|LOCUS_07810 16155 15880 gene locus_tag LOCUS_07820 16155 15880 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303876.1 protein_id gnl|my_center|LOCUS_07820 16333 16130 gene locus_tag LOCUS_07830 16333 16130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556012.1 protein_id gnl|my_center|LOCUS_07830 17549 16371 gene locus_tag LOCUS_07840 17549 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 17799 17593 gene locus_tag LOCUS_07850 17799 17593 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488188.1 protein_id gnl|my_center|LOCUS_07850 18358 17909 gene locus_tag LOCUS_07860 18358 17909 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_07860 18940 18617 gene locus_tag LOCUS_07870 18940 18617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 19854 19225 gene locus_tag LOCUS_07880 19854 19225 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085103.1 protein_id gnl|my_center|LOCUS_07880 22225 19841 gene locus_tag LOCUS_07890 22225 19841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 23495 22338 gene locus_tag LOCUS_07900 23495 22338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 26377 23492 gene locus_tag LOCUS_07910 26377 23492 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143551.1 protein_id gnl|my_center|LOCUS_07910 26663 26529 gene locus_tag LOCUS_07920 26663 26529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence021 873 64 gene locus_tag LOCUS_07930 gene pabC 873 64 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_07930 2178 889 gene locus_tag LOCUS_07940 gene fabF 2178 889 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065093.1 protein_id gnl|my_center|LOCUS_07940 2517 2284 gene locus_tag LOCUS_07950 gene acpP 2517 2284 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_07950 5156 2631 gene locus_tag LOCUS_07960 5156 2631 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_07960 5886 5158 gene locus_tag LOCUS_07970 5886 5158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_07970 5930 6457 gene locus_tag LOCUS_07980 5930 6457 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534522.1 protein_id gnl|my_center|LOCUS_07980 7474 6533 gene locus_tag LOCUS_07990 7474 6533 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_07990 8161 7505 gene locus_tag LOCUS_08000 8161 7505 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929830.1 protein_id gnl|my_center|LOCUS_08000 8572 8327 gene locus_tag LOCUS_08010 8572 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 8698 9801 gene locus_tag LOCUS_08020 gene rlmM 8698 9801 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155650284.1 protein_id gnl|my_center|LOCUS_08020 10845 9868 gene locus_tag LOCUS_08030 10845 9868 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_08030 11535 14105 gene locus_tag LOCUS_08040 11535 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 14654 14172 gene locus_tag LOCUS_08050 14654 14172 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_08050 15920 14727 gene locus_tag LOCUS_08060 15920 14727 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_08060 16037 16579 gene locus_tag LOCUS_08070 gene ppa 16037 16579 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 protein_id gnl|my_center|LOCUS_08070 16579 17433 gene locus_tag LOCUS_08080 gene folD 16579 17433 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192825.1 protein_id gnl|my_center|LOCUS_08080 17828 17502 gene locus_tag LOCUS_08090 17828 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 18498 17992 gene locus_tag LOCUS_08100 18498 17992 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_08100 18694 18500 gene locus_tag LOCUS_08110 gene iscX 18694 18500 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192531.1 protein_id gnl|my_center|LOCUS_08110 19031 18696 gene locus_tag LOCUS_08120 gene fdx 19031 18696 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193872.1 protein_id gnl|my_center|LOCUS_08120 20906 19044 gene locus_tag LOCUS_08130 gene hscA 20906 19044 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951132.1 protein_id gnl|my_center|LOCUS_08130 21539 21003 gene locus_tag LOCUS_08140 gene hscB 21539 21003 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_08140 22088 21720 gene locus_tag LOCUS_08150 gene iscA 22088 21720 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191333.1 protein_id gnl|my_center|LOCUS_08150 22470 22054 gene locus_tag LOCUS_08160 gene iscU 22470 22054 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192918.1 protein_id gnl|my_center|LOCUS_08160 23769 22561 gene locus_tag LOCUS_08170 23769 22561 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_08170 24254 23799 gene locus_tag LOCUS_08180 gene iscR 24254 23799 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_08180 25073 24339 gene locus_tag LOCUS_08190 gene cysE 25073 24339 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266905.1 protein_id gnl|my_center|LOCUS_08190 25837 25073 gene locus_tag LOCUS_08200 gene trmJ 25837 25073 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence022 2351 1206 gene locus_tag LOCUS_08210 gene bcsZ 2351 1206 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817393.1 protein_id gnl|my_center|LOCUS_08210 4683 2359 gene locus_tag LOCUS_08220 gene bcsB 4683 2359 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205645.1 protein_id gnl|my_center|LOCUS_08220 7232 4803 gene locus_tag LOCUS_08230 gene bcsA 7232 4803 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025858.1 protein_id gnl|my_center|LOCUS_08230 7999 7229 gene locus_tag LOCUS_08240 7999 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 8523 7999 gene locus_tag LOCUS_08250 8523 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 9028 8552 gene locus_tag LOCUS_08260 9028 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 9270 9794 gene locus_tag LOCUS_08270 gene grpE 9270 9794 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_08270 9905 11827 gene locus_tag LOCUS_08280 gene dnaK 9905 11827 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_08280 12040 13179 gene locus_tag LOCUS_08290 gene dnaJ 12040 13179 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395180.1 protein_id gnl|my_center|LOCUS_08290 13820 13257 gene locus_tag LOCUS_08300 13820 13257 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_08300 14631 13843 gene locus_tag LOCUS_08310 14631 13843 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_08310 14965 14660 gene locus_tag LOCUS_08320 14965 14660 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554203.1 protein_id gnl|my_center|LOCUS_08320 15466 15083 gene locus_tag LOCUS_08330 gene crcB 15466 15083 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_08330 16735 15476 gene locus_tag LOCUS_08340 16735 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 17309 16725 gene locus_tag LOCUS_08350 17309 16725 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_08350 17769 17374 gene locus_tag LOCUS_08360 17769 17374 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_08360 19559 17766 gene locus_tag LOCUS_08370 19559 17766 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_08370 21978 19678 gene locus_tag LOCUS_08380 21978 19678 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039380.1 protein_id gnl|my_center|LOCUS_08380 23477 22119 gene locus_tag LOCUS_08390 gene radA 23477 22119 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_08390 23621 25765 gene locus_tag LOCUS_08400 23621 25765 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence023 246 1319 gene locus_tag LOCUS_08410 246 1319 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998604.1 protein_id gnl|my_center|LOCUS_08410 2401 1400 gene locus_tag LOCUS_08420 2401 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 3039 2440 gene locus_tag LOCUS_08430 3039 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3591 3064 gene locus_tag LOCUS_08440 3591 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3788 5503 gene locus_tag LOCUS_08450 3788 5503 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_08450 5603 6205 gene locus_tag LOCUS_08460 5603 6205 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_08460 6732 6232 gene locus_tag LOCUS_08470 6732 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 7294 6695 gene locus_tag LOCUS_08480 7294 6695 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 protein_id gnl|my_center|LOCUS_08480 7510 8400 gene locus_tag LOCUS_08490 gene mshM 7510 8400 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_08490 8626 10464 gene locus_tag LOCUS_08500 8626 10464 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_08500 10461 11471 gene locus_tag LOCUS_08510 10461 11471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 11562 13298 gene locus_tag LOCUS_08520 11562 13298 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_08520 13295 14500 gene locus_tag LOCUS_08530 13295 14500 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_08530 14497 15987 gene locus_tag LOCUS_08540 14497 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 15984 16574 gene locus_tag LOCUS_08550 15984 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 16837 17172 gene locus_tag LOCUS_08560 16837 17172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 17169 18632 gene locus_tag LOCUS_08570 17169 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 18648 19400 gene locus_tag LOCUS_08580 18648 19400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 19397 20035 gene locus_tag LOCUS_08590 19397 20035 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 protein_id gnl|my_center|LOCUS_08590 20044 21141 gene locus_tag LOCUS_08600 20044 21141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 21257 21955 gene locus_tag LOCUS_08610 21257 21955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 22033 22707 gene locus_tag LOCUS_08620 22033 22707 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_08620 23027 23314 gene locus_tag LOCUS_08630 23027 23314 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_08630 24757 23318 gene locus_tag LOCUS_08640 gene cysS 24757 23318 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225718.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence024 163 504 gene locus_tag LOCUS_08650 gene hypA 163 504 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_08650 598 1134 gene locus_tag LOCUS_08660 598 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1887 1237 gene locus_tag LOCUS_08670 gene lolD 1887 1237 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481886.1 protein_id gnl|my_center|LOCUS_08670 3235 1949 gene locus_tag LOCUS_08680 3235 1949 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_08680 3422 4225 gene locus_tag LOCUS_08690 gene cysQ 3422 4225 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_08690 4229 4843 gene locus_tag LOCUS_08700 gene cysC 4229 4843 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_08700 5546 5058 gene locus_tag LOCUS_08710 5546 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 6686 6282 gene locus_tag LOCUS_08720 6686 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 7765 6767 gene locus_tag LOCUS_08730 7765 6767 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 protein_id gnl|my_center|LOCUS_08730 7868 8632 gene locus_tag LOCUS_08740 7868 8632 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083886.1 protein_id gnl|my_center|LOCUS_08740 9386 8688 gene locus_tag LOCUS_08750 9386 8688 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970020.1 protein_id gnl|my_center|LOCUS_08750 9581 9991 gene locus_tag LOCUS_08760 gene madL 9581 9991 CDS product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526555.1 protein_id gnl|my_center|LOCUS_08760 10008 10772 gene locus_tag LOCUS_08770 gene madM 10008 10772 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193747.1 protein_id gnl|my_center|LOCUS_08770 10820 12475 gene locus_tag LOCUS_08780 gene mdcA 10820 12475 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038693.1 protein_id gnl|my_center|LOCUS_08780 12481 12795 gene locus_tag LOCUS_08790 gene mdcC 12481 12795 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038694.1 protein_id gnl|my_center|LOCUS_08790 12792 13700 gene locus_tag LOCUS_08800 12792 13700 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994153.1 protein_id gnl|my_center|LOCUS_08800 13697 14410 gene locus_tag LOCUS_08810 gene mdcE 13697 14410 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038696.1 protein_id gnl|my_center|LOCUS_08810 14415 15083 gene locus_tag LOCUS_08820 gene mdcG 14415 15083 CDS product malonate decarboxylase holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083098.1 protein_id gnl|my_center|LOCUS_08820 15157 15951 gene locus_tag LOCUS_08830 gene mdcB 15157 15951 CDS product triphosphoribosyl-dephospho-CoA synthase MdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038698.1 protein_id gnl|my_center|LOCUS_08830 15957 16847 gene locus_tag LOCUS_08840 gene mdcH 15957 16847 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038699.1 protein_id gnl|my_center|LOCUS_08840 16991 17827 gene locus_tag LOCUS_08850 16991 17827 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020663.1 protein_id gnl|my_center|LOCUS_08850 17898 18989 gene locus_tag LOCUS_08860 17898 18989 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762626.1 protein_id gnl|my_center|LOCUS_08860 18989 20086 gene locus_tag LOCUS_08870 18989 20086 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184894.1 protein_id gnl|my_center|LOCUS_08870 20171 20860 gene locus_tag LOCUS_08880 20171 20860 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_08880 21646 21080 gene locus_tag LOCUS_08890 21646 21080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 22003 22968 gene locus_tag LOCUS_08900 gene corA 22003 22968 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521393.1 protein_id gnl|my_center|LOCUS_08900 22991 23842 gene locus_tag LOCUS_08910 22991 23842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence025 1741 626 gene locus_tag LOCUS_08920 1741 626 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_08920 2551 2009 gene locus_tag LOCUS_08930 2551 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2902 3960 gene locus_tag LOCUS_08940 gene purM 2902 3960 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222409.1 protein_id gnl|my_center|LOCUS_08940 4016 4654 gene locus_tag LOCUS_08950 gene purN 4016 4654 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064038.1 protein_id gnl|my_center|LOCUS_08950 4657 5349 gene locus_tag LOCUS_08960 4657 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5346 6374 gene locus_tag LOCUS_08970 5346 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 6550 6825 gene locus_tag LOCUS_08980 6550 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 6825 7139 gene locus_tag LOCUS_08990 6825 7139 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035952.1 protein_id gnl|my_center|LOCUS_08990 7464 7264 gene locus_tag LOCUS_09000 7464 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7816 9069 gene locus_tag LOCUS_09010 7816 9069 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222346.1 protein_id gnl|my_center|LOCUS_09010 10375 9077 gene locus_tag LOCUS_09020 10375 9077 CDS product leucine-rich repeat-containing protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895623.1 protein_id gnl|my_center|LOCUS_09020 11082 10375 gene locus_tag LOCUS_09030 11082 10375 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_09030 11984 11193 gene locus_tag LOCUS_09040 gene folE2 11984 11193 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_09040 13873 12041 gene locus_tag LOCUS_09050 gene dxs 13873 12041 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_09050 14763 13873 gene locus_tag LOCUS_09060 14763 13873 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697633.1 protein_id gnl|my_center|LOCUS_09060 15005 14763 gene locus_tag LOCUS_09070 15005 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 15126 16223 gene locus_tag LOCUS_09080 15126 16223 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_09080 16324 17181 gene locus_tag LOCUS_09090 16324 17181 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_09090 17184 17531 gene locus_tag LOCUS_09100 17184 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 17822 17667 gene locus_tag LOCUS_09110 gene rpmG 17822 17667 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 protein_id gnl|my_center|LOCUS_09110 18071 17835 gene locus_tag LOCUS_09120 gene rpmB 18071 17835 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_09120 18247 20013 gene locus_tag LOCUS_09130 18247 20013 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_09130 20110 21438 gene locus_tag LOCUS_09140 20110 21438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 21540 22589 gene locus_tag LOCUS_09150 gene pstS 21540 22589 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 protein_id gnl|my_center|LOCUS_09150 22691 23653 gene locus_tag LOCUS_09160 gene pstC 22691 23653 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_09160 23656 24501 gene locus_tag LOCUS_09170 gene pstA 23656 24501 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence026 1436 765 gene locus_tag LOCUS_09180 gene rph 1436 765 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_09180 2340 1549 gene locus_tag LOCUS_09190 2340 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 2417 3280 gene locus_tag LOCUS_09200 2417 3280 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225470.1 protein_id gnl|my_center|LOCUS_09200 3340 3957 gene locus_tag LOCUS_09210 gene gmk 3340 3957 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_09210 3961 4167 gene locus_tag LOCUS_09220 gene rpoZ 3961 4167 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_09220 4199 6367 gene locus_tag LOCUS_09230 4199 6367 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 protein_id gnl|my_center|LOCUS_09230 6436 7716 gene locus_tag LOCUS_09240 6436 7716 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104851.1 protein_id gnl|my_center|LOCUS_09240 7844 8812 gene locus_tag LOCUS_09250 gene ispB 7844 8812 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925908.1 protein_id gnl|my_center|LOCUS_09250 8860 9072 gene locus_tag LOCUS_09260 8860 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 9085 10686 gene locus_tag LOCUS_09270 gene pilS 9085 10686 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_09270 10670 12049 gene locus_tag LOCUS_09280 gene pilR 10670 12049 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_09280 12039 12581 gene locus_tag LOCUS_09290 gene ampD 12039 12581 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266650.1 protein_id gnl|my_center|LOCUS_09290 15114 12730 gene locus_tag LOCUS_09300 15114 12730 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_09300 15969 15205 gene locus_tag LOCUS_09310 15969 15205 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_09310 16707 15976 gene locus_tag LOCUS_09320 16707 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 17547 16720 gene locus_tag LOCUS_09330 gene prpC 17547 16720 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_09330 17983 17558 gene locus_tag LOCUS_09340 17983 17558 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_09340 18726 17986 gene locus_tag LOCUS_09350 18726 17986 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106697.1 protein_id gnl|my_center|LOCUS_09350 19702 18821 gene locus_tag LOCUS_09360 gene sucD 19702 18821 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203894.1 protein_id gnl|my_center|LOCUS_09360 20868 19702 gene locus_tag LOCUS_09370 gene sucC 20868 19702 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189251.1 protein_id gnl|my_center|LOCUS_09370 21911 21045 gene locus_tag LOCUS_09380 21911 21045 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 protein_id gnl|my_center|LOCUS_09380 <24468 21925 gene locus_tag LOCUS_09390 <24468 21925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109982246.1:response regulator >Feature sequence027 1102 3126 gene locus_tag LOCUS_09400 gene ligA 1102 3126 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_09400 3129 4016 gene locus_tag LOCUS_09410 gene galU 3129 4016 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_09410 4022 4591 gene locus_tag LOCUS_09420 4022 4591 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694420.1 protein_id gnl|my_center|LOCUS_09420 4689 5447 gene locus_tag LOCUS_09430 4689 5447 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268329.1 protein_id gnl|my_center|LOCUS_09430 5471 5998 gene locus_tag LOCUS_09440 gene def 5471 5998 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268642.1 protein_id gnl|my_center|LOCUS_09440 6071 7030 gene locus_tag LOCUS_09450 6071 7030 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_09450 7239 9629 gene locus_tag LOCUS_09460 7239 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 9652 10596 gene locus_tag LOCUS_09470 9652 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 10602 12209 gene locus_tag LOCUS_09480 10602 12209 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148065091.1 protein_id gnl|my_center|LOCUS_09480 12244 12591 gene locus_tag LOCUS_09490 12244 12591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 13871 12597 gene locus_tag LOCUS_09500 gene umuC 13871 12597 CDS product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457628.1 protein_id gnl|my_center|LOCUS_09500 14363 13899 gene locus_tag LOCUS_09510 gene umuD 14363 13899 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124912.1 protein_id gnl|my_center|LOCUS_09510 14962 14369 gene locus_tag LOCUS_09520 14962 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 15154 18969 gene locus_tag LOCUS_09530 15154 18969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 20251 19058 gene locus_tag LOCUS_09540 20251 19058 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_09540 21530 20331 gene locus_tag LOCUS_09550 21530 20331 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_09550 22740 21532 gene locus_tag LOCUS_09560 22740 21532 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_09560 <23422 22897 gene locus_tag LOCUS_09570 <23422 22897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173387053.1:ABC transporter ATP-binding protein >Feature sequence028 1616 444 gene locus_tag LOCUS_09580 gene nirF 1616 444 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_09580 1857 1600 gene locus_tag LOCUS_09590 1857 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2286 1960 gene locus_tag LOCUS_09600 2286 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4085 2376 gene locus_tag LOCUS_09610 gene nirS 4085 2376 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_09610 5245 4280 gene locus_tag LOCUS_09620 5245 4280 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267361.1 protein_id gnl|my_center|LOCUS_09620 6175 5282 gene locus_tag LOCUS_09630 6175 5282 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_09630 6564 6214 gene locus_tag LOCUS_09640 6564 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 6868 6572 gene locus_tag LOCUS_09650 6868 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 8594 6951 gene locus_tag LOCUS_09660 gene leuA 8594 6951 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 protein_id gnl|my_center|LOCUS_09660 8877 9338 gene locus_tag LOCUS_09670 8877 9338 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_09670 9423 9734 gene locus_tag LOCUS_09680 gene nirM 9423 9734 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_09680 9848 11815 gene locus_tag LOCUS_09690 9848 11815 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527764.1 protein_id gnl|my_center|LOCUS_09690 11809 12657 gene locus_tag LOCUS_09700 11809 12657 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_09700 12735 13049 gene locus_tag LOCUS_09710 12735 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 13115 14527 gene locus_tag LOCUS_09720 13115 14527 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_09720 14537 15430 gene locus_tag LOCUS_09730 14537 15430 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_09730 15427 16209 gene locus_tag LOCUS_09740 15427 16209 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_09740 16266 16520 gene locus_tag LOCUS_09750 16266 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 16523 17719 gene locus_tag LOCUS_09760 16523 17719 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_09760 17752 18657 gene locus_tag LOCUS_09770 17752 18657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 18713 19588 gene locus_tag LOCUS_09780 gene aroE 18713 19588 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_09780 19585 20280 gene locus_tag LOCUS_09790 gene mtgA 19585 20280 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_09790 21550 20303 gene locus_tag LOCUS_09800 gene lysA 21550 20303 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196768.1 protein_id gnl|my_center|LOCUS_09800 21690 21553 gene locus_tag LOCUS_09810 21690 21553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 21746 22048 gene locus_tag LOCUS_09820 gene cyaY 21746 22048 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005953.1 protein_id gnl|my_center|LOCUS_09820 <23376 22141 gene locus_tag LOCUS_09830 <23376 22141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925780.1:TonB-dependent receptor >Feature sequence029 216 2312 gene locus_tag LOCUS_09840 gene recG 216 2312 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 protein_id gnl|my_center|LOCUS_09840 2293 2841 gene locus_tag LOCUS_09850 2293 2841 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 protein_id gnl|my_center|LOCUS_09850 5493 2854 gene locus_tag LOCUS_09860 5493 2854 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545171.1 protein_id gnl|my_center|LOCUS_09860 7734 5650 gene locus_tag LOCUS_09870 7734 5650 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942987.1 protein_id gnl|my_center|LOCUS_09870 8051 7737 gene locus_tag LOCUS_09880 8051 7737 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941730.1 protein_id gnl|my_center|LOCUS_09880 9021 8314 gene locus_tag LOCUS_09890 9021 8314 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269182.1 protein_id gnl|my_center|LOCUS_09890 10838 9018 gene locus_tag LOCUS_09900 10838 9018 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269181.1 protein_id gnl|my_center|LOCUS_09900 11904 10960 gene locus_tag LOCUS_09910 11904 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 13077 12175 gene locus_tag LOCUS_09920 13077 12175 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_09920 13309 15297 gene locus_tag LOCUS_09930 13309 15297 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525894.1 protein_id gnl|my_center|LOCUS_09930 15294 16532 gene locus_tag LOCUS_09940 15294 16532 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197240.1 protein_id gnl|my_center|LOCUS_09940 16525 17022 gene locus_tag LOCUS_09950 16525 17022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 18720 17437 gene locus_tag LOCUS_09960 18720 17437 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_09960 18754 19506 gene locus_tag LOCUS_09970 18754 19506 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_09970 19881 20729 gene locus_tag LOCUS_09980 gene ttcA 19881 20729 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261911.1 protein_id gnl|my_center|LOCUS_09980 21128 21439 gene locus_tag LOCUS_09990 21128 21439 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_09990 21439 22059 gene locus_tag LOCUS_10000 21439 22059 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence030 <1 1690 gene locus_tag LOCUS_10010 <1 1690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390311.1:transglutaminase family protein 3564 2119 gene locus_tag LOCUS_10020 gene tldD 3564 2119 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_10020 4494 3646 gene locus_tag LOCUS_10030 4494 3646 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 protein_id gnl|my_center|LOCUS_10030 8322 4519 gene locus_tag LOCUS_10040 8322 4519 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550020.1 protein_id gnl|my_center|LOCUS_10040 8476 8273 gene locus_tag LOCUS_10050 8476 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8559 11282 gene locus_tag LOCUS_10060 gene glnE 8559 11282 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224816.1 protein_id gnl|my_center|LOCUS_10060 11920 11303 gene locus_tag LOCUS_10070 11920 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 12673 13131 gene locus_tag LOCUS_10080 12673 13131 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813149.1 protein_id gnl|my_center|LOCUS_10080 13128 14525 gene locus_tag LOCUS_10090 13128 14525 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064132.1 protein_id gnl|my_center|LOCUS_10090 14567 15757 gene locus_tag LOCUS_10100 14567 15757 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447276.1 protein_id gnl|my_center|LOCUS_10100 15750 17303 gene locus_tag LOCUS_10110 15750 17303 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193982.1 protein_id gnl|my_center|LOCUS_10110 19460 17547 gene locus_tag LOCUS_10120 19460 17547 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 protein_id gnl|my_center|LOCUS_10120 19915 19460 gene locus_tag LOCUS_10130 19915 19460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 20576 20016 gene locus_tag LOCUS_10140 gene bcp 20576 20016 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_10140 20674 20748 gene locus_tag LOCUS_t00140 20674 20748 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21114 21905 gene locus_tag LOCUS_10150 21114 21905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence031 4806 4336 gene locus_tag LOCUS_10160 4806 4336 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012501288.1 protein_id gnl|my_center|LOCUS_10160 6108 4807 gene locus_tag LOCUS_10170 gene rlmD 6108 4807 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_10170 6510 6136 gene locus_tag LOCUS_10180 6510 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7283 6510 gene locus_tag LOCUS_10190 7283 6510 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_10190 7750 7340 gene locus_tag LOCUS_10200 7750 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 7911 7747 gene locus_tag LOCUS_10210 7911 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 8565 7921 gene locus_tag LOCUS_10220 8565 7921 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943548.1 protein_id gnl|my_center|LOCUS_10220 8957 8565 gene locus_tag LOCUS_10230 8957 8565 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_10230 9433 8951 gene locus_tag LOCUS_10240 9433 8951 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_10240 11739 9430 gene locus_tag LOCUS_10250 11739 9430 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942422.1 protein_id gnl|my_center|LOCUS_10250 12319 11780 gene locus_tag LOCUS_10260 12319 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 12945 12316 gene locus_tag LOCUS_10270 12945 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 13472 12942 gene locus_tag LOCUS_10280 13472 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 14299 13472 gene locus_tag LOCUS_10290 14299 13472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 15977 14280 gene locus_tag LOCUS_10300 15977 14280 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_10300 17164 15974 gene locus_tag LOCUS_10310 17164 15974 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_10310 17645 17214 gene locus_tag LOCUS_10320 gene gspG 17645 17214 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_10320 18378 17671 gene locus_tag LOCUS_10330 18378 17671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 20631 18718 gene locus_tag LOCUS_10340 20631 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence032 2653 1139 gene locus_tag LOCUS_10350 2653 1139 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705692.1 protein_id gnl|my_center|LOCUS_10350 4404 2650 gene locus_tag LOCUS_10360 4404 2650 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195138.1 protein_id gnl|my_center|LOCUS_10360 4847 4407 gene locus_tag LOCUS_10370 4847 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 5772 4837 gene locus_tag LOCUS_10380 gene rsmH 5772 4837 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224919.1 protein_id gnl|my_center|LOCUS_10380 6215 5769 gene locus_tag LOCUS_10390 gene mraZ 6215 5769 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295770.1 protein_id gnl|my_center|LOCUS_10390 6598 7470 gene locus_tag LOCUS_10400 6598 7470 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533668.1 protein_id gnl|my_center|LOCUS_10400 7470 8624 gene locus_tag LOCUS_10410 7470 8624 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428856.1 protein_id gnl|my_center|LOCUS_10410 9422 8730 gene locus_tag LOCUS_10420 gene pgl 9422 8730 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_10420 10380 9409 gene locus_tag LOCUS_10430 gene gnd 10380 9409 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089498.1 protein_id gnl|my_center|LOCUS_10430 10593 12119 gene locus_tag LOCUS_10440 gene zwf 10593 12119 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_10440 12718 12191 gene locus_tag LOCUS_10450 gene tpx 12718 12191 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195100.1 protein_id gnl|my_center|LOCUS_10450 15621 12769 gene locus_tag LOCUS_10460 gene gcvP 15621 12769 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_10460 16128 15739 gene locus_tag LOCUS_10470 gene gcvH 16128 15739 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_10470 17323 16235 gene locus_tag LOCUS_10480 gene gcvT 17323 16235 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202927.1 protein_id gnl|my_center|LOCUS_10480 17902 17609 gene locus_tag LOCUS_10490 17902 17609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 18042 17899 gene locus_tag LOCUS_10500 18042 17899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 18769 18266 gene locus_tag LOCUS_10510 18769 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 19008 18766 gene locus_tag LOCUS_10520 19008 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 20503 19055 gene locus_tag LOCUS_10530 gene gatB 20503 19055 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence033 156 902 gene locus_tag LOCUS_10540 156 902 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104614758.1 protein_id gnl|my_center|LOCUS_10540 1114 4197 gene locus_tag LOCUS_10550 1114 4197 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_10550 4429 4734 gene locus_tag LOCUS_10560 4429 4734 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214787.1 protein_id gnl|my_center|LOCUS_10560 4736 5134 gene locus_tag LOCUS_10570 4736 5134 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209924.1 protein_id gnl|my_center|LOCUS_10570 5247 5570 gene locus_tag LOCUS_10580 5247 5570 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004173862.1 protein_id gnl|my_center|LOCUS_10580 6063 7409 gene locus_tag LOCUS_10590 6063 7409 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192757.1 protein_id gnl|my_center|LOCUS_10590 7463 7705 gene locus_tag LOCUS_10600 7463 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 8023 8859 gene locus_tag LOCUS_10610 8023 8859 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_10610 10286 9132 gene locus_tag LOCUS_10620 10286 9132 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160754.1 protein_id gnl|my_center|LOCUS_10620 10716 10303 gene locus_tag LOCUS_10630 10716 10303 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_10630 11765 10782 gene locus_tag LOCUS_10640 11765 10782 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_10640 12453 11815 gene locus_tag LOCUS_10650 12453 11815 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 protein_id gnl|my_center|LOCUS_10650 12764 13717 gene locus_tag LOCUS_10660 12764 13717 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817255.1 protein_id gnl|my_center|LOCUS_10660 13749 14762 gene locus_tag LOCUS_10670 13749 14762 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_10670 14767 15648 gene locus_tag LOCUS_10680 14767 15648 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205164.1 protein_id gnl|my_center|LOCUS_10680 15806 16258 gene locus_tag LOCUS_10690 15806 16258 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 protein_id gnl|my_center|LOCUS_10690 17175 16297 gene locus_tag LOCUS_10700 17175 16297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 17637 18014 gene locus_tag LOCUS_10710 17637 18014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 18753 18932 gene locus_tag LOCUS_10720 18753 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 18963 19364 gene locus_tag LOCUS_10730 18963 19364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10730 19383 19628 gene locus_tag LOCUS_10740 19383 19628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 19799 20347 gene locus_tag LOCUS_10750 19799 20347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10750 >Feature sequence034 1250 1573 gene locus_tag LOCUS_10760 1250 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1712 3085 gene locus_tag LOCUS_10770 gene pcnB 1712 3085 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929702.1 protein_id gnl|my_center|LOCUS_10770 3082 3564 gene locus_tag LOCUS_10780 gene folK 3082 3564 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036940.1 protein_id gnl|my_center|LOCUS_10780 3589 4401 gene locus_tag LOCUS_10790 gene panB 3589 4401 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_10790 4401 5267 gene locus_tag LOCUS_10800 gene panC 4401 5267 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_10800 5275 5655 gene locus_tag LOCUS_10810 5275 5655 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_10810 5858 6577 gene locus_tag LOCUS_10820 gene tpiA 5858 6577 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 protein_id gnl|my_center|LOCUS_10820 6602 6934 gene locus_tag LOCUS_10830 gene secG 6602 6934 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_10830 6950 7036 gene locus_tag LOCUS_t00150 6950 7036 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7214 7570 gene locus_tag LOCUS_10840 7214 7570 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_10840 7561 8037 gene locus_tag LOCUS_10850 7561 8037 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_10850 8046 8642 gene locus_tag LOCUS_10860 8046 8642 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_10860 8896 10125 gene locus_tag LOCUS_10870 8896 10125 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_10870 10125 10604 gene locus_tag LOCUS_10880 gene nuoE 10125 10604 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224830.1 protein_id gnl|my_center|LOCUS_10880 10601 11866 gene locus_tag LOCUS_10890 gene nuoF 10601 11866 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_10890 11886 14255 gene locus_tag LOCUS_10900 gene nuoG 11886 14255 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543813.1 protein_id gnl|my_center|LOCUS_10900 14252 15280 gene locus_tag LOCUS_10910 gene nuoH 14252 15280 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_10910 15313 15801 gene locus_tag LOCUS_10920 gene nuoI 15313 15801 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_10920 15901 16503 gene locus_tag LOCUS_10930 15901 16503 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769059.1 protein_id gnl|my_center|LOCUS_10930 16617 16922 gene locus_tag LOCUS_10940 gene nuoK 16617 16922 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_10940 16927 19020 gene locus_tag LOCUS_10950 gene nuoL 16927 19020 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208277753.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence035 1235 303 gene locus_tag LOCUS_10960 gene fmt 1235 303 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083540.1 protein_id gnl|my_center|LOCUS_10960 1764 1261 gene locus_tag LOCUS_10970 gene def 1764 1261 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525852.1 protein_id gnl|my_center|LOCUS_10970 1852 2871 gene locus_tag LOCUS_10980 1852 2871 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_10980 2900 3985 gene locus_tag LOCUS_10990 gene dprA 2900 3985 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_10990 3998 4453 gene locus_tag LOCUS_11000 3998 4453 CDS product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040781.1 protein_id gnl|my_center|LOCUS_11000 4458 7094 gene locus_tag LOCUS_11010 4458 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 7303 9102 gene locus_tag LOCUS_11020 7303 9102 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_11020 10331 9609 gene locus_tag LOCUS_11030 10331 9609 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933923.1 protein_id gnl|my_center|LOCUS_11030 13575 11197 gene locus_tag LOCUS_11040 gene gyrB 13575 11197 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689984.1 protein_id gnl|my_center|LOCUS_11040 14751 13642 gene locus_tag LOCUS_11050 gene dnaN 14751 13642 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_11050 16419 15292 gene locus_tag LOCUS_11060 16419 15292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 17558 19141 gene locus_tag LOCUS_11070 gene yidC 17558 19141 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence036 1764 859 gene locus_tag LOCUS_11080 gene cysD 1764 859 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_11080 2519 1809 gene locus_tag LOCUS_11090 2519 1809 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 protein_id gnl|my_center|LOCUS_11090 4687 2648 gene locus_tag LOCUS_11100 4687 2648 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_11100 5470 4697 gene locus_tag LOCUS_11110 5470 4697 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_11110 5587 6528 gene locus_tag LOCUS_11120 5587 6528 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 protein_id gnl|my_center|LOCUS_11120 6963 6616 gene locus_tag LOCUS_11130 6963 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 8572 6980 gene locus_tag LOCUS_11140 gene murJ 8572 6980 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211214.1 protein_id gnl|my_center|LOCUS_11140 8942 8544 gene locus_tag LOCUS_11150 8942 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 9069 9470 gene locus_tag LOCUS_11160 9069 9470 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534270.1 protein_id gnl|my_center|LOCUS_11160 9607 9795 gene locus_tag LOCUS_11170 9607 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 9800 10594 gene locus_tag LOCUS_11180 9800 10594 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_11180 10591 11100 gene locus_tag LOCUS_11190 gene dfrA 10591 11100 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_11190 11104 13155 gene locus_tag LOCUS_11200 gene rlhA 11104 13155 CDS product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313806.1 protein_id gnl|my_center|LOCUS_11200 13252 13707 gene locus_tag LOCUS_11210 13252 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 14035 13832 gene locus_tag LOCUS_11220 14035 13832 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_11220 16535 14289 gene locus_tag LOCUS_11230 16535 14289 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 protein_id gnl|my_center|LOCUS_11230 17176 16643 gene locus_tag LOCUS_11240 gene dcd 17176 16643 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224592.1 protein_id gnl|my_center|LOCUS_11240 18396 17302 gene locus_tag LOCUS_11250 gene apbC 18396 17302 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence037 928 1278 gene locus_tag LOCUS_11260 928 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1370 3583 gene locus_tag LOCUS_11270 1370 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 4472 3624 gene locus_tag LOCUS_11280 4472 3624 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_11280 4546 5736 gene locus_tag LOCUS_11290 gene dapC 4546 5736 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_11290 5811 7499 gene locus_tag LOCUS_11300 gene recJ 5811 7499 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_11300 7642 8898 gene locus_tag LOCUS_11310 7642 8898 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_11310 8996 10042 gene locus_tag LOCUS_11320 gene prfB 8996 10042 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199566.1 protein_id gnl|my_center|LOCUS_11320 10652 10128 gene locus_tag LOCUS_11330 10652 10128 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546171.1 protein_id gnl|my_center|LOCUS_11330 12106 10652 gene locus_tag LOCUS_11340 gene glgA 12106 10652 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369346.1 protein_id gnl|my_center|LOCUS_11340 12526 12215 gene locus_tag LOCUS_11350 12526 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 15172 12701 gene locus_tag LOCUS_11360 15172 12701 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_11360 16327 15335 gene locus_tag LOCUS_11370 gene glk 16327 15335 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_11370 17864 16383 gene locus_tag LOCUS_11380 gene rmuC 17864 16383 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084315.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence038 1284 1078 gene locus_tag LOCUS_11390 1284 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1653 1408 gene locus_tag LOCUS_11400 1653 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2669 1764 gene locus_tag LOCUS_11410 2669 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3657 2641 gene locus_tag LOCUS_11420 gene aroF 3657 2641 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_11420 4757 3654 gene locus_tag LOCUS_11430 gene hisC 4757 3654 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_11430 5635 4862 gene locus_tag LOCUS_11440 5635 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6725 5661 gene locus_tag LOCUS_11450 gene pheA 6725 5661 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 protein_id gnl|my_center|LOCUS_11450 7980 6790 gene locus_tag LOCUS_11460 7980 6790 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_11460 9145 8063 gene locus_tag LOCUS_11470 gene serC 9145 8063 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_11470 11840 9249 gene locus_tag LOCUS_11480 gene gyrA 11840 9249 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527513.1 protein_id gnl|my_center|LOCUS_11480 13126 11960 gene locus_tag LOCUS_11490 13126 11960 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_11490 13674 13306 gene locus_tag LOCUS_tm00010 13674 13306 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 14355 13714 gene locus_tag LOCUS_11500 gene gph 14355 13714 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_11500 15127 14432 gene locus_tag LOCUS_11510 gene ubiG 15127 14432 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_11510 15404 15994 gene locus_tag LOCUS_11520 15404 15994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_11520 18432 16012 gene locus_tag LOCUS_11530 18432 16012 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence039 <1 770 gene locus_tag LOCUS_11540 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036071.1:peptide chain release factor N(5)-glutamine methyltransferase 825 1154 gene locus_tag LOCUS_11550 gene grxD 825 1154 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807622.1 protein_id gnl|my_center|LOCUS_11550 3089 1698 gene locus_tag LOCUS_11560 gene argH 3089 1698 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191886.1 protein_id gnl|my_center|LOCUS_11560 3255 4289 gene locus_tag LOCUS_11570 3255 4289 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012777536.1 protein_id gnl|my_center|LOCUS_11570 4286 5032 gene locus_tag LOCUS_11580 4286 5032 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_11580 6598 5222 gene locus_tag LOCUS_11590 gene dacB 6598 5222 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189150.1 protein_id gnl|my_center|LOCUS_11590 8004 6595 gene locus_tag LOCUS_11600 gene bioA 8004 6595 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525973.1 protein_id gnl|my_center|LOCUS_11600 8101 9000 gene locus_tag LOCUS_11610 8101 9000 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 protein_id gnl|my_center|LOCUS_11610 9145 10395 gene locus_tag LOCUS_11620 9145 10395 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_11620 10514 10804 gene locus_tag LOCUS_11630 gene groES 10514 10804 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 protein_id gnl|my_center|LOCUS_11630 10870 12507 gene locus_tag LOCUS_11640 gene groL 10870 12507 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538665.1 protein_id gnl|my_center|LOCUS_11640 12793 12868 gene locus_tag LOCUS_t00160 12793 12868 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 13868 13260 gene locus_tag LOCUS_11650 13868 13260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11650 13913 14212 gene locus_tag LOCUS_11660 13913 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 14209 14457 gene locus_tag LOCUS_11670 14209 14457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 14626 15774 gene locus_tag LOCUS_11680 14626 15774 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035313.1 protein_id gnl|my_center|LOCUS_11680 15881 16237 gene locus_tag LOCUS_11690 15881 16237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11690 16319 16603 gene locus_tag LOCUS_11700 16319 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 16808 17686 gene locus_tag LOCUS_11710 16808 17686 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence040 427 1263 gene locus_tag LOCUS_11720 427 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1326 2087 gene locus_tag LOCUS_11730 1326 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2080 2826 gene locus_tag LOCUS_11740 2080 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 3640 2828 gene locus_tag LOCUS_11750 3640 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4147 3674 gene locus_tag LOCUS_11760 4147 3674 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407330.1 protein_id gnl|my_center|LOCUS_11760 4963 4199 gene locus_tag LOCUS_11770 4963 4199 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_11770 5029 6024 gene locus_tag LOCUS_11780 gene bioB 5029 6024 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 protein_id gnl|my_center|LOCUS_11780 6053 7273 gene locus_tag LOCUS_11790 gene bioF 6053 7273 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 protein_id gnl|my_center|LOCUS_11790 7369 8205 gene locus_tag LOCUS_11800 gene bioH 7369 8205 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_11800 8198 9067 gene locus_tag LOCUS_11810 8198 9067 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_11810 9095 9763 gene locus_tag LOCUS_11820 gene bioD 9095 9763 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269170.1 protein_id gnl|my_center|LOCUS_11820 9796 10581 gene locus_tag LOCUS_11830 9796 10581 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_11830 10568 11152 gene locus_tag LOCUS_11840 10568 11152 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064817.1 protein_id gnl|my_center|LOCUS_11840 11341 11991 gene locus_tag LOCUS_11850 11341 11991 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_11850 11984 14251 gene locus_tag LOCUS_11860 11984 14251 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814032.1 protein_id gnl|my_center|LOCUS_11860 14354 14968 gene locus_tag LOCUS_11870 gene lolA 14354 14968 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185701.1 protein_id gnl|my_center|LOCUS_11870 14975 16288 gene locus_tag LOCUS_11880 14975 16288 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_11880 16386 16682 gene locus_tag LOCUS_11890 16386 16682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 16727 18022 gene locus_tag LOCUS_11900 gene serS 16727 18022 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence041 1101 469 gene locus_tag LOCUS_11910 gene leuD 1101 469 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_11910 1220 1101 gene locus_tag LOCUS_11920 1220 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2749 1352 gene locus_tag LOCUS_11930 gene leuC 2749 1352 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_11930 4986 2872 gene locus_tag LOCUS_11940 4986 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 6171 5023 gene locus_tag LOCUS_11950 6171 5023 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_11950 6490 7593 gene locus_tag LOCUS_11960 6490 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 7584 11711 gene locus_tag LOCUS_11970 7584 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 11953 13101 gene locus_tag LOCUS_11980 11953 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 14314 13190 gene locus_tag LOCUS_11990 14314 13190 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770934.1 protein_id gnl|my_center|LOCUS_11990 15732 14326 gene locus_tag LOCUS_12000 15732 14326 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770932.1 protein_id gnl|my_center|LOCUS_12000 16478 15813 gene locus_tag LOCUS_12010 16478 15813 CDS product alginate O-acetyltransferase AlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770931.1 protein_id gnl|my_center|LOCUS_12010 17152 16487 gene locus_tag LOCUS_12020 17152 16487 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556137.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence042 338 262 gene locus_tag LOCUS_t00170 338 262 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 505 1605 gene locus_tag LOCUS_12030 505 1605 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494086.1 protein_id gnl|my_center|LOCUS_12030 1605 4679 gene locus_tag LOCUS_12040 1605 4679 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_12040 4676 4990 gene locus_tag LOCUS_12050 4676 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 4987 6291 gene locus_tag LOCUS_12060 4987 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6275 6538 gene locus_tag LOCUS_12070 6275 6538 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580382.1 protein_id gnl|my_center|LOCUS_12070 6617 7438 gene locus_tag LOCUS_12080 6617 7438 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521971.1 protein_id gnl|my_center|LOCUS_12080 7546 8349 gene locus_tag LOCUS_12090 7546 8349 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527983.1 protein_id gnl|my_center|LOCUS_12090 8442 8681 gene locus_tag LOCUS_12100 8442 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 8692 9933 gene locus_tag LOCUS_12110 8692 9933 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 protein_id gnl|my_center|LOCUS_12110 10035 13115 gene locus_tag LOCUS_12120 gene mexK 10035 13115 CDS product multidrug efflux RND transporter permease subunit MexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_12120 14112 13588 gene locus_tag LOCUS_12130 14112 13588 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947309.1 protein_id gnl|my_center|LOCUS_12130 14319 16835 gene locus_tag LOCUS_12140 14319 16835 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_12140 16979 17854 gene locus_tag LOCUS_12150 16979 17854 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023152.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence043 3888 1783 gene locus_tag LOCUS_12160 gene pnp 3888 1783 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 protein_id gnl|my_center|LOCUS_12160 4254 3985 gene locus_tag LOCUS_12170 gene rpsO 4254 3985 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_12170 4474 4328 gene locus_tag LOCUS_12180 4474 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 5397 4495 gene locus_tag LOCUS_12190 gene truB 5397 4495 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_12190 5797 5435 gene locus_tag LOCUS_12200 gene rbfA 5797 5435 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_12200 8511 5797 gene locus_tag LOCUS_12210 gene infB 8511 5797 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526850.1 protein_id gnl|my_center|LOCUS_12210 10126 8654 gene locus_tag LOCUS_12220 gene nusA 10126 8654 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810546.1 protein_id gnl|my_center|LOCUS_12220 10598 10173 gene locus_tag LOCUS_12230 gene rimP 10598 10173 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_12230 11093 10815 gene locus_tag LOCUS_12240 11093 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 11487 11098 gene locus_tag LOCUS_12250 11487 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 11820 11491 gene locus_tag LOCUS_12260 11820 11491 CDS product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809432.1 protein_id gnl|my_center|LOCUS_12260 12622 11870 gene locus_tag LOCUS_12270 12622 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 13240 12686 gene locus_tag LOCUS_12280 13240 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 17164 13244 gene locus_tag LOCUS_12290 17164 13244 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197541448.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence044 1452 973 gene locus_tag LOCUS_12300 1452 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2512 1436 gene locus_tag LOCUS_12310 gene recA 2512 1436 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189458.1 protein_id gnl|my_center|LOCUS_12310 3083 2592 gene locus_tag LOCUS_12320 gene pncC 3083 2592 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 protein_id gnl|my_center|LOCUS_12320 4252 3083 gene locus_tag LOCUS_12330 4252 3083 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_12330 5865 4339 gene locus_tag LOCUS_12340 gene purF 5865 4339 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_12340 6372 5878 gene locus_tag LOCUS_12350 6372 5878 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705745.1 protein_id gnl|my_center|LOCUS_12350 7145 6369 gene locus_tag LOCUS_12360 7145 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 8562 7294 gene locus_tag LOCUS_12370 gene folC 8562 7294 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039854.1 protein_id gnl|my_center|LOCUS_12370 9547 8663 gene locus_tag LOCUS_12380 gene accD 9547 8663 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_12380 10409 9609 gene locus_tag LOCUS_12390 gene trpA 10409 9609 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_12390 11602 10406 gene locus_tag LOCUS_12400 gene trpB 11602 10406 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 protein_id gnl|my_center|LOCUS_12400 12317 11595 gene locus_tag LOCUS_12410 12317 11595 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_12410 13115 12351 gene locus_tag LOCUS_12420 gene truA 13115 12351 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_12420 13726 13115 gene locus_tag LOCUS_12430 13726 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 16431 13786 gene locus_tag LOCUS_12440 16431 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 <17182 16610 gene locus_tag LOCUS_12450 <17182 16610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948008.1:aspartate-semialdehyde dehydrogenase >Feature sequence045 773 405 gene locus_tag LOCUS_12460 773 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1212 838 gene locus_tag LOCUS_12470 1212 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2258 1350 gene locus_tag LOCUS_12480 2258 1350 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_12480 3606 2278 gene locus_tag LOCUS_12490 3606 2278 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124441.1 protein_id gnl|my_center|LOCUS_12490 4513 3755 gene locus_tag LOCUS_12500 4513 3755 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_12500 5462 4611 gene locus_tag LOCUS_12510 5462 4611 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_12510 7370 5502 gene locus_tag LOCUS_12520 7370 5502 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_12520 8037 7492 gene locus_tag LOCUS_12530 8037 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 8347 8123 gene locus_tag LOCUS_12540 8347 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 9069 8428 gene locus_tag LOCUS_12550 9069 8428 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093241.1 protein_id gnl|my_center|LOCUS_12550 10070 9138 gene locus_tag LOCUS_12560 gene secF 10070 9138 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064325.1 protein_id gnl|my_center|LOCUS_12560 11888 10077 gene locus_tag LOCUS_12570 gene secD 11888 10077 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809414.1 protein_id gnl|my_center|LOCUS_12570 12274 11945 gene locus_tag LOCUS_12580 gene yajC 12274 11945 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_12580 13433 12327 gene locus_tag LOCUS_12590 gene tgt 13433 12327 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194199.1 protein_id gnl|my_center|LOCUS_12590 14520 13495 gene locus_tag LOCUS_12600 gene queA 14520 13495 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248769.1 protein_id gnl|my_center|LOCUS_12600 14600 14686 gene locus_tag LOCUS_t00180 14600 14686 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14926 15135 gene locus_tag LOCUS_12610 14926 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 15241 15687 gene locus_tag LOCUS_12620 15241 15687 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_12620 15680 16795 gene locus_tag LOCUS_12630 gene mnmA 15680 16795 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence046 336 851 gene locus_tag LOCUS_12640 336 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 844 1632 gene locus_tag LOCUS_12650 844 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1616 2506 gene locus_tag LOCUS_12660 1616 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2603 3196 gene locus_tag LOCUS_12670 2603 3196 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_12670 3451 4488 gene locus_tag LOCUS_12680 3451 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6196 4490 gene locus_tag LOCUS_12690 gene ubiB 6196 4490 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_12690 6933 6211 gene locus_tag LOCUS_12700 6933 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 7552 6971 gene locus_tag LOCUS_12710 7552 6971 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771783.1 protein_id gnl|my_center|LOCUS_12710 8810 7896 gene locus_tag LOCUS_12720 8810 7896 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947761.1 protein_id gnl|my_center|LOCUS_12720 9667 8813 gene locus_tag LOCUS_12730 9667 8813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 protein_id gnl|my_center|LOCUS_12730 10794 9667 gene locus_tag LOCUS_12740 10794 9667 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772900.1 protein_id gnl|my_center|LOCUS_12740 10939 12051 gene locus_tag LOCUS_12750 gene hisC 10939 12051 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_12750 12064 12651 gene locus_tag LOCUS_12760 gene hisB 12064 12651 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_12760 12651 13364 gene locus_tag LOCUS_12770 gene hisH 12651 13364 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_12770 13446 14132 gene locus_tag LOCUS_12780 gene hisA 13446 14132 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_12780 14133 14891 gene locus_tag LOCUS_12790 gene hisF 14133 14891 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_12790 14995 15384 gene locus_tag LOCUS_12800 gene hisI 14995 15384 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_12800 15381 15698 gene locus_tag LOCUS_12810 15381 15698 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687491.1 protein_id gnl|my_center|LOCUS_12810 15701 16048 gene locus_tag LOCUS_12820 15701 16048 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222846.1 protein_id gnl|my_center|LOCUS_12820 16066 16287 gene locus_tag LOCUS_12830 gene tatA 16066 16287 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_12830 16386 16745 gene locus_tag LOCUS_12840 gene tatB 16386 16745 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448907.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence047 1224 349 gene locus_tag LOCUS_12850 1224 349 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_12850 1582 1232 gene locus_tag LOCUS_12860 1582 1232 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_12860 2040 2459 gene locus_tag LOCUS_12870 2040 2459 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264684.1 protein_id gnl|my_center|LOCUS_12870 2750 2475 gene locus_tag LOCUS_12880 2750 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 3022 2750 gene locus_tag LOCUS_12890 3022 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4230 3112 gene locus_tag LOCUS_12900 4230 3112 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527179.1 protein_id gnl|my_center|LOCUS_12900 4629 4258 gene locus_tag LOCUS_12910 4629 4258 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_12910 6254 4626 gene locus_tag LOCUS_12920 6254 4626 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193449.1 protein_id gnl|my_center|LOCUS_12920 7846 6503 gene locus_tag LOCUS_12930 gene xseA 7846 6503 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225145.1 protein_id gnl|my_center|LOCUS_12930 8242 8850 gene locus_tag LOCUS_12940 8242 8850 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_12940 8857 9276 gene locus_tag LOCUS_12950 8857 9276 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_12950 9476 10474 gene locus_tag LOCUS_12960 gene lpxK 9476 10474 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706582.1 protein_id gnl|my_center|LOCUS_12960 10455 10643 gene locus_tag LOCUS_12970 10455 10643 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422539.1 protein_id gnl|my_center|LOCUS_12970 10646 11416 gene locus_tag LOCUS_12980 gene kdsB 10646 11416 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_12980 11494 12150 gene locus_tag LOCUS_12990 gene adk 11494 12150 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185840.1 protein_id gnl|my_center|LOCUS_12990 12152 12568 gene locus_tag LOCUS_13000 12152 12568 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199588.1 protein_id gnl|my_center|LOCUS_13000 13407 12634 gene locus_tag LOCUS_13010 13407 12634 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093967.1 protein_id gnl|my_center|LOCUS_13010 13602 15635 gene locus_tag LOCUS_13020 13602 15635 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_13020 <16488 15685 gene locus_tag LOCUS_13030 <16488 15685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199587.1:excinuclease ABC subunit UvrB >Feature sequence048 <1 2140 gene locus_tag LOCUS_13040 <1 2140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113821.1:phosphoribosylformylglycinamidine synthase 2212 2988 gene locus_tag LOCUS_13050 gene djlA 2212 2988 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_13050 4710 3016 gene locus_tag LOCUS_13060 4710 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5276 4998 gene locus_tag LOCUS_13070 5276 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 5519 7603 gene locus_tag LOCUS_13080 5519 7603 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_13080 8558 7827 gene locus_tag LOCUS_13090 8558 7827 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811964.1 protein_id gnl|my_center|LOCUS_13090 9111 8668 gene locus_tag LOCUS_13100 9111 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 10202 9180 gene locus_tag LOCUS_13110 10202 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 10365 11921 gene locus_tag LOCUS_13120 gene lnt 10365 11921 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707020.1 protein_id gnl|my_center|LOCUS_13120 11918 12187 gene locus_tag LOCUS_13130 11918 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 12348 14261 gene locus_tag LOCUS_13140 gene thrS 12348 14261 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_13140 14317 14811 gene locus_tag LOCUS_13150 gene infC 14317 14811 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_13150 14993 15190 gene locus_tag LOCUS_13160 gene rpmI 14993 15190 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_13160 15201 15560 gene locus_tag LOCUS_13170 gene rplT 15201 15560 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence049 238 1476 gene locus_tag LOCUS_13180 gene lplT 238 1476 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_13180 2426 1497 gene locus_tag LOCUS_13190 2426 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2859 2419 gene locus_tag LOCUS_13200 gene rimI 2859 2419 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_13200 3614 2868 gene locus_tag LOCUS_13210 gene tsaB 3614 2868 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038052.1 protein_id gnl|my_center|LOCUS_13210 4087 3611 gene locus_tag LOCUS_13220 gene ispF 4087 3611 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_13220 4836 4078 gene locus_tag LOCUS_13230 gene ispD 4836 4078 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191584.1 protein_id gnl|my_center|LOCUS_13230 4816 8214 gene locus_tag LOCUS_13240 gene mfd 4816 8214 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_13240 8366 11374 gene locus_tag LOCUS_13250 8366 11374 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_13250 11509 12351 gene locus_tag LOCUS_13260 gene serB 11509 12351 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_13260 12404 15229 gene locus_tag LOCUS_13270 12404 15229 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529996.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence050 993 244 gene locus_tag LOCUS_13280 993 244 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204659.1 protein_id gnl|my_center|LOCUS_13280 1544 1194 gene locus_tag LOCUS_13290 gene arsC 1544 1194 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 protein_id gnl|my_center|LOCUS_13290 2242 1607 gene locus_tag LOCUS_13300 2242 1607 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389275.1 protein_id gnl|my_center|LOCUS_13300 3552 2476 gene locus_tag LOCUS_13310 gene nadA 3552 2476 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185886.1 protein_id gnl|my_center|LOCUS_13310 4144 3662 gene locus_tag LOCUS_13320 gene nudB 4144 3662 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240378.1 protein_id gnl|my_center|LOCUS_13320 4657 4268 gene locus_tag LOCUS_13330 4657 4268 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037424.1 protein_id gnl|my_center|LOCUS_13330 5031 4660 gene locus_tag LOCUS_13340 5031 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 6830 5034 gene locus_tag LOCUS_13350 gene aspS 6830 5034 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_13350 7455 6844 gene locus_tag LOCUS_13360 7455 6844 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_13360 7701 7459 gene locus_tag LOCUS_13370 7701 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8001 9521 gene locus_tag LOCUS_13380 8001 9521 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448947.1 protein_id gnl|my_center|LOCUS_13380 9614 9763 gene locus_tag LOCUS_13390 9614 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 9767 10462 gene locus_tag LOCUS_13400 9767 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 11196 10507 gene locus_tag LOCUS_13410 11196 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_13410 11815 11279 gene locus_tag LOCUS_13420 11815 11279 CDS product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763288.1 protein_id gnl|my_center|LOCUS_13420 11951 14179 gene locus_tag LOCUS_13430 11951 14179 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_13430 14458 14255 gene locus_tag LOCUS_13440 14458 14255 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_13440 14680 14997 gene locus_tag LOCUS_13450 gene clpS 14680 14997 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041728.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence051 2360 267 gene locus_tag LOCUS_13460 gene fusA 2360 267 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806902.1 protein_id gnl|my_center|LOCUS_13460 2868 2398 gene locus_tag LOCUS_13470 gene rpsG 2868 2398 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215391.1 protein_id gnl|my_center|LOCUS_13470 3289 2915 gene locus_tag LOCUS_13480 gene rpsL 3289 2915 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874480.1 protein_id gnl|my_center|LOCUS_13480 7645 3404 gene locus_tag LOCUS_13490 gene rpoC 7645 3404 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 protein_id gnl|my_center|LOCUS_13490 11815 7736 gene locus_tag LOCUS_13500 gene rpoB 11815 7736 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 protein_id gnl|my_center|LOCUS_13500 12315 11941 gene locus_tag LOCUS_13510 gene rplL 12315 11941 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_13510 12950 12345 gene locus_tag LOCUS_13520 gene rplJ 12950 12345 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_13520 13847 13161 gene locus_tag LOCUS_13530 gene rplA 13847 13161 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 protein_id gnl|my_center|LOCUS_13530 14278 13847 gene locus_tag LOCUS_13540 gene rplK 14278 13847 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929572.1 protein_id gnl|my_center|LOCUS_13540 14931 14398 gene locus_tag LOCUS_13550 gene nusG 14931 14398 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_13550 15278 14931 gene locus_tag LOCUS_13560 gene secE 15278 14931 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185179.1 protein_id gnl|my_center|LOCUS_13560 15388 15313 gene locus_tag LOCUS_t00190 15388 15313 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence052 932 243 gene locus_tag LOCUS_13570 932 243 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039565.1 protein_id gnl|my_center|LOCUS_13570 1575 934 gene locus_tag LOCUS_13580 1575 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2990 1572 gene locus_tag LOCUS_13590 2990 1572 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 protein_id gnl|my_center|LOCUS_13590 5407 3008 gene locus_tag LOCUS_13600 5407 3008 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550100.1 protein_id gnl|my_center|LOCUS_13600 7827 5476 gene locus_tag LOCUS_13610 7827 5476 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494110.1 protein_id gnl|my_center|LOCUS_13610 8382 8056 gene locus_tag LOCUS_13620 8382 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 8586 8383 gene locus_tag LOCUS_13630 8586 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 8924 9238 gene locus_tag LOCUS_13640 8924 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 9228 10457 gene locus_tag LOCUS_13650 9228 10457 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044888.1 protein_id gnl|my_center|LOCUS_13650 11187 10639 gene locus_tag LOCUS_13660 11187 10639 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 protein_id gnl|my_center|LOCUS_13660 12026 11574 gene locus_tag LOCUS_13670 12026 11574 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689877.1 protein_id gnl|my_center|LOCUS_13670 12189 12052 gene locus_tag LOCUS_13680 12189 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 12680 12318 gene locus_tag LOCUS_13690 12680 12318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 13190 12717 gene locus_tag LOCUS_13700 13190 12717 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337019.1 protein_id gnl|my_center|LOCUS_13700 14170 13301 gene locus_tag LOCUS_13710 14170 13301 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388114.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence053 <1 795 gene locus_tag LOCUS_13720 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528363.1:ATP-binding cassette domain-containing protein 792 1706 gene locus_tag LOCUS_13730 792 1706 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189262.1 protein_id gnl|my_center|LOCUS_13730 1709 2821 gene locus_tag LOCUS_13740 1709 2821 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921425.1 protein_id gnl|my_center|LOCUS_13740 3556 3158 gene locus_tag LOCUS_13750 3556 3158 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_13750 4633 3560 gene locus_tag LOCUS_13760 4633 3560 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 protein_id gnl|my_center|LOCUS_13760 5060 4638 gene locus_tag LOCUS_13770 5060 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 5290 9159 gene locus_tag LOCUS_13780 5290 9159 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535491.1 protein_id gnl|my_center|LOCUS_13780 9226 10833 gene locus_tag LOCUS_13790 gene fimW 9226 10833 CDS product cyclic-di-GMP receptor FimW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113922.1 protein_id gnl|my_center|LOCUS_13790 12182 10914 gene locus_tag LOCUS_13800 gene phoR 12182 10914 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_13800 12949 12260 gene locus_tag LOCUS_13810 gene phoB 12949 12260 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_13810 14526 13012 gene locus_tag LOCUS_13820 14526 13012 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence054 405 229 gene locus_tag LOCUS_13830 405 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 989 402 gene locus_tag LOCUS_13840 gene rsxA 989 402 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_13840 1612 986 gene locus_tag LOCUS_13850 1612 986 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_13850 2289 1609 gene locus_tag LOCUS_13860 2289 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 3323 2286 gene locus_tag LOCUS_13870 3323 2286 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_13870 4657 3320 gene locus_tag LOCUS_13880 gene rsxC 4657 3320 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_13880 9572 4659 gene locus_tag LOCUS_13890 9572 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 10456 9581 gene locus_tag LOCUS_13900 10456 9581 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_13900 10684 11631 gene locus_tag LOCUS_13910 10684 11631 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_13910 12468 11659 gene locus_tag LOCUS_13920 12468 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 12877 12506 gene locus_tag LOCUS_13930 12877 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 13681 12905 gene locus_tag LOCUS_13940 13681 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 13798 14745 gene locus_tag LOCUS_13950 13798 14745 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence055 3206 141 gene locus_tag LOCUS_13960 gene mexK 3206 141 CDS product multidrug efflux RND transporter permease subunit MexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_13960 4240 3203 gene locus_tag LOCUS_13970 gene mexJ 4240 3203 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_13970 4917 4369 gene locus_tag LOCUS_13980 4917 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 5205 5813 gene locus_tag LOCUS_13990 5205 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 5815 7311 gene locus_tag LOCUS_14000 5815 7311 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464476.1 protein_id gnl|my_center|LOCUS_14000 7341 8048 gene locus_tag LOCUS_14010 7341 8048 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_14010 8045 8848 gene locus_tag LOCUS_14020 8045 8848 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_14020 8866 9495 gene locus_tag LOCUS_14030 8866 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_14030 9594 10679 gene locus_tag LOCUS_14040 gene hemH 9594 10679 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 protein_id gnl|my_center|LOCUS_14040 11194 10754 gene locus_tag LOCUS_14050 11194 10754 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091672.1 protein_id gnl|my_center|LOCUS_14050 11779 11234 gene locus_tag LOCUS_14060 gene orn 11779 11234 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_14060 11862 13106 gene locus_tag LOCUS_14070 11862 13106 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_14070 13117 13419 gene locus_tag LOCUS_14080 13117 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 13429 13761 gene locus_tag LOCUS_14090 13429 13761 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence056 <1 506 gene locus_tag LOCUS_14100 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203868.1:methionine--tRNA ligase 903 2300 gene locus_tag LOCUS_14110 gene sthA 903 2300 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_14110 4144 2312 gene locus_tag LOCUS_14120 4144 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4734 4222 gene locus_tag LOCUS_14130 4734 4222 CDS product hydrogenase/oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528368.1 protein_id gnl|my_center|LOCUS_14130 6272 4734 gene locus_tag LOCUS_14140 6272 4734 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528369.1 protein_id gnl|my_center|LOCUS_14140 7733 6276 gene locus_tag LOCUS_14150 7733 6276 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_14150 8388 7726 gene locus_tag LOCUS_14160 8388 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_14160 9349 8390 gene locus_tag LOCUS_14170 9349 8390 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_14170 11358 9349 gene locus_tag LOCUS_14180 gene hyfB 11358 9349 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532947.1 protein_id gnl|my_center|LOCUS_14180 <14469 11527 gene locus_tag LOCUS_14190 <14469 11527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813231.1:DNA polymerase III subunit alpha >Feature sequence057 <1 535 gene locus_tag LOCUS_14200 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185539.1:ketol-acid reductoisomerase 726 1469 gene locus_tag LOCUS_14210 gene pssA 726 1469 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 protein_id gnl|my_center|LOCUS_14210 1540 3075 gene locus_tag LOCUS_14220 1540 3075 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 protein_id gnl|my_center|LOCUS_14220 3151 4140 gene locus_tag LOCUS_14230 3151 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5492 4200 gene locus_tag LOCUS_14240 gene pabB 5492 4200 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765730.1 protein_id gnl|my_center|LOCUS_14240 6412 5489 gene locus_tag LOCUS_14250 6412 5489 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_14250 6788 8119 gene locus_tag LOCUS_14260 6788 8119 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 protein_id gnl|my_center|LOCUS_14260 8140 8847 gene locus_tag LOCUS_14270 8140 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 8844 9152 gene locus_tag LOCUS_14280 8844 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 9447 9839 gene locus_tag LOCUS_14290 9447 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 9818 9982 gene locus_tag LOCUS_14300 9818 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 10135 12234 gene locus_tag LOCUS_14310 10135 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 12687 12472 gene locus_tag LOCUS_14320 12687 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 13246 12908 gene locus_tag LOCUS_14330 13246 12908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 13564 13394 gene locus_tag LOCUS_14340 13564 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 14223 13756 gene locus_tag LOCUS_14350 14223 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence058 1073 219 gene locus_tag LOCUS_14360 1073 219 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_14360 1626 1084 gene locus_tag LOCUS_14370 gene ybeY 1626 1084 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037474.1 protein_id gnl|my_center|LOCUS_14370 2934 1639 gene locus_tag LOCUS_14380 gene miaB 2934 1639 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927876.1 protein_id gnl|my_center|LOCUS_14380 6270 3601 gene locus_tag LOCUS_14390 6270 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 6836 7252 gene locus_tag LOCUS_14400 6836 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 7499 7747 gene locus_tag LOCUS_14410 7499 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 7760 8425 gene locus_tag LOCUS_14420 7760 8425 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337790.1 protein_id gnl|my_center|LOCUS_14420 8442 9098 gene locus_tag LOCUS_14430 gene pmrA 8442 9098 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_14430 9100 10422 gene locus_tag LOCUS_14440 9100 10422 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770760.1 protein_id gnl|my_center|LOCUS_14440 11611 10472 gene locus_tag LOCUS_14450 gene alkT 11611 10472 CDS product rubredoxin-NAD(+) reductase AlkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114369.1 protein_id gnl|my_center|LOCUS_14450 11858 11694 gene locus_tag LOCUS_14460 11858 11694 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098329.1 protein_id gnl|my_center|LOCUS_14460 12350 11880 gene locus_tag LOCUS_14470 12350 11880 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143723.1 protein_id gnl|my_center|LOCUS_14470 12482 13390 gene locus_tag LOCUS_14480 12482 13390 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_14480 14157 14069 gene locus_tag LOCUS_t00200 14157 14069 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14238 14165 gene locus_tag LOCUS_t00210 14238 14165 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence059 661 1263 gene locus_tag LOCUS_14490 gene wrbA 661 1263 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 protein_id gnl|my_center|LOCUS_14490 1260 1964 gene locus_tag LOCUS_14500 1260 1964 CDS product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_14500 2060 2275 gene locus_tag LOCUS_14510 gene rpmE 2060 2275 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218070.1 protein_id gnl|my_center|LOCUS_14510 2384 3799 gene locus_tag LOCUS_14520 2384 3799 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_14520 3825 5471 gene locus_tag LOCUS_14530 3825 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196441.1 protein_id gnl|my_center|LOCUS_14530 6040 5552 gene locus_tag LOCUS_14540 6040 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 7178 6081 gene locus_tag LOCUS_14550 gene aroC 7178 6081 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_14550 7239 8024 gene locus_tag LOCUS_14560 7239 8024 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527360.1 protein_id gnl|my_center|LOCUS_14560 8118 8846 gene locus_tag LOCUS_14570 8118 8846 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_14570 9867 8824 gene locus_tag LOCUS_14580 9867 8824 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705236.1 protein_id gnl|my_center|LOCUS_14580 11131 9980 gene locus_tag LOCUS_14590 11131 9980 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972807.1 protein_id gnl|my_center|LOCUS_14590 11441 12691 gene locus_tag LOCUS_14600 gene lamB 11441 12691 CDS product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757932.1 protein_id gnl|my_center|LOCUS_14600 12729 13679 gene locus_tag LOCUS_14610 gene rbsB 12729 13679 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297966.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence060 2 406 gene locus_tag LOCUS_14620 2 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 712 506 gene locus_tag LOCUS_14630 712 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 869 1795 gene locus_tag LOCUS_14640 gene rlmF 869 1795 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092887.1 protein_id gnl|my_center|LOCUS_14640 1861 3708 gene locus_tag LOCUS_14650 1861 3708 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266153.1 protein_id gnl|my_center|LOCUS_14650 3806 4240 gene locus_tag LOCUS_14660 3806 4240 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_14660 4647 4853 gene locus_tag LOCUS_14670 4647 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4882 5202 gene locus_tag LOCUS_14680 4882 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5678 6550 gene locus_tag LOCUS_14690 5678 6550 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_14690 6564 8234 gene locus_tag LOCUS_14700 gene recN 6564 8234 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194023.1 protein_id gnl|my_center|LOCUS_14700 8261 8629 gene locus_tag LOCUS_14710 8261 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 8659 9465 gene locus_tag LOCUS_14720 gene dapB 8659 9465 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_14720 9885 9496 gene locus_tag LOCUS_14730 9885 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 10439 9903 gene locus_tag LOCUS_14740 10439 9903 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_14740 10634 11785 gene locus_tag LOCUS_14750 gene carA 10634 11785 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence061 730 227 gene locus_tag LOCUS_14760 gene rimM 730 227 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690619.1 protein_id gnl|my_center|LOCUS_14760 1004 744 gene locus_tag LOCUS_14770 gene rpsP 1004 744 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687476.1 protein_id gnl|my_center|LOCUS_14770 1044 1217 gene locus_tag LOCUS_14780 1044 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2440 1367 gene locus_tag LOCUS_14790 2440 1367 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038743784.1 protein_id gnl|my_center|LOCUS_14790 4193 2712 gene locus_tag LOCUS_14800 gene pap 4193 2712 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_14800 4817 4203 gene locus_tag LOCUS_14810 gene sixA 4817 4203 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_14810 4898 5350 gene locus_tag LOCUS_14820 4898 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 7482 5404 gene locus_tag LOCUS_14830 gene ppk1 7482 5404 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809633.1 protein_id gnl|my_center|LOCUS_14830 7824 7558 gene locus_tag LOCUS_14840 7824 7558 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214948.1 protein_id gnl|my_center|LOCUS_14840 8714 7896 gene locus_tag LOCUS_14850 8714 7896 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_14850 10806 8935 gene locus_tag LOCUS_14860 gene thiC 10806 8935 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 protein_id gnl|my_center|LOCUS_14860 11157 11819 gene locus_tag LOCUS_14870 11157 11819 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815097.1 protein_id gnl|my_center|LOCUS_14870 11893 13221 gene locus_tag LOCUS_14880 11893 13221 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_14880 13282 13566 gene locus_tag LOCUS_14890 13282 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence062 211 774 gene locus_tag LOCUS_14900 211 774 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_14900 765 1148 gene locus_tag LOCUS_14910 765 1148 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 protein_id gnl|my_center|LOCUS_14910 1294 1950 gene locus_tag LOCUS_14920 1294 1950 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_14920 1964 2893 gene locus_tag LOCUS_14930 gene ylqF 1964 2893 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_14930 2890 3750 gene locus_tag LOCUS_14940 2890 3750 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_14940 3751 4893 gene locus_tag LOCUS_14950 3751 4893 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_14950 5883 4990 gene locus_tag LOCUS_14960 5883 4990 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_14960 6228 8939 gene locus_tag LOCUS_14970 gene leuS 6228 8939 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_14970 8950 9468 gene locus_tag LOCUS_14980 8950 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115142.1 protein_id gnl|my_center|LOCUS_14980 9468 10472 gene locus_tag LOCUS_14990 gene holA 9468 10472 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_14990 10469 10798 gene locus_tag LOCUS_15000 10469 10798 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806936.1 protein_id gnl|my_center|LOCUS_15000 10801 12627 gene locus_tag LOCUS_15010 gene dsbD 10801 12627 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_15010 12797 13129 gene locus_tag LOCUS_15020 12797 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 13144 13602 gene locus_tag LOCUS_15030 gene accB 13144 13602 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence063 2 961 gene locus_tag LOCUS_15040 2 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 965 1819 gene locus_tag LOCUS_15050 965 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1858 3222 gene locus_tag LOCUS_15060 gene nrfD 1858 3222 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_15060 3225 3755 gene locus_tag LOCUS_15070 3225 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3752 4366 gene locus_tag LOCUS_15080 3752 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4379 5392 gene locus_tag LOCUS_15090 4379 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 5472 5996 gene locus_tag LOCUS_15100 5472 5996 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_15100 5993 6385 gene locus_tag LOCUS_15110 5993 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7482 6622 gene locus_tag LOCUS_15120 gene rpoH 7482 6622 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522872.1 protein_id gnl|my_center|LOCUS_15120 7856 7677 gene locus_tag LOCUS_15130 7856 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 8884 7979 gene locus_tag LOCUS_15140 gene ftsX 8884 7979 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084508.1 protein_id gnl|my_center|LOCUS_15140 9621 8881 gene locus_tag LOCUS_15150 gene ftsE 9621 8881 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_15150 10589 9618 gene locus_tag LOCUS_15160 10589 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 10695 12053 gene locus_tag LOCUS_15170 10695 12053 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_15170 12043 13371 gene locus_tag LOCUS_15180 12043 13371 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence064 1049 465 gene locus_tag LOCUS_15190 gene sodB 1049 465 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 protein_id gnl|my_center|LOCUS_15190 1477 1154 gene locus_tag LOCUS_15200 1477 1154 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205776.1 protein_id gnl|my_center|LOCUS_15200 1817 2143 gene locus_tag LOCUS_15210 gene trxA 1817 2143 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_15210 2277 3533 gene locus_tag LOCUS_15220 gene rho 2277 3533 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_15220 3634 3945 gene locus_tag LOCUS_15230 gene rplU 3634 3945 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_15230 3969 4226 gene locus_tag LOCUS_15240 gene rpmA 3969 4226 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689821.1 protein_id gnl|my_center|LOCUS_15240 4350 5414 gene locus_tag LOCUS_15250 gene obgE 4350 5414 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_15250 5463 6581 gene locus_tag LOCUS_15260 gene proB 5463 6581 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_15260 7356 6904 gene locus_tag LOCUS_15270 7356 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 8552 7392 gene locus_tag LOCUS_15280 8552 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 10419 8575 gene locus_tag LOCUS_15290 10419 8575 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_15290 11999 10473 gene locus_tag LOCUS_15300 11999 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 <13503 12441 gene locus_tag LOCUS_15310 <13503 12441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807044.1:cardiolipin synthase ClsB >Feature sequence065 1606 311 gene locus_tag LOCUS_15320 gene hemL 1606 311 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_15320 2262 1636 gene locus_tag LOCUS_15330 gene thiE 2262 1636 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_15330 3073 2234 gene locus_tag LOCUS_15340 3073 2234 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_15340 3874 3176 gene locus_tag LOCUS_15350 3874 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5217 3943 gene locus_tag LOCUS_15360 5217 3943 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_15360 6170 5214 gene locus_tag LOCUS_15370 6170 5214 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_15370 6720 6148 gene locus_tag LOCUS_15380 6720 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 7273 6713 gene locus_tag LOCUS_15390 7273 6713 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_15390 8524 7388 gene locus_tag LOCUS_15400 8524 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 10267 8630 gene locus_tag LOCUS_15410 10267 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 10693 10286 gene locus_tag LOCUS_15420 10693 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 13123 10874 gene locus_tag LOCUS_15430 13123 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence066 1002 199 gene locus_tag LOCUS_15440 1002 199 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_15440 2352 1006 gene locus_tag LOCUS_15450 2352 1006 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_15450 3628 2426 gene locus_tag LOCUS_15460 3628 2426 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_15460 4278 3631 gene locus_tag LOCUS_15470 4278 3631 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_15470 4924 4283 gene locus_tag LOCUS_15480 4924 4283 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077250.1 protein_id gnl|my_center|LOCUS_15480 6333 5449 gene locus_tag LOCUS_15490 6333 5449 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193008.1 protein_id gnl|my_center|LOCUS_15490 6642 6337 gene locus_tag LOCUS_15500 6642 6337 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705345.1 protein_id gnl|my_center|LOCUS_15500 7076 6639 gene locus_tag LOCUS_15510 7076 6639 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_15510 7140 7589 gene locus_tag LOCUS_15520 gene smpB 7140 7589 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_15520 7857 8474 gene locus_tag LOCUS_15530 gene msrA 7857 8474 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400942.1 protein_id gnl|my_center|LOCUS_15530 9359 8754 gene locus_tag LOCUS_15540 9359 8754 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545946.1 protein_id gnl|my_center|LOCUS_15540 10160 9420 gene locus_tag LOCUS_15550 10160 9420 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545035.1 protein_id gnl|my_center|LOCUS_15550 10355 10639 gene locus_tag LOCUS_15560 10355 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 12337 10523 gene locus_tag LOCUS_15570 gene typA 12337 10523 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688609.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence067 3449 2289 gene locus_tag LOCUS_15580 gene ftsZ 3449 2289 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_15580 4738 3503 gene locus_tag LOCUS_15590 gene ftsA 4738 3503 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_15590 5525 4794 gene locus_tag LOCUS_15600 5525 4794 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_15600 6474 5515 gene locus_tag LOCUS_15610 6474 5515 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194254.1 protein_id gnl|my_center|LOCUS_15610 7448 6471 gene locus_tag LOCUS_15620 gene murB 7448 6471 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_15620 8839 7445 gene locus_tag LOCUS_15630 gene murC 8839 7445 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_15630 9900 8836 gene locus_tag LOCUS_15640 gene murG 9900 8836 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_15640 11200 10037 gene locus_tag LOCUS_15650 gene ftsW 11200 10037 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_15650 12519 11188 gene locus_tag LOCUS_15660 gene murD 12519 11188 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705695.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence068 <1 1941 gene locus_tag LOCUS_15670 <1 1941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463958.1:bifunctional diguanylate cyclase/phosphodiesterase 2211 2062 gene locus_tag LOCUS_15680 2211 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3115 2321 gene locus_tag LOCUS_15690 3115 2321 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096744.1 protein_id gnl|my_center|LOCUS_15690 3973 3191 gene locus_tag LOCUS_15700 3973 3191 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_15700 4653 3973 gene locus_tag LOCUS_15710 4653 3973 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_15710 5232 4702 gene locus_tag LOCUS_15720 gene gmhB 5232 4702 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_15720 7340 5229 gene locus_tag LOCUS_15730 gene glyS 7340 5229 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_15730 8335 7337 gene locus_tag LOCUS_15740 gene glyQ 8335 7337 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_15740 8974 8474 gene locus_tag LOCUS_15750 8974 8474 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704513.1 protein_id gnl|my_center|LOCUS_15750 9372 9091 gene locus_tag LOCUS_15760 9372 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 10586 9381 gene locus_tag LOCUS_15770 10586 9381 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819957.1 protein_id gnl|my_center|LOCUS_15770 11507 10662 gene locus_tag LOCUS_15780 11507 10662 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929219.1 protein_id gnl|my_center|LOCUS_15780 12205 11504 gene locus_tag LOCUS_15790 gene dnaQ 12205 11504 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064948.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence069 511 747 gene locus_tag LOCUS_15800 511 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 744 1052 gene locus_tag LOCUS_15810 744 1052 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_15810 1179 982 gene locus_tag LOCUS_15820 1179 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2577 1312 gene locus_tag LOCUS_15830 2577 1312 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552069.1 protein_id gnl|my_center|LOCUS_15830 2776 3240 gene locus_tag LOCUS_15840 2776 3240 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_15840 3242 4039 gene locus_tag LOCUS_15850 3242 4039 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_15850 4092 6038 gene locus_tag LOCUS_15860 4092 6038 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695653.1 protein_id gnl|my_center|LOCUS_15860 6882 6166 gene locus_tag LOCUS_15870 6882 6166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064071.1 protein_id gnl|my_center|LOCUS_15870 7642 6875 gene locus_tag LOCUS_15880 7642 6875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064072.1 protein_id gnl|my_center|LOCUS_15880 8733 7639 gene locus_tag LOCUS_15890 8733 7639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812851.1 protein_id gnl|my_center|LOCUS_15890 9656 8733 gene locus_tag LOCUS_15900 9656 8733 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064074.1 protein_id gnl|my_center|LOCUS_15900 10828 9674 gene locus_tag LOCUS_15910 10828 9674 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195843.1 protein_id gnl|my_center|LOCUS_15910 11442 10963 gene locus_tag LOCUS_15920 11442 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 11854 11519 gene locus_tag LOCUS_15930 gene nirM 11854 11519 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence070 <1 3625 gene locus_tag LOCUS_15940 <1 3625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704393.1:response regulator 3622 4770 gene locus_tag LOCUS_15950 3622 4770 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_15950 4767 5144 gene locus_tag LOCUS_15960 4767 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 5141 5635 gene locus_tag LOCUS_15970 5141 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 5632 5961 gene locus_tag LOCUS_15980 5632 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 5958 6815 gene locus_tag LOCUS_15990 5958 6815 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_15990 6878 7306 gene locus_tag LOCUS_16000 6878 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 7347 8099 gene locus_tag LOCUS_16010 7347 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 9667 8192 gene locus_tag LOCUS_16020 gene ppx 9667 8192 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_16020 10380 9667 gene locus_tag LOCUS_16030 gene phoU 10380 9667 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193271.1 protein_id gnl|my_center|LOCUS_16030 11158 10496 gene locus_tag LOCUS_16040 gene rpiA 11158 10496 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence071 1509 55 gene locus_tag LOCUS_16050 gene gatA 1509 55 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_16050 1748 1515 gene locus_tag LOCUS_16060 gene gatC 1748 1515 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_16060 1887 2930 gene locus_tag LOCUS_16070 1887 2930 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_16070 3051 3962 gene locus_tag LOCUS_16080 gene mreC 3051 3962 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_16080 3962 4474 gene locus_tag LOCUS_16090 gene mreD 3962 4474 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815202.1 protein_id gnl|my_center|LOCUS_16090 4471 6396 gene locus_tag LOCUS_16100 gene mrdA 4471 6396 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_16100 6398 7495 gene locus_tag LOCUS_16110 gene rodA 6398 7495 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 protein_id gnl|my_center|LOCUS_16110 7529 8467 gene locus_tag LOCUS_16120 7529 8467 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_16120 8471 8923 gene locus_tag LOCUS_16130 8471 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 9714 8929 gene locus_tag LOCUS_16140 9714 8929 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190175.1 protein_id gnl|my_center|LOCUS_16140 10443 9823 gene locus_tag LOCUS_16150 gene dsbA 10443 9823 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190112.1 protein_id gnl|my_center|LOCUS_16150 11129 10470 gene locus_tag LOCUS_16160 11129 10470 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011215990.1 protein_id gnl|my_center|LOCUS_16160 <11682 11175 gene locus_tag LOCUS_16170 <11682 11175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023853376.1:arginine--tRNA ligase >Feature sequence072 248 1450 gene locus_tag LOCUS_16180 248 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1447 2844 gene locus_tag LOCUS_16190 1447 2844 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880783.1 protein_id gnl|my_center|LOCUS_16190 2869 4008 gene locus_tag LOCUS_16200 gene rffA 2869 4008 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_16200 4005 4880 gene locus_tag LOCUS_16210 4005 4880 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114948346.1 protein_id gnl|my_center|LOCUS_16210 5251 4889 gene locus_tag LOCUS_16220 5251 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 5922 5254 gene locus_tag LOCUS_16230 5922 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 6853 5906 gene locus_tag LOCUS_16240 6853 5906 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_16240 7722 6862 gene locus_tag LOCUS_16250 7722 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 8768 7719 gene locus_tag LOCUS_16260 8768 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 9577 8765 gene locus_tag LOCUS_16270 9577 8765 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 protein_id gnl|my_center|LOCUS_16270 10329 9577 gene locus_tag LOCUS_16280 10329 9577 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_16280 <11588 10322 gene locus_tag LOCUS_16290 <11588 10322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816144.1:outer core oligosaccharide ligase WaaL-os >Feature sequence073 634 843 gene locus_tag LOCUS_16300 634 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2713 1277 gene locus_tag LOCUS_16310 2713 1277 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814201.1 protein_id gnl|my_center|LOCUS_16310 2878 3192 gene locus_tag LOCUS_16320 2878 3192 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 protein_id gnl|my_center|LOCUS_16320 3192 3419 gene locus_tag LOCUS_16330 3192 3419 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_16330 6296 3453 gene locus_tag LOCUS_16340 6296 3453 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_16340 6752 6414 gene locus_tag LOCUS_16350 6752 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 7168 6755 gene locus_tag LOCUS_16360 7168 6755 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193228.1 protein_id gnl|my_center|LOCUS_16360 8659 7175 gene locus_tag LOCUS_16370 gene pepA 8659 7175 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209310.1 protein_id gnl|my_center|LOCUS_16370 8692 9825 gene locus_tag LOCUS_16380 gene lptF 8692 9825 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_16380 9822 10898 gene locus_tag LOCUS_16390 gene lptG 9822 10898 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_16390 <11491 10963 gene locus_tag LOCUS_16400 <11491 10963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191664.1:inositol monophosphatase family protein >Feature sequence074 79 3 gene locus_tag LOCUS_t00220 79 3 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 905 117 gene locus_tag LOCUS_16410 905 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1620 898 gene locus_tag LOCUS_16420 1620 898 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_16420 2588 1617 gene locus_tag LOCUS_16430 gene birA 2588 1617 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_16430 3755 2664 gene locus_tag LOCUS_16440 gene ychF 3755 2664 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_16440 4398 3961 gene locus_tag LOCUS_16450 4398 3961 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331629.1 protein_id gnl|my_center|LOCUS_16450 5003 4428 gene locus_tag LOCUS_16460 gene pth 5003 4428 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_16460 5696 5070 gene locus_tag LOCUS_16470 5696 5070 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039051.1 protein_id gnl|my_center|LOCUS_16470 6740 5790 gene locus_tag LOCUS_16480 6740 5790 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_16480 6866 6792 gene locus_tag LOCUS_t00230 6866 6792 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7701 6877 gene locus_tag LOCUS_16490 gene ispE 7701 6877 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_16490 8303 7698 gene locus_tag LOCUS_16500 gene lolB 8303 7698 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096231.1 protein_id gnl|my_center|LOCUS_16500 10149 8368 gene locus_tag LOCUS_16510 gene lbcA 10149 8368 CDS product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 protein_id gnl|my_center|LOCUS_16510 10197 11219 gene locus_tag LOCUS_16520 10197 11219 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence075 982 446 gene locus_tag LOCUS_16530 982 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1085 1396 gene locus_tag LOCUS_16540 1085 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1870 1421 gene locus_tag LOCUS_16550 1870 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16550 2162 2314 gene locus_tag LOCUS_16560 2162 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16560 2382 2678 gene locus_tag LOCUS_16570 2382 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 4202 2856 gene locus_tag LOCUS_16580 4202 2856 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814738.1 protein_id gnl|my_center|LOCUS_16580 6363 4396 gene locus_tag LOCUS_16590 gene acs 6363 4396 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926941.1 protein_id gnl|my_center|LOCUS_16590 6836 8494 gene locus_tag LOCUS_16600 6836 8494 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192790.1 protein_id gnl|my_center|LOCUS_16600 8491 9342 gene locus_tag LOCUS_16610 gene kdsA 8491 9342 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 protein_id gnl|my_center|LOCUS_16610 9395 10678 gene locus_tag LOCUS_16620 gene eno 9395 10678 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065136.1 protein_id gnl|my_center|LOCUS_16620 10789 11106 gene locus_tag LOCUS_16630 10789 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence076 396 187 gene locus_tag LOCUS_16640 396 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 813 604 gene locus_tag LOCUS_16650 813 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1377 1009 gene locus_tag LOCUS_16660 1377 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2234 1623 gene locus_tag LOCUS_16670 2234 1623 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_16670 2727 2200 gene locus_tag LOCUS_16680 gene mobB 2727 2200 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812685.1 protein_id gnl|my_center|LOCUS_16680 3131 2706 gene locus_tag LOCUS_16690 3131 2706 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867291.1 protein_id gnl|my_center|LOCUS_16690 3372 3133 gene locus_tag LOCUS_16700 3372 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 3872 3369 gene locus_tag LOCUS_16710 gene moaC 3872 3369 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_16710 5006 3903 gene locus_tag LOCUS_16720 gene moaA 5006 3903 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_16720 6375 5065 gene locus_tag LOCUS_16730 6375 5065 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852902.1 protein_id gnl|my_center|LOCUS_16730 7554 6403 gene locus_tag LOCUS_16740 7554 6403 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_16740 7739 7554 gene locus_tag LOCUS_16750 7739 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 8617 7739 gene locus_tag LOCUS_16760 gene hflC 8617 7739 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_16760 9816 8614 gene locus_tag LOCUS_16770 gene hflK 9816 8614 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_16770 10955 9807 gene locus_tag LOCUS_16780 gene hflX 10955 9807 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence077 347 1540 gene locus_tag LOCUS_16790 gene hemW 347 1540 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_16790 1883 1551 gene locus_tag LOCUS_16800 1883 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2776 2012 gene locus_tag LOCUS_16810 gene trmB 2776 2012 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222361.1 protein_id gnl|my_center|LOCUS_16810 3576 2782 gene locus_tag LOCUS_16820 3576 2782 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446412.1 protein_id gnl|my_center|LOCUS_16820 3789 3649 gene locus_tag LOCUS_16830 3789 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3895 3968 gene locus_tag LOCUS_t00240 3895 3968 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6612 4051 gene locus_tag LOCUS_16840 6612 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 8011 6806 gene locus_tag LOCUS_16850 8011 6806 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_16850 8560 8766 gene locus_tag LOCUS_16860 8560 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 8802 10103 gene locus_tag LOCUS_16870 8802 10103 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence078 3160 542 gene locus_tag LOCUS_16880 gene cphA 3160 542 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_16880 5331 3160 gene locus_tag LOCUS_16890 gene cphA 5331 3160 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_16890 5601 7883 gene locus_tag LOCUS_16900 5601 7883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_16900 7880 8341 gene locus_tag LOCUS_16910 7880 8341 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_16910 9595 8849 gene locus_tag LOCUS_16920 9595 8849 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_16920 9803 10606 gene locus_tag LOCUS_16930 9803 10606 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706380.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence079 429 43 gene locus_tag LOCUS_16940 429 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 747 1805 gene locus_tag LOCUS_16950 747 1805 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_16950 1802 2491 gene locus_tag LOCUS_16960 gene hda 1802 2491 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_16960 2488 3150 gene locus_tag LOCUS_16970 2488 3150 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_16970 3152 3379 gene locus_tag LOCUS_16980 3152 3379 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_16980 4041 3457 gene locus_tag LOCUS_16990 4041 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 4306 4515 gene locus_tag LOCUS_17000 4306 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 5123 4695 gene locus_tag LOCUS_17010 5123 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 6871 5291 gene locus_tag LOCUS_17020 6871 5291 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036716.1 protein_id gnl|my_center|LOCUS_17020 8595 6943 gene locus_tag LOCUS_17030 gene sulP 8595 6943 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_17030 8906 8703 gene locus_tag LOCUS_17040 8906 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 9101 9772 gene locus_tag LOCUS_17050 9101 9772 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence080 134 619 gene locus_tag LOCUS_17060 134 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 637 1251 gene locus_tag LOCUS_17070 637 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1251 2105 gene locus_tag LOCUS_17080 1251 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2416 2754 gene locus_tag LOCUS_17090 2416 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2770 3213 gene locus_tag LOCUS_17100 2770 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3238 3588 gene locus_tag LOCUS_17110 3238 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3624 3968 gene locus_tag LOCUS_17120 3624 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 4038 5048 gene locus_tag LOCUS_17130 4038 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 5048 6391 gene locus_tag LOCUS_17140 5048 6391 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_17140 6480 7223 gene locus_tag LOCUS_17150 gene phbB 6480 7223 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813586.1 protein_id gnl|my_center|LOCUS_17150 8469 7294 gene locus_tag LOCUS_17160 8469 7294 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_17160 8747 9487 gene locus_tag LOCUS_17170 8747 9487 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525015.1 protein_id gnl|my_center|LOCUS_17170 <10818 9563 gene locus_tag LOCUS_17180 <10818 9563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001061938.1:outer membrane protein transport protein >Feature sequence081 465 1541 gene locus_tag LOCUS_17190 465 1541 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200089.1 protein_id gnl|my_center|LOCUS_17190 1641 1565 gene locus_tag LOCUS_t00250 1641 1565 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1811 1719 gene locus_tag LOCUS_t00260 1811 1719 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2073 3494 gene locus_tag LOCUS_17200 gene dbpA 2073 3494 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203996.1 protein_id gnl|my_center|LOCUS_17200 4083 3793 gene locus_tag LOCUS_17210 gene minE 4083 3793 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215465.1 protein_id gnl|my_center|LOCUS_17210 4897 4085 gene locus_tag LOCUS_17220 gene minD 4897 4085 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814250.1 protein_id gnl|my_center|LOCUS_17220 5824 4967 gene locus_tag LOCUS_17230 gene minC 5824 4967 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114802.1 protein_id gnl|my_center|LOCUS_17230 6000 6158 gene locus_tag LOCUS_17240 6000 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 6257 7051 gene locus_tag LOCUS_17250 6257 7051 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_17250 7122 8312 gene locus_tag LOCUS_17260 7122 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 10370 8583 gene locus_tag LOCUS_17270 10370 8583 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919291.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence082 709 2679 gene locus_tag LOCUS_17280 709 2679 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522854.1 protein_id gnl|my_center|LOCUS_17280 3198 2716 gene locus_tag LOCUS_17290 3198 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 4219 3200 gene locus_tag LOCUS_17300 gene mutY 4219 3200 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927127.1 protein_id gnl|my_center|LOCUS_17300 4445 5446 gene locus_tag LOCUS_17310 4445 5446 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_17310 6084 5482 gene locus_tag LOCUS_17320 6084 5482 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_17320 7521 6124 gene locus_tag LOCUS_17330 gene hemN 7521 6124 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216474.1 protein_id gnl|my_center|LOCUS_17330 7771 8547 gene locus_tag LOCUS_17340 gene fnr 7771 8547 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358997.1 protein_id gnl|my_center|LOCUS_17340 8629 9132 gene locus_tag LOCUS_17350 8629 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 9139 9810 gene locus_tag LOCUS_17360 9139 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 10034 9849 gene locus_tag LOCUS_17370 10034 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence083 <1 1171 gene locus_tag LOCUS_17380 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786535.1:sulfate adenylyltransferase subunit CysN 1605 2282 gene locus_tag LOCUS_17390 1605 2282 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085635.1 protein_id gnl|my_center|LOCUS_17390 2279 3172 gene locus_tag LOCUS_17400 gene prpB 2279 3172 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103044.1 protein_id gnl|my_center|LOCUS_17400 3199 4347 gene locus_tag LOCUS_17410 gene prpC 3199 4347 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187967.1 protein_id gnl|my_center|LOCUS_17410 4473 7079 gene locus_tag LOCUS_17420 gene acnD 4473 7079 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477783.1 protein_id gnl|my_center|LOCUS_17420 7079 8257 gene locus_tag LOCUS_17430 gene prpF 7079 8257 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114192.1 protein_id gnl|my_center|LOCUS_17430 8369 10258 gene locus_tag LOCUS_17440 8369 10258 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477696.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence084 130 471 gene locus_tag LOCUS_17450 130 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 517 984 gene locus_tag LOCUS_17460 517 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1653 1417 gene locus_tag LOCUS_17470 1653 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2494 2090 gene locus_tag LOCUS_17480 2494 2090 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_17480 3134 2481 gene locus_tag LOCUS_17490 3134 2481 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 protein_id gnl|my_center|LOCUS_17490 5594 3195 gene locus_tag LOCUS_17500 5594 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 6459 5971 gene locus_tag LOCUS_17510 6459 5971 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038706.1 protein_id gnl|my_center|LOCUS_17510 7055 6786 gene locus_tag LOCUS_17520 7055 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 8006 8980 gene locus_tag LOCUS_17530 8006 8980 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_17530 8973 9989 gene locus_tag LOCUS_17540 8973 9989 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence085 398 1735 gene locus_tag LOCUS_17550 gene chrA 398 1735 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206681.1 protein_id gnl|my_center|LOCUS_17550 2347 1970 gene locus_tag LOCUS_17560 2347 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3183 2602 gene locus_tag LOCUS_17570 3183 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4841 3372 gene locus_tag LOCUS_17580 4841 3372 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_17580 5091 6509 gene locus_tag LOCUS_17590 5091 6509 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 protein_id gnl|my_center|LOCUS_17590 6511 7458 gene locus_tag LOCUS_17600 6511 7458 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 protein_id gnl|my_center|LOCUS_17600 7536 8261 gene locus_tag LOCUS_17610 7536 8261 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence086 1372 1462 gene locus_tag LOCUS_t00270 1372 1462 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2379 3809 gene locus_tag LOCUS_17620 gene ccoN 2379 3809 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_17620 3823 4620 gene locus_tag LOCUS_17630 gene ccoO 3823 4620 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_17630 4613 4825 gene locus_tag LOCUS_17640 4613 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 4822 5847 gene locus_tag LOCUS_17650 gene ccoP 4822 5847 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085551.1 protein_id gnl|my_center|LOCUS_17650 6208 7641 gene locus_tag LOCUS_17660 gene ccoG 6208 7641 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895670.1 protein_id gnl|my_center|LOCUS_17660 7667 8221 gene locus_tag LOCUS_17670 7667 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence087 631 1641 gene locus_tag LOCUS_17680 gene hemB 631 1641 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 protein_id gnl|my_center|LOCUS_17680 2521 1922 gene locus_tag LOCUS_17690 2521 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194356.1 protein_id gnl|my_center|LOCUS_17690 4827 2521 gene locus_tag LOCUS_17700 4827 2521 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_17700 4980 6080 gene locus_tag LOCUS_17710 4980 6080 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_17710 6077 6667 gene locus_tag LOCUS_17720 6077 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 6664 7293 gene locus_tag LOCUS_17730 gene pilO 6664 7293 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_17730 7290 7802 gene locus_tag LOCUS_17740 7290 7802 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214522.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence088 1925 2626 gene locus_tag LOCUS_17750 1925 2626 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266992.1 protein_id gnl|my_center|LOCUS_17750 3772 2648 gene locus_tag LOCUS_17760 gene zapE 3772 2648 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220874.1 protein_id gnl|my_center|LOCUS_17760 4051 4419 gene locus_tag LOCUS_17770 4051 4419 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552611.1 protein_id gnl|my_center|LOCUS_17770 4437 4736 gene locus_tag LOCUS_17780 4437 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 4726 7878 gene locus_tag LOCUS_17790 4726 7878 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence089 922 3255 gene locus_tag LOCUS_17800 922 3255 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 protein_id gnl|my_center|LOCUS_17800 3270 4592 gene locus_tag LOCUS_17810 3270 4592 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_17810 4593 5621 gene locus_tag LOCUS_17820 gene pdxA 4593 5621 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103187.1 protein_id gnl|my_center|LOCUS_17820 5667 6458 gene locus_tag LOCUS_17830 gene rsmA 5667 6458 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225484.1 protein_id gnl|my_center|LOCUS_17830 6617 8644 gene locus_tag LOCUS_17840 6617 8644 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550186.1 protein_id gnl|my_center|LOCUS_17840 8725 8967 gene locus_tag LOCUS_17850 8725 8967 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_17850 8968 9372 gene locus_tag LOCUS_17860 8968 9372 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence090 <1 657 gene locus_tag LOCUS_17870 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104755.1:ABC transporter ATP-binding protein 654 1427 gene locus_tag LOCUS_17880 654 1427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_17880 1823 1473 gene locus_tag LOCUS_17890 gene arsC 1823 1473 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815819.1 protein_id gnl|my_center|LOCUS_17890 3761 1881 gene locus_tag LOCUS_17900 3761 1881 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191791.1 protein_id gnl|my_center|LOCUS_17900 4481 3789 gene locus_tag LOCUS_17910 gene kdpE 4481 3789 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_17910 5986 4478 gene locus_tag LOCUS_17920 5986 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 7147 6152 gene locus_tag LOCUS_17930 7147 6152 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_17930 7670 7257 gene locus_tag LOCUS_17940 7670 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 8260 7793 gene locus_tag LOCUS_17950 gene secB 8260 7793 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_17950 8532 8275 gene locus_tag LOCUS_17960 gene grxC 8532 8275 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_17960 8948 8532 gene locus_tag LOCUS_17970 8948 8532 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307875.1 protein_id gnl|my_center|LOCUS_17970 9387 8923 gene locus_tag LOCUS_17980 9387 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence091 1248 82 gene locus_tag LOCUS_17990 1248 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2596 1301 gene locus_tag LOCUS_18000 2596 1301 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270475.1 protein_id gnl|my_center|LOCUS_18000 5738 2964 gene locus_tag LOCUS_18010 gene ppc 5738 2964 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_18010 5818 6771 gene locus_tag LOCUS_18020 gene hemC 5818 6771 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217854.1 protein_id gnl|my_center|LOCUS_18020 6854 7645 gene locus_tag LOCUS_18030 6854 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 7642 8748 gene locus_tag LOCUS_18040 7642 8748 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704440.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence092 232 942 gene locus_tag LOCUS_18050 232 942 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_18050 927 1159 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatcaatcgactctgaccctat 3596 1272 gene locus_tag LOCUS_18060 3596 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 4885 3593 gene locus_tag LOCUS_18070 4885 3593 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009982187.1 protein_id gnl|my_center|LOCUS_18070 5673 4882 gene locus_tag LOCUS_18080 5673 4882 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943179.1 protein_id gnl|my_center|LOCUS_18080 7857 5761 gene locus_tag LOCUS_18090 7857 5761 CDS product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103884.1 protein_id gnl|my_center|LOCUS_18090 8036 8839 gene locus_tag LOCUS_18100 8036 8839 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106098.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence093 <1 516 gene locus_tag LOCUS_18110 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522466.1:formate-dependent phosphoribosylglycinamide formyltransferase 547 1056 gene locus_tag LOCUS_18120 547 1056 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_18120 1179 1538 gene locus_tag LOCUS_18130 1179 1538 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_18130 2576 1542 gene locus_tag LOCUS_18140 gene mnmH 2576 1542 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_18140 2591 3640 gene locus_tag LOCUS_18150 gene selD 2591 3640 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_18150 4153 3797 gene locus_tag LOCUS_18160 4153 3797 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_18160 4411 5250 gene locus_tag LOCUS_18170 gene rlmJ 4411 5250 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538077.1 protein_id gnl|my_center|LOCUS_18170 5294 7420 gene locus_tag LOCUS_18180 5294 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence094 1766 843 gene locus_tag LOCUS_18190 1766 843 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_18190 2223 3260 gene locus_tag LOCUS_18200 2223 3260 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192786.1 protein_id gnl|my_center|LOCUS_18200 3306 3446 gene locus_tag LOCUS_18210 3306 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 3443 3727 gene locus_tag LOCUS_18220 3443 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 4407 3769 gene locus_tag LOCUS_18230 4407 3769 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070938.1 protein_id gnl|my_center|LOCUS_18230 7682 4572 gene locus_tag LOCUS_18240 7682 4572 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_18240 8977 7826 gene locus_tag LOCUS_18250 8977 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence095 70 537 gene locus_tag LOCUS_18260 gene nusB 70 537 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185707.1 protein_id gnl|my_center|LOCUS_18260 592 1527 gene locus_tag LOCUS_18270 gene thiL 592 1527 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 protein_id gnl|my_center|LOCUS_18270 1511 2014 gene locus_tag LOCUS_18280 1511 2014 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_18280 2117 3034 gene locus_tag LOCUS_18290 2117 3034 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090741.1 protein_id gnl|my_center|LOCUS_18290 4024 3242 gene locus_tag LOCUS_18300 gene lpxH 4024 3242 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706567.1 protein_id gnl|my_center|LOCUS_18300 4619 4035 gene locus_tag LOCUS_18310 4619 4035 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_18310 5785 4619 gene locus_tag LOCUS_18320 5785 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 6347 5787 gene locus_tag LOCUS_18330 6347 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 7494 6388 gene locus_tag LOCUS_18340 7494 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence096 <1 1294 gene locus_tag LOCUS_18350 <1 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809588.1:carbamoyl-phosphate synthase large subunit 1381 1857 gene locus_tag LOCUS_18360 gene greA 1381 1857 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_18360 2288 1938 gene locus_tag LOCUS_18370 2288 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2327 2947 gene locus_tag LOCUS_18380 2327 2947 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213963.1 protein_id gnl|my_center|LOCUS_18380 3010 4911 gene locus_tag LOCUS_18390 gene ftsH 3010 4911 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_18390 4998 5819 gene locus_tag LOCUS_18400 gene folP 4998 5819 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_18400 5816 7171 gene locus_tag LOCUS_18410 gene glmM 5816 7171 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_18410 <8977 7246 gene locus_tag LOCUS_18420 <8977 7246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196461.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence097 98 829 gene locus_tag LOCUS_18430 gene tatC 98 829 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199900.1 protein_id gnl|my_center|LOCUS_18430 843 2120 gene locus_tag LOCUS_18440 843 2120 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186398.1 protein_id gnl|my_center|LOCUS_18440 2504 2208 gene locus_tag LOCUS_18450 2504 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3025 5646 gene locus_tag LOCUS_18460 3025 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 6915 5770 gene locus_tag LOCUS_18470 6915 5770 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_18470 6954 7700 gene locus_tag LOCUS_18480 6954 7700 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202811.1 protein_id gnl|my_center|LOCUS_18480 8349 7720 gene locus_tag LOCUS_18490 8349 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence098 <1 1038 gene locus_tag LOCUS_18500 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186903.1:energy-dependent translational throttle protein EttA 1202 2071 gene locus_tag LOCUS_18510 1202 2071 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_18510 2114 3352 gene locus_tag LOCUS_18520 2114 3352 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 protein_id gnl|my_center|LOCUS_18520 3733 5199 gene locus_tag LOCUS_18530 3733 5199 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207211.1 protein_id gnl|my_center|LOCUS_18530 5505 5227 gene locus_tag LOCUS_18540 5505 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 5649 7208 gene locus_tag LOCUS_18550 gene mnmC 5649 7208 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence099 1961 543 gene locus_tag LOCUS_18560 1961 543 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_18560 2266 2676 gene locus_tag LOCUS_18570 gene hemJ 2266 2676 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_18570 2685 3830 gene locus_tag LOCUS_18580 2685 3830 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 protein_id gnl|my_center|LOCUS_18580 <8416 4494 gene locus_tag LOCUS_18590 <8416 4494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933286.1:very short patch repair endonuclease >Feature sequence100 1640 519 gene locus_tag LOCUS_18600 1640 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1865 2290 gene locus_tag LOCUS_18610 gene norC 1865 2290 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_18610 2332 3711 gene locus_tag LOCUS_18620 gene norB 2332 3711 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_18620 3778 4395 gene locus_tag LOCUS_18630 3778 4395 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_18630 4402 4668 gene locus_tag LOCUS_18640 4402 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 4703 5503 gene locus_tag LOCUS_18650 gene nirQ 4703 5503 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_18650 5525 6490 gene locus_tag LOCUS_18660 5525 6490 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870255.1 protein_id gnl|my_center|LOCUS_18660 6491 8311 gene locus_tag LOCUS_18670 6491 8311 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence101 53 1408 gene locus_tag LOCUS_18680 gene accC 53 1408 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_18680 1408 2301 gene locus_tag LOCUS_18690 gene prmA 1408 2301 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950979.1 protein_id gnl|my_center|LOCUS_18690 2311 3177 gene locus_tag LOCUS_18700 2311 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4532 3195 gene locus_tag LOCUS_18710 gene yegQ 4532 3195 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_18710 5924 4860 gene locus_tag LOCUS_18720 gene fba 5924 4860 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687252.1 protein_id gnl|my_center|LOCUS_18720 7409 5961 gene locus_tag LOCUS_18730 gene pyk 7409 5961 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_18730 <8175 7503 gene locus_tag LOCUS_18740 <8175 7503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704731.1:phosphoglycerate kinase >Feature sequence102 2200 827 gene locus_tag LOCUS_18750 2200 827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810154.1 protein_id gnl|my_center|LOCUS_18750 3174 2197 gene locus_tag LOCUS_18760 3174 2197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 protein_id gnl|my_center|LOCUS_18760 3682 3248 gene locus_tag LOCUS_18770 3682 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4341 3682 gene locus_tag LOCUS_18780 4341 3682 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086281.1 protein_id gnl|my_center|LOCUS_18780 4714 4352 gene locus_tag LOCUS_18790 4714 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 <8107 4727 gene locus_tag LOCUS_18800 <8107 4727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205406.1:YjbH domain-containing protein >Feature sequence103 1837 839 gene locus_tag LOCUS_18810 gene gap 1837 839 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_18810 3957 1942 gene locus_tag LOCUS_18820 gene tkt 3957 1942 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703436.1 protein_id gnl|my_center|LOCUS_18820 4931 4287 gene locus_tag LOCUS_18830 gene esaR 4931 4287 CDS product response regulator transcription factor EsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935896.1 protein_id gnl|my_center|LOCUS_18830 7054 4928 gene locus_tag LOCUS_18840 7054 4928 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_18840 7658 7062 gene locus_tag LOCUS_18850 7658 7062 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence104 965 525 gene locus_tag LOCUS_18860 gene nrdR 965 525 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_18860 2336 1089 gene locus_tag LOCUS_18870 2336 1089 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225269.1 protein_id gnl|my_center|LOCUS_18870 3278 2478 gene locus_tag LOCUS_18880 3278 2478 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144308590.1 protein_id gnl|my_center|LOCUS_18880 5085 3358 gene locus_tag LOCUS_18890 gene lpdA 5085 3358 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192702.1 protein_id gnl|my_center|LOCUS_18890 6617 5328 gene locus_tag LOCUS_18900 6617 5328 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_18900 6677 7504 gene locus_tag LOCUS_18910 gene trpC 6677 7504 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 protein_id gnl|my_center|LOCUS_18910 7530 7676 gene locus_tag LOCUS_18920 7530 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence105 1838 498 gene locus_tag LOCUS_18930 1838 498 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209167.1 protein_id gnl|my_center|LOCUS_18930 4369 1856 gene locus_tag LOCUS_18940 4369 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 6680 4566 gene locus_tag LOCUS_18950 6680 4566 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073633.1 protein_id gnl|my_center|LOCUS_18950 6830 7816 gene locus_tag LOCUS_18960 6830 7816 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence106 231 2045 gene locus_tag LOCUS_18970 231 2045 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110093.1 protein_id gnl|my_center|LOCUS_18970 2768 2358 gene locus_tag LOCUS_18980 2768 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 4178 3012 gene locus_tag LOCUS_18990 4178 3012 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814929.1 protein_id gnl|my_center|LOCUS_18990 7171 4331 gene locus_tag LOCUS_19000 7171 4331 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194230.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence107 221 2662 gene locus_tag LOCUS_19010 221 2662 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_19010 3500 2850 gene locus_tag LOCUS_19020 3500 2850 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070918.1 protein_id gnl|my_center|LOCUS_19020 5422 3554 gene locus_tag LOCUS_19030 5422 3554 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388687.1 protein_id gnl|my_center|LOCUS_19030 5771 7297 gene locus_tag LOCUS_19040 5771 7297 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_19040 7368 7727 gene locus_tag LOCUS_19050 7368 7727 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence108 <1 510 gene locus_tag LOCUS_19060 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812701.1:YihY family inner membrane protein 575 1378 gene locus_tag LOCUS_19070 575 1378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_19070 1383 2171 gene locus_tag LOCUS_19080 gene mlaE 1383 2171 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_19080 2173 2637 gene locus_tag LOCUS_19090 gene mlaD 2173 2637 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_19090 2651 3277 gene locus_tag LOCUS_19100 2651 3277 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815780.1 protein_id gnl|my_center|LOCUS_19100 3274 3552 gene locus_tag LOCUS_19110 3274 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3627 3869 gene locus_tag LOCUS_19120 3627 3869 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_19120 3943 5193 gene locus_tag LOCUS_19130 gene murA 3943 5193 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527889.1 protein_id gnl|my_center|LOCUS_19130 5284 5919 gene locus_tag LOCUS_19140 gene hisG 5284 5919 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_19140 5934 7235 gene locus_tag LOCUS_19150 gene hisD 5934 7235 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185201.1 protein_id gnl|my_center|LOCUS_19150 7298 7382 gene locus_tag LOCUS_t00280 7298 7382 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7443 7516 gene locus_tag LOCUS_t00290 7443 7516 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7528 7602 gene locus_tag LOCUS_t00300 7528 7602 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence109 440 1513 gene locus_tag LOCUS_19160 gene modC 440 1513 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104308.1 protein_id gnl|my_center|LOCUS_19160 1510 1956 gene locus_tag LOCUS_19170 1510 1956 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754241.1 protein_id gnl|my_center|LOCUS_19170 2400 2699 gene locus_tag LOCUS_19180 2400 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2692 3633 gene locus_tag LOCUS_19190 2692 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 4796 4029 gene locus_tag LOCUS_19200 4796 4029 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444218.1 protein_id gnl|my_center|LOCUS_19200 4961 5239 gene locus_tag LOCUS_19210 4961 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 5930 5433 gene locus_tag LOCUS_19220 5930 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 6863 6012 gene locus_tag LOCUS_19230 6863 6012 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_19230 7660 6863 gene locus_tag LOCUS_19240 7660 6863 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence110 68 1840 gene locus_tag LOCUS_19250 68 1840 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_19250 2337 1843 gene locus_tag LOCUS_19260 2337 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 3815 2337 gene locus_tag LOCUS_19270 3815 2337 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_19270 4375 3824 gene locus_tag LOCUS_19280 4375 3824 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_19280 5150 4377 gene locus_tag LOCUS_19290 gene hoxU 5150 4377 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_19290 6945 5137 gene locus_tag LOCUS_19300 gene nuoF 6945 5137 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence111 2195 1329 gene locus_tag LOCUS_19310 gene atpG 2195 1329 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_19310 3750 2209 gene locus_tag LOCUS_19320 gene atpA 3750 2209 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_19320 4313 3780 gene locus_tag LOCUS_19330 4313 3780 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105592.1 protein_id gnl|my_center|LOCUS_19330 4789 4319 gene locus_tag LOCUS_19340 gene atpF 4789 4319 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707912.1 protein_id gnl|my_center|LOCUS_19340 5109 4834 gene locus_tag LOCUS_19350 gene atpE 5109 4834 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195828.1 protein_id gnl|my_center|LOCUS_19350 5982 5173 gene locus_tag LOCUS_19360 gene atpB 5982 5173 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214802.1 protein_id gnl|my_center|LOCUS_19360 6462 5995 gene locus_tag LOCUS_19370 6462 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 7320 6472 gene locus_tag LOCUS_19380 7320 6472 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074337.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence112 1619 630 gene locus_tag LOCUS_19390 1619 630 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_19390 2013 1711 gene locus_tag LOCUS_19400 2013 1711 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265860.1 protein_id gnl|my_center|LOCUS_19400 2100 3638 gene locus_tag LOCUS_19410 gene gpmI 2100 3638 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_19410 3635 4807 gene locus_tag LOCUS_19420 3635 4807 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_19420 4819 6210 gene locus_tag LOCUS_19430 gene cptA 4819 6210 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_19430 6232 6636 gene locus_tag LOCUS_19440 6232 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 6650 7399 gene locus_tag LOCUS_19450 gene moeB 6650 7399 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence113 105 605 gene locus_tag LOCUS_19460 gene rsmD 105 605 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195251.1 protein_id gnl|my_center|LOCUS_19460 602 1099 gene locus_tag LOCUS_19470 gene coaD 602 1099 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_19470 1129 1380 gene locus_tag LOCUS_19480 1129 1380 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 protein_id gnl|my_center|LOCUS_19480 2750 1533 gene locus_tag LOCUS_19490 gene trpB 2750 1533 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 protein_id gnl|my_center|LOCUS_19490 3753 2923 gene locus_tag LOCUS_19500 3753 2923 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227738.1 protein_id gnl|my_center|LOCUS_19500 4303 3890 gene locus_tag LOCUS_19510 4303 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 5300 4470 gene locus_tag LOCUS_19520 gene mutM 5300 4470 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704183.1 protein_id gnl|my_center|LOCUS_19520 6649 5303 gene locus_tag LOCUS_19530 6649 5303 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence114 <1 1884 gene locus_tag LOCUS_19540 <1 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583115.1:ATP-binding protein 1881 2705 gene locus_tag LOCUS_19550 1881 2705 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_19550 2702 4567 gene locus_tag LOCUS_19560 gene walK 2702 4567 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437327.1 protein_id gnl|my_center|LOCUS_19560 4564 6501 gene locus_tag LOCUS_19570 4564 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence115 530 1927 gene locus_tag LOCUS_19580 530 1927 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_19580 1968 2807 gene locus_tag LOCUS_19590 1968 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2967 5732 gene locus_tag LOCUS_19600 2967 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 6751 5729 gene locus_tag LOCUS_19610 6751 5729 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_19610 6960 6658 gene locus_tag LOCUS_19620 6960 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence116 <1 1179 gene locus_tag LOCUS_19630 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225531.1:peptide chain release factor 3 1251 1481 gene locus_tag LOCUS_19640 1251 1481 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182307811.1 protein_id gnl|my_center|LOCUS_19640 1481 1888 gene locus_tag LOCUS_19650 gene vapC 1481 1888 CDS product type II toxin-antitoxin system toxin VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970128.1 protein_id gnl|my_center|LOCUS_19650 1937 2398 gene locus_tag LOCUS_19660 1937 2398 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957577.1 protein_id gnl|my_center|LOCUS_19660 2385 3281 gene locus_tag LOCUS_19670 gene xerD 2385 3281 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203577.1 protein_id gnl|my_center|LOCUS_19670 3423 4376 gene locus_tag LOCUS_19680 3423 4376 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_19680 4414 4803 gene locus_tag LOCUS_19690 4414 4803 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_19690 4832 5290 gene locus_tag LOCUS_19700 4832 5290 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109277682.1 protein_id gnl|my_center|LOCUS_19700 6643 5297 gene locus_tag LOCUS_19710 6643 5297 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927646.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence117 44 754 gene locus_tag LOCUS_19720 44 754 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_19720 819 1499 gene locus_tag LOCUS_19730 gene rpe 819 1499 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739815.1 protein_id gnl|my_center|LOCUS_19730 1505 1690 gene locus_tag LOCUS_19740 1505 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 1699 2397 gene locus_tag LOCUS_19750 1699 2397 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_19750 2465 3952 gene locus_tag LOCUS_19760 gene trpE 2465 3952 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219345.1 protein_id gnl|my_center|LOCUS_19760 3955 5574 gene locus_tag LOCUS_19770 3955 5574 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_19770 5579 6571 gene locus_tag LOCUS_19780 5579 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence118 1977 112 gene locus_tag LOCUS_19790 1977 112 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_19790 2944 1967 gene locus_tag LOCUS_19800 2944 1967 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186499.1 protein_id gnl|my_center|LOCUS_19800 4043 2961 gene locus_tag LOCUS_19810 gene waaC 4043 2961 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_19810 5629 4388 gene locus_tag LOCUS_19820 5629 4388 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389727.1 protein_id gnl|my_center|LOCUS_19820 5840 5613 gene locus_tag LOCUS_19830 5840 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 6592 6047 gene locus_tag LOCUS_19840 gene rfbC 6592 6047 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence119 1164 415 gene locus_tag LOCUS_19850 gene modA 1164 415 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_19850 1424 1230 gene locus_tag LOCUS_19860 1424 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1713 1390 gene locus_tag LOCUS_19870 1713 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3574 2837 gene locus_tag LOCUS_19880 3574 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 4031 3561 gene locus_tag LOCUS_19890 4031 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 5442 4105 gene locus_tag LOCUS_19900 5442 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 5683 6375 gene locus_tag LOCUS_19910 5683 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence120 91 918 gene locus_tag LOCUS_19920 91 918 CDS product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948323.1 protein_id gnl|my_center|LOCUS_19920 925 1497 gene locus_tag LOCUS_19930 925 1497 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188960.1 protein_id gnl|my_center|LOCUS_19930 1521 3035 gene locus_tag LOCUS_19940 gene ubiB 1521 3035 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_19940 3451 3113 gene locus_tag LOCUS_19950 3451 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3831 3589 gene locus_tag LOCUS_19960 3831 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19960 5687 3861 gene locus_tag LOCUS_19970 gene glmS 5687 3861 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035815.1 protein_id gnl|my_center|LOCUS_19970 <6837 5775 gene locus_tag LOCUS_19980 <6837 5775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040718.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence121 3386 474 gene locus_tag LOCUS_19990 3386 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 5557 3383 gene locus_tag LOCUS_20000 5557 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5649 6047 gene locus_tag LOCUS_20010 5649 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence122 95 1267 gene locus_tag LOCUS_20020 95 1267 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 protein_id gnl|my_center|LOCUS_20020 1281 2219 gene locus_tag LOCUS_20030 gene argF 1281 2219 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_20030 2233 2661 gene locus_tag LOCUS_20040 2233 2661 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 protein_id gnl|my_center|LOCUS_20040 2672 3895 gene locus_tag LOCUS_20050 2672 3895 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363593.1 protein_id gnl|my_center|LOCUS_20050 3914 4402 gene locus_tag LOCUS_20060 3914 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4413 4724 gene locus_tag LOCUS_20070 4413 4724 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 protein_id gnl|my_center|LOCUS_20070 4735 5223 gene locus_tag LOCUS_20080 4735 5223 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_20080 5272 5676 gene locus_tag LOCUS_20090 5272 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 5673 6215 gene locus_tag LOCUS_20100 5673 6215 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence123 1811 171 gene locus_tag LOCUS_20110 1811 171 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389163.1 protein_id gnl|my_center|LOCUS_20110 4628 1866 gene locus_tag LOCUS_20120 4628 1866 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389164.1 protein_id gnl|my_center|LOCUS_20120 6052 4625 gene locus_tag LOCUS_20130 6052 4625 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_20130 6492 6049 gene locus_tag LOCUS_20140 6492 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence124 299 1708 gene locus_tag LOCUS_20150 299 1708 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_20150 1733 2686 gene locus_tag LOCUS_20160 gene tal 1733 2686 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351598.1 protein_id gnl|my_center|LOCUS_20160 3635 4258 gene locus_tag LOCUS_20170 3635 4258 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072497.1 protein_id gnl|my_center|LOCUS_20170 4255 4620 gene locus_tag LOCUS_20180 4255 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4617 5996 gene locus_tag LOCUS_20190 4617 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence125 206 1228 gene locus_tag LOCUS_20200 gene tsaD 206 1228 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811013.1 protein_id gnl|my_center|LOCUS_20200 1841 1236 gene locus_tag LOCUS_20210 gene plsY 1841 1236 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_20210 1915 2274 gene locus_tag LOCUS_20220 gene folB 1915 2274 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212199.1 protein_id gnl|my_center|LOCUS_20220 2791 2462 gene locus_tag LOCUS_20230 2791 2462 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_20230 3297 2911 gene locus_tag LOCUS_20240 3297 2911 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053649.1 protein_id gnl|my_center|LOCUS_20240 3595 3290 gene locus_tag LOCUS_20250 3595 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 4042 3863 gene locus_tag LOCUS_20260 4042 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 <6384 4539 gene locus_tag LOCUS_20270 <6384 4539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004540200.1:DNA polymerase I >Feature sequence126 <1 678 gene locus_tag LOCUS_20280 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004713904.1:phosphate ABC transporter ATP-binding protein PstB 1776 973 gene locus_tag LOCUS_20290 1776 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2537 1809 gene locus_tag LOCUS_20300 2537 1809 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970873.1 protein_id gnl|my_center|LOCUS_20300 3580 2561 gene locus_tag LOCUS_20310 3580 2561 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970872.1 protein_id gnl|my_center|LOCUS_20310 4131 3838 gene locus_tag LOCUS_20320 4131 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 4380 5222 gene locus_tag LOCUS_20330 4380 5222 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence127 1099 1815 gene locus_tag LOCUS_20340 1099 1815 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_20340 1859 2194 gene locus_tag LOCUS_20350 1859 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2325 3290 gene locus_tag LOCUS_20360 2325 3290 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_20360 3324 4100 gene locus_tag LOCUS_20370 3324 4100 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064051.1 protein_id gnl|my_center|LOCUS_20370 4170 4664 gene locus_tag LOCUS_20380 4170 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 5079 4648 gene locus_tag LOCUS_20390 5079 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 <6366 5076 gene locus_tag LOCUS_20400 <6366 5076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812546.1:UvrD-helicase domain-containing protein >Feature sequence128 555 160 gene locus_tag LOCUS_20410 555 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 737 1744 gene locus_tag LOCUS_20420 737 1744 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088017.1 protein_id gnl|my_center|LOCUS_20420 1850 2836 gene locus_tag LOCUS_20430 1850 2836 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_20430 2833 3816 gene locus_tag LOCUS_20440 2833 3816 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_20440 3927 4967 gene locus_tag LOCUS_20450 3927 4967 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193921.1 protein_id gnl|my_center|LOCUS_20450 5082 5981 gene locus_tag LOCUS_20460 5082 5981 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191750.1 protein_id gnl|my_center|LOCUS_20460 6250 6325 gene locus_tag LOCUS_t00310 6250 6325 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence129 <1 1276 gene locus_tag LOCUS_20470 <1 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188897.1:3-phosphoshikimate 1-carboxyvinyltransferase 1341 3053 gene locus_tag LOCUS_20480 gene rpsA 1341 3053 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_20480 3069 3356 gene locus_tag LOCUS_20490 3069 3356 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_20490 3456 3722 gene locus_tag LOCUS_20500 3456 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 3842 4999 gene locus_tag LOCUS_20510 gene lapB 3842 4999 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_20510 4996 5697 gene locus_tag LOCUS_20520 gene pyrF 4996 5697 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687835.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence130 466 849 gene locus_tag LOCUS_20530 466 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1335 1589 gene locus_tag LOCUS_20540 1335 1589 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 protein_id gnl|my_center|LOCUS_20540 1586 2011 gene locus_tag LOCUS_20550 1586 2011 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_20550 3450 2188 gene locus_tag LOCUS_20560 3450 2188 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_20560 4433 3672 gene locus_tag LOCUS_20570 gene xth 4433 3672 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 protein_id gnl|my_center|LOCUS_20570 5689 4622 gene locus_tag LOCUS_20580 5689 4622 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence131 <1 1116 gene locus_tag LOCUS_20590 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003688344.1:aspartate kinase 1336 1587 gene locus_tag LOCUS_20600 1336 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1584 2501 gene locus_tag LOCUS_20610 1584 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2498 2974 gene locus_tag LOCUS_20620 2498 2974 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842874.1 protein_id gnl|my_center|LOCUS_20620 3041 4156 gene locus_tag LOCUS_20630 3041 4156 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880596.1 protein_id gnl|my_center|LOCUS_20630 4153 4812 gene locus_tag LOCUS_20640 4153 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 4809 6077 gene locus_tag LOCUS_20650 4809 6077 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880594.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence132 1484 1020 gene locus_tag LOCUS_20660 1484 1020 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776814.1 protein_id gnl|my_center|LOCUS_20660 2095 1490 gene locus_tag LOCUS_20670 2095 1490 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463347.1 protein_id gnl|my_center|LOCUS_20670 3890 2112 gene locus_tag LOCUS_20680 3890 2112 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106635.1 protein_id gnl|my_center|LOCUS_20680 5358 3934 gene locus_tag LOCUS_20690 5358 3934 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812764.1 protein_id gnl|my_center|LOCUS_20690 6020 5355 gene locus_tag LOCUS_20700 6020 5355 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence133 204 566 gene locus_tag LOCUS_20710 204 566 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458809.1 protein_id gnl|my_center|LOCUS_20710 671 2062 gene locus_tag LOCUS_20720 gene purB 671 2062 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_20720 2831 2157 gene locus_tag LOCUS_20730 gene radC 2831 2157 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_20730 2967 4229 gene locus_tag LOCUS_20740 2967 4229 CDS product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818086.1 protein_id gnl|my_center|LOCUS_20740 4263 5447 gene locus_tag LOCUS_20750 gene coaBC 4263 5447 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 protein_id gnl|my_center|LOCUS_20750 5447 5902 gene locus_tag LOCUS_20760 gene dut 5447 5902 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812576.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence134 793 2172 gene locus_tag LOCUS_20770 793 2172 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_20770 2370 3173 gene locus_tag LOCUS_20780 gene nirQ 2370 3173 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_20780 3187 5433 gene locus_tag LOCUS_20790 3187 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence135 337 2583 gene locus_tag LOCUS_20800 337 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2685 3686 gene locus_tag LOCUS_20810 2685 3686 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189384.1 protein_id gnl|my_center|LOCUS_20810 3744 4238 gene locus_tag LOCUS_20820 gene purE 3744 4238 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_20820 4294 5178 gene locus_tag LOCUS_20830 4294 5178 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_20830 5207 5839 gene locus_tag LOCUS_20840 5207 5839 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942944.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence136 357 139 gene locus_tag LOCUS_20850 357 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 506 1426 gene locus_tag LOCUS_20860 506 1426 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_20860 1612 1806 gene locus_tag LOCUS_20870 1612 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1866 2879 gene locus_tag LOCUS_20880 gene waaF 1866 2879 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 protein_id gnl|my_center|LOCUS_20880 3590 4966 gene locus_tag LOCUS_20890 3590 4966 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_20890 5773 4976 gene locus_tag LOCUS_20900 5773 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20900 >Feature sequence137 3370 311 gene locus_tag LOCUS_20910 3370 311 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263656.1 protein_id gnl|my_center|LOCUS_20910 3844 3434 gene locus_tag LOCUS_20920 gene arfB 3844 3434 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_20920 <5890 3835 gene locus_tag LOCUS_20930 <5890 3835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195192.1:excinuclease ABC subunit UvrA >Feature sequence138 <1 588 gene locus_tag LOCUS_20940 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390838.1:glycosyltransferase family A protein 576 1349 gene locus_tag LOCUS_20950 576 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1346 2455 gene locus_tag LOCUS_20960 1346 2455 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_20960 2452 3396 gene locus_tag LOCUS_20970 2452 3396 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 protein_id gnl|my_center|LOCUS_20970 3414 4538 gene locus_tag LOCUS_20980 gene rfbB 3414 4538 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_20980 4538 5440 gene locus_tag LOCUS_20990 gene rfbD 4538 5440 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023623.1 protein_id gnl|my_center|LOCUS_20990 5451 5726 gene locus_tag LOCUS_21000 5451 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence139 485 958 gene locus_tag LOCUS_21010 485 958 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_21010 1157 2320 gene locus_tag LOCUS_21020 gene nirJ 1157 2320 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_21020 2323 3858 gene locus_tag LOCUS_21030 gene nirN 2323 3858 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_21030 3915 4205 gene locus_tag LOCUS_21040 3915 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 4338 4565 gene locus_tag LOCUS_21050 4338 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 5085 5273 gene locus_tag LOCUS_21060 5085 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21060 5714 5346 gene locus_tag LOCUS_21070 5714 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence140 20 2359 gene locus_tag LOCUS_21080 20 2359 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_21080 2367 2693 gene locus_tag LOCUS_21090 gene gldC 2367 2693 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_21090 3541 2717 gene locus_tag LOCUS_21100 3541 2717 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_21100 5191 3548 gene locus_tag LOCUS_21110 5191 3548 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence141 1711 623 gene locus_tag LOCUS_21120 gene prfA 1711 623 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222130.1 protein_id gnl|my_center|LOCUS_21120 2977 1724 gene locus_tag LOCUS_21130 gene hemA 2977 1724 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521984.1 protein_id gnl|my_center|LOCUS_21130 3119 3979 gene locus_tag LOCUS_21140 gene ubiA 3119 3979 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_21140 <5505 4456 gene locus_tag LOCUS_21150 <5505 4456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521919.1:deoxyguanosinetriphosphate triphosphohydrolase >Feature sequence142 2 271 gene locus_tag LOCUS_21160 2 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 400 702 gene locus_tag LOCUS_21170 400 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 811 1074 gene locus_tag LOCUS_21180 gene xanC 811 1074 CDS product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 protein_id gnl|my_center|LOCUS_21180 1156 1818 gene locus_tag LOCUS_21190 1156 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 1818 3131 gene locus_tag LOCUS_21200 gene xanA2 1818 3131 CDS product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 protein_id gnl|my_center|LOCUS_21200 3122 3421 gene locus_tag LOCUS_21210 3122 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3411 4307 gene locus_tag LOCUS_21220 3411 4307 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_21220 4307 4879 gene locus_tag LOCUS_21230 4307 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence143 2455 1808 gene locus_tag LOCUS_21240 2455 1808 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528674.1 protein_id gnl|my_center|LOCUS_21240 3863 2448 gene locus_tag LOCUS_21250 3863 2448 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976168.1 protein_id gnl|my_center|LOCUS_21250 3808 4014 gene locus_tag LOCUS_21260 3808 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 4130 4468 gene locus_tag LOCUS_21270 4130 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence144 1540 404 gene locus_tag LOCUS_21280 1540 404 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 protein_id gnl|my_center|LOCUS_21280 2643 1600 gene locus_tag LOCUS_21290 2643 1600 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_21290 2715 3404 gene locus_tag LOCUS_21300 2715 3404 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_21300 3432 4241 gene locus_tag LOCUS_21310 gene proC 3432 4241 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_21310 4241 4807 gene locus_tag LOCUS_21320 4241 4807 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence145 2871 178 gene locus_tag LOCUS_21330 gene acnA 2871 178 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_21330 3147 4733 gene locus_tag LOCUS_21340 3147 4733 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence146 44 119 gene locus_tag LOCUS_t00320 44 119 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 578 1183 gene locus_tag LOCUS_21350 578 1183 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_21350 2029 2244 gene locus_tag LOCUS_21360 2029 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2334 2555 gene locus_tag LOCUS_21370 2334 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21370 2619 4043 gene locus_tag LOCUS_21380 2619 4043 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_21380 <4809 4102 gene locus_tag LOCUS_21390 <4809 4102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930369.1:M48 family metallopeptidase >Feature sequence147 <1 922 gene locus_tag LOCUS_21400 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186137.1:NADH-quinone oxidoreductase subunit M 1032 2474 gene locus_tag LOCUS_21410 gene nuoN 1032 2474 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_21410 2538 3095 gene locus_tag LOCUS_21420 2538 3095 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526464.1 protein_id gnl|my_center|LOCUS_21420 3281 4483 gene locus_tag LOCUS_21430 3281 4483 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence148 296 9 gene locus_tag LOCUS_21440 296 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2854 332 gene locus_tag LOCUS_21450 2854 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 4017 2851 gene locus_tag LOCUS_21460 4017 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence149 593 315 gene locus_tag LOCUS_21470 593 315 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357604.1 protein_id gnl|my_center|LOCUS_21470 1317 637 gene locus_tag LOCUS_21480 gene dut 1317 637 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_21480 2245 1547 gene locus_tag LOCUS_21490 2245 1547 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364547.1 protein_id gnl|my_center|LOCUS_21490 2999 2310 gene locus_tag LOCUS_21500 2999 2310 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_21500 4025 3024 gene locus_tag LOCUS_21510 gene rfaD 4025 3024 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544120.1 protein_id gnl|my_center|LOCUS_21510 <4662 4125 gene locus_tag LOCUS_21520 <4662 4125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002217546.1:ADP-heptose synthase >Feature sequence150 1177 950 gene locus_tag LOCUS_21530 1177 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 1923 1174 gene locus_tag LOCUS_21540 gene istB 1923 1174 CDS product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021079.1 protein_id gnl|my_center|LOCUS_21540 3451 1913 gene locus_tag LOCUS_21550 3451 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 4465 4157 gene locus_tag LOCUS_21560 4465 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence151 506 1072 gene locus_tag LOCUS_21570 gene cobO 506 1072 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393737.1 protein_id gnl|my_center|LOCUS_21570 1130 2908 gene locus_tag LOCUS_21580 gene msbA 1130 2908 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551246.1 protein_id gnl|my_center|LOCUS_21580 3274 2939 gene locus_tag LOCUS_21590 3274 2939 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661811.1 protein_id gnl|my_center|LOCUS_21590 3550 4155 gene locus_tag LOCUS_21600 3550 4155 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence152 99 2597 gene locus_tag LOCUS_21610 99 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 3234 4283 gene locus_tag LOCUS_21620 3234 4283 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169265.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence153 549 460 gene locus_tag LOCUS_t00330 549 460 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1092 649 gene locus_tag LOCUS_21630 gene queD 1092 649 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040017.1 protein_id gnl|my_center|LOCUS_21630 2169 1537 gene locus_tag LOCUS_21640 2169 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2325 3044 gene locus_tag LOCUS_21650 gene ompR 2325 3044 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704310.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence154 3572 3835 gene locus_tag LOCUS_21660 gene rpsT 3572 3835 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence155 126 36 gene locus_tag LOCUS_t00340 126 36 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 320 2998 gene locus_tag LOCUS_21670 320 2998 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_21670 3072 3995 gene locus_tag LOCUS_21680 3072 3995 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence156 1831 1592 gene locus_tag LOCUS_21690 1831 1592 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740683.1 protein_id gnl|my_center|LOCUS_21690 2212 3192 gene locus_tag LOCUS_21700 2212 3192 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_21700 3212 3754 gene locus_tag LOCUS_21710 3212 3754 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence157 <1 510 gene locus_tag LOCUS_21720 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199069.1:methionine adenosyltransferase 831 2243 gene locus_tag LOCUS_21730 gene ahcY 831 2243 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_21730 2275 2604 gene locus_tag LOCUS_21740 2275 2604 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265541.1 protein_id gnl|my_center|LOCUS_21740 2641 2970 gene locus_tag LOCUS_21750 2641 2970 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_21750 2970 3806 gene locus_tag LOCUS_21760 gene metF 2970 3806 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765400.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence158 651 367 gene locus_tag LOCUS_21770 651 367 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958388.1 protein_id gnl|my_center|LOCUS_21770 2162 732 gene locus_tag LOCUS_21780 gene thrC 2162 732 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_21780 3549 2236 gene locus_tag LOCUS_21790 3549 2236 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence159 955 314 gene locus_tag LOCUS_21800 gene nudC 955 314 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957914.1 protein_id gnl|my_center|LOCUS_21800 1392 3761 gene locus_tag LOCUS_21810 1392 3761 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence160 365 1387 gene locus_tag LOCUS_21820 gene trpD 365 1387 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217365.1 protein_id gnl|my_center|LOCUS_21820 2694 1396 gene locus_tag LOCUS_21830 2694 1396 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065042.1 protein_id gnl|my_center|LOCUS_21830 3400 2687 gene locus_tag LOCUS_21840 3400 2687 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039134.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence161 357 608 gene locus_tag LOCUS_21850 357 608 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_21850 605 1720 gene locus_tag LOCUS_21860 gene hypD 605 1720 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_21860 1717 2751 gene locus_tag LOCUS_21870 gene hypE 1717 2751 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_21870 <3674 2764 gene locus_tag LOCUS_21880 <3674 2764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence162 398 1243 gene locus_tag LOCUS_21890 398 1243 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_21890 1233 2018 gene locus_tag LOCUS_21900 1233 2018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192376.1 protein_id gnl|my_center|LOCUS_21900 2243 2821 gene locus_tag LOCUS_21910 2243 2821 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973222.1 protein_id gnl|my_center|LOCUS_21910 <3602 2904 gene locus_tag LOCUS_21920 <3602 2904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105555.1:sodium-extruding oxaloacetate decarboxylase subunit alpha >Feature sequence163 1055 513 gene locus_tag LOCUS_21930 1055 513 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_21930 2305 1052 gene locus_tag LOCUS_21940 2305 1052 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_21940 2412 2903 gene locus_tag LOCUS_21950 2412 2903 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222219.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence164 1567 2391 gene locus_tag LOCUS_21960 1567 2391 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814962.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence165 418 555 gene locus_tag LOCUS_21970 418 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21970 552 776 gene locus_tag LOCUS_21980 552 776 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_21980 870 1409 gene locus_tag LOCUS_21990 870 1409 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_21990 1418 1732 gene locus_tag LOCUS_22000 1418 1732 CDS product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764940.1 protein_id gnl|my_center|LOCUS_22000 1733 2164 gene locus_tag LOCUS_22010 1733 2164 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975895.1 protein_id gnl|my_center|LOCUS_22010 <3062 2187 gene locus_tag LOCUS_22020 <3062 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185503.1:lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase >Feature sequence166 <1 528 gene locus_tag LOCUS_22030 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522490.1:DNA topoisomerase IV subunit A 584 2683 gene locus_tag LOCUS_22040 584 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence167 521 69 gene locus_tag LOCUS_22050 gene ribH 521 69 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_22050 1628 534 gene locus_tag LOCUS_22060 gene ribBA 1628 534 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039073.1 protein_id gnl|my_center|LOCUS_22060 2221 1625 gene locus_tag LOCUS_22070 2221 1625 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_22070 <2955 2262 gene locus_tag LOCUS_22080 <2955 2262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186140.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD >Feature sequence168 355 65 gene locus_tag LOCUS_22090 gene yggU 355 65 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073225.1 protein_id gnl|my_center|LOCUS_22090 1050 361 gene locus_tag LOCUS_22100 gene ccsA 1050 361 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194227.1 protein_id gnl|my_center|LOCUS_22100 1242 2594 gene locus_tag LOCUS_22110 gene ffh 1242 2594 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence169 133 11 gene locus_tag LOCUS_22120 133 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 593 126 gene locus_tag LOCUS_22130 gene rnhA 593 126 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_22130 1359 583 gene locus_tag LOCUS_22140 1359 583 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_22140 1383 2159 gene locus_tag LOCUS_22150 gene gloB 1383 2159 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456739.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence170 1452 412 gene locus_tag LOCUS_22160 1452 412 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence171 1394 312 gene locus_tag LOCUS_22170 gene aroB 1394 312 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_22170 1972 1406 gene locus_tag LOCUS_22180 1972 1406 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_22180 2541 2038 gene locus_tag LOCUS_22190 2541 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence172 >Feature sequence173 1708 1496 gene locus_tag LOCUS_22200 1708 1496 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_22200 <2412 1725 gene locus_tag LOCUS_22210 <2412 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181711674.1:efflux RND transporter permease subunit >Feature sequence174 211 1437 gene locus_tag LOCUS_22220 211 1437 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_22220 1699 1403 gene locus_tag LOCUS_22230 1699 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2108 1806 gene locus_tag LOCUS_22240 2108 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence175 250 639 gene locus_tag LOCUS_22250 250 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 939 1607 gene locus_tag LOCUS_22260 939 1607 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529923.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence176 410 865 gene locus_tag LOCUS_22270 410 865 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207809.1 protein_id gnl|my_center|LOCUS_22270 1331 1624 gene locus_tag LOCUS_22280 1331 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 <2287 1675 gene locus_tag LOCUS_22290 <2287 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920971.1:LysR family transcriptional regulator >Feature sequence177 1379 1747 gene locus_tag LOCUS_22300 1379 1747 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence178 1628 1257 gene locus_tag LOCUS_22310 1628 1257 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940839.1 protein_id gnl|my_center|LOCUS_22310 1843 1625 gene locus_tag LOCUS_22320 1843 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence179 2162 297 gene locus_tag LOCUS_22330 2162 297 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203862.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence180 116 826 gene locus_tag LOCUS_22340 116 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence181 1664 888 gene locus_tag LOCUS_22350 1664 888 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence182 833 1381 gene locus_tag LOCUS_22360 833 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence183 1 1464 gene locus_tag LOCUS_22370 gene ubiD 1 1464 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222122.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence184 216 638 gene locus_tag LOCUS_22380 216 638 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence185 151 276 gene locus_tag LOCUS_22390 151 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 273 593 gene locus_tag LOCUS_22400 273 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 624 974 gene locus_tag LOCUS_22410 624 974 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972473.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence186 <1 705 gene locus_tag LOCUS_22420 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524586.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence187 373 1542 gene locus_tag LOCUS_22430 373 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence188 >Feature sequence189 <1 582 gene locus_tag LOCUS_22440 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010793829.1:exodeoxyribonuclease V subunit gamma >Feature sequence190 17 847 gene locus_tag LOCUS_22450 gene dapF 17 847 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807183.1 protein_id gnl|my_center|LOCUS_22450 858 1487 gene locus_tag LOCUS_22460 858 1487 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944790.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence191 38 826 gene locus_tag LOCUS_22470 38 826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192376.1 protein_id gnl|my_center|LOCUS_22470 <1558 881 gene locus_tag LOCUS_22480 <1558 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105555.1:sodium-extruding oxaloacetate decarboxylase subunit alpha >Feature sequence192 159 521 gene locus_tag LOCUS_22490 gene rplS 159 521 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813315.1 protein_id gnl|my_center|LOCUS_22490 791 1075 gene locus_tag LOCUS_22500 791 1075 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_22500 1072 1416 gene locus_tag LOCUS_22510 1072 1416 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941219.1 protein_id gnl|my_center|LOCUS_22510