>Feature sequence01 1045 1488 gene locus_tag LOCUS_00010 1045 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1491 4700 gene locus_tag LOCUS_00020 1491 4700 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 protein_id gnl|my_center|LOCUS_00020 4950 5186 gene locus_tag LOCUS_00030 4950 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5564 7522 gene locus_tag LOCUS_00040 5564 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918991.1 protein_id gnl|my_center|LOCUS_00040 8380 7529 gene locus_tag LOCUS_00050 8380 7529 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110022974.1 protein_id gnl|my_center|LOCUS_00050 9234 8392 gene locus_tag LOCUS_00060 9234 8392 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933746.1 protein_id gnl|my_center|LOCUS_00060 10217 9234 gene locus_tag LOCUS_00070 gene prfB 10217 9234 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_00070 10583 12592 gene locus_tag LOCUS_00080 10583 12592 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_00080 12601 15936 gene locus_tag LOCUS_00090 gene treS 12601 15936 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933743.1 protein_id gnl|my_center|LOCUS_00090 16801 15995 gene locus_tag LOCUS_00100 gene mazG 16801 15995 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933741.1 protein_id gnl|my_center|LOCUS_00100 16915 18336 gene locus_tag LOCUS_00110 gene mnmE 16915 18336 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933739.1 protein_id gnl|my_center|LOCUS_00110 19188 18391 gene locus_tag LOCUS_00120 gene ccsA 19188 18391 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933223.1 protein_id gnl|my_center|LOCUS_00120 20423 19185 gene locus_tag LOCUS_00130 20423 19185 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933224.1 protein_id gnl|my_center|LOCUS_00130 21219 22532 gene locus_tag LOCUS_00140 21219 22532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 22751 23320 gene locus_tag LOCUS_00150 22751 23320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 23347 23685 gene locus_tag LOCUS_00160 23347 23685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23716 24489 gene locus_tag LOCUS_00170 23716 24489 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_00170 24509 25393 gene locus_tag LOCUS_00180 24509 25393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 25461 28076 gene locus_tag LOCUS_00190 25461 28076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 28076 28519 gene locus_tag LOCUS_00200 28076 28519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28599 29201 gene locus_tag LOCUS_00210 28599 29201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 29418 29933 gene locus_tag LOCUS_00220 29418 29933 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_00220 29930 30169 gene locus_tag LOCUS_00230 29930 30169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30197 31339 gene locus_tag LOCUS_00240 30197 31339 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926978.1 protein_id gnl|my_center|LOCUS_00240 31503 32648 gene locus_tag LOCUS_00250 31503 32648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 32656 33546 gene locus_tag LOCUS_00260 32656 33546 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_00260 33589 35460 gene locus_tag LOCUS_00270 gene dsbD 33589 35460 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_00270 35952 35518 gene locus_tag LOCUS_00280 35952 35518 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105017.1 protein_id gnl|my_center|LOCUS_00280 37573 36326 gene locus_tag LOCUS_00290 37573 36326 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967584.1 protein_id gnl|my_center|LOCUS_00290 38131 39990 gene locus_tag LOCUS_00300 38131 39990 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927144.1 protein_id gnl|my_center|LOCUS_00300 39994 40761 gene locus_tag LOCUS_00310 39994 40761 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927143.1 protein_id gnl|my_center|LOCUS_00310 40898 41179 gene locus_tag LOCUS_00320 40898 41179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927289.1 protein_id gnl|my_center|LOCUS_00320 42255 41176 gene locus_tag LOCUS_00330 42255 41176 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933722.1 protein_id gnl|my_center|LOCUS_00330 42444 43142 gene locus_tag LOCUS_00340 42444 43142 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933720.1 protein_id gnl|my_center|LOCUS_00340 44613 43183 gene locus_tag LOCUS_00350 44613 43183 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 protein_id gnl|my_center|LOCUS_00350 45848 44682 gene locus_tag LOCUS_00360 45848 44682 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_00360 46804 45848 gene locus_tag LOCUS_00370 46804 45848 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933711.1 protein_id gnl|my_center|LOCUS_00370 47802 46801 gene locus_tag LOCUS_00380 47802 46801 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933710.1 protein_id gnl|my_center|LOCUS_00380 48118 47894 gene locus_tag LOCUS_00390 48118 47894 CDS product chlorosome envelope protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927140.1 protein_id gnl|my_center|LOCUS_00390 48425 48865 gene locus_tag LOCUS_00400 48425 48865 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932073.1 protein_id gnl|my_center|LOCUS_00400 49900 48899 gene locus_tag LOCUS_00410 49900 48899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926852.1 protein_id gnl|my_center|LOCUS_00410 51153 49897 gene locus_tag LOCUS_00420 51153 49897 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_00420 51465 52208 gene locus_tag LOCUS_00430 gene gpmA 51465 52208 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_00430 52320 56921 gene locus_tag LOCUS_00440 gene gltB 52320 56921 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_00440 56947 58422 gene locus_tag LOCUS_00450 56947 58422 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_00450 58448 58717 gene locus_tag LOCUS_00460 58448 58717 CDS product DUF4404 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932094.1 protein_id gnl|my_center|LOCUS_00460 58866 60074 gene locus_tag LOCUS_00470 gene clpX 58866 60074 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932095.1 protein_id gnl|my_center|LOCUS_00470 60145 60221 gene locus_tag LOCUS_t00010 60145 60221 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 60379 60633 gene locus_tag LOCUS_00480 60379 60633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926954.1 protein_id gnl|my_center|LOCUS_00480 62308 60716 gene locus_tag LOCUS_00490 gene cimA 62308 60716 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932299.1 protein_id gnl|my_center|LOCUS_00490 62878 62312 gene locus_tag LOCUS_00500 62878 62312 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_00500 64200 62905 gene locus_tag LOCUS_00510 64200 62905 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_00510 65283 64225 gene locus_tag LOCUS_00520 gene leuB 65283 64225 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927220.1 protein_id gnl|my_center|LOCUS_00520 66294 65302 gene locus_tag LOCUS_00530 gene ilvC 66294 65302 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932303.1 protein_id gnl|my_center|LOCUS_00530 66825 66337 gene locus_tag LOCUS_00540 gene ilvN 66825 66337 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932304.1 protein_id gnl|my_center|LOCUS_00540 68543 66822 gene locus_tag LOCUS_00550 gene ilvB 68543 66822 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932305.1 protein_id gnl|my_center|LOCUS_00550 70258 68561 gene locus_tag LOCUS_00560 gene ilvD 70258 68561 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932306.1 protein_id gnl|my_center|LOCUS_00560 70655 72235 gene locus_tag LOCUS_00570 70655 72235 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926895.1 protein_id gnl|my_center|LOCUS_00570 72260 72928 gene locus_tag LOCUS_00580 gene tolQ 72260 72928 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932317.1 protein_id gnl|my_center|LOCUS_00580 72965 73360 gene locus_tag LOCUS_00590 gene tolR 72965 73360 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932318.1 protein_id gnl|my_center|LOCUS_00590 73369 74244 gene locus_tag LOCUS_00600 73369 74244 CDS product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932319.1 protein_id gnl|my_center|LOCUS_00600 74318 75634 gene locus_tag LOCUS_00610 gene tolB 74318 75634 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932320.1 protein_id gnl|my_center|LOCUS_00610 75755 76297 gene locus_tag LOCUS_00620 gene pal 75755 76297 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_00620 76449 77159 gene locus_tag LOCUS_00630 gene ybgF 76449 77159 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926896.1 protein_id gnl|my_center|LOCUS_00630 77637 77203 gene locus_tag LOCUS_00640 gene pscD 77637 77203 CDS product photosystem P840 reaction center protein PscD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932325.1 protein_id gnl|my_center|LOCUS_00640 79704 77782 gene locus_tag LOCUS_00650 gene dnaK 79704 77782 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932327.1 protein_id gnl|my_center|LOCUS_00650 80184 79786 gene locus_tag LOCUS_00660 80184 79786 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932328.1 protein_id gnl|my_center|LOCUS_00660 80781 80392 gene locus_tag LOCUS_00670 80781 80392 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932330.1 protein_id gnl|my_center|LOCUS_00670 81184 80927 gene locus_tag LOCUS_00680 81184 80927 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932331.1 protein_id gnl|my_center|LOCUS_00680 81840 81211 gene locus_tag LOCUS_00690 81840 81211 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_00690 81970 83493 gene locus_tag LOCUS_00700 81970 83493 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926897.1 protein_id gnl|my_center|LOCUS_00700 84723 83503 gene locus_tag LOCUS_00710 84723 83503 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926898.1 protein_id gnl|my_center|LOCUS_00710 85315 84785 gene locus_tag LOCUS_00720 85315 84785 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932336.1 protein_id gnl|my_center|LOCUS_00720 88753 85445 gene locus_tag LOCUS_00730 gene mfd 88753 85445 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926899.1 protein_id gnl|my_center|LOCUS_00730 88849 89814 gene locus_tag LOCUS_00740 88849 89814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932339.1 protein_id gnl|my_center|LOCUS_00740 90809 89931 gene locus_tag LOCUS_00750 90809 89931 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_00750 91214 90891 gene locus_tag LOCUS_00760 91214 90891 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_00760 91430 91218 gene locus_tag LOCUS_00770 91430 91218 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_00770 91838 92842 gene locus_tag LOCUS_00780 91838 92842 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933926.1 protein_id gnl|my_center|LOCUS_00780 92883 93899 gene locus_tag LOCUS_00790 92883 93899 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933927.1 protein_id gnl|my_center|LOCUS_00790 94020 94316 gene locus_tag LOCUS_00800 94020 94316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927181.1 protein_id gnl|my_center|LOCUS_00800 94341 95663 gene locus_tag LOCUS_00810 94341 95663 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933929.1 protein_id gnl|my_center|LOCUS_00810 95828 98407 gene locus_tag LOCUS_00820 95828 98407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 98441 98974 gene locus_tag LOCUS_00830 98441 98974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927299.1 protein_id gnl|my_center|LOCUS_00830 99015 100442 gene locus_tag LOCUS_00840 gene gatB 99015 100442 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933868.1 protein_id gnl|my_center|LOCUS_00840 100718 100449 gene locus_tag LOCUS_00850 gene xseB 100718 100449 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933867.1 protein_id gnl|my_center|LOCUS_00850 100876 101805 gene locus_tag LOCUS_00860 gene obgE 100876 101805 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933866.1 protein_id gnl|my_center|LOCUS_00860 101809 102276 gene locus_tag LOCUS_00870 101809 102276 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933865.1 protein_id gnl|my_center|LOCUS_00870 102303 102569 gene locus_tag LOCUS_00880 102303 102569 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933864.1 protein_id gnl|my_center|LOCUS_00880 102572 103684 gene locus_tag LOCUS_00890 102572 103684 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986818.1 protein_id gnl|my_center|LOCUS_00890 103687 104526 gene locus_tag LOCUS_00900 103687 104526 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933862.1 protein_id gnl|my_center|LOCUS_00900 104516 105079 gene locus_tag LOCUS_00910 104516 105079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 105060 106235 gene locus_tag LOCUS_00920 105060 106235 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927168.1 protein_id gnl|my_center|LOCUS_00920 106232 107728 gene locus_tag LOCUS_00930 106232 107728 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933859.1 protein_id gnl|my_center|LOCUS_00930 107733 110090 gene locus_tag LOCUS_00940 107733 110090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933858.1 protein_id gnl|my_center|LOCUS_00940 111382 110138 gene locus_tag LOCUS_00950 111382 110138 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202285.1 protein_id gnl|my_center|LOCUS_00950 111668 111369 gene locus_tag LOCUS_00960 111668 111369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 111863 112456 gene locus_tag LOCUS_00970 111863 112456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 112622 112927 gene locus_tag LOCUS_00980 112622 112927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 112893 113264 gene locus_tag LOCUS_00990 112893 113264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 114143 113283 gene locus_tag LOCUS_01000 114143 113283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 114748 114176 gene locus_tag LOCUS_01010 114748 114176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533245.1 protein_id gnl|my_center|LOCUS_01010 115147 115737 gene locus_tag LOCUS_01020 115147 115737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 115799 117691 gene locus_tag LOCUS_01030 115799 117691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 protein_id gnl|my_center|LOCUS_01030 117684 118877 gene locus_tag LOCUS_01040 117684 118877 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_01040 119122 119376 gene locus_tag LOCUS_01050 119122 119376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 119977 120387 gene locus_tag LOCUS_01060 gene rpsL 119977 120387 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933847.1 protein_id gnl|my_center|LOCUS_01060 120418 120885 gene locus_tag LOCUS_01070 gene rpsG 120418 120885 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933846.1 protein_id gnl|my_center|LOCUS_01070 120926 123040 gene locus_tag LOCUS_01080 gene fusA 120926 123040 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933845.1 protein_id gnl|my_center|LOCUS_01080 123110 124291 gene locus_tag LOCUS_01090 gene tuf 123110 124291 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933844.1 protein_id gnl|my_center|LOCUS_01090 124368 124679 gene locus_tag LOCUS_01100 gene rpsJ 124368 124679 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933843.1 protein_id gnl|my_center|LOCUS_01100 124703 125332 gene locus_tag LOCUS_01110 gene rplC 124703 125332 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933842.1 protein_id gnl|my_center|LOCUS_01110 125340 125978 gene locus_tag LOCUS_01120 gene rplD 125340 125978 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933841.1 protein_id gnl|my_center|LOCUS_01120 126011 126322 gene locus_tag LOCUS_01130 gene rplW 126011 126322 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933840.1 protein_id gnl|my_center|LOCUS_01130 126399 127193 gene locus_tag LOCUS_01140 gene rplB 126399 127193 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_01140 127227 127526 gene locus_tag LOCUS_01150 gene rpsS 127227 127526 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933838.1 protein_id gnl|my_center|LOCUS_01150 127535 127915 gene locus_tag LOCUS_01160 gene rplV 127535 127915 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933837.1 protein_id gnl|my_center|LOCUS_01160 127931 128692 gene locus_tag LOCUS_01170 gene rpsC 127931 128692 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933836.1 protein_id gnl|my_center|LOCUS_01170 128783 129154 gene locus_tag LOCUS_01180 gene rplP 128783 129154 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_01180 129189 129395 gene locus_tag LOCUS_01190 gene rpmC 129189 129395 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933834.1 protein_id gnl|my_center|LOCUS_01190 129395 129727 gene locus_tag LOCUS_01200 gene rpsQ 129395 129727 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933833.1 protein_id gnl|my_center|LOCUS_01200 129766 130134 gene locus_tag LOCUS_01210 gene rplN 129766 130134 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933832.1 protein_id gnl|my_center|LOCUS_01210 130145 130218 gene locus_tag LOCUS_t00020 130145 130218 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 130254 130496 gene locus_tag LOCUS_01220 130254 130496 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139457464.1 protein_id gnl|my_center|LOCUS_01220 130556 131143 gene locus_tag LOCUS_01230 gene rplE 130556 131143 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986816.1 protein_id gnl|my_center|LOCUS_01230 131160 131429 gene locus_tag LOCUS_01240 gene rpsN 131160 131429 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933829.1 protein_id gnl|my_center|LOCUS_01240 131492 131887 gene locus_tag LOCUS_01250 gene rpsH 131492 131887 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933828.1 protein_id gnl|my_center|LOCUS_01250 131916 132455 gene locus_tag LOCUS_01260 gene rplF 131916 132455 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933827.1 protein_id gnl|my_center|LOCUS_01260 132509 132868 gene locus_tag LOCUS_01270 gene rplR 132509 132868 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439276.1 protein_id gnl|my_center|LOCUS_01270 132894 133412 gene locus_tag LOCUS_01280 gene rpsE 132894 133412 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933825.1 protein_id gnl|my_center|LOCUS_01280 133430 133615 gene locus_tag LOCUS_01290 gene rpmD 133430 133615 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933824.1 protein_id gnl|my_center|LOCUS_01290 133650 134204 gene locus_tag LOCUS_01300 gene rplO 133650 134204 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933823.1 protein_id gnl|my_center|LOCUS_01300 134223 135554 gene locus_tag LOCUS_01310 gene secY 134223 135554 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_01310 135564 136361 gene locus_tag LOCUS_01320 gene map 135564 136361 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933821.1 protein_id gnl|my_center|LOCUS_01320 136401 136619 gene locus_tag LOCUS_01330 gene infA 136401 136619 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933820.1 protein_id gnl|my_center|LOCUS_01330 136879 137256 gene locus_tag LOCUS_01340 gene rpsM 136879 137256 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933818.1 protein_id gnl|my_center|LOCUS_01340 137302 137685 gene locus_tag LOCUS_01350 gene rpsK 137302 137685 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933817.1 protein_id gnl|my_center|LOCUS_01350 137723 138334 gene locus_tag LOCUS_01360 gene rpsD 137723 138334 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933816.1 protein_id gnl|my_center|LOCUS_01360 138363 139346 gene locus_tag LOCUS_01370 138363 139346 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933815.1 protein_id gnl|my_center|LOCUS_01370 139394 139846 gene locus_tag LOCUS_01380 gene rplQ 139394 139846 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933814.1 protein_id gnl|my_center|LOCUS_01380 140564 139899 gene locus_tag LOCUS_01390 gene rsmG 140564 139899 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933813.1 protein_id gnl|my_center|LOCUS_01390 140745 141866 gene locus_tag LOCUS_01400 140745 141866 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933812.1 protein_id gnl|my_center|LOCUS_01400 143240 141870 gene locus_tag LOCUS_01410 gene cysS 143240 141870 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933811.1 protein_id gnl|my_center|LOCUS_01410 143458 144039 gene locus_tag LOCUS_01420 gene yihA 143458 144039 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933808.1 protein_id gnl|my_center|LOCUS_01420 144051 145355 gene locus_tag LOCUS_01430 144051 145355 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933807.1 protein_id gnl|my_center|LOCUS_01430 145374 145694 gene locus_tag LOCUS_01440 145374 145694 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927166.1 protein_id gnl|my_center|LOCUS_01440 145788 147050 gene locus_tag LOCUS_01450 gene bchN 145788 147050 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933805.1 protein_id gnl|my_center|LOCUS_01450 147090 148697 gene locus_tag LOCUS_01460 147090 148697 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933804.1 protein_id gnl|my_center|LOCUS_01460 148734 149561 gene locus_tag LOCUS_01470 gene bchL 148734 149561 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933803.1 protein_id gnl|my_center|LOCUS_01470 149716 150435 gene locus_tag LOCUS_01480 149716 150435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 151073 150501 gene locus_tag LOCUS_01490 gene bchJ 151073 150501 CDS product bacteriochlorophyll 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933670.1 protein_id gnl|my_center|LOCUS_01490 152202 151090 gene locus_tag LOCUS_01500 152202 151090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 152328 153797 gene locus_tag LOCUS_01510 152328 153797 CDS product starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933668.1 protein_id gnl|my_center|LOCUS_01510 153804 154394 gene locus_tag LOCUS_01520 153804 154394 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933667.1 protein_id gnl|my_center|LOCUS_01520 154431 155555 gene locus_tag LOCUS_01530 gene hemW 154431 155555 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933666.1 protein_id gnl|my_center|LOCUS_01530 155583 158225 gene locus_tag LOCUS_01540 155583 158225 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_01540 158232 159032 gene locus_tag LOCUS_01550 gene lpxA 158232 159032 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933664.1 protein_id gnl|my_center|LOCUS_01550 159048 160031 gene locus_tag LOCUS_01560 159048 160031 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933663.1 protein_id gnl|my_center|LOCUS_01560 160191 160742 gene locus_tag LOCUS_01570 160191 160742 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986808.1 protein_id gnl|my_center|LOCUS_01570 160752 161495 gene locus_tag LOCUS_01580 160752 161495 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933661.1 protein_id gnl|my_center|LOCUS_01580 161515 162597 gene locus_tag LOCUS_01590 161515 162597 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927132.1 protein_id gnl|my_center|LOCUS_01590 163078 162656 gene locus_tag LOCUS_01600 163078 162656 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence02 83 1165 gene locus_tag LOCUS_01610 gene proB 83 1165 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933124.1 protein_id gnl|my_center|LOCUS_01610 1178 2434 gene locus_tag LOCUS_01620 1178 2434 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933139.1 protein_id gnl|my_center|LOCUS_01620 2851 3615 gene locus_tag LOCUS_01630 2851 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 3727 8298 gene locus_tag LOCUS_01640 3727 8298 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933286.1 protein_id gnl|my_center|LOCUS_01640 8427 8858 gene locus_tag LOCUS_01650 8427 8858 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 protein_id gnl|my_center|LOCUS_01650 8855 9091 gene locus_tag LOCUS_01660 8855 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679683.1 protein_id gnl|my_center|LOCUS_01660 9167 9529 gene locus_tag LOCUS_01670 9167 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 9583 10275 gene locus_tag LOCUS_01680 9583 10275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927264.1 protein_id gnl|my_center|LOCUS_01680 10341 10550 gene locus_tag LOCUS_01690 10341 10550 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770699.1 protein_id gnl|my_center|LOCUS_01690 10661 11569 gene locus_tag LOCUS_01700 10661 11569 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932627.1 protein_id gnl|my_center|LOCUS_01700 12659 11586 gene locus_tag LOCUS_01710 12659 11586 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926948.1 protein_id gnl|my_center|LOCUS_01710 12937 13554 gene locus_tag LOCUS_01720 gene trmH 12937 13554 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926947.1 protein_id gnl|my_center|LOCUS_01720 14584 13601 gene locus_tag LOCUS_01730 14584 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 15094 14672 gene locus_tag LOCUS_01740 gene ybeY 15094 14672 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933051.1 protein_id gnl|my_center|LOCUS_01740 16380 15091 gene locus_tag LOCUS_01750 gene hflX 16380 15091 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933052.1 protein_id gnl|my_center|LOCUS_01750 16588 17511 gene locus_tag LOCUS_01760 16588 17511 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_01760 17582 19117 gene locus_tag LOCUS_01770 gene lysS 17582 19117 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933055.1 protein_id gnl|my_center|LOCUS_01770 19151 19573 gene locus_tag LOCUS_01780 19151 19573 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258928.1 protein_id gnl|my_center|LOCUS_01780 19566 19880 gene locus_tag LOCUS_01790 19566 19880 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693849.1 protein_id gnl|my_center|LOCUS_01790 19901 20839 gene locus_tag LOCUS_01800 19901 20839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 21328 21014 gene locus_tag LOCUS_01810 21328 21014 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_01810 21750 21325 gene locus_tag LOCUS_01820 21750 21325 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_01820 22799 21786 gene locus_tag LOCUS_01830 22799 21786 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_01830 23063 24511 gene locus_tag LOCUS_01840 23063 24511 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_01840 24531 25604 gene locus_tag LOCUS_01850 24531 25604 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_01850 25628 26455 gene locus_tag LOCUS_01860 25628 26455 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139457001.1 protein_id gnl|my_center|LOCUS_01860 26695 27465 gene locus_tag LOCUS_01870 26695 27465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 27772 27524 gene locus_tag LOCUS_01880 27772 27524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 28406 27765 gene locus_tag LOCUS_01890 28406 27765 CDS product ParA family plasmid-partitioning AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024524750.1 protein_id gnl|my_center|LOCUS_01890 29721 28471 gene locus_tag LOCUS_01900 29721 28471 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143531.1 protein_id gnl|my_center|LOCUS_01900 30330 31487 gene locus_tag LOCUS_01910 gene nifV 30330 31487 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927046.1 protein_id gnl|my_center|LOCUS_01910 31507 33141 gene locus_tag LOCUS_01920 31507 33141 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_01920 34883 33201 gene locus_tag LOCUS_01930 gene pgi 34883 33201 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 protein_id gnl|my_center|LOCUS_01930 35350 34943 gene locus_tag LOCUS_01940 35350 34943 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932667.1 protein_id gnl|my_center|LOCUS_01940 35543 36268 gene locus_tag LOCUS_01950 35543 36268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932664.1 protein_id gnl|my_center|LOCUS_01950 37639 36506 gene locus_tag LOCUS_01960 37639 36506 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_01960 38758 37709 gene locus_tag LOCUS_01970 38758 37709 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932661.1 protein_id gnl|my_center|LOCUS_01970 39051 40631 gene locus_tag LOCUS_01980 gene serA 39051 40631 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_01980 41900 40713 gene locus_tag LOCUS_01990 41900 40713 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932660.1 protein_id gnl|my_center|LOCUS_01990 43812 42061 gene locus_tag LOCUS_02000 43812 42061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 44698 43967 gene locus_tag LOCUS_02010 gene truA 44698 43967 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932658.1 protein_id gnl|my_center|LOCUS_02010 44821 46725 gene locus_tag LOCUS_02020 44821 46725 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926967.1 protein_id gnl|my_center|LOCUS_02020 46755 47666 gene locus_tag LOCUS_02030 46755 47666 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_02030 47705 49465 gene locus_tag LOCUS_02040 47705 49465 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932655.1 protein_id gnl|my_center|LOCUS_02040 49475 50053 gene locus_tag LOCUS_02050 49475 50053 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932654.1 protein_id gnl|my_center|LOCUS_02050 50096 51022 gene locus_tag LOCUS_02060 gene miaA 50096 51022 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932653.1 protein_id gnl|my_center|LOCUS_02060 51187 51774 gene locus_tag LOCUS_02070 51187 51774 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932652.1 protein_id gnl|my_center|LOCUS_02070 51883 53001 gene locus_tag LOCUS_02080 gene cfa 51883 53001 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933625.1 protein_id gnl|my_center|LOCUS_02080 54268 53006 gene locus_tag LOCUS_02090 54268 53006 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926965.1 protein_id gnl|my_center|LOCUS_02090 54403 54328 gene locus_tag LOCUS_t00030 54403 54328 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 56557 54449 gene locus_tag LOCUS_02100 gene metG 56557 54449 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932649.1 protein_id gnl|my_center|LOCUS_02100 57496 56570 gene locus_tag LOCUS_02110 gene ricT 57496 56570 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932648.1 protein_id gnl|my_center|LOCUS_02110 58410 57628 gene locus_tag LOCUS_02120 gene cruD 58410 57628 CDS product hydroxychlorobactene glucoside lauroyltransferase CruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932647.1 protein_id gnl|my_center|LOCUS_02120 59626 58418 gene locus_tag LOCUS_02130 59626 58418 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932646.1 protein_id gnl|my_center|LOCUS_02130 60145 59642 gene locus_tag LOCUS_02140 gene coaD 60145 59642 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932645.1 protein_id gnl|my_center|LOCUS_02140 60612 60142 gene locus_tag LOCUS_02150 gene rsmD 60612 60142 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932644.1 protein_id gnl|my_center|LOCUS_02150 61619 60708 gene locus_tag LOCUS_02160 61619 60708 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932643.1 protein_id gnl|my_center|LOCUS_02160 62302 61658 gene locus_tag LOCUS_02170 62302 61658 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932641.1 protein_id gnl|my_center|LOCUS_02170 63042 62332 gene locus_tag LOCUS_02180 63042 62332 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932640.1 protein_id gnl|my_center|LOCUS_02180 63513 63103 gene locus_tag LOCUS_02190 63513 63103 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932639.1 protein_id gnl|my_center|LOCUS_02190 63661 64644 gene locus_tag LOCUS_02200 63661 64644 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986870.1 protein_id gnl|my_center|LOCUS_02200 67237 64658 gene locus_tag LOCUS_02210 67237 64658 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_02210 68856 67249 gene locus_tag LOCUS_02220 gene murB 68856 67249 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932899.1 protein_id gnl|my_center|LOCUS_02220 69252 71483 gene locus_tag LOCUS_02230 69252 71483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 71658 71987 gene locus_tag LOCUS_02240 71658 71987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 72949 72095 gene locus_tag LOCUS_02250 72949 72095 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_02250 73579 73019 gene locus_tag LOCUS_02260 73579 73019 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933129.1 protein_id gnl|my_center|LOCUS_02260 74419 73640 gene locus_tag LOCUS_02270 gene ygiD 74419 73640 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_02270 75039 74428 gene locus_tag LOCUS_02280 75039 74428 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_02280 75441 75803 gene locus_tag LOCUS_02290 75441 75803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 76182 77462 gene locus_tag LOCUS_02300 76182 77462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 77581 78369 gene locus_tag LOCUS_02310 77581 78369 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_02310 78366 79154 gene locus_tag LOCUS_02320 gene fetB 78366 79154 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679254.1 protein_id gnl|my_center|LOCUS_02320 79930 79193 gene locus_tag LOCUS_02330 79930 79193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 81254 82027 gene locus_tag LOCUS_02340 81254 82027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 83600 82365 gene locus_tag LOCUS_02350 83600 82365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 85557 83626 gene locus_tag LOCUS_02360 85557 83626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 88094 85557 gene locus_tag LOCUS_02370 88094 85557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 88965 88892 gene locus_tag LOCUS_t00040 88965 88892 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 89052 88979 gene locus_tag LOCUS_t00050 89052 88979 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 90492 89110 gene locus_tag LOCUS_02380 90492 89110 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926935.1 protein_id gnl|my_center|LOCUS_02380 91142 90528 gene locus_tag LOCUS_02390 gene recR 91142 90528 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932487.1 protein_id gnl|my_center|LOCUS_02390 91484 91149 gene locus_tag LOCUS_02400 91484 91149 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926934.1 protein_id gnl|my_center|LOCUS_02400 92567 91584 gene locus_tag LOCUS_02410 92567 91584 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932485.1 protein_id gnl|my_center|LOCUS_02410 92639 93424 gene locus_tag LOCUS_02420 gene rsmA 92639 93424 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932484.1 protein_id gnl|my_center|LOCUS_02420 93564 95486 gene locus_tag LOCUS_02430 93564 95486 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_02430 95483 95890 gene locus_tag LOCUS_02440 gene mce 95483 95890 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_02440 95919 97712 gene locus_tag LOCUS_02450 95919 97712 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069811506.1 protein_id gnl|my_center|LOCUS_02450 97716 101003 gene locus_tag LOCUS_02460 97716 101003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 101276 101473 gene locus_tag LOCUS_02470 101276 101473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 101470 101739 gene locus_tag LOCUS_02480 101470 101739 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_02480 102119 103132 gene locus_tag LOCUS_02490 gene meaB 102119 103132 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932480.1 protein_id gnl|my_center|LOCUS_02490 103574 103116 gene locus_tag LOCUS_02500 103574 103116 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_02500 104417 103587 gene locus_tag LOCUS_02510 104417 103587 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932478.1 protein_id gnl|my_center|LOCUS_02510 105388 104426 gene locus_tag LOCUS_02520 105388 104426 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466227.1 protein_id gnl|my_center|LOCUS_02520 106416 107240 gene locus_tag LOCUS_02530 gene nifH 106416 107240 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933198.1 protein_id gnl|my_center|LOCUS_02530 107259 107612 gene locus_tag LOCUS_02540 107259 107612 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933199.1 protein_id gnl|my_center|LOCUS_02540 107613 107990 gene locus_tag LOCUS_02550 107613 107990 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933200.1 protein_id gnl|my_center|LOCUS_02550 108028 109668 gene locus_tag LOCUS_02560 gene nifD 108028 109668 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933201.1 protein_id gnl|my_center|LOCUS_02560 109696 111078 gene locus_tag LOCUS_02570 gene nifK 109696 111078 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933202.1 protein_id gnl|my_center|LOCUS_02570 111268 112629 gene locus_tag LOCUS_02580 gene nifE 111268 112629 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933203.1 protein_id gnl|my_center|LOCUS_02580 112626 113984 gene locus_tag LOCUS_02590 112626 113984 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933204.1 protein_id gnl|my_center|LOCUS_02590 113997 115268 gene locus_tag LOCUS_02600 gene nifB 113997 115268 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_02600 115314 115622 gene locus_tag LOCUS_02610 115314 115622 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933206.1 protein_id gnl|my_center|LOCUS_02610 117252 115849 gene locus_tag LOCUS_02620 117252 115849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence03 1645 311 gene locus_tag LOCUS_02630 gene purF 1645 311 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932005.1 protein_id gnl|my_center|LOCUS_02630 2181 2705 gene locus_tag LOCUS_02640 2181 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932006.1 protein_id gnl|my_center|LOCUS_02640 2851 2778 gene locus_tag LOCUS_t00060 2851 2778 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2948 3826 gene locus_tag LOCUS_02650 2948 3826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926835.1 protein_id gnl|my_center|LOCUS_02650 4677 3835 gene locus_tag LOCUS_02660 gene nfo 4677 3835 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932008.1 protein_id gnl|my_center|LOCUS_02660 5620 4691 gene locus_tag LOCUS_02670 5620 4691 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_02670 6437 5766 gene locus_tag LOCUS_02680 6437 5766 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932010.1 protein_id gnl|my_center|LOCUS_02680 7036 6434 gene locus_tag LOCUS_02690 gene purN 7036 6434 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932011.1 protein_id gnl|my_center|LOCUS_02690 7367 8944 gene locus_tag LOCUS_02700 gene purH 7367 8944 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932012.1 protein_id gnl|my_center|LOCUS_02700 9088 10092 gene locus_tag LOCUS_02710 9088 10092 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_02710 11118 10162 gene locus_tag LOCUS_02720 gene queG 11118 10162 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986833.1 protein_id gnl|my_center|LOCUS_02720 11383 11111 gene locus_tag LOCUS_02730 11383 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 13358 11385 gene locus_tag LOCUS_02740 13358 11385 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931974.1 protein_id gnl|my_center|LOCUS_02740 14344 13355 gene locus_tag LOCUS_02750 14344 13355 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931975.1 protein_id gnl|my_center|LOCUS_02750 15164 14361 gene locus_tag LOCUS_02760 gene murI 15164 14361 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931976.1 protein_id gnl|my_center|LOCUS_02760 16259 15168 gene locus_tag LOCUS_02770 gene ychF 16259 15168 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931977.1 protein_id gnl|my_center|LOCUS_02770 16366 17085 gene locus_tag LOCUS_02780 gene cmk 16366 17085 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931978.1 protein_id gnl|my_center|LOCUS_02780 17196 18980 gene locus_tag LOCUS_02790 gene rpsA 17196 18980 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931980.1 protein_id gnl|my_center|LOCUS_02790 20646 19114 gene locus_tag LOCUS_02800 20646 19114 CDS product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 protein_id gnl|my_center|LOCUS_02800 21770 20853 gene locus_tag LOCUS_02810 gene era 21770 20853 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931981.1 protein_id gnl|my_center|LOCUS_02810 21865 23124 gene locus_tag LOCUS_02820 gene rodA 21865 23124 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926830.1 protein_id gnl|my_center|LOCUS_02820 23618 23163 gene locus_tag LOCUS_02830 23618 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926831.1 protein_id gnl|my_center|LOCUS_02830 23790 25151 gene locus_tag LOCUS_02840 gene mtaB 23790 25151 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_02840 25202 25735 gene locus_tag LOCUS_02850 25202 25735 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931985.1 protein_id gnl|my_center|LOCUS_02850 25745 27154 gene locus_tag LOCUS_02860 25745 27154 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986831.1 protein_id gnl|my_center|LOCUS_02860 27679 27371 gene locus_tag LOCUS_02870 27679 27371 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986832.1 protein_id gnl|my_center|LOCUS_02870 28087 27716 gene locus_tag LOCUS_02880 28087 27716 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927201.1 protein_id gnl|my_center|LOCUS_02880 29926 28091 gene locus_tag LOCUS_02890 gene ftsH 29926 28091 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986879.1 protein_id gnl|my_center|LOCUS_02890 30336 31844 gene locus_tag LOCUS_02900 gene gltX 30336 31844 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931991.1 protein_id gnl|my_center|LOCUS_02900 31947 32020 gene locus_tag LOCUS_t00070 31947 32020 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 32164 33294 gene locus_tag LOCUS_02910 gene crtC 32164 33294 CDS product hydroxyneurosporene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931993.1 protein_id gnl|my_center|LOCUS_02910 33460 34005 gene locus_tag LOCUS_02920 33460 34005 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931994.1 protein_id gnl|my_center|LOCUS_02920 34041 35327 gene locus_tag LOCUS_02930 34041 35327 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931995.1 protein_id gnl|my_center|LOCUS_02930 38850 35404 gene locus_tag LOCUS_02940 38850 35404 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931996.1 protein_id gnl|my_center|LOCUS_02940 39404 39015 gene locus_tag LOCUS_02950 39404 39015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 39789 39388 gene locus_tag LOCUS_02960 39789 39388 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927278.1 protein_id gnl|my_center|LOCUS_02960 40089 39811 gene locus_tag LOCUS_02970 40089 39811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 40877 40170 gene locus_tag LOCUS_02980 40877 40170 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933426.1 protein_id gnl|my_center|LOCUS_02980 42040 40985 gene locus_tag LOCUS_02990 gene modC 42040 40985 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932139.1 protein_id gnl|my_center|LOCUS_02990 42723 42037 gene locus_tag LOCUS_03000 gene modB 42723 42037 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932140.1 protein_id gnl|my_center|LOCUS_03000 43409 42726 gene locus_tag LOCUS_03010 gene modA 43409 42726 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943593.1 protein_id gnl|my_center|LOCUS_03010 44092 45084 gene locus_tag LOCUS_03020 gene moaA 44092 45084 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933001.1 protein_id gnl|my_center|LOCUS_03020 45562 47721 gene locus_tag LOCUS_03030 45562 47721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 48205 49404 gene locus_tag LOCUS_03040 48205 49404 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403915.1 protein_id gnl|my_center|LOCUS_03040 49641 50156 gene locus_tag LOCUS_03050 49641 50156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 50438 51694 gene locus_tag LOCUS_03060 50438 51694 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_03060 52149 51706 gene locus_tag LOCUS_03070 52149 51706 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932389.1 protein_id gnl|my_center|LOCUS_03070 52461 52264 gene locus_tag LOCUS_03080 52461 52264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 52992 52684 gene locus_tag LOCUS_03090 52992 52684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932391.1 protein_id gnl|my_center|LOCUS_03090 53454 52996 gene locus_tag LOCUS_03100 53454 52996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 protein_id gnl|my_center|LOCUS_03100 53608 53865 gene locus_tag LOCUS_03110 53608 53865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926911.1 protein_id gnl|my_center|LOCUS_03110 55717 54002 gene locus_tag LOCUS_03120 gene sulP 55717 54002 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_03120 55922 56449 gene locus_tag LOCUS_03130 55922 56449 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932995.1 protein_id gnl|my_center|LOCUS_03130 56836 56510 gene locus_tag LOCUS_03140 56836 56510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 57148 56876 gene locus_tag LOCUS_03150 57148 56876 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_03150 57372 59108 gene locus_tag LOCUS_03160 57372 59108 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926915.1 protein_id gnl|my_center|LOCUS_03160 59209 60171 gene locus_tag LOCUS_03170 59209 60171 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932399.1 protein_id gnl|my_center|LOCUS_03170 60857 60168 gene locus_tag LOCUS_03180 60857 60168 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932400.1 protein_id gnl|my_center|LOCUS_03180 60922 60995 gene locus_tag LOCUS_t00080 60922 60995 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 62487 61072 gene locus_tag LOCUS_03190 gene ahcY 62487 61072 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932403.1 protein_id gnl|my_center|LOCUS_03190 63736 62522 gene locus_tag LOCUS_03200 gene metK 63736 62522 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932404.1 protein_id gnl|my_center|LOCUS_03200 64956 63979 gene locus_tag LOCUS_03210 64956 63979 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_03210 65193 65600 gene locus_tag LOCUS_03220 65193 65600 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932411.1 protein_id gnl|my_center|LOCUS_03220 65662 65735 gene locus_tag LOCUS_t00090 65662 65735 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 65761 65834 gene locus_tag LOCUS_t00100 65761 65834 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65862 65936 gene locus_tag LOCUS_t00110 65862 65936 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 65943 66015 gene locus_tag LOCUS_t00120 65943 66015 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 66084 68495 gene locus_tag LOCUS_03230 gene pheT 66084 68495 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932412.1 protein_id gnl|my_center|LOCUS_03230 68509 68814 gene locus_tag LOCUS_03240 68509 68814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926917.1 protein_id gnl|my_center|LOCUS_03240 68824 69087 gene locus_tag LOCUS_03250 68824 69087 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439255.1 protein_id gnl|my_center|LOCUS_03250 69389 70978 gene locus_tag LOCUS_03260 gene rny 69389 70978 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932416.1 protein_id gnl|my_center|LOCUS_03260 71611 71009 gene locus_tag LOCUS_03270 gene hisB 71611 71009 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932417.1 protein_id gnl|my_center|LOCUS_03270 71816 71619 gene locus_tag LOCUS_03280 71816 71619 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926919.1 protein_id gnl|my_center|LOCUS_03280 71953 72303 gene locus_tag LOCUS_03290 gene secG 71953 72303 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932419.1 protein_id gnl|my_center|LOCUS_03290 72311 72386 gene locus_tag LOCUS_t00130 72311 72386 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 72508 73833 gene locus_tag LOCUS_03300 72508 73833 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926921.1 protein_id gnl|my_center|LOCUS_03300 74250 73858 gene locus_tag LOCUS_03310 74250 73858 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932426.1 protein_id gnl|my_center|LOCUS_03310 74593 75030 gene locus_tag LOCUS_03320 74593 75030 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932428.1 protein_id gnl|my_center|LOCUS_03320 75033 76157 gene locus_tag LOCUS_03330 gene ribD 75033 76157 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932429.1 protein_id gnl|my_center|LOCUS_03330 76144 76632 gene locus_tag LOCUS_03340 76144 76632 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932430.1 protein_id gnl|my_center|LOCUS_03340 76643 77431 gene locus_tag LOCUS_03350 76643 77431 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986856.1 protein_id gnl|my_center|LOCUS_03350 77556 78065 gene locus_tag LOCUS_03360 gene tpx 77556 78065 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_03360 78086 78742 gene locus_tag LOCUS_03370 78086 78742 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932438.1 protein_id gnl|my_center|LOCUS_03370 78742 80085 gene locus_tag LOCUS_03380 78742 80085 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926922.1 protein_id gnl|my_center|LOCUS_03380 81396 80176 gene locus_tag LOCUS_03390 81396 80176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932942.1 protein_id gnl|my_center|LOCUS_03390 81864 83177 gene locus_tag LOCUS_03400 81864 83177 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926923.1 protein_id gnl|my_center|LOCUS_03400 84012 83209 gene locus_tag LOCUS_03410 84012 83209 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932441.1 protein_id gnl|my_center|LOCUS_03410 84678 84160 gene locus_tag LOCUS_03420 84678 84160 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932442.1 protein_id gnl|my_center|LOCUS_03420 84802 84717 gene locus_tag LOCUS_t00140 84802 84717 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 84899 84815 gene locus_tag LOCUS_t00150 84899 84815 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 85013 85606 gene locus_tag LOCUS_03430 85013 85606 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932444.1 protein_id gnl|my_center|LOCUS_03430 85588 86649 gene locus_tag LOCUS_03440 85588 86649 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986857.1 protein_id gnl|my_center|LOCUS_03440 86664 87281 gene locus_tag LOCUS_03450 86664 87281 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986858.1 protein_id gnl|my_center|LOCUS_03450 87278 87526 gene locus_tag LOCUS_03460 87278 87526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932447.1 protein_id gnl|my_center|LOCUS_03460 87657 88097 gene locus_tag LOCUS_03470 gene ndhC 87657 88097 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_03470 88126 88695 gene locus_tag LOCUS_03480 88126 88695 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_03480 88720 89238 gene locus_tag LOCUS_03490 88720 89238 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_03490 89270 90472 gene locus_tag LOCUS_03500 89270 90472 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_03500 90469 91587 gene locus_tag LOCUS_03510 gene nuoH 90469 91587 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_03510 91634 92248 gene locus_tag LOCUS_03520 91634 92248 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932453.1 protein_id gnl|my_center|LOCUS_03520 92241 92750 gene locus_tag LOCUS_03530 92241 92750 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_03530 92770 93090 gene locus_tag LOCUS_03540 gene nuoK 92770 93090 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_03540 93146 95401 gene locus_tag LOCUS_03550 gene nuoL 93146 95401 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927227.1 protein_id gnl|my_center|LOCUS_03550 95441 97075 gene locus_tag LOCUS_03560 95441 97075 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_03560 97114 98649 gene locus_tag LOCUS_03570 97114 98649 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_03570 99098 100183 gene locus_tag LOCUS_03580 99098 100183 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_03580 100199 101917 gene locus_tag LOCUS_03590 100199 101917 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_03590 101930 102613 gene locus_tag LOCUS_03600 gene cybH 101930 102613 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932460.1 protein_id gnl|my_center|LOCUS_03600 102610 103128 gene locus_tag LOCUS_03610 102610 103128 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926926.1 protein_id gnl|my_center|LOCUS_03610 103686 103090 gene locus_tag LOCUS_03620 gene folE 103686 103090 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_03620 104255 103746 gene locus_tag LOCUS_03630 104255 103746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932973.1 protein_id gnl|my_center|LOCUS_03630 104462 106354 gene locus_tag LOCUS_03640 104462 106354 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932972.1 protein_id gnl|my_center|LOCUS_03640 106462 107172 gene locus_tag LOCUS_03650 106462 107172 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_03650 107202 107528 gene locus_tag LOCUS_03660 107202 107528 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence04 1543 200 gene locus_tag LOCUS_03670 gene accC 1543 200 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_03670 2018 1563 gene locus_tag LOCUS_03680 gene accB 2018 1563 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931852.1 protein_id gnl|my_center|LOCUS_03680 2640 2074 gene locus_tag LOCUS_03690 gene efp 2640 2074 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931853.1 protein_id gnl|my_center|LOCUS_03690 2861 3136 gene locus_tag LOCUS_03700 2861 3136 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_03700 3227 4234 gene locus_tag LOCUS_03710 3227 4234 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931855.1 protein_id gnl|my_center|LOCUS_03710 5332 4292 gene locus_tag LOCUS_03720 5332 4292 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931856.1 protein_id gnl|my_center|LOCUS_03720 7215 5329 gene locus_tag LOCUS_03730 7215 5329 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931857.1 protein_id gnl|my_center|LOCUS_03730 7685 7434 gene locus_tag LOCUS_03740 7685 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931858.1 protein_id gnl|my_center|LOCUS_03740 7955 10636 gene locus_tag LOCUS_03750 gene alaS 7955 10636 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_03750 10637 11137 gene locus_tag LOCUS_03760 10637 11137 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926805.1 protein_id gnl|my_center|LOCUS_03760 12353 11085 gene locus_tag LOCUS_03770 gene serB 12353 11085 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931867.1 protein_id gnl|my_center|LOCUS_03770 12627 12968 gene locus_tag LOCUS_03780 12627 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 13106 13738 gene locus_tag LOCUS_03790 13106 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 13850 14365 gene locus_tag LOCUS_03800 13850 14365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 14954 15268 gene locus_tag LOCUS_03810 14954 15268 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_03810 15634 16938 gene locus_tag LOCUS_03820 15634 16938 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_03820 16999 17769 gene locus_tag LOCUS_03830 16999 17769 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195415.1 protein_id gnl|my_center|LOCUS_03830 18542 17763 gene locus_tag LOCUS_03840 18542 17763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 20126 18585 gene locus_tag LOCUS_03850 gene guaA 20126 18585 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439265.1 protein_id gnl|my_center|LOCUS_03850 22454 20163 gene locus_tag LOCUS_03860 22454 20163 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927193.1 protein_id gnl|my_center|LOCUS_03860 23350 22463 gene locus_tag LOCUS_03870 23350 22463 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931871.1 protein_id gnl|my_center|LOCUS_03870 23524 24195 gene locus_tag LOCUS_03880 23524 24195 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931872.1 protein_id gnl|my_center|LOCUS_03880 24521 24595 gene locus_tag LOCUS_t00160 24521 24595 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24640 25893 gene locus_tag LOCUS_03890 24640 25893 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926807.1 protein_id gnl|my_center|LOCUS_03890 25893 26633 gene locus_tag LOCUS_03900 25893 26633 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931876.1 protein_id gnl|my_center|LOCUS_03900 26633 26884 gene locus_tag LOCUS_03910 26633 26884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 26996 27322 gene locus_tag LOCUS_03920 26996 27322 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926808.1 protein_id gnl|my_center|LOCUS_03920 27333 28157 gene locus_tag LOCUS_03930 27333 28157 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926809.1 protein_id gnl|my_center|LOCUS_03930 28161 29513 gene locus_tag LOCUS_03940 28161 29513 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932609.1 protein_id gnl|my_center|LOCUS_03940 30160 29690 gene locus_tag LOCUS_03950 30160 29690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931884.1 protein_id gnl|my_center|LOCUS_03950 30348 32870 gene locus_tag LOCUS_03960 30348 32870 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_03960 34284 32914 gene locus_tag LOCUS_03970 34284 32914 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931886.1 protein_id gnl|my_center|LOCUS_03970 34428 34340 gene locus_tag LOCUS_t00170 34428 34340 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35657 34533 gene locus_tag LOCUS_03980 gene thiL 35657 34533 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931893.1 protein_id gnl|my_center|LOCUS_03980 35712 36656 gene locus_tag LOCUS_03990 gene ftsY 35712 36656 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931894.1 protein_id gnl|my_center|LOCUS_03990 36830 37492 gene locus_tag LOCUS_04000 36830 37492 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986876.1 protein_id gnl|my_center|LOCUS_04000 37518 39620 gene locus_tag LOCUS_04010 37518 39620 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931897.1 protein_id gnl|my_center|LOCUS_04010 41402 39639 gene locus_tag LOCUS_04020 gene ptsP 41402 39639 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931898.1 protein_id gnl|my_center|LOCUS_04020 42956 41433 gene locus_tag LOCUS_04030 gene dnaB 42956 41433 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931899.1 protein_id gnl|my_center|LOCUS_04030 43609 42953 gene locus_tag LOCUS_04040 43609 42953 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931900.1 protein_id gnl|my_center|LOCUS_04040 44904 43633 gene locus_tag LOCUS_04050 gene coaBC 44904 43633 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931901.1 protein_id gnl|my_center|LOCUS_04050 49460 44925 gene locus_tag LOCUS_04060 49460 44925 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986829.1 protein_id gnl|my_center|LOCUS_04060 49959 49447 gene locus_tag LOCUS_04070 gene rfaE2 49959 49447 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_04070 50273 51043 gene locus_tag LOCUS_04080 gene rfbF 50273 51043 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816873.1 protein_id gnl|my_center|LOCUS_04080 51061 52128 gene locus_tag LOCUS_04090 gene rfbG 51061 52128 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934346.1 protein_id gnl|my_center|LOCUS_04090 52578 53969 gene locus_tag LOCUS_04100 52578 53969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 54021 54917 gene locus_tag LOCUS_04110 54021 54917 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965478.1 protein_id gnl|my_center|LOCUS_04110 54925 56736 gene locus_tag LOCUS_04120 gene ilvB 54925 56736 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_04120 56739 57437 gene locus_tag LOCUS_04130 56739 57437 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533626.1 protein_id gnl|my_center|LOCUS_04130 57470 58135 gene locus_tag LOCUS_04140 57470 58135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 58132 59205 gene locus_tag LOCUS_04150 gene aroB 58132 59205 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358508.1 protein_id gnl|my_center|LOCUS_04150 59212 60000 gene locus_tag LOCUS_04160 59212 60000 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001977544.1 protein_id gnl|my_center|LOCUS_04160 60036 60452 gene locus_tag LOCUS_04170 60036 60452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 60449 62956 gene locus_tag LOCUS_04180 60449 62956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 62959 63912 gene locus_tag LOCUS_04190 62959 63912 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_04190 63912 64832 gene locus_tag LOCUS_04200 63912 64832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 66819 64867 gene locus_tag LOCUS_04210 66819 64867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926815.1 protein_id gnl|my_center|LOCUS_04210 66919 67851 gene locus_tag LOCUS_04220 66919 67851 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931905.1 protein_id gnl|my_center|LOCUS_04220 67903 68730 gene locus_tag LOCUS_04230 67903 68730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 68776 69774 gene locus_tag LOCUS_04240 68776 69774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 69967 71052 gene locus_tag LOCUS_04250 gene rfaQ 69967 71052 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942892.1 protein_id gnl|my_center|LOCUS_04250 71031 71789 gene locus_tag LOCUS_04260 71031 71789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04260 71761 72573 gene locus_tag LOCUS_04270 71761 72573 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_04270 72576 73442 gene locus_tag LOCUS_04280 72576 73442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 73609 74523 gene locus_tag LOCUS_04290 gene waaF 73609 74523 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466240.1 protein_id gnl|my_center|LOCUS_04290 75546 74569 gene locus_tag LOCUS_04300 75546 74569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931913.1 protein_id gnl|my_center|LOCUS_04300 76660 75614 gene locus_tag LOCUS_04310 76660 75614 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926818.1 protein_id gnl|my_center|LOCUS_04310 77796 76735 gene locus_tag LOCUS_04320 77796 76735 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926821.1 protein_id gnl|my_center|LOCUS_04320 77989 78951 gene locus_tag LOCUS_04330 77989 78951 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931924.1 protein_id gnl|my_center|LOCUS_04330 78963 79805 gene locus_tag LOCUS_04340 78963 79805 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927196.1 protein_id gnl|my_center|LOCUS_04340 79932 80402 gene locus_tag LOCUS_04350 79932 80402 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926822.1 protein_id gnl|my_center|LOCUS_04350 80408 81700 gene locus_tag LOCUS_04360 gene hisS 80408 81700 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931928.1 protein_id gnl|my_center|LOCUS_04360 81697 81948 gene locus_tag LOCUS_04370 81697 81948 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931929.1 protein_id gnl|my_center|LOCUS_04370 82285 82806 gene locus_tag LOCUS_04380 gene rimP 82285 82806 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931931.1 protein_id gnl|my_center|LOCUS_04380 82867 84411 gene locus_tag LOCUS_04390 gene nusA 82867 84411 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931932.1 protein_id gnl|my_center|LOCUS_04390 84475 87270 gene locus_tag LOCUS_04400 gene infB 84475 87270 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931933.1 protein_id gnl|my_center|LOCUS_04400 87289 87648 gene locus_tag LOCUS_04410 gene rbfA 87289 87648 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931934.1 protein_id gnl|my_center|LOCUS_04410 87675 88409 gene locus_tag LOCUS_04420 gene truB 87675 88409 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931935.1 protein_id gnl|my_center|LOCUS_04420 88420 89382 gene locus_tag LOCUS_04430 88420 89382 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_04430 89431 89700 gene locus_tag LOCUS_04440 gene rpsO 89431 89700 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931937.1 protein_id gnl|my_center|LOCUS_04440 89787 90674 gene locus_tag LOCUS_04450 89787 90674 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931938.1 protein_id gnl|my_center|LOCUS_04450 90679 91263 gene locus_tag LOCUS_04460 gene gmk 90679 91263 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931939.1 protein_id gnl|my_center|LOCUS_04460 91275 91628 gene locus_tag LOCUS_04470 91275 91628 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931940.1 protein_id gnl|my_center|LOCUS_04470 91606 92103 gene locus_tag LOCUS_04480 91606 92103 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931941.1 protein_id gnl|my_center|LOCUS_04480 92864 92115 gene locus_tag LOCUS_04490 92864 92115 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931943.1 protein_id gnl|my_center|LOCUS_04490 93256 92864 gene locus_tag LOCUS_04500 93256 92864 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931944.1 protein_id gnl|my_center|LOCUS_04500 93791 93273 gene locus_tag LOCUS_04510 gene lptC 93791 93273 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986830.1 protein_id gnl|my_center|LOCUS_04510 94346 93843 gene locus_tag LOCUS_04520 94346 93843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 95694 94543 gene locus_tag LOCUS_04530 gene dprA 95694 94543 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926825.1 protein_id gnl|my_center|LOCUS_04530 96720 95707 gene locus_tag LOCUS_04540 96720 95707 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931948.1 protein_id gnl|my_center|LOCUS_04540 97790 96717 gene locus_tag LOCUS_04550 gene fni 97790 96717 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931949.1 protein_id gnl|my_center|LOCUS_04550 97898 99166 gene locus_tag LOCUS_04560 97898 99166 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931950.1 protein_id gnl|my_center|LOCUS_04560 101000 99147 gene locus_tag LOCUS_04570 101000 99147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931951.1 protein_id gnl|my_center|LOCUS_04570 102399 101002 gene locus_tag LOCUS_04580 gene glmM 102399 101002 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931952.1 protein_id gnl|my_center|LOCUS_04580 102631 102912 gene locus_tag LOCUS_04590 gene rpsT 102631 102912 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931953.1 protein_id gnl|my_center|LOCUS_04590 103001 103603 gene locus_tag LOCUS_04600 gene ruvA 103001 103603 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931954.1 protein_id gnl|my_center|LOCUS_04600 103613 104881 gene locus_tag LOCUS_04610 103613 104881 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926826.1 protein_id gnl|my_center|LOCUS_04610 105209 106498 gene locus_tag LOCUS_04620 gene rho 105209 106498 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139456756.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence05 609 824 gene locus_tag LOCUS_04630 609 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 1944 892 gene locus_tag LOCUS_04640 gene lpxD 1944 892 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933028.1 protein_id gnl|my_center|LOCUS_04640 2120 3103 gene locus_tag LOCUS_04650 2120 3103 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933029.1 protein_id gnl|my_center|LOCUS_04650 3135 3734 gene locus_tag LOCUS_04660 3135 3734 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933030.1 protein_id gnl|my_center|LOCUS_04660 3815 5305 gene locus_tag LOCUS_04670 3815 5305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933032.1 protein_id gnl|my_center|LOCUS_04670 5339 5614 gene locus_tag LOCUS_04680 5339 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933034.1 protein_id gnl|my_center|LOCUS_04680 6996 5695 gene locus_tag LOCUS_04690 6996 5695 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926993.1 protein_id gnl|my_center|LOCUS_04690 8164 7061 gene locus_tag LOCUS_04700 gene ald 8164 7061 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926910.1 protein_id gnl|my_center|LOCUS_04700 9078 8677 gene locus_tag LOCUS_04710 9078 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 9470 9075 gene locus_tag LOCUS_04720 9470 9075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 11935 9743 gene locus_tag LOCUS_04730 11935 9743 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933035.1 protein_id gnl|my_center|LOCUS_04730 12043 12912 gene locus_tag LOCUS_04740 gene metF 12043 12912 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_04740 14178 12925 gene locus_tag LOCUS_04750 gene lysA 14178 12925 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933039.1 protein_id gnl|my_center|LOCUS_04750 14330 14512 gene locus_tag LOCUS_04760 gene rpmG 14330 14512 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_04760 14545 14627 gene locus_tag LOCUS_t00180 14545 14627 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14786 15586 gene locus_tag LOCUS_04770 14786 15586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927023.1 protein_id gnl|my_center|LOCUS_04770 19693 16061 gene locus_tag LOCUS_04780 19693 16061 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940330.1 protein_id gnl|my_center|LOCUS_04780 21933 20008 gene locus_tag LOCUS_04790 21933 20008 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932515.1 protein_id gnl|my_center|LOCUS_04790 22822 25521 gene locus_tag LOCUS_04800 22822 25521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 25643 26179 gene locus_tag LOCUS_04810 25643 26179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 26154 27158 gene locus_tag LOCUS_04820 26154 27158 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_04820 27497 27793 gene locus_tag LOCUS_04830 27497 27793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 29876 28344 gene locus_tag LOCUS_04840 29876 28344 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926942.1 protein_id gnl|my_center|LOCUS_04840 30410 29925 gene locus_tag LOCUS_04850 30410 29925 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_04850 30579 32132 gene locus_tag LOCUS_04860 30579 32132 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932512.1 protein_id gnl|my_center|LOCUS_04860 33019 32141 gene locus_tag LOCUS_04870 33019 32141 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932511.1 protein_id gnl|my_center|LOCUS_04870 34937 33051 gene locus_tag LOCUS_04880 gene htpG 34937 33051 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932510.1 protein_id gnl|my_center|LOCUS_04880 35893 34997 gene locus_tag LOCUS_04890 35893 34997 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_04890 36469 35951 gene locus_tag LOCUS_04900 36469 35951 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932505.1 protein_id gnl|my_center|LOCUS_04900 36672 37985 gene locus_tag LOCUS_04910 36672 37985 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933159.1 protein_id gnl|my_center|LOCUS_04910 37999 38859 gene locus_tag LOCUS_04920 37999 38859 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933160.1 protein_id gnl|my_center|LOCUS_04920 39727 38864 gene locus_tag LOCUS_04930 gene ispE 39727 38864 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933161.1 protein_id gnl|my_center|LOCUS_04930 39821 40540 gene locus_tag LOCUS_04940 39821 40540 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927040.1 protein_id gnl|my_center|LOCUS_04940 40577 41704 gene locus_tag LOCUS_04950 40577 41704 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933163.1 protein_id gnl|my_center|LOCUS_04950 43233 41725 gene locus_tag LOCUS_04960 gene lnt 43233 41725 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_04960 43537 44637 gene locus_tag LOCUS_04970 43537 44637 CDS product bacteriochlorophyll a protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933165.1 protein_id gnl|my_center|LOCUS_04970 45090 44689 gene locus_tag LOCUS_04980 45090 44689 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933166.1 protein_id gnl|my_center|LOCUS_04980 45427 45227 gene locus_tag LOCUS_04990 45427 45227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 45326 46921 gene locus_tag LOCUS_05000 45326 46921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933167.1 protein_id gnl|my_center|LOCUS_05000 48098 46911 gene locus_tag LOCUS_05010 gene purT 48098 46911 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932738.1 protein_id gnl|my_center|LOCUS_05010 48780 48283 gene locus_tag LOCUS_05020 48780 48283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 49602 49300 gene locus_tag LOCUS_05030 49602 49300 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_05030 49885 49604 gene locus_tag LOCUS_05040 49885 49604 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_05040 51236 49995 gene locus_tag LOCUS_05050 51236 49995 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164996215.1 protein_id gnl|my_center|LOCUS_05050 51956 51603 gene locus_tag LOCUS_05060 51956 51603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 53407 52025 gene locus_tag LOCUS_05070 53407 52025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 53784 53512 gene locus_tag LOCUS_05080 53784 53512 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 protein_id gnl|my_center|LOCUS_05080 54203 53904 gene locus_tag LOCUS_05090 54203 53904 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_05090 54417 54193 gene locus_tag LOCUS_05100 54417 54193 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_05100 55571 58114 gene locus_tag LOCUS_05110 gene mgtA 55571 58114 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_05110 58549 58136 gene locus_tag LOCUS_05120 gene arfB 58549 58136 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 protein_id gnl|my_center|LOCUS_05120 59740 58553 gene locus_tag LOCUS_05130 59740 58553 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266835.1 protein_id gnl|my_center|LOCUS_05130 61903 62367 gene locus_tag LOCUS_05140 61903 62367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 62843 65206 gene locus_tag LOCUS_05150 62843 65206 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932519.1 protein_id gnl|my_center|LOCUS_05150 65248 65703 gene locus_tag LOCUS_05160 65248 65703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 65970 66422 gene locus_tag LOCUS_05170 65970 66422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 67301 66543 gene locus_tag LOCUS_05180 67301 66543 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932600.1 protein_id gnl|my_center|LOCUS_05180 67957 67325 gene locus_tag LOCUS_05190 67957 67325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 68303 67938 gene locus_tag LOCUS_05200 68303 67938 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_05200 69260 68379 gene locus_tag LOCUS_05210 69260 68379 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932599.1 protein_id gnl|my_center|LOCUS_05210 70554 69283 gene locus_tag LOCUS_05220 70554 69283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932597.1 protein_id gnl|my_center|LOCUS_05220 70951 70535 gene locus_tag LOCUS_05230 70951 70535 CDS product DoxX-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926952.1 protein_id gnl|my_center|LOCUS_05230 74098 70988 gene locus_tag LOCUS_05240 74098 70988 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_05240 75132 74095 gene locus_tag LOCUS_05250 gene vmeC 75132 74095 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455175.1 protein_id gnl|my_center|LOCUS_05250 76000 75269 gene locus_tag LOCUS_05260 76000 75269 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932583.1 protein_id gnl|my_center|LOCUS_05260 76793 76107 gene locus_tag LOCUS_05270 gene phoU 76793 76107 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932580.1 protein_id gnl|my_center|LOCUS_05270 77672 76812 gene locus_tag LOCUS_05280 gene pstB 77672 76812 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932579.1 protein_id gnl|my_center|LOCUS_05280 79025 77679 gene locus_tag LOCUS_05290 gene pstA 79025 77679 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932578.1 protein_id gnl|my_center|LOCUS_05290 80213 79050 gene locus_tag LOCUS_05300 80213 79050 CDS product PstC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926951.1 protein_id gnl|my_center|LOCUS_05300 81239 80427 gene locus_tag LOCUS_05310 81239 80427 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932575.1 protein_id gnl|my_center|LOCUS_05310 81476 81700 gene locus_tag LOCUS_05320 81476 81700 CDS product chlorosome envelope protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927140.1 protein_id gnl|my_center|LOCUS_05320 81818 82483 gene locus_tag LOCUS_05330 81818 82483 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_05330 82899 84119 gene locus_tag LOCUS_05340 82899 84119 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_05340 84122 84886 gene locus_tag LOCUS_05350 84122 84886 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_05350 84876 86675 gene locus_tag LOCUS_05360 84876 86675 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810170.1 protein_id gnl|my_center|LOCUS_05360 86965 88407 gene locus_tag LOCUS_05370 86965 88407 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_05370 88468 88968 gene locus_tag LOCUS_05380 88468 88968 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876457.1 protein_id gnl|my_center|LOCUS_05380 89002 89424 gene locus_tag LOCUS_05390 89002 89424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 90565 89444 gene locus_tag LOCUS_05400 90565 89444 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_05400 91688 90588 gene locus_tag LOCUS_05410 91688 90588 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_05410 92431 91694 gene locus_tag LOCUS_05420 92431 91694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 93356 92424 gene locus_tag LOCUS_05430 93356 92424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 94255 93353 gene locus_tag LOCUS_05440 94255 93353 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_05440 95506 94301 gene locus_tag LOCUS_05450 95506 94301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 96840 95752 gene locus_tag LOCUS_05460 96840 95752 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932259.1 protein_id gnl|my_center|LOCUS_05460 97820 96852 gene locus_tag LOCUS_05470 gene nadA 97820 96852 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932257.1 protein_id gnl|my_center|LOCUS_05470 98252 97866 gene locus_tag LOCUS_05480 98252 97866 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_05480 98896 99738 gene locus_tag LOCUS_05490 gene mreC 98896 99738 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926883.1 protein_id gnl|my_center|LOCUS_05490 99821 100246 gene locus_tag LOCUS_05500 99821 100246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 100250 102169 gene locus_tag LOCUS_05510 gene mrdA 100250 102169 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932253.1 protein_id gnl|my_center|LOCUS_05510 102166 103653 gene locus_tag LOCUS_05520 102166 103653 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_05520 103664 104137 gene locus_tag LOCUS_05530 gene smpB 103664 104137 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932251.1 protein_id gnl|my_center|LOCUS_05530 104157 105368 gene locus_tag LOCUS_05540 gene tyrS 104157 105368 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932250.1 protein_id gnl|my_center|LOCUS_05540 105732 105412 gene locus_tag LOCUS_05550 105732 105412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence06 1402 422 gene locus_tag LOCUS_05560 1402 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 4782 1399 gene locus_tag LOCUS_05570 4782 1399 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 protein_id gnl|my_center|LOCUS_05570 6068 4830 gene locus_tag LOCUS_05580 6068 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 6735 6256 gene locus_tag LOCUS_05590 6735 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582786.1 protein_id gnl|my_center|LOCUS_05590 8302 7397 gene locus_tag LOCUS_05600 8302 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 8835 8428 gene locus_tag LOCUS_05610 8835 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 9401 8946 gene locus_tag LOCUS_05620 9401 8946 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926969.1 protein_id gnl|my_center|LOCUS_05620 10566 9472 gene locus_tag LOCUS_05630 10566 9472 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932520.1 protein_id gnl|my_center|LOCUS_05630 11024 10539 gene locus_tag LOCUS_05640 11024 10539 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932926.1 protein_id gnl|my_center|LOCUS_05640 11416 11126 gene locus_tag LOCUS_05650 11416 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 11949 11494 gene locus_tag LOCUS_05660 11949 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 15790 12596 gene locus_tag LOCUS_05670 15790 12596 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932984.1 protein_id gnl|my_center|LOCUS_05670 17373 16105 gene locus_tag LOCUS_05680 17373 16105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 17775 17422 gene locus_tag LOCUS_05690 17775 17422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 18005 17772 gene locus_tag LOCUS_05700 18005 17772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 18513 18148 gene locus_tag LOCUS_05710 18513 18148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 19235 18510 gene locus_tag LOCUS_05720 19235 18510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 20274 20035 gene locus_tag LOCUS_05730 20274 20035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 20588 21142 gene locus_tag LOCUS_05740 20588 21142 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695952.1 protein_id gnl|my_center|LOCUS_05740 21269 21493 gene locus_tag LOCUS_05750 21269 21493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 21500 21676 gene locus_tag LOCUS_05760 21500 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 22246 24420 gene locus_tag LOCUS_05770 22246 24420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 28121 24750 gene locus_tag LOCUS_05780 28121 24750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 28827 29693 gene locus_tag LOCUS_05790 28827 29693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 29693 30478 gene locus_tag LOCUS_05800 29693 30478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 31240 34821 gene locus_tag LOCUS_05810 gene recB 31240 34821 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932747.1 protein_id gnl|my_center|LOCUS_05810 34826 36562 gene locus_tag LOCUS_05820 gene recD 34826 36562 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 protein_id gnl|my_center|LOCUS_05820 37198 36965 gene locus_tag LOCUS_05830 37198 36965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 37471 37292 gene locus_tag LOCUS_05840 37471 37292 CDS product FaeA/PapI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813931.1 protein_id gnl|my_center|LOCUS_05840 37688 38833 gene locus_tag LOCUS_05850 37688 38833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_05850 38939 39808 gene locus_tag LOCUS_05860 38939 39808 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_05860 39808 40803 gene locus_tag LOCUS_05870 39808 40803 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_05870 40800 41528 gene locus_tag LOCUS_05880 40800 41528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_05880 41521 42216 gene locus_tag LOCUS_05890 41521 42216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_05890 42338 43789 gene locus_tag LOCUS_05900 42338 43789 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948261.1 protein_id gnl|my_center|LOCUS_05900 43887 44195 gene locus_tag LOCUS_05910 43887 44195 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986832.1 protein_id gnl|my_center|LOCUS_05910 44659 44387 gene locus_tag LOCUS_05920 44659 44387 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_05920 46826 44994 gene locus_tag LOCUS_05930 46826 44994 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_05930 48087 46891 gene locus_tag LOCUS_05940 48087 46891 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_05940 48241 49041 gene locus_tag LOCUS_05950 gene lgt 48241 49041 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932768.1 protein_id gnl|my_center|LOCUS_05950 49677 49027 gene locus_tag LOCUS_05960 49677 49027 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932773.1 protein_id gnl|my_center|LOCUS_05960 49931 50410 gene locus_tag LOCUS_05970 49931 50410 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926982.1 protein_id gnl|my_center|LOCUS_05970 51626 50376 gene locus_tag LOCUS_05980 51626 50376 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932780.1 protein_id gnl|my_center|LOCUS_05980 52920 51649 gene locus_tag LOCUS_05990 52920 51649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932781.1 protein_id gnl|my_center|LOCUS_05990 54182 52917 gene locus_tag LOCUS_06000 54182 52917 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926983.1 protein_id gnl|my_center|LOCUS_06000 54975 54187 gene locus_tag LOCUS_06010 54975 54187 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932784.1 protein_id gnl|my_center|LOCUS_06010 55396 56427 gene locus_tag LOCUS_06020 gene argC 55396 56427 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932787.1 protein_id gnl|my_center|LOCUS_06020 56535 57743 gene locus_tag LOCUS_06030 gene argJ 56535 57743 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932788.1 protein_id gnl|my_center|LOCUS_06030 57781 58695 gene locus_tag LOCUS_06040 gene argB 57781 58695 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926984.1 protein_id gnl|my_center|LOCUS_06040 58700 59716 gene locus_tag LOCUS_06050 gene argF 58700 59716 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932790.1 protein_id gnl|my_center|LOCUS_06050 59731 60177 gene locus_tag LOCUS_06060 59731 60177 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932791.1 protein_id gnl|my_center|LOCUS_06060 60195 61397 gene locus_tag LOCUS_06070 60195 61397 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932792.1 protein_id gnl|my_center|LOCUS_06070 62226 61489 gene locus_tag LOCUS_06080 62226 61489 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_06080 62349 63734 gene locus_tag LOCUS_06090 gene argH 62349 63734 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932733.1 protein_id gnl|my_center|LOCUS_06090 65788 63731 gene locus_tag LOCUS_06100 65788 63731 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926974.1 protein_id gnl|my_center|LOCUS_06100 66324 65806 gene locus_tag LOCUS_06110 66324 65806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 68410 66344 gene locus_tag LOCUS_06120 68410 66344 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926974.1 protein_id gnl|my_center|LOCUS_06120 68583 69557 gene locus_tag LOCUS_06130 68583 69557 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_06130 70780 69560 gene locus_tag LOCUS_06140 70780 69560 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932730.1 protein_id gnl|my_center|LOCUS_06140 71485 70808 gene locus_tag LOCUS_06150 71485 70808 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932729.1 protein_id gnl|my_center|LOCUS_06150 71910 71476 gene locus_tag LOCUS_06160 gene rpiB 71910 71476 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932728.1 protein_id gnl|my_center|LOCUS_06160 74021 71907 gene locus_tag LOCUS_06170 gene ppk1 74021 71907 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986865.1 protein_id gnl|my_center|LOCUS_06170 74538 74038 gene locus_tag LOCUS_06180 74538 74038 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932726.1 protein_id gnl|my_center|LOCUS_06180 74947 76275 gene locus_tag LOCUS_06190 74947 76275 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932720.1 protein_id gnl|my_center|LOCUS_06190 76395 76589 gene locus_tag LOCUS_06200 76395 76589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932719.1 protein_id gnl|my_center|LOCUS_06200 76671 77459 gene locus_tag LOCUS_06210 76671 77459 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932718.1 protein_id gnl|my_center|LOCUS_06210 78466 77471 gene locus_tag LOCUS_06220 78466 77471 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932715.1 protein_id gnl|my_center|LOCUS_06220 79510 78557 gene locus_tag LOCUS_06230 79510 78557 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932714.1 protein_id gnl|my_center|LOCUS_06230 80633 79803 gene locus_tag LOCUS_06240 80633 79803 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932815.1 protein_id gnl|my_center|LOCUS_06240 81176 81460 gene locus_tag LOCUS_06250 81176 81460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 83574 81496 gene locus_tag LOCUS_06260 83574 81496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 83936 84526 gene locus_tag LOCUS_06270 83936 84526 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932818.1 protein_id gnl|my_center|LOCUS_06270 86156 84591 gene locus_tag LOCUS_06280 gene hcp 86156 84591 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927070.1 protein_id gnl|my_center|LOCUS_06280 86652 86386 gene locus_tag LOCUS_06290 86652 86386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06290 87720 86836 gene locus_tag LOCUS_06300 87720 86836 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_06300 88197 87730 gene locus_tag LOCUS_06310 88197 87730 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933365.1 protein_id gnl|my_center|LOCUS_06310 88429 88737 gene locus_tag LOCUS_06320 88429 88737 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958263.1 protein_id gnl|my_center|LOCUS_06320 88980 89051 gene locus_tag LOCUS_t00190 88980 89051 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 90261 89104 gene locus_tag LOCUS_06330 90261 89104 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932823.1 protein_id gnl|my_center|LOCUS_06330 91410 90280 gene locus_tag LOCUS_06340 91410 90280 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932824.1 protein_id gnl|my_center|LOCUS_06340 92136 91423 gene locus_tag LOCUS_06350 92136 91423 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932825.1 protein_id gnl|my_center|LOCUS_06350 93115 92159 gene locus_tag LOCUS_06360 93115 92159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932826.1 protein_id gnl|my_center|LOCUS_06360 94176 93112 gene locus_tag LOCUS_06370 94176 93112 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932827.1 protein_id gnl|my_center|LOCUS_06370 94355 96187 gene locus_tag LOCUS_06380 94355 96187 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_06380 97068 96241 gene locus_tag LOCUS_06390 97068 96241 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932834.1 protein_id gnl|my_center|LOCUS_06390 97570 97208 gene locus_tag LOCUS_06400 gene rplS 97570 97208 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932835.1 protein_id gnl|my_center|LOCUS_06400 98321 97620 gene locus_tag LOCUS_06410 gene trmD 98321 97620 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932836.1 protein_id gnl|my_center|LOCUS_06410 98825 98322 gene locus_tag LOCUS_06420 gene rimM 98825 98322 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932837.1 protein_id gnl|my_center|LOCUS_06420 99221 98850 gene locus_tag LOCUS_06430 gene rpsP 99221 98850 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932838.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence07 1038 136 gene locus_tag LOCUS_06440 1038 136 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927052.1 protein_id gnl|my_center|LOCUS_06440 1562 2065 gene locus_tag LOCUS_06450 1562 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2619 2185 gene locus_tag LOCUS_06460 2619 2185 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_06460 3011 2604 gene locus_tag LOCUS_06470 3011 2604 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038625.1 protein_id gnl|my_center|LOCUS_06470 4629 3256 gene locus_tag LOCUS_06480 4629 3256 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_06480 5602 4658 gene locus_tag LOCUS_06490 gene rsgA 5602 4658 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933238.1 protein_id gnl|my_center|LOCUS_06490 7786 5669 gene locus_tag LOCUS_06500 gene recG 7786 5669 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933239.1 protein_id gnl|my_center|LOCUS_06500 7807 8112 gene locus_tag LOCUS_06510 7807 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 8165 8725 gene locus_tag LOCUS_06520 gene frr 8165 8725 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933241.1 protein_id gnl|my_center|LOCUS_06520 9955 8789 gene locus_tag LOCUS_06530 gene bchY 9955 8789 CDS product chlorophyllide a reductase subunit Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927095.1 protein_id gnl|my_center|LOCUS_06530 11036 10008 gene locus_tag LOCUS_06540 11036 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 13285 12056 gene locus_tag LOCUS_06550 13285 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 13567 14772 gene locus_tag LOCUS_06560 gene xseA 13567 14772 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933488.1 protein_id gnl|my_center|LOCUS_06560 15499 14753 gene locus_tag LOCUS_06570 gene kdsB 15499 14753 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933490.1 protein_id gnl|my_center|LOCUS_06570 15805 15500 gene locus_tag LOCUS_06580 15805 15500 CDS product DUF167 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933492.1 protein_id gnl|my_center|LOCUS_06580 16085 15798 gene locus_tag LOCUS_06590 gene gatC 16085 15798 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_06590 17505 16162 gene locus_tag LOCUS_06600 17505 16162 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_06600 17680 17755 gene locus_tag LOCUS_t00200 17680 17755 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 18603 17860 gene locus_tag LOCUS_06610 18603 17860 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_06610 18857 18651 gene locus_tag LOCUS_06620 18857 18651 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933495.1 protein_id gnl|my_center|LOCUS_06620 19222 19656 gene locus_tag LOCUS_06630 19222 19656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 19875 21056 gene locus_tag LOCUS_06640 19875 21056 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927099.1 protein_id gnl|my_center|LOCUS_06640 21092 22807 gene locus_tag LOCUS_06650 gene menD 21092 22807 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927100.1 protein_id gnl|my_center|LOCUS_06650 23598 22858 gene locus_tag LOCUS_06660 23598 22858 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121746.1 protein_id gnl|my_center|LOCUS_06660 24127 23828 gene locus_tag LOCUS_06670 24127 23828 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036266.1 protein_id gnl|my_center|LOCUS_06670 24411 24124 gene locus_tag LOCUS_06680 24411 24124 CDS product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036265.1 protein_id gnl|my_center|LOCUS_06680 24737 25582 gene locus_tag LOCUS_06690 gene menH 24737 25582 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933504.1 protein_id gnl|my_center|LOCUS_06690 25579 26400 gene locus_tag LOCUS_06700 gene menB 25579 26400 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_06700 26397 27470 gene locus_tag LOCUS_06710 gene menC 26397 27470 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933506.1 protein_id gnl|my_center|LOCUS_06710 27764 29233 gene locus_tag LOCUS_06720 gene menE 27764 29233 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933507.1 protein_id gnl|my_center|LOCUS_06720 29753 29208 gene locus_tag LOCUS_06730 29753 29208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933508.1 protein_id gnl|my_center|LOCUS_06730 30505 29759 gene locus_tag LOCUS_06740 gene dapB 30505 29759 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933509.1 protein_id gnl|my_center|LOCUS_06740 31446 30547 gene locus_tag LOCUS_06750 31446 30547 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933510.1 protein_id gnl|my_center|LOCUS_06750 32259 31462 gene locus_tag LOCUS_06760 32259 31462 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933511.1 protein_id gnl|my_center|LOCUS_06760 32355 32945 gene locus_tag LOCUS_06770 32355 32945 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933512.1 protein_id gnl|my_center|LOCUS_06770 33053 34435 gene locus_tag LOCUS_06780 gene mgtE 33053 34435 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_06780 34451 36082 gene locus_tag LOCUS_06790 34451 36082 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958018.1 protein_id gnl|my_center|LOCUS_06790 36391 37353 gene locus_tag LOCUS_06800 36391 37353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 37356 38927 gene locus_tag LOCUS_06810 37356 38927 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256724.1 protein_id gnl|my_center|LOCUS_06810 39032 41656 gene locus_tag LOCUS_06820 39032 41656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 41616 43661 gene locus_tag LOCUS_06830 41616 43661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 43961 45382 gene locus_tag LOCUS_06840 43961 45382 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933564.1 protein_id gnl|my_center|LOCUS_06840 45473 46717 gene locus_tag LOCUS_06850 45473 46717 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986860.1 protein_id gnl|my_center|LOCUS_06850 47515 46730 gene locus_tag LOCUS_06860 47515 46730 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259119.1 protein_id gnl|my_center|LOCUS_06860 48160 47636 gene locus_tag LOCUS_06870 48160 47636 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933483.1 protein_id gnl|my_center|LOCUS_06870 48519 48349 gene locus_tag LOCUS_06880 48519 48349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 48740 48516 gene locus_tag LOCUS_06890 48740 48516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 49172 49498 gene locus_tag LOCUS_06900 49172 49498 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933565.1 protein_id gnl|my_center|LOCUS_06900 49502 50311 gene locus_tag LOCUS_06910 49502 50311 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933566.1 protein_id gnl|my_center|LOCUS_06910 51575 50274 gene locus_tag LOCUS_06920 gene aroA 51575 50274 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933576.1 protein_id gnl|my_center|LOCUS_06920 52454 51894 gene locus_tag LOCUS_06930 52454 51894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933578.1 protein_id gnl|my_center|LOCUS_06930 53994 52621 gene locus_tag LOCUS_06940 53994 52621 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933579.1 protein_id gnl|my_center|LOCUS_06940 54221 55372 gene locus_tag LOCUS_06950 gene alr 54221 55372 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933580.1 protein_id gnl|my_center|LOCUS_06950 55369 55884 gene locus_tag LOCUS_06960 55369 55884 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933581.1 protein_id gnl|my_center|LOCUS_06960 55896 56747 gene locus_tag LOCUS_06970 55896 56747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933582.1 protein_id gnl|my_center|LOCUS_06970 58024 56864 gene locus_tag LOCUS_06980 58024 56864 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_06980 61780 58355 gene locus_tag LOCUS_06990 61780 58355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 62133 61879 gene locus_tag LOCUS_07000 62133 61879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 62394 62137 gene locus_tag LOCUS_07010 62394 62137 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_07010 63556 62537 gene locus_tag LOCUS_07020 63556 62537 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933585.1 protein_id gnl|my_center|LOCUS_07020 64610 63567 gene locus_tag LOCUS_07030 gene dusB 64610 63567 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_07030 65671 64607 gene locus_tag LOCUS_07040 gene recA 65671 64607 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933587.1 protein_id gnl|my_center|LOCUS_07040 66691 65702 gene locus_tag LOCUS_07050 66691 65702 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933588.1 protein_id gnl|my_center|LOCUS_07050 66946 68226 gene locus_tag LOCUS_07060 66946 68226 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986805.1 protein_id gnl|my_center|LOCUS_07060 68325 69608 gene locus_tag LOCUS_07070 gene tig 68325 69608 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933591.1 protein_id gnl|my_center|LOCUS_07070 70035 69673 gene locus_tag LOCUS_07080 gene acpS 70035 69673 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933592.1 protein_id gnl|my_center|LOCUS_07080 70929 70048 gene locus_tag LOCUS_07090 gene nadC 70929 70048 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927121.1 protein_id gnl|my_center|LOCUS_07090 71241 71576 gene locus_tag LOCUS_07100 71241 71576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 71576 71953 gene locus_tag LOCUS_07110 gene folB 71576 71953 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933594.1 protein_id gnl|my_center|LOCUS_07110 71958 72500 gene locus_tag LOCUS_07120 gene folK 71958 72500 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933595.1 protein_id gnl|my_center|LOCUS_07120 73691 72537 gene locus_tag LOCUS_07130 73691 72537 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933596.1 protein_id gnl|my_center|LOCUS_07130 75275 73749 gene locus_tag LOCUS_07140 75275 73749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 75689 75447 gene locus_tag LOCUS_07150 75689 75447 CDS product bacteriochlorophyll c-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933599.1 protein_id gnl|my_center|LOCUS_07150 76254 75835 gene locus_tag LOCUS_07160 76254 75835 CDS product chlorosome protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933600.1 protein_id gnl|my_center|LOCUS_07160 77602 76376 gene locus_tag LOCUS_07170 77602 76376 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933602.1 protein_id gnl|my_center|LOCUS_07170 77747 78616 gene locus_tag LOCUS_07180 77747 78616 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933603.1 protein_id gnl|my_center|LOCUS_07180 78720 79187 gene locus_tag LOCUS_07190 78720 79187 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_07190 79248 80288 gene locus_tag LOCUS_07200 gene holA 79248 80288 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933605.1 protein_id gnl|my_center|LOCUS_07200 81293 80301 gene locus_tag LOCUS_07210 81293 80301 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927122.1 protein_id gnl|my_center|LOCUS_07210 81534 82736 gene locus_tag LOCUS_07220 81534 82736 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927123.1 protein_id gnl|my_center|LOCUS_07220 83085 85703 gene locus_tag LOCUS_07230 83085 85703 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933610.1 protein_id gnl|my_center|LOCUS_07230 85859 89662 gene locus_tag LOCUS_07240 gene bchH 85859 89662 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927124.1 protein_id gnl|my_center|LOCUS_07240 89692 93516 gene locus_tag LOCUS_07250 89692 93516 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933614.1 protein_id gnl|my_center|LOCUS_07250 93575 94273 gene locus_tag LOCUS_07260 gene bchM 93575 94273 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933615.1 protein_id gnl|my_center|LOCUS_07260 94420 96060 gene locus_tag LOCUS_07270 gene bchE 94420 96060 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933616.1 protein_id gnl|my_center|LOCUS_07270 <97351 96153 gene locus_tag LOCUS_07280 <97351 96153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114402.1:type I restriction endonuclease subunit R >Feature sequence08 546 920 gene locus_tag LOCUS_07290 546 920 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120800232.1 protein_id gnl|my_center|LOCUS_07290 913 1236 gene locus_tag LOCUS_07300 913 1236 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969960.1 protein_id gnl|my_center|LOCUS_07300 1699 1265 gene locus_tag LOCUS_07310 1699 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 2212 1946 gene locus_tag LOCUS_07320 2212 1946 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142529.1 protein_id gnl|my_center|LOCUS_07320 2552 2812 gene locus_tag LOCUS_07330 2552 2812 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_07330 2950 3222 gene locus_tag LOCUS_07340 2950 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07340 5054 3363 gene locus_tag LOCUS_07350 5054 3363 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931740.1 protein_id gnl|my_center|LOCUS_07350 6358 5072 gene locus_tag LOCUS_07360 gene bioA 6358 5072 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931741.1 protein_id gnl|my_center|LOCUS_07360 7048 6374 gene locus_tag LOCUS_07370 gene bioD 7048 6374 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439254.1 protein_id gnl|my_center|LOCUS_07370 7833 7045 gene locus_tag LOCUS_07380 gene bioC 7833 7045 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931743.1 protein_id gnl|my_center|LOCUS_07380 8507 7818 gene locus_tag LOCUS_07390 8507 7818 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926793.1 protein_id gnl|my_center|LOCUS_07390 9672 8515 gene locus_tag LOCUS_07400 9672 8515 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931745.1 protein_id gnl|my_center|LOCUS_07400 10687 9683 gene locus_tag LOCUS_07410 gene bioB 10687 9683 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931746.1 protein_id gnl|my_center|LOCUS_07410 11692 10706 gene locus_tag LOCUS_07420 11692 10706 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931747.1 protein_id gnl|my_center|LOCUS_07420 13544 11814 gene locus_tag LOCUS_07430 13544 11814 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986824.1 protein_id gnl|my_center|LOCUS_07430 13768 16158 gene locus_tag LOCUS_07440 gene topA 13768 16158 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931749.1 protein_id gnl|my_center|LOCUS_07440 18313 16175 gene locus_tag LOCUS_07450 gene feoB 18313 16175 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_07450 18560 18330 gene locus_tag LOCUS_07460 18560 18330 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931751.1 protein_id gnl|my_center|LOCUS_07460 19058 18696 gene locus_tag LOCUS_07470 19058 18696 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931752.1 protein_id gnl|my_center|LOCUS_07470 20536 19205 gene locus_tag LOCUS_07480 20536 19205 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_07480 21385 20849 gene locus_tag LOCUS_07490 21385 20849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 23621 21540 gene locus_tag LOCUS_07500 23621 21540 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 protein_id gnl|my_center|LOCUS_07500 24324 23938 gene locus_tag LOCUS_07510 24324 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 24498 24992 gene locus_tag LOCUS_07520 24498 24992 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931767.1 protein_id gnl|my_center|LOCUS_07520 25562 25158 gene locus_tag LOCUS_07530 25562 25158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 26797 26024 gene locus_tag LOCUS_07540 26797 26024 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_07540 28747 26807 gene locus_tag LOCUS_07550 28747 26807 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006365757.1 protein_id gnl|my_center|LOCUS_07550 29472 28801 gene locus_tag LOCUS_07560 29472 28801 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927180.1 protein_id gnl|my_center|LOCUS_07560 30214 29561 gene locus_tag LOCUS_07570 30214 29561 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_07570 30993 30211 gene locus_tag LOCUS_07580 30993 30211 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933920.1 protein_id gnl|my_center|LOCUS_07580 31150 31641 gene locus_tag LOCUS_07590 31150 31641 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933922.1 protein_id gnl|my_center|LOCUS_07590 32368 31700 gene locus_tag LOCUS_07600 gene fsa 32368 31700 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931704.1 protein_id gnl|my_center|LOCUS_07600 33427 32378 gene locus_tag LOCUS_07610 33427 32378 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_07610 33799 34860 gene locus_tag LOCUS_07620 gene trpS 33799 34860 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931707.1 protein_id gnl|my_center|LOCUS_07620 34854 35555 gene locus_tag LOCUS_07630 34854 35555 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_07630 35566 37227 gene locus_tag LOCUS_07640 gene argS 35566 37227 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931709.1 protein_id gnl|my_center|LOCUS_07640 37837 37238 gene locus_tag LOCUS_07650 gene nadD 37837 37238 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931710.1 protein_id gnl|my_center|LOCUS_07650 38740 37850 gene locus_tag LOCUS_07660 gene bamD 38740 37850 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926787.1 protein_id gnl|my_center|LOCUS_07660 38904 38831 gene locus_tag LOCUS_t00210 38904 38831 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 39571 39026 gene locus_tag LOCUS_07670 39571 39026 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931712.1 protein_id gnl|my_center|LOCUS_07670 40112 39585 gene locus_tag LOCUS_07680 40112 39585 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931713.1 protein_id gnl|my_center|LOCUS_07680 40443 40216 gene locus_tag LOCUS_07690 40443 40216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 41561 40545 gene locus_tag LOCUS_07700 41561 40545 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931715.1 protein_id gnl|my_center|LOCUS_07700 41971 41558 gene locus_tag LOCUS_07710 41971 41558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 42240 41989 gene locus_tag LOCUS_07720 42240 41989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 42441 43205 gene locus_tag LOCUS_07730 gene pgeF 42441 43205 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931720.1 protein_id gnl|my_center|LOCUS_07730 44501 43209 gene locus_tag LOCUS_07740 44501 43209 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_07740 45800 44511 gene locus_tag LOCUS_07750 gene ftsZ 45800 44511 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931724.1 protein_id gnl|my_center|LOCUS_07750 47147 45843 gene locus_tag LOCUS_07760 gene ftsA 47147 45843 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926790.1 protein_id gnl|my_center|LOCUS_07760 48030 47167 gene locus_tag LOCUS_07770 48030 47167 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931726.1 protein_id gnl|my_center|LOCUS_07770 49467 48055 gene locus_tag LOCUS_07780 gene murC 49467 48055 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926791.1 protein_id gnl|my_center|LOCUS_07780 50580 49483 gene locus_tag LOCUS_07790 gene murG 50580 49483 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931728.1 protein_id gnl|my_center|LOCUS_07790 51803 50577 gene locus_tag LOCUS_07800 51803 50577 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931729.1 protein_id gnl|my_center|LOCUS_07800 53173 51776 gene locus_tag LOCUS_07810 gene murD 53173 51776 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931730.1 protein_id gnl|my_center|LOCUS_07810 54285 53179 gene locus_tag LOCUS_07820 gene mraY 54285 53179 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931731.1 protein_id gnl|my_center|LOCUS_07820 55716 54295 gene locus_tag LOCUS_07830 gene murF 55716 54295 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927184.1 protein_id gnl|my_center|LOCUS_07830 57287 55713 gene locus_tag LOCUS_07840 57287 55713 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931733.1 protein_id gnl|my_center|LOCUS_07840 59287 57284 gene locus_tag LOCUS_07850 59287 57284 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931734.1 protein_id gnl|my_center|LOCUS_07850 59600 59319 gene locus_tag LOCUS_07860 59600 59319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 60579 59587 gene locus_tag LOCUS_07870 gene rsmH 60579 59587 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931736.1 protein_id gnl|my_center|LOCUS_07870 61055 60585 gene locus_tag LOCUS_07880 gene mraZ 61055 60585 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931737.1 protein_id gnl|my_center|LOCUS_07880 61501 61917 gene locus_tag LOCUS_07890 61501 61917 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933877.1 protein_id gnl|my_center|LOCUS_07890 61934 62959 gene locus_tag LOCUS_07900 gene mltG 61934 62959 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933876.1 protein_id gnl|my_center|LOCUS_07900 63086 64228 gene locus_tag LOCUS_07910 63086 64228 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933875.1 protein_id gnl|my_center|LOCUS_07910 64246 65061 gene locus_tag LOCUS_07920 64246 65061 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_07920 66512 65073 gene locus_tag LOCUS_07930 gene rlmD 66512 65073 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 protein_id gnl|my_center|LOCUS_07930 67163 66567 gene locus_tag LOCUS_07940 67163 66567 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_07940 68923 67169 gene locus_tag LOCUS_07950 gene yidC 68923 67169 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_07950 70440 71849 gene locus_tag LOCUS_07960 gene dnaA 70440 71849 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931696.1 protein_id gnl|my_center|LOCUS_07960 72129 73253 gene locus_tag LOCUS_07970 gene dnaN 72129 73253 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931695.1 protein_id gnl|my_center|LOCUS_07970 73314 74366 gene locus_tag LOCUS_07980 gene recF 73314 74366 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933935.1 protein_id gnl|my_center|LOCUS_07980 74378 74671 gene locus_tag LOCUS_07990 74378 74671 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927182.1 protein_id gnl|my_center|LOCUS_07990 75945 74722 gene locus_tag LOCUS_08000 75945 74722 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933933.1 protein_id gnl|my_center|LOCUS_08000 78445 76061 gene locus_tag LOCUS_08010 78445 76061 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927300.1 protein_id gnl|my_center|LOCUS_08010 80414 78513 gene locus_tag LOCUS_08020 gene mnmG 80414 78513 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933931.1 protein_id gnl|my_center|LOCUS_08020 80745 81056 gene locus_tag LOCUS_08030 80745 81056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 81081 81401 gene locus_tag LOCUS_08040 gene soxZ 81081 81401 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 protein_id gnl|my_center|LOCUS_08040 81455 81853 gene locus_tag LOCUS_08050 81455 81853 CDS product cytochrome subunit of sulfide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933735.1 protein_id gnl|my_center|LOCUS_08050 81862 83160 gene locus_tag LOCUS_08060 81862 83160 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_08060 83316 85178 gene locus_tag LOCUS_08070 gene secD 83316 85178 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839265.1 protein_id gnl|my_center|LOCUS_08070 85200 86135 gene locus_tag LOCUS_08080 gene secF 85200 86135 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_08080 86233 87555 gene locus_tag LOCUS_08090 86233 87555 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_08090 89493 87544 gene locus_tag LOCUS_08100 gene gyrB 89493 87544 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933913.1 protein_id gnl|my_center|LOCUS_08100 89966 89574 gene locus_tag LOCUS_08110 89966 89574 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933912.1 protein_id gnl|my_center|LOCUS_08110 90583 89963 gene locus_tag LOCUS_08120 90583 89963 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933911.1 protein_id gnl|my_center|LOCUS_08120 91714 91031 gene locus_tag LOCUS_08130 91714 91031 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932742.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence09 485 1432 gene locus_tag LOCUS_08140 485 1432 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932240.1 protein_id gnl|my_center|LOCUS_08140 1503 2945 gene locus_tag LOCUS_08150 1503 2945 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926880.1 protein_id gnl|my_center|LOCUS_08150 3091 3636 gene locus_tag LOCUS_08160 3091 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4223 5791 gene locus_tag LOCUS_08170 4223 5791 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090936308.1 protein_id gnl|my_center|LOCUS_08170 7158 6034 gene locus_tag LOCUS_08180 7158 6034 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_08180 7612 8184 gene locus_tag LOCUS_08190 7612 8184 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933072.1 protein_id gnl|my_center|LOCUS_08190 8202 9302 gene locus_tag LOCUS_08200 gene aroB 8202 9302 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933073.1 protein_id gnl|my_center|LOCUS_08200 10098 9292 gene locus_tag LOCUS_08210 10098 9292 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933075.1 protein_id gnl|my_center|LOCUS_08210 10734 10123 gene locus_tag LOCUS_08220 10734 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933076.1 protein_id gnl|my_center|LOCUS_08220 12939 10771 gene locus_tag LOCUS_08230 12939 10771 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933078.1 protein_id gnl|my_center|LOCUS_08230 13510 12986 gene locus_tag LOCUS_08240 13510 12986 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933079.1 protein_id gnl|my_center|LOCUS_08240 13915 15276 gene locus_tag LOCUS_08250 13915 15276 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933081.1 protein_id gnl|my_center|LOCUS_08250 15300 15929 gene locus_tag LOCUS_08260 15300 15929 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_08260 15911 16603 gene locus_tag LOCUS_08270 15911 16603 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_08270 16725 17501 gene locus_tag LOCUS_08280 gene csmH 16725 17501 CDS product chlorosome envelope protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933084.1 protein_id gnl|my_center|LOCUS_08280 18052 17606 gene locus_tag LOCUS_08290 gene dut 18052 17606 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933085.1 protein_id gnl|my_center|LOCUS_08290 18122 18856 gene locus_tag LOCUS_08300 gene bshB1 18122 18856 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986785.1 protein_id gnl|my_center|LOCUS_08300 19626 18904 gene locus_tag LOCUS_08310 19626 18904 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932340.1 protein_id gnl|my_center|LOCUS_08310 20246 20797 gene locus_tag LOCUS_08320 20246 20797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 20962 22458 gene locus_tag LOCUS_08330 20962 22458 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_08330 23602 22550 gene locus_tag LOCUS_08340 23602 22550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 24144 24821 gene locus_tag LOCUS_08350 gene phoU 24144 24821 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932580.1 protein_id gnl|my_center|LOCUS_08350 24902 27022 gene locus_tag LOCUS_08360 gene ppk1 24902 27022 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986865.1 protein_id gnl|my_center|LOCUS_08360 27047 28162 gene locus_tag LOCUS_08370 27047 28162 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926948.1 protein_id gnl|my_center|LOCUS_08370 28276 28536 gene locus_tag LOCUS_08380 28276 28536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 28774 29934 gene locus_tag LOCUS_08390 28774 29934 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926950.1 protein_id gnl|my_center|LOCUS_08390 30132 30902 gene locus_tag LOCUS_08400 30132 30902 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932575.1 protein_id gnl|my_center|LOCUS_08400 31176 32819 gene locus_tag LOCUS_08410 31176 32819 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927028.1 protein_id gnl|my_center|LOCUS_08410 32923 33396 gene locus_tag LOCUS_08420 gene bchF 32923 33396 CDS product 2-vinyl bacteriochlorophyllide hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933088.1 protein_id gnl|my_center|LOCUS_08420 33421 34392 gene locus_tag LOCUS_08430 gene bchC 33421 34392 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933089.1 protein_id gnl|my_center|LOCUS_08430 34403 35506 gene locus_tag LOCUS_08440 34403 35506 CDS product chlorophyllide a reductase iron protein subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927029.1 protein_id gnl|my_center|LOCUS_08440 35555 35740 gene locus_tag LOCUS_08450 35555 35740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08450 35838 36089 gene locus_tag LOCUS_08460 35838 36089 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918376.1 protein_id gnl|my_center|LOCUS_08460 38674 36848 gene locus_tag LOCUS_08470 gene typA 38674 36848 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933091.1 protein_id gnl|my_center|LOCUS_08470 38846 39691 gene locus_tag LOCUS_08480 gene ccsA 38846 39691 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933092.1 protein_id gnl|my_center|LOCUS_08480 39793 41070 gene locus_tag LOCUS_08490 gene hemA 39793 41070 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933093.1 protein_id gnl|my_center|LOCUS_08490 41090 42031 gene locus_tag LOCUS_08500 gene hemC 41090 42031 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933094.1 protein_id gnl|my_center|LOCUS_08500 42031 42774 gene locus_tag LOCUS_08510 42031 42774 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933095.1 protein_id gnl|my_center|LOCUS_08510 43539 42778 gene locus_tag LOCUS_08520 gene hisN 43539 42778 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927030.1 protein_id gnl|my_center|LOCUS_08520 43812 45353 gene locus_tag LOCUS_08530 43812 45353 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_08530 45368 45748 gene locus_tag LOCUS_08540 45368 45748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 45745 46164 gene locus_tag LOCUS_08550 45745 46164 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_08550 46172 47308 gene locus_tag LOCUS_08560 46172 47308 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789543.1 protein_id gnl|my_center|LOCUS_08560 47419 48405 gene locus_tag LOCUS_08570 gene hemB 47419 48405 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933098.1 protein_id gnl|my_center|LOCUS_08570 48462 49655 gene locus_tag LOCUS_08580 gene aroC 48462 49655 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933099.1 protein_id gnl|my_center|LOCUS_08580 51087 49741 gene locus_tag LOCUS_08590 51087 49741 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_08590 51405 53507 gene locus_tag LOCUS_08600 51405 53507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 53626 54969 gene locus_tag LOCUS_08610 53626 54969 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_08610 55551 55198 gene locus_tag LOCUS_08620 55551 55198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 55686 56027 gene locus_tag LOCUS_08630 55686 56027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 56061 56921 gene locus_tag LOCUS_08640 56061 56921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 57006 57356 gene locus_tag LOCUS_08650 57006 57356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 57353 57769 gene locus_tag LOCUS_08660 57353 57769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 58490 59227 gene locus_tag LOCUS_08670 58490 59227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 59273 59851 gene locus_tag LOCUS_08680 59273 59851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 59960 60295 gene locus_tag LOCUS_08690 59960 60295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 60279 61433 gene locus_tag LOCUS_08700 60279 61433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 61436 62122 gene locus_tag LOCUS_08710 61436 62122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 62206 62562 gene locus_tag LOCUS_08720 62206 62562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 63114 62635 gene locus_tag LOCUS_08730 63114 62635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 63295 63089 gene locus_tag LOCUS_08740 63295 63089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 64010 63501 gene locus_tag LOCUS_08750 64010 63501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 66861 67550 gene locus_tag LOCUS_08760 66861 67550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence10 1880 2653 gene locus_tag LOCUS_08770 1880 2653 CDS product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977928.1 protein_id gnl|my_center|LOCUS_08770 2890 3609 gene locus_tag LOCUS_08780 2890 3609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932143.1 protein_id gnl|my_center|LOCUS_08780 3609 5183 gene locus_tag LOCUS_08790 gene cruA 3609 5183 CDS product lycopene beta-monocyclase CruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932144.1 protein_id gnl|my_center|LOCUS_08790 5196 7199 gene locus_tag LOCUS_08800 gene ligA 5196 7199 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932145.1 protein_id gnl|my_center|LOCUS_08800 7209 7850 gene locus_tag LOCUS_08810 7209 7850 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932146.1 protein_id gnl|my_center|LOCUS_08810 8510 7851 gene locus_tag LOCUS_08820 gene ubiE 8510 7851 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926864.1 protein_id gnl|my_center|LOCUS_08820 8970 8557 gene locus_tag LOCUS_08830 gene hisI 8970 8557 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932151.1 protein_id gnl|my_center|LOCUS_08830 9135 10217 gene locus_tag LOCUS_08840 9135 10217 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932152.1 protein_id gnl|my_center|LOCUS_08840 10234 11241 gene locus_tag LOCUS_08850 10234 11241 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986857.1 protein_id gnl|my_center|LOCUS_08850 11341 12183 gene locus_tag LOCUS_08860 11341 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 13660 12224 gene locus_tag LOCUS_08870 gene gltA 13660 12224 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926868.1 protein_id gnl|my_center|LOCUS_08870 14620 13775 gene locus_tag LOCUS_08880 14620 13775 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_08880 14791 15396 gene locus_tag LOCUS_08890 gene hisH 14791 15396 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932163.1 protein_id gnl|my_center|LOCUS_08890 15419 16189 gene locus_tag LOCUS_08900 gene hisA 15419 16189 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932164.1 protein_id gnl|my_center|LOCUS_08900 16249 16887 gene locus_tag LOCUS_08910 gene scpB 16249 16887 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932165.1 protein_id gnl|my_center|LOCUS_08910 16874 17617 gene locus_tag LOCUS_08920 16874 17617 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932166.1 protein_id gnl|my_center|LOCUS_08920 17709 19700 gene locus_tag LOCUS_08930 17709 19700 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932167.1 protein_id gnl|my_center|LOCUS_08930 20695 19715 gene locus_tag LOCUS_08940 20695 19715 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933378.1 protein_id gnl|my_center|LOCUS_08940 21315 20692 gene locus_tag LOCUS_08950 21315 20692 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933377.1 protein_id gnl|my_center|LOCUS_08950 21532 23100 gene locus_tag LOCUS_08960 21532 23100 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933376.1 protein_id gnl|my_center|LOCUS_08960 23165 23626 gene locus_tag LOCUS_08970 23165 23626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933374.1 protein_id gnl|my_center|LOCUS_08970 23651 24529 gene locus_tag LOCUS_08980 23651 24529 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932170.1 protein_id gnl|my_center|LOCUS_08980 24701 25474 gene locus_tag LOCUS_08990 24701 25474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 25917 25615 gene locus_tag LOCUS_09000 25917 25615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 26160 26546 gene locus_tag LOCUS_09010 26160 26546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 27448 26705 gene locus_tag LOCUS_09020 27448 26705 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926908.1 protein_id gnl|my_center|LOCUS_09020 28539 27439 gene locus_tag LOCUS_09030 gene thiH 28539 27439 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932379.1 protein_id gnl|my_center|LOCUS_09030 29321 28539 gene locus_tag LOCUS_09040 29321 28539 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932380.1 protein_id gnl|my_center|LOCUS_09040 29543 29331 gene locus_tag LOCUS_09050 gene thiS 29543 29331 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926909.1 protein_id gnl|my_center|LOCUS_09050 30710 29571 gene locus_tag LOCUS_09060 30710 29571 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932383.1 protein_id gnl|my_center|LOCUS_09060 32744 30825 gene locus_tag LOCUS_09070 32744 30825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 34269 32812 gene locus_tag LOCUS_09080 34269 32812 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_09080 35227 34313 gene locus_tag LOCUS_09090 35227 34313 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783689.1 protein_id gnl|my_center|LOCUS_09090 36232 35279 gene locus_tag LOCUS_09100 gene cysK 36232 35279 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_09100 36994 36341 gene locus_tag LOCUS_09110 36994 36341 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786122.1 protein_id gnl|my_center|LOCUS_09110 38298 36997 gene locus_tag LOCUS_09120 38298 36997 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137848.1 protein_id gnl|my_center|LOCUS_09120 39930 39121 gene locus_tag LOCUS_09130 39930 39121 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933208.1 protein_id gnl|my_center|LOCUS_09130 40260 40529 gene locus_tag LOCUS_09140 40260 40529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 40584 42584 gene locus_tag LOCUS_09150 40584 42584 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933422.1 protein_id gnl|my_center|LOCUS_09150 42610 43179 gene locus_tag LOCUS_09160 42610 43179 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933413.1 protein_id gnl|my_center|LOCUS_09160 44631 45461 gene locus_tag LOCUS_09170 gene nifH 44631 45461 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389149.1 protein_id gnl|my_center|LOCUS_09170 45503 45802 gene locus_tag LOCUS_09180 45503 45802 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021234.1 protein_id gnl|my_center|LOCUS_09180 45815 46180 gene locus_tag LOCUS_09190 45815 46180 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021236.1 protein_id gnl|my_center|LOCUS_09190 46214 47773 gene locus_tag LOCUS_09200 gene anfD 46214 47773 CDS product nitrogenase iron-iron protein, alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389148.1 protein_id gnl|my_center|LOCUS_09200 47775 48122 gene locus_tag LOCUS_09210 gene anfG 47775 48122 CDS product Fe-only nitrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021231.1 protein_id gnl|my_center|LOCUS_09210 48171 49559 gene locus_tag LOCUS_09220 gene anfK 48171 49559 CDS product Fe-only nitrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389146.1 protein_id gnl|my_center|LOCUS_09220 49714 50172 gene locus_tag LOCUS_09230 49714 50172 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 protein_id gnl|my_center|LOCUS_09230 50583 51740 gene locus_tag LOCUS_09240 gene nifB 50583 51740 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_09240 53336 51849 gene locus_tag LOCUS_09250 53336 51849 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389142.1 protein_id gnl|my_center|LOCUS_09250 54829 53690 gene locus_tag LOCUS_09260 gene nifB 54829 53690 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_09260 55765 54941 gene locus_tag LOCUS_09270 gene nifH 55765 54941 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933198.1 protein_id gnl|my_center|LOCUS_09270 56452 57447 gene locus_tag LOCUS_09280 56452 57447 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933421.1 protein_id gnl|my_center|LOCUS_09280 57441 58268 gene locus_tag LOCUS_09290 57441 58268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933420.1 protein_id gnl|my_center|LOCUS_09290 58308 60344 gene locus_tag LOCUS_09300 58308 60344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 60440 61087 gene locus_tag LOCUS_09310 60440 61087 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927082.1 protein_id gnl|my_center|LOCUS_09310 61108 62184 gene locus_tag LOCUS_09320 61108 62184 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933418.1 protein_id gnl|my_center|LOCUS_09320 62196 63269 gene locus_tag LOCUS_09330 62196 63269 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986799.1 protein_id gnl|my_center|LOCUS_09330 63283 63981 gene locus_tag LOCUS_09340 63283 63981 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933416.1 protein_id gnl|my_center|LOCUS_09340 63978 64973 gene locus_tag LOCUS_09350 63978 64973 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933415.1 protein_id gnl|my_center|LOCUS_09350 65812 66192 gene locus_tag LOCUS_09360 65812 66192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 66509 67198 gene locus_tag LOCUS_09370 66509 67198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence11 <1 535 gene locus_tag LOCUS_09380 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933316.1:acetate--CoA ligase 1211 714 gene locus_tag LOCUS_09390 1211 714 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933324.1 protein_id gnl|my_center|LOCUS_09390 1402 2214 gene locus_tag LOCUS_09400 1402 2214 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439261.1 protein_id gnl|my_center|LOCUS_09400 2341 3744 gene locus_tag LOCUS_09410 2341 3744 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_09410 4539 4039 gene locus_tag LOCUS_09420 4539 4039 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927065.1 protein_id gnl|my_center|LOCUS_09420 5232 4666 gene locus_tag LOCUS_09430 gene ruvC 5232 4666 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933328.1 protein_id gnl|my_center|LOCUS_09430 5988 5236 gene locus_tag LOCUS_09440 5988 5236 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933329.1 protein_id gnl|my_center|LOCUS_09440 6106 6957 gene locus_tag LOCUS_09450 gene pheA 6106 6957 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933330.1 protein_id gnl|my_center|LOCUS_09450 6954 9788 gene locus_tag LOCUS_09460 gene polA 6954 9788 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933331.1 protein_id gnl|my_center|LOCUS_09460 9869 10642 gene locus_tag LOCUS_09470 9869 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 10667 10894 gene locus_tag LOCUS_09480 10667 10894 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933332.1 protein_id gnl|my_center|LOCUS_09480 10914 13112 gene locus_tag LOCUS_09490 10914 13112 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986894.1 protein_id gnl|my_center|LOCUS_09490 13159 13824 gene locus_tag LOCUS_09500 gene rpe 13159 13824 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933334.1 protein_id gnl|my_center|LOCUS_09500 14581 13805 gene locus_tag LOCUS_09510 gene trpC 14581 13805 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933335.1 protein_id gnl|my_center|LOCUS_09510 16066 14588 gene locus_tag LOCUS_09520 gene carB 16066 14588 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933336.1 protein_id gnl|my_center|LOCUS_09520 16586 16155 gene locus_tag LOCUS_09530 16586 16155 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933337.1 protein_id gnl|my_center|LOCUS_09530 17869 16583 gene locus_tag LOCUS_09540 gene purD 17869 16583 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933338.1 protein_id gnl|my_center|LOCUS_09540 18051 18665 gene locus_tag LOCUS_09550 18051 18665 CDS product DUF374 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933339.1 protein_id gnl|my_center|LOCUS_09550 18655 19722 gene locus_tag LOCUS_09560 gene lpxK 18655 19722 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927066.1 protein_id gnl|my_center|LOCUS_09560 20278 19736 gene locus_tag LOCUS_09570 20278 19736 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_09570 21247 20366 gene locus_tag LOCUS_09580 21247 20366 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933345.1 protein_id gnl|my_center|LOCUS_09580 21397 24147 gene locus_tag LOCUS_09590 gene ppdK 21397 24147 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_09590 24394 24230 gene locus_tag LOCUS_09600 24394 24230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 24537 27374 gene locus_tag LOCUS_09610 gene uvrA 24537 27374 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933353.1 protein_id gnl|my_center|LOCUS_09610 28660 27413 gene locus_tag LOCUS_09620 28660 27413 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_09620 29247 28657 gene locus_tag LOCUS_09630 29247 28657 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932308.1 protein_id gnl|my_center|LOCUS_09630 29918 29328 gene locus_tag LOCUS_09640 29918 29328 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932310.1 protein_id gnl|my_center|LOCUS_09640 31235 30117 gene locus_tag LOCUS_09650 gene gmd 31235 30117 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048162.1 protein_id gnl|my_center|LOCUS_09650 32161 31232 gene locus_tag LOCUS_09660 32161 31232 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331384.1 protein_id gnl|my_center|LOCUS_09660 33717 32212 gene locus_tag LOCUS_09670 33717 32212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932692.1 protein_id gnl|my_center|LOCUS_09670 33998 34342 gene locus_tag LOCUS_09680 33998 34342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 36223 34355 gene locus_tag LOCUS_09690 gene cysC 36223 34355 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224712.1 protein_id gnl|my_center|LOCUS_09690 36592 36236 gene locus_tag LOCUS_09700 36592 36236 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140252.1 protein_id gnl|my_center|LOCUS_09700 36891 36655 gene locus_tag LOCUS_09710 36891 36655 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140251.1 protein_id gnl|my_center|LOCUS_09710 37221 36892 gene locus_tag LOCUS_09720 37221 36892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 37818 37594 gene locus_tag LOCUS_09730 37818 37594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 38152 37973 gene locus_tag LOCUS_09740 38152 37973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 39170 38190 gene locus_tag LOCUS_09750 39170 38190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_09750 40490 39561 gene locus_tag LOCUS_09760 40490 39561 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 protein_id gnl|my_center|LOCUS_09760 40862 40590 gene locus_tag LOCUS_09770 40862 40590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 41286 40984 gene locus_tag LOCUS_09780 41286 40984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 42863 42162 gene locus_tag LOCUS_09790 42863 42162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 44038 42872 gene locus_tag LOCUS_09800 44038 42872 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_09800 45992 44043 gene locus_tag LOCUS_09810 gene asnB 45992 44043 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_09810 47206 45992 gene locus_tag LOCUS_09820 47206 45992 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_09820 48233 47157 gene locus_tag LOCUS_09830 48233 47157 CDS product EpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057045.1 protein_id gnl|my_center|LOCUS_09830 49098 48253 gene locus_tag LOCUS_09840 49098 48253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 50388 49225 gene locus_tag LOCUS_09850 50388 49225 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_09850 51261 50611 gene locus_tag LOCUS_09860 51261 50611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 52565 51441 gene locus_tag LOCUS_09870 52565 51441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 53875 52562 gene locus_tag LOCUS_09880 53875 52562 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931325.1 protein_id gnl|my_center|LOCUS_09880 54432 53890 gene locus_tag LOCUS_09890 54432 53890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 55770 54496 gene locus_tag LOCUS_09900 gene tviB 55770 54496 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607932.1 protein_id gnl|my_center|LOCUS_09900 56525 55782 gene locus_tag LOCUS_09910 56525 55782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 56427 56714 gene locus_tag LOCUS_09920 56427 56714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 57902 56877 gene locus_tag LOCUS_09930 57902 56877 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186126.1 protein_id gnl|my_center|LOCUS_09930 58221 57976 gene locus_tag LOCUS_09940 58221 57976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 58529 58218 gene locus_tag LOCUS_09950 58529 58218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 59775 58582 gene locus_tag LOCUS_09960 59775 58582 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_09960 61527 59776 gene locus_tag LOCUS_09970 61527 59776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 63694 61868 gene locus_tag LOCUS_09980 gene recQ 63694 61868 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_09980 63786 63947 gene locus_tag LOCUS_09990 63786 63947 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933679.1 protein_id gnl|my_center|LOCUS_09990 64896 63991 gene locus_tag LOCUS_10000 gene mtgA 64896 63991 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933680.1 protein_id gnl|my_center|LOCUS_10000 65009 64936 gene locus_tag LOCUS_t00220 65009 64936 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <66390 65056 gene locus_tag LOCUS_10010 <66390 65056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933683.1:DNA mismatch repair endonuclease MutL >Feature sequence12 594 815 gene locus_tag LOCUS_10020 594 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 802 1182 gene locus_tag LOCUS_10030 802 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1572 1282 gene locus_tag LOCUS_10040 1572 1282 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_10040 1882 1544 gene locus_tag LOCUS_10050 1882 1544 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390829.1 protein_id gnl|my_center|LOCUS_10050 2131 2343 gene locus_tag LOCUS_10060 2131 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3204 2422 gene locus_tag LOCUS_10070 3204 2422 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967485.1 protein_id gnl|my_center|LOCUS_10070 3471 4064 gene locus_tag LOCUS_10080 3471 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4183 4464 gene locus_tag LOCUS_10090 4183 4464 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_10090 4461 4790 gene locus_tag LOCUS_10100 4461 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4813 5031 gene locus_tag LOCUS_10110 4813 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5581 5336 gene locus_tag LOCUS_10120 5581 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5899 6315 gene locus_tag LOCUS_10130 5899 6315 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208381.1 protein_id gnl|my_center|LOCUS_10130 6312 7199 gene locus_tag LOCUS_10140 6312 7199 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342501.1 protein_id gnl|my_center|LOCUS_10140 7696 7938 gene locus_tag LOCUS_10150 7696 7938 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_10150 7943 8287 gene locus_tag LOCUS_10160 gene mazF 7943 8287 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_10160 8704 8970 gene locus_tag LOCUS_10170 8704 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 8927 9415 gene locus_tag LOCUS_10180 8927 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 9851 9492 gene locus_tag LOCUS_10190 9851 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 10379 11602 gene locus_tag LOCUS_10200 10379 11602 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454161.1 protein_id gnl|my_center|LOCUS_10200 11639 12868 gene locus_tag LOCUS_10210 11639 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 13236 14498 gene locus_tag LOCUS_10220 13236 14498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 14518 14976 gene locus_tag LOCUS_10230 14518 14976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 14994 15917 gene locus_tag LOCUS_10240 14994 15917 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_10240 15914 16723 gene locus_tag LOCUS_10250 15914 16723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970044.1 protein_id gnl|my_center|LOCUS_10250 16752 17744 gene locus_tag LOCUS_10260 16752 17744 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964709.1 protein_id gnl|my_center|LOCUS_10260 17763 19619 gene locus_tag LOCUS_10270 17763 19619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966041.1 protein_id gnl|my_center|LOCUS_10270 19616 21373 gene locus_tag LOCUS_10280 19616 21373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_10280 21412 22686 gene locus_tag LOCUS_10290 21412 22686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030686.1 protein_id gnl|my_center|LOCUS_10290 22683 23162 gene locus_tag LOCUS_10300 22683 23162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 23254 23406 gene locus_tag LOCUS_10310 23254 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 23551 24426 gene locus_tag LOCUS_10320 gene nifH 23551 24426 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461519.1 protein_id gnl|my_center|LOCUS_10320 24463 25878 gene locus_tag LOCUS_10330 24463 25878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 25880 27199 gene locus_tag LOCUS_10340 25880 27199 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388530.1 protein_id gnl|my_center|LOCUS_10340 27268 28110 gene locus_tag LOCUS_10350 27268 28110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530817.1 protein_id gnl|my_center|LOCUS_10350 28153 29019 gene locus_tag LOCUS_10360 28153 29019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970044.1 protein_id gnl|my_center|LOCUS_10360 29035 30111 gene locus_tag LOCUS_10370 29035 30111 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727460.1 protein_id gnl|my_center|LOCUS_10370 30119 31162 gene locus_tag LOCUS_10380 30119 31162 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976273.1 protein_id gnl|my_center|LOCUS_10380 31302 32984 gene locus_tag LOCUS_10390 31302 32984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_10390 33025 34848 gene locus_tag LOCUS_10400 33025 34848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243544.1 protein_id gnl|my_center|LOCUS_10400 34886 35125 gene locus_tag LOCUS_10410 34886 35125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 35168 35791 gene locus_tag LOCUS_10420 35168 35791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 36176 37555 gene locus_tag LOCUS_10430 36176 37555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 38133 38942 gene locus_tag LOCUS_10440 38133 38942 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_10440 39037 40422 gene locus_tag LOCUS_10450 39037 40422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 40468 41673 gene locus_tag LOCUS_10460 40468 41673 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869500.1 protein_id gnl|my_center|LOCUS_10460 41731 43119 gene locus_tag LOCUS_10470 41731 43119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 43637 44992 gene locus_tag LOCUS_10480 43637 44992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 45022 46053 gene locus_tag LOCUS_10490 45022 46053 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112655.1 protein_id gnl|my_center|LOCUS_10490 46175 46984 gene locus_tag LOCUS_10500 46175 46984 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_10500 46975 48153 gene locus_tag LOCUS_10510 46975 48153 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869500.1 protein_id gnl|my_center|LOCUS_10510 48232 49026 gene locus_tag LOCUS_10520 48232 49026 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886451.1 protein_id gnl|my_center|LOCUS_10520 49023 49811 gene locus_tag LOCUS_10530 49023 49811 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886451.1 protein_id gnl|my_center|LOCUS_10530 49829 50608 gene locus_tag LOCUS_10540 49829 50608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206755.1 protein_id gnl|my_center|LOCUS_10540 50885 52675 gene locus_tag LOCUS_10550 50885 52675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_10550 52672 54534 gene locus_tag LOCUS_10560 52672 54534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243525.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence13 326 1090 gene locus_tag LOCUS_10570 326 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1227 1580 gene locus_tag LOCUS_10580 1227 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10580 2000 2806 gene locus_tag LOCUS_10590 2000 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 2914 6132 gene locus_tag LOCUS_10600 gene recC 2914 6132 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932746.1 protein_id gnl|my_center|LOCUS_10600 6414 7331 gene locus_tag LOCUS_10610 6414 7331 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023152.1 protein_id gnl|my_center|LOCUS_10610 7452 8858 gene locus_tag LOCUS_10620 7452 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 8920 10251 gene locus_tag LOCUS_10630 8920 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 10425 11048 gene locus_tag LOCUS_10640 10425 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 11187 13145 gene locus_tag LOCUS_10650 11187 13145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 13214 13651 gene locus_tag LOCUS_10660 13214 13651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 13664 14101 gene locus_tag LOCUS_10670 13664 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 14113 14289 gene locus_tag LOCUS_10680 14113 14289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 14289 14999 gene locus_tag LOCUS_10690 14289 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 14996 16762 gene locus_tag LOCUS_10700 14996 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 16777 17046 gene locus_tag LOCUS_10710 16777 17046 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_10710 17109 17552 gene locus_tag LOCUS_10720 17109 17552 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_10720 17556 21239 gene locus_tag LOCUS_10730 17556 21239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 21236 24637 gene locus_tag LOCUS_10740 21236 24637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136459539.1 protein_id gnl|my_center|LOCUS_10740 24659 28354 gene locus_tag LOCUS_10750 24659 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 28506 29942 gene locus_tag LOCUS_10760 28506 29942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 30097 33111 gene locus_tag LOCUS_10770 30097 33111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 33234 34565 gene locus_tag LOCUS_10780 33234 34565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 35397 34603 gene locus_tag LOCUS_10790 35397 34603 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927080.1 protein_id gnl|my_center|LOCUS_10790 36505 35435 gene locus_tag LOCUS_10800 36505 35435 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986796.1 protein_id gnl|my_center|LOCUS_10800 36739 36557 gene locus_tag LOCUS_10810 36739 36557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 37492 36740 gene locus_tag LOCUS_10820 37492 36740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 protein_id gnl|my_center|LOCUS_10820 37741 38319 gene locus_tag LOCUS_10830 37741 38319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 38323 39894 gene locus_tag LOCUS_10840 38323 39894 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_10840 39997 40839 gene locus_tag LOCUS_10850 39997 40839 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_10850 40916 41785 gene locus_tag LOCUS_10860 gene dinD 40916 41785 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_10860 41864 43042 gene locus_tag LOCUS_10870 41864 43042 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 protein_id gnl|my_center|LOCUS_10870 43173 44420 gene locus_tag LOCUS_10880 43173 44420 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_10880 44417 44932 gene locus_tag LOCUS_10890 44417 44932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797867.1 protein_id gnl|my_center|LOCUS_10890 44981 45724 gene locus_tag LOCUS_10900 44981 45724 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121746.1 protein_id gnl|my_center|LOCUS_10900 45721 46713 gene locus_tag LOCUS_10910 45721 46713 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_10910 46710 47117 gene locus_tag LOCUS_10920 46710 47117 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_10920 47107 50358 gene locus_tag LOCUS_10930 47107 50358 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_10930 50355 51080 gene locus_tag LOCUS_10940 50355 51080 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_10940 51918 51544 gene locus_tag LOCUS_10950 51918 51544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 52575 53573 gene locus_tag LOCUS_10960 52575 53573 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967304.1 protein_id gnl|my_center|LOCUS_10960 54195 53662 gene locus_tag LOCUS_10970 54195 53662 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986873.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence14 936 2444 gene locus_tag LOCUS_10980 936 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3574 2864 gene locus_tag LOCUS_10990 3574 2864 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932277.1 protein_id gnl|my_center|LOCUS_10990 4577 3552 gene locus_tag LOCUS_11000 gene pdxA 4577 3552 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932278.1 protein_id gnl|my_center|LOCUS_11000 5044 4580 gene locus_tag LOCUS_11010 5044 4580 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932279.1 protein_id gnl|my_center|LOCUS_11010 5274 5756 gene locus_tag LOCUS_11020 5274 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5771 7009 gene locus_tag LOCUS_11030 5771 7009 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 protein_id gnl|my_center|LOCUS_11030 7125 7337 gene locus_tag LOCUS_11040 7125 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 7348 9054 gene locus_tag LOCUS_11050 7348 9054 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_11050 9079 10788 gene locus_tag LOCUS_11060 gene aprD 9079 10788 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_11060 10824 11978 gene locus_tag LOCUS_11070 10824 11978 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088217.1 protein_id gnl|my_center|LOCUS_11070 12018 13352 gene locus_tag LOCUS_11080 gene tolC 12018 13352 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735329.1 protein_id gnl|my_center|LOCUS_11080 13585 15960 gene locus_tag LOCUS_11090 gene rnr 13585 15960 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926872.1 protein_id gnl|my_center|LOCUS_11090 16192 16119 gene locus_tag LOCUS_t00230 16192 16119 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17453 16254 gene locus_tag LOCUS_11100 gene trpB 17453 16254 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932208.1 protein_id gnl|my_center|LOCUS_11100 17658 20204 gene locus_tag LOCUS_11110 17658 20204 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986846.1 protein_id gnl|my_center|LOCUS_11110 21012 20209 gene locus_tag LOCUS_11120 21012 20209 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932211.1 protein_id gnl|my_center|LOCUS_11120 21209 21622 gene locus_tag LOCUS_11130 21209 21622 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932212.1 protein_id gnl|my_center|LOCUS_11130 21749 24604 gene locus_tag LOCUS_11140 gene uvrA 21749 24604 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986847.1 protein_id gnl|my_center|LOCUS_11140 24941 24666 gene locus_tag LOCUS_11150 24941 24666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932215.1 protein_id gnl|my_center|LOCUS_11150 25119 25403 gene locus_tag LOCUS_11160 gene groES 25119 25403 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_11160 25446 27089 gene locus_tag LOCUS_11170 gene groL 25446 27089 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_11170 27216 27500 gene locus_tag LOCUS_11180 27216 27500 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_11180 27497 27823 gene locus_tag LOCUS_11190 27497 27823 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_11190 27907 28140 gene locus_tag LOCUS_11200 27907 28140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 28137 28415 gene locus_tag LOCUS_11210 28137 28415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 28693 29400 gene locus_tag LOCUS_11220 gene queC 28693 29400 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_11220 29426 30121 gene locus_tag LOCUS_11230 29426 30121 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926874.1 protein_id gnl|my_center|LOCUS_11230 30137 30940 gene locus_tag LOCUS_11240 gene trpA 30137 30940 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932222.1 protein_id gnl|my_center|LOCUS_11240 30953 31960 gene locus_tag LOCUS_11250 30953 31960 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932223.1 protein_id gnl|my_center|LOCUS_11250 32551 31940 gene locus_tag LOCUS_11260 32551 31940 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986873.1 protein_id gnl|my_center|LOCUS_11260 33663 32620 gene locus_tag LOCUS_11270 33663 32620 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_11270 35149 33839 gene locus_tag LOCUS_11280 35149 33839 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932225.1 protein_id gnl|my_center|LOCUS_11280 35904 37040 gene locus_tag LOCUS_11290 gene bshA 35904 37040 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926877.1 protein_id gnl|my_center|LOCUS_11290 38089 37061 gene locus_tag LOCUS_11300 38089 37061 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932234.1 protein_id gnl|my_center|LOCUS_11300 38345 39631 gene locus_tag LOCUS_11310 gene hisD 38345 39631 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932233.1 protein_id gnl|my_center|LOCUS_11310 39628 40653 gene locus_tag LOCUS_11320 gene queA 39628 40653 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932232.1 protein_id gnl|my_center|LOCUS_11320 40893 43463 gene locus_tag LOCUS_11330 gene acnB 40893 43463 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932230.1 protein_id gnl|my_center|LOCUS_11330 43822 43619 gene locus_tag LOCUS_11340 43822 43619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 44382 44308 gene locus_tag LOCUS_t00240 44382 44308 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 44467 44393 gene locus_tag LOCUS_t00250 44467 44393 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 44550 44476 gene locus_tag LOCUS_t00260 44550 44476 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44657 44583 gene locus_tag LOCUS_t00270 44657 44583 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 46012 44741 gene locus_tag LOCUS_11350 gene murA 46012 44741 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932242.1 protein_id gnl|my_center|LOCUS_11350 46353 47693 gene locus_tag LOCUS_11360 46353 47693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 47699 48253 gene locus_tag LOCUS_11370 47699 48253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 48266 49099 gene locus_tag LOCUS_11380 48266 49099 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932247.1 protein_id gnl|my_center|LOCUS_11380 50775 49180 gene locus_tag LOCUS_11390 gene nadB 50775 49180 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932248.1 protein_id gnl|my_center|LOCUS_11390 51362 50817 gene locus_tag LOCUS_11400 51362 50817 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_11400 52230 51622 gene locus_tag LOCUS_11410 52230 51622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927105.1 protein_id gnl|my_center|LOCUS_11410 52680 54137 gene locus_tag LOCUS_11420 52680 54137 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066243.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence15 564 262 gene locus_tag LOCUS_11430 564 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 976 569 gene locus_tag LOCUS_11440 976 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2560 1136 gene locus_tag LOCUS_11450 2560 1136 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927042.1 protein_id gnl|my_center|LOCUS_11450 5157 2560 gene locus_tag LOCUS_11460 gene mutS 5157 2560 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933169.1 protein_id gnl|my_center|LOCUS_11460 5359 5799 gene locus_tag LOCUS_11470 5359 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933170.1 protein_id gnl|my_center|LOCUS_11470 5908 6195 gene locus_tag LOCUS_11480 gene rplU 5908 6195 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933171.1 protein_id gnl|my_center|LOCUS_11480 6230 6484 gene locus_tag LOCUS_11490 gene rpmA 6230 6484 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933172.1 protein_id gnl|my_center|LOCUS_11490 6629 7561 gene locus_tag LOCUS_11500 gene mdh 6629 7561 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933173.1 protein_id gnl|my_center|LOCUS_11500 8612 7566 gene locus_tag LOCUS_11510 8612 7566 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_11510 9881 8628 gene locus_tag LOCUS_11520 9881 8628 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_11520 10772 9897 gene locus_tag LOCUS_11530 10772 9897 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_11530 11641 10787 gene locus_tag LOCUS_11540 11641 10787 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933177.1 protein_id gnl|my_center|LOCUS_11540 12740 11679 gene locus_tag LOCUS_11550 12740 11679 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933178.1 protein_id gnl|my_center|LOCUS_11550 13109 12759 gene locus_tag LOCUS_11560 13109 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933179.1 protein_id gnl|my_center|LOCUS_11560 13529 15106 gene locus_tag LOCUS_11570 13529 15106 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932499.1 protein_id gnl|my_center|LOCUS_11570 15117 16436 gene locus_tag LOCUS_11580 15117 16436 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_11580 16426 17679 gene locus_tag LOCUS_11590 16426 17679 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_11590 17676 20813 gene locus_tag LOCUS_11600 17676 20813 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941986.1 protein_id gnl|my_center|LOCUS_11600 20957 21304 gene locus_tag LOCUS_11610 20957 21304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 21314 23578 gene locus_tag LOCUS_11620 21314 23578 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932496.1 protein_id gnl|my_center|LOCUS_11620 24546 23590 gene locus_tag LOCUS_11630 24546 23590 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_11630 25053 24772 gene locus_tag LOCUS_11640 25053 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 26012 25050 gene locus_tag LOCUS_11650 26012 25050 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_11650 26770 26009 gene locus_tag LOCUS_11660 26770 26009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 27025 27567 gene locus_tag LOCUS_11670 27025 27567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 30128 27645 gene locus_tag LOCUS_11680 30128 27645 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_11680 30439 31011 gene locus_tag LOCUS_11690 gene pth 30439 31011 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932921.1 protein_id gnl|my_center|LOCUS_11690 31835 31008 gene locus_tag LOCUS_11700 31835 31008 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932922.1 protein_id gnl|my_center|LOCUS_11700 32441 31899 gene locus_tag LOCUS_11710 32441 31899 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_11710 33510 32443 gene locus_tag LOCUS_11720 gene hisC 33510 32443 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927011.1 protein_id gnl|my_center|LOCUS_11720 33687 34109 gene locus_tag LOCUS_11730 33687 34109 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932926.1 protein_id gnl|my_center|LOCUS_11730 34216 35205 gene locus_tag LOCUS_11740 gene rfaD 34216 35205 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932927.1 protein_id gnl|my_center|LOCUS_11740 35917 35615 gene locus_tag LOCUS_11750 35917 35615 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 protein_id gnl|my_center|LOCUS_11750 36927 35956 gene locus_tag LOCUS_11760 36927 35956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 37996 37370 gene locus_tag LOCUS_11770 37996 37370 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932936.1 protein_id gnl|my_center|LOCUS_11770 38514 38050 gene locus_tag LOCUS_11780 38514 38050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986771.1 protein_id gnl|my_center|LOCUS_11780 38844 39743 gene locus_tag LOCUS_11790 gene chlG 38844 39743 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986772.1 protein_id gnl|my_center|LOCUS_11790 40085 39747 gene locus_tag LOCUS_11800 40085 39747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 41036 40182 gene locus_tag LOCUS_11810 41036 40182 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_11810 41164 41239 gene locus_tag LOCUS_t00280 41164 41239 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 42111 41740 gene locus_tag LOCUS_11820 42111 41740 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966792.1 protein_id gnl|my_center|LOCUS_11820 42872 42165 gene locus_tag LOCUS_11830 42872 42165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 44391 42982 gene locus_tag LOCUS_11840 44391 42982 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 protein_id gnl|my_center|LOCUS_11840 47620 44408 gene locus_tag LOCUS_11850 47620 44408 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932956.1 protein_id gnl|my_center|LOCUS_11850 48820 47648 gene locus_tag LOCUS_11860 48820 47648 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_11860 49788 49069 gene locus_tag LOCUS_11870 49788 49069 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931967.1 protein_id gnl|my_center|LOCUS_11870 50632 50123 gene locus_tag LOCUS_11880 gene msrB 50632 50123 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926800.1 protein_id gnl|my_center|LOCUS_11880 52898 50736 gene locus_tag LOCUS_11890 52898 50736 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_11890 52994 53404 gene locus_tag LOCUS_11900 52994 53404 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933123.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence16 733 2070 gene locus_tag LOCUS_11910 733 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2452 2643 gene locus_tag LOCUS_11920 2452 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3905 2832 gene locus_tag LOCUS_11930 3905 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4143 3895 gene locus_tag LOCUS_11940 4143 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5318 4287 gene locus_tag LOCUS_11950 5318 4287 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933272.1 protein_id gnl|my_center|LOCUS_11950 5608 6591 gene locus_tag LOCUS_11960 gene trpD 5608 6591 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933273.1 protein_id gnl|my_center|LOCUS_11960 6667 7659 gene locus_tag LOCUS_11970 gene chlG 6667 7659 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933274.1 protein_id gnl|my_center|LOCUS_11970 7730 7948 gene locus_tag LOCUS_11980 gene rpmB 7730 7948 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933275.1 protein_id gnl|my_center|LOCUS_11980 8033 8473 gene locus_tag LOCUS_11990 gene rnhA 8033 8473 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_11990 8485 9525 gene locus_tag LOCUS_12000 8485 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927061.1 protein_id gnl|my_center|LOCUS_12000 10516 9539 gene locus_tag LOCUS_12010 gene tilS 10516 9539 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986789.1 protein_id gnl|my_center|LOCUS_12010 10659 11297 gene locus_tag LOCUS_12020 10659 11297 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933279.1 protein_id gnl|my_center|LOCUS_12020 11396 11605 gene locus_tag LOCUS_12030 11396 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 11624 13327 gene locus_tag LOCUS_12040 gene recN 11624 13327 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933282.1 protein_id gnl|my_center|LOCUS_12040 13524 14654 gene locus_tag LOCUS_12050 13524 14654 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_12050 15179 14679 gene locus_tag LOCUS_12060 15179 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 15723 15244 gene locus_tag LOCUS_12070 15723 15244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 16188 15982 gene locus_tag LOCUS_12080 16188 15982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 16817 16488 gene locus_tag LOCUS_12090 16817 16488 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_12090 17599 18396 gene locus_tag LOCUS_12100 gene dapA 17599 18396 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933288.1 protein_id gnl|my_center|LOCUS_12100 19788 18454 gene locus_tag LOCUS_12110 gene gcvPA 19788 18454 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_12110 20175 19792 gene locus_tag LOCUS_12120 gene gcvH 20175 19792 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933290.1 protein_id gnl|my_center|LOCUS_12120 21022 20276 gene locus_tag LOCUS_12130 gene rlmB 21022 20276 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933291.1 protein_id gnl|my_center|LOCUS_12130 21312 24884 gene locus_tag LOCUS_12140 gene nifJ 21312 24884 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_12140 26442 24955 gene locus_tag LOCUS_12150 26442 24955 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927062.1 protein_id gnl|my_center|LOCUS_12150 27466 26444 gene locus_tag LOCUS_12160 gene ruvB 27466 26444 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933294.1 protein_id gnl|my_center|LOCUS_12160 28480 27515 gene locus_tag LOCUS_12170 28480 27515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_12170 29142 30542 gene locus_tag LOCUS_12180 29142 30542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 32874 31069 gene locus_tag LOCUS_12190 32874 31069 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986790.1 protein_id gnl|my_center|LOCUS_12190 33880 32867 gene locus_tag LOCUS_12200 gene hprK 33880 32867 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933297.1 protein_id gnl|my_center|LOCUS_12200 34268 33948 gene locus_tag LOCUS_12210 gene raiA 34268 33948 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927271.1 protein_id gnl|my_center|LOCUS_12210 35326 34349 gene locus_tag LOCUS_12220 35326 34349 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933299.1 protein_id gnl|my_center|LOCUS_12220 36189 35323 gene locus_tag LOCUS_12230 36189 35323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933300.1 protein_id gnl|my_center|LOCUS_12230 36884 36186 gene locus_tag LOCUS_12240 36884 36186 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933301.1 protein_id gnl|my_center|LOCUS_12240 37024 37374 gene locus_tag LOCUS_12250 gene queF 37024 37374 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_12250 37922 37473 gene locus_tag LOCUS_12260 37922 37473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 37837 38205 gene locus_tag LOCUS_12270 37837 38205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 38395 39951 gene locus_tag LOCUS_12280 38395 39951 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933305.1 protein_id gnl|my_center|LOCUS_12280 40082 41419 gene locus_tag LOCUS_12290 40082 41419 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170181187.1 protein_id gnl|my_center|LOCUS_12290 43279 41477 gene locus_tag LOCUS_12300 gene sppA 43279 41477 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933308.1 protein_id gnl|my_center|LOCUS_12300 44183 43272 gene locus_tag LOCUS_12310 44183 43272 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933309.1 protein_id gnl|my_center|LOCUS_12310 44346 45086 gene locus_tag LOCUS_12320 gene rsmI 44346 45086 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933310.1 protein_id gnl|my_center|LOCUS_12320 45070 45921 gene locus_tag LOCUS_12330 gene panC 45070 45921 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933311.1 protein_id gnl|my_center|LOCUS_12330 45985 48222 gene locus_tag LOCUS_12340 45985 48222 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933313.1 protein_id gnl|my_center|LOCUS_12340 48289 50706 gene locus_tag LOCUS_12350 gene leuS 48289 50706 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933314.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence17 1118 102 gene locus_tag LOCUS_12360 1118 102 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965384.1 protein_id gnl|my_center|LOCUS_12360 2818 1463 gene locus_tag LOCUS_12370 gene rimO 2818 1463 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933065.1 protein_id gnl|my_center|LOCUS_12370 3794 2751 gene locus_tag LOCUS_12380 gene tgt 3794 2751 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933064.1 protein_id gnl|my_center|LOCUS_12380 4026 4490 gene locus_tag LOCUS_12390 4026 4490 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_12390 5798 4563 gene locus_tag LOCUS_12400 5798 4563 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932517.1 protein_id gnl|my_center|LOCUS_12400 6063 9632 gene locus_tag LOCUS_12410 gene dnaE 6063 9632 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926943.1 protein_id gnl|my_center|LOCUS_12410 9734 10063 gene locus_tag LOCUS_12420 gene trxA 9734 10063 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932522.1 protein_id gnl|my_center|LOCUS_12420 10152 11087 gene locus_tag LOCUS_12430 gene trxB 10152 11087 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_12430 11529 11101 gene locus_tag LOCUS_12440 11529 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 11774 11526 gene locus_tag LOCUS_12450 11774 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 12426 12611 gene locus_tag LOCUS_12460 12426 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 13353 12775 gene locus_tag LOCUS_12470 13353 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 13666 13956 gene locus_tag LOCUS_12480 13666 13956 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831611.1 protein_id gnl|my_center|LOCUS_12480 13984 14988 gene locus_tag LOCUS_12490 13984 14988 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_12490 14998 15417 gene locus_tag LOCUS_12500 14998 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 15489 18149 gene locus_tag LOCUS_12510 15489 18149 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 protein_id gnl|my_center|LOCUS_12510 18451 18978 gene locus_tag LOCUS_12520 18451 18978 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_12520 19500 19183 gene locus_tag LOCUS_12530 19500 19183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 20059 20754 gene locus_tag LOCUS_12540 20059 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 21042 21215 gene locus_tag LOCUS_12550 21042 21215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932888.1 protein_id gnl|my_center|LOCUS_12550 22462 21281 gene locus_tag LOCUS_12560 22462 21281 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932884.1 protein_id gnl|my_center|LOCUS_12560 22620 23549 gene locus_tag LOCUS_12570 22620 23549 CDS product DUF4292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986766.1 protein_id gnl|my_center|LOCUS_12570 24240 23632 gene locus_tag LOCUS_12580 24240 23632 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932882.1 protein_id gnl|my_center|LOCUS_12580 24352 24699 gene locus_tag LOCUS_12590 24352 24699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927003.1 protein_id gnl|my_center|LOCUS_12590 24696 25343 gene locus_tag LOCUS_12600 gene coaE 24696 25343 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932880.1 protein_id gnl|my_center|LOCUS_12600 26175 25357 gene locus_tag LOCUS_12610 26175 25357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 26395 27372 gene locus_tag LOCUS_12620 26395 27372 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932877.1 protein_id gnl|my_center|LOCUS_12620 27432 28163 gene locus_tag LOCUS_12630 27432 28163 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932876.1 protein_id gnl|my_center|LOCUS_12630 28343 28170 gene locus_tag LOCUS_12640 28343 28170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439258.1 protein_id gnl|my_center|LOCUS_12640 28620 28420 gene locus_tag LOCUS_12650 28620 28420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 29713 28688 gene locus_tag LOCUS_12660 29713 28688 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932871.1 protein_id gnl|my_center|LOCUS_12660 31269 29728 gene locus_tag LOCUS_12670 31269 29728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289202.1 protein_id gnl|my_center|LOCUS_12670 32315 31290 gene locus_tag LOCUS_12680 32315 31290 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932869.1 protein_id gnl|my_center|LOCUS_12680 34065 32548 gene locus_tag LOCUS_12690 34065 32548 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_12690 35020 34586 gene locus_tag LOCUS_12700 35020 34586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 35351 35091 gene locus_tag LOCUS_12710 35351 35091 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255008.1 protein_id gnl|my_center|LOCUS_12710 36430 35711 gene locus_tag LOCUS_12720 36430 35711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 36898 36686 gene locus_tag LOCUS_12730 36898 36686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 38112 37285 gene locus_tag LOCUS_12740 38112 37285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 38671 39852 gene locus_tag LOCUS_12750 38671 39852 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926978.1 protein_id gnl|my_center|LOCUS_12750 40338 39928 gene locus_tag LOCUS_12760 40338 39928 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932691.1 protein_id gnl|my_center|LOCUS_12760 41584 40340 gene locus_tag LOCUS_12770 41584 40340 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932690.1 protein_id gnl|my_center|LOCUS_12770 42549 41632 gene locus_tag LOCUS_12780 42549 41632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 42794 43024 gene locus_tag LOCUS_12790 42794 43024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 43217 43462 gene locus_tag LOCUS_12800 gene tatA 43217 43462 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_12800 44023 43472 gene locus_tag LOCUS_12810 44023 43472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 44156 44617 gene locus_tag LOCUS_12820 44156 44617 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943318.1 protein_id gnl|my_center|LOCUS_12820 44845 45591 gene locus_tag LOCUS_12830 44845 45591 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_12830 45814 47325 gene locus_tag LOCUS_12840 45814 47325 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 protein_id gnl|my_center|LOCUS_12840 47876 47427 gene locus_tag LOCUS_12850 47876 47427 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931767.1 protein_id gnl|my_center|LOCUS_12850 48190 48032 gene locus_tag LOCUS_12860 48190 48032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 48780 48529 gene locus_tag LOCUS_12870 48780 48529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 49477 49905 gene locus_tag LOCUS_12880 49477 49905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence18 <1 1129 gene locus_tag LOCUS_12890 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968692.1:type I restriction endonuclease subunit R 1077 1481 gene locus_tag LOCUS_12900 1077 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2374 1874 gene locus_tag LOCUS_12910 2374 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3213 2923 gene locus_tag LOCUS_12920 3213 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3466 3194 gene locus_tag LOCUS_12930 3466 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 4317 3688 gene locus_tag LOCUS_12940 gene msrA 4317 3688 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928865.1 protein_id gnl|my_center|LOCUS_12940 6035 4335 gene locus_tag LOCUS_12950 6035 4335 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252802.1 protein_id gnl|my_center|LOCUS_12950 6557 7831 gene locus_tag LOCUS_12960 6557 7831 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_12960 7839 8279 gene locus_tag LOCUS_12970 gene tsaE 7839 8279 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931832.1 protein_id gnl|my_center|LOCUS_12970 8276 8956 gene locus_tag LOCUS_12980 gene tsaB 8276 8956 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931833.1 protein_id gnl|my_center|LOCUS_12980 9033 10205 gene locus_tag LOCUS_12990 9033 10205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 11775 10321 gene locus_tag LOCUS_13000 11775 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 12982 11825 gene locus_tag LOCUS_13010 gene nrfD 12982 11825 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_13010 13771 12992 gene locus_tag LOCUS_13020 13771 12992 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933894.1 protein_id gnl|my_center|LOCUS_13020 15790 14141 gene locus_tag LOCUS_13030 15790 14141 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933896.1 protein_id gnl|my_center|LOCUS_13030 16788 15793 gene locus_tag LOCUS_13040 gene dsrM 16788 15793 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933897.1 protein_id gnl|my_center|LOCUS_13040 17246 16785 gene locus_tag LOCUS_13050 17246 16785 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933898.1 protein_id gnl|my_center|LOCUS_13050 17600 17292 gene locus_tag LOCUS_13060 gene tusB 17600 17292 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_13060 17968 17597 gene locus_tag LOCUS_13070 gene tusC 17968 17597 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_13070 18335 17976 gene locus_tag LOCUS_13080 gene tusD 18335 17976 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_13080 18754 18386 gene locus_tag LOCUS_13090 18754 18386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933899.1 protein_id gnl|my_center|LOCUS_13090 20532 18796 gene locus_tag LOCUS_13100 20532 18796 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_13100 21630 20551 gene locus_tag LOCUS_13110 gene dsrB 21630 20551 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_13110 22971 21727 gene locus_tag LOCUS_13120 gene dsrA 22971 21727 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_13120 23361 23026 gene locus_tag LOCUS_13130 23361 23026 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932532.1 protein_id gnl|my_center|LOCUS_13130 24187 23795 gene locus_tag LOCUS_13140 24187 23795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 25297 24905 gene locus_tag LOCUS_13150 25297 24905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 27801 26347 gene locus_tag LOCUS_13160 27801 26347 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_13160 28563 27907 gene locus_tag LOCUS_13170 28563 27907 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_13170 31790 28560 gene locus_tag LOCUS_13180 31790 28560 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933702.1 protein_id gnl|my_center|LOCUS_13180 31948 31787 gene locus_tag LOCUS_13190 31948 31787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 33224 31899 gene locus_tag LOCUS_13200 33224 31899 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933704.1 protein_id gnl|my_center|LOCUS_13200 33481 33230 gene locus_tag LOCUS_13210 33481 33230 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927139.1 protein_id gnl|my_center|LOCUS_13210 33745 34119 gene locus_tag LOCUS_13220 33745 34119 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926873.1 protein_id gnl|my_center|LOCUS_13220 35656 34250 gene locus_tag LOCUS_13230 35656 34250 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986821.1 protein_id gnl|my_center|LOCUS_13230 35996 35760 gene locus_tag LOCUS_13240 35996 35760 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_13240 36453 36040 gene locus_tag LOCUS_13250 36453 36040 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932524.1 protein_id gnl|my_center|LOCUS_13250 37035 36526 gene locus_tag LOCUS_13260 37035 36526 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_13260 37603 37178 gene locus_tag LOCUS_13270 37603 37178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932541.1 protein_id gnl|my_center|LOCUS_13270 38502 37600 gene locus_tag LOCUS_13280 38502 37600 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986862.1 protein_id gnl|my_center|LOCUS_13280 41515 38654 gene locus_tag LOCUS_13290 41515 38654 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_13290 43087 41534 gene locus_tag LOCUS_13300 gene nrfD 43087 41534 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_13300 44720 43494 gene locus_tag LOCUS_13310 44720 43494 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932704.1 protein_id gnl|my_center|LOCUS_13310 45306 45887 gene locus_tag LOCUS_13320 45306 45887 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932744.1 protein_id gnl|my_center|LOCUS_13320 46421 45966 gene locus_tag LOCUS_13330 gene rplI 46421 45966 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933786.1 protein_id gnl|my_center|LOCUS_13330 46736 46458 gene locus_tag LOCUS_13340 gene rpsR 46736 46458 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927162.1 protein_id gnl|my_center|LOCUS_13340 47244 46771 gene locus_tag LOCUS_13350 gene ssb 47244 46771 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927163.1 protein_id gnl|my_center|LOCUS_13350 47854 47309 gene locus_tag LOCUS_13360 47854 47309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 48895 47897 gene locus_tag LOCUS_13370 48895 47897 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_13370 49439 48912 gene locus_tag LOCUS_13380 49439 48912 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933792.1 protein_id gnl|my_center|LOCUS_13380 49851 49453 gene locus_tag LOCUS_13390 49851 49453 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933794.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence19 145 1116 gene locus_tag LOCUS_13400 145 1116 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932069.1 protein_id gnl|my_center|LOCUS_13400 1113 3089 gene locus_tag LOCUS_13410 1113 3089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932070.1 protein_id gnl|my_center|LOCUS_13410 3152 3565 gene locus_tag LOCUS_13420 3152 3565 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262969.1 protein_id gnl|my_center|LOCUS_13420 3578 3778 gene locus_tag LOCUS_13430 3578 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3841 4428 gene locus_tag LOCUS_13440 3841 4428 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_13440 4436 5200 gene locus_tag LOCUS_13450 4436 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926870.1 protein_id gnl|my_center|LOCUS_13450 6431 5262 gene locus_tag LOCUS_13460 6431 5262 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932280.1 protein_id gnl|my_center|LOCUS_13460 6930 8723 gene locus_tag LOCUS_13470 6930 8723 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926891.1 protein_id gnl|my_center|LOCUS_13470 8744 9229 gene locus_tag LOCUS_13480 8744 9229 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926892.1 protein_id gnl|my_center|LOCUS_13480 10151 9237 gene locus_tag LOCUS_13490 gene xerD 10151 9237 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932289.1 protein_id gnl|my_center|LOCUS_13490 11445 10156 gene locus_tag LOCUS_13500 gene rsmB 11445 10156 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932290.1 protein_id gnl|my_center|LOCUS_13500 11810 12871 gene locus_tag LOCUS_13510 gene metX 11810 12871 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_13510 14248 12968 gene locus_tag LOCUS_13520 gene serS 14248 12968 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932293.1 protein_id gnl|my_center|LOCUS_13520 14728 14270 gene locus_tag LOCUS_13530 14728 14270 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_13530 15508 14840 gene locus_tag LOCUS_13540 gene radC 15508 14840 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932298.1 protein_id gnl|my_center|LOCUS_13540 16034 15606 gene locus_tag LOCUS_13550 16034 15606 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927259.1 protein_id gnl|my_center|LOCUS_13550 17738 16173 gene locus_tag LOCUS_13560 17738 16173 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214693.1 protein_id gnl|my_center|LOCUS_13560 21784 17918 gene locus_tag LOCUS_13570 21784 17918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 22108 22608 gene locus_tag LOCUS_13580 22108 22608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 23029 26184 gene locus_tag LOCUS_13590 23029 26184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 27833 26448 gene locus_tag LOCUS_13600 27833 26448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 29043 27838 gene locus_tag LOCUS_13610 29043 27838 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566296.1 protein_id gnl|my_center|LOCUS_13610 29273 29073 gene locus_tag LOCUS_13620 29273 29073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 29678 29292 gene locus_tag LOCUS_13630 29678 29292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 30277 29675 gene locus_tag LOCUS_13640 30277 29675 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764600.1 protein_id gnl|my_center|LOCUS_13640 30609 30274 gene locus_tag LOCUS_13650 30609 30274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 31976 30621 gene locus_tag LOCUS_13660 31976 30621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 32425 31973 gene locus_tag LOCUS_13670 32425 31973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 33362 32436 gene locus_tag LOCUS_13680 33362 32436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 34351 33404 gene locus_tag LOCUS_13690 34351 33404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 35055 34375 gene locus_tag LOCUS_13700 35055 34375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 35753 36892 gene locus_tag LOCUS_13710 35753 36892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 36889 38019 gene locus_tag LOCUS_13720 36889 38019 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_13720 38019 39788 gene locus_tag LOCUS_13730 38019 39788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 41883 40609 gene locus_tag LOCUS_13740 41883 40609 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_13740 42353 41901 gene locus_tag LOCUS_13750 gene umuD 42353 41901 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_13750 42635 42483 gene locus_tag LOCUS_13760 42635 42483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 43022 42750 gene locus_tag LOCUS_13770 43022 42750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence20 80 1585 gene locus_tag LOCUS_13780 gene oadA 80 1585 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261303.1 protein_id gnl|my_center|LOCUS_13780 1623 3167 gene locus_tag LOCUS_13790 1623 3167 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258907.1 protein_id gnl|my_center|LOCUS_13790 3178 3387 gene locus_tag LOCUS_13800 3178 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3399 3794 gene locus_tag LOCUS_13810 3399 3794 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258905.1 protein_id gnl|my_center|LOCUS_13810 4769 3903 gene locus_tag LOCUS_13820 4769 3903 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_13820 5602 5297 gene locus_tag LOCUS_13830 5602 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 5873 5595 gene locus_tag LOCUS_13840 5873 5595 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_13840 7279 6161 gene locus_tag LOCUS_13850 gene cobD 7279 6161 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932619.1 protein_id gnl|my_center|LOCUS_13850 8842 7325 gene locus_tag LOCUS_13860 8842 7325 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932618.1 protein_id gnl|my_center|LOCUS_13860 9480 8836 gene locus_tag LOCUS_13870 gene bluB 9480 8836 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_13870 11557 9602 gene locus_tag LOCUS_13880 11557 9602 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926958.1 protein_id gnl|my_center|LOCUS_13880 12150 12560 gene locus_tag LOCUS_13890 12150 12560 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926957.1 protein_id gnl|my_center|LOCUS_13890 12538 13431 gene locus_tag LOCUS_13900 12538 13431 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932610.1 protein_id gnl|my_center|LOCUS_13900 13904 13425 gene locus_tag LOCUS_13910 13904 13425 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932613.1 protein_id gnl|my_center|LOCUS_13910 13999 14574 gene locus_tag LOCUS_13920 13999 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 14811 16082 gene locus_tag LOCUS_13930 14811 16082 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932672.1 protein_id gnl|my_center|LOCUS_13930 16125 17159 gene locus_tag LOCUS_13940 16125 17159 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932671.1 protein_id gnl|my_center|LOCUS_13940 17185 18609 gene locus_tag LOCUS_13950 17185 18609 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932670.1 protein_id gnl|my_center|LOCUS_13950 18674 19978 gene locus_tag LOCUS_13960 gene purB 18674 19978 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932669.1 protein_id gnl|my_center|LOCUS_13960 19990 20460 gene locus_tag LOCUS_13970 19990 20460 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932860.1 protein_id gnl|my_center|LOCUS_13970 20465 21286 gene locus_tag LOCUS_13980 20465 21286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932861.1 protein_id gnl|my_center|LOCUS_13980 26724 21319 gene locus_tag LOCUS_13990 26724 21319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 27915 27001 gene locus_tag LOCUS_14000 27915 27001 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_14000 28599 28144 gene locus_tag LOCUS_14010 gene aroQ 28599 28144 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932862.1 protein_id gnl|my_center|LOCUS_14010 30159 28729 gene locus_tag LOCUS_14020 gene hslU 30159 28729 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932863.1 protein_id gnl|my_center|LOCUS_14020 30792 30244 gene locus_tag LOCUS_14030 gene hslV 30792 30244 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932864.1 protein_id gnl|my_center|LOCUS_14030 32247 30796 gene locus_tag LOCUS_14040 gene rpoN 32247 30796 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932865.1 protein_id gnl|my_center|LOCUS_14040 32819 32247 gene locus_tag LOCUS_14050 32819 32247 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927241.1 protein_id gnl|my_center|LOCUS_14050 33062 33430 gene locus_tag LOCUS_14060 33062 33430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 33682 33942 gene locus_tag LOCUS_14070 33682 33942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 34047 34934 gene locus_tag LOCUS_14080 gene folD 34047 34934 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_14080 34941 36311 gene locus_tag LOCUS_14090 gene radA 34941 36311 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932867.1 protein_id gnl|my_center|LOCUS_14090 36394 36735 gene locus_tag LOCUS_14100 36394 36735 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 protein_id gnl|my_center|LOCUS_14100 37590 36781 gene locus_tag LOCUS_14110 37590 36781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542058.1 protein_id gnl|my_center|LOCUS_14110 38438 37587 gene locus_tag LOCUS_14120 gene cbiQ 38438 37587 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023916.1 protein_id gnl|my_center|LOCUS_14120 38766 38431 gene locus_tag LOCUS_14130 38766 38431 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584113.1 protein_id gnl|my_center|LOCUS_14130 39443 38763 gene locus_tag LOCUS_14140 39443 38763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14140 39692 39880 gene locus_tag LOCUS_14150 39692 39880 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932929.1 protein_id gnl|my_center|LOCUS_14150 41058 39979 gene locus_tag LOCUS_14160 41058 39979 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073850.1 protein_id gnl|my_center|LOCUS_14160 41918 41382 gene locus_tag LOCUS_14170 41918 41382 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957925.1 protein_id gnl|my_center|LOCUS_14170 42813 42247 gene locus_tag LOCUS_14180 42813 42247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 43517 44765 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaaacacccccacgcctgtggggaagac >Feature sequence21 4694 198 gene locus_tag LOCUS_14190 gene rpoC 4694 198 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931850.1 protein_id gnl|my_center|LOCUS_14190 8680 4763 gene locus_tag LOCUS_14200 gene rpoB 8680 4763 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927192.1 protein_id gnl|my_center|LOCUS_14200 9260 8886 gene locus_tag LOCUS_14210 gene rplL 9260 8886 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931848.1 protein_id gnl|my_center|LOCUS_14210 9846 9328 gene locus_tag LOCUS_14220 gene rplJ 9846 9328 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931847.1 protein_id gnl|my_center|LOCUS_14220 10553 9864 gene locus_tag LOCUS_14230 gene rplA 10553 9864 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931846.1 protein_id gnl|my_center|LOCUS_14230 11055 10630 gene locus_tag LOCUS_14240 gene rplK 11055 10630 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931845.1 protein_id gnl|my_center|LOCUS_14240 11672 11097 gene locus_tag LOCUS_14250 gene nusG 11672 11097 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931844.1 protein_id gnl|my_center|LOCUS_14250 11888 11697 gene locus_tag LOCUS_14260 gene secE 11888 11697 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931843.1 protein_id gnl|my_center|LOCUS_14260 12006 11933 gene locus_tag LOCUS_t00290 12006 11933 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 12104 12031 gene locus_tag LOCUS_t00300 12104 12031 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12200 12118 gene locus_tag LOCUS_t00310 12200 12118 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 12284 12211 gene locus_tag LOCUS_t00320 12284 12211 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13136 12357 gene locus_tag LOCUS_14270 13136 12357 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931842.1 protein_id gnl|my_center|LOCUS_14270 15184 13133 gene locus_tag LOCUS_14280 gene ispG 15184 13133 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986827.1 protein_id gnl|my_center|LOCUS_14280 15521 15213 gene locus_tag LOCUS_14290 15521 15213 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931840.1 protein_id gnl|my_center|LOCUS_14290 16937 15624 gene locus_tag LOCUS_14300 gene eno 16937 15624 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931839.1 protein_id gnl|my_center|LOCUS_14300 17159 19228 gene locus_tag LOCUS_14310 gene fusA 17159 19228 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931838.1 protein_id gnl|my_center|LOCUS_14310 20076 19288 gene locus_tag LOCUS_14320 20076 19288 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933673.1 protein_id gnl|my_center|LOCUS_14320 20846 20157 gene locus_tag LOCUS_14330 20846 20157 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933674.1 protein_id gnl|my_center|LOCUS_14330 23137 20942 gene locus_tag LOCUS_14340 23137 20942 CDS product photosystem I reaction center subunit IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933675.1 protein_id gnl|my_center|LOCUS_14340 23551 24363 gene locus_tag LOCUS_14350 gene dapF 23551 24363 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927135.1 protein_id gnl|my_center|LOCUS_14350 25064 27286 gene locus_tag LOCUS_14360 25064 27286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 27524 28822 gene locus_tag LOCUS_14370 27524 28822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 28885 29994 gene locus_tag LOCUS_14380 28885 29994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 30188 31366 gene locus_tag LOCUS_14390 gene sucC 30188 31366 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932072.1 protein_id gnl|my_center|LOCUS_14390 33467 31494 gene locus_tag LOCUS_14400 33467 31494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932070.1 protein_id gnl|my_center|LOCUS_14400 34432 33464 gene locus_tag LOCUS_14410 34432 33464 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932069.1 protein_id gnl|my_center|LOCUS_14410 35672 34416 gene locus_tag LOCUS_14420 35672 34416 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926846.1 protein_id gnl|my_center|LOCUS_14420 35939 37897 gene locus_tag LOCUS_14430 35939 37897 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_14430 38968 37946 gene locus_tag LOCUS_14440 38968 37946 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933388.1 protein_id gnl|my_center|LOCUS_14440 39412 39110 gene locus_tag LOCUS_14450 39412 39110 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933389.1 protein_id gnl|my_center|LOCUS_14450 39839 39471 gene locus_tag LOCUS_14460 39839 39471 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933390.1 protein_id gnl|my_center|LOCUS_14460 <41216 40107 gene locus_tag LOCUS_14470 <41216 40107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932065.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence22 <1 1408 gene locus_tag LOCUS_14480 <1 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764951.1:DUF805 domain-containing protein 1625 2026 gene locus_tag LOCUS_14490 1625 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2086 2613 gene locus_tag LOCUS_14500 2086 2613 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932621.1 protein_id gnl|my_center|LOCUS_14500 2697 3659 gene locus_tag LOCUS_14510 2697 3659 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926960.1 protein_id gnl|my_center|LOCUS_14510 3674 4930 gene locus_tag LOCUS_14520 3674 4930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932623.1 protein_id gnl|my_center|LOCUS_14520 5069 5305 gene locus_tag LOCUS_14530 5069 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 5298 5702 gene locus_tag LOCUS_14540 gene vapC 5298 5702 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331362.1 protein_id gnl|my_center|LOCUS_14540 5757 5987 gene locus_tag LOCUS_14550 5757 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 6229 6477 gene locus_tag LOCUS_14560 6229 6477 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_14560 6474 6875 gene locus_tag LOCUS_14570 6474 6875 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_14570 7196 6972 gene locus_tag LOCUS_14580 7196 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 7487 7287 gene locus_tag LOCUS_14590 7487 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 7729 7484 gene locus_tag LOCUS_14600 7729 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 7933 9756 gene locus_tag LOCUS_14610 7933 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14610 10090 10932 gene locus_tag LOCUS_14620 gene cbiR 10090 10932 CDS product cobamide remodeling phosphodiesterase CbiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932624.1 protein_id gnl|my_center|LOCUS_14620 11178 13043 gene locus_tag LOCUS_14630 11178 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 13482 14003 gene locus_tag LOCUS_14640 gene cobU 13482 14003 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932625.1 protein_id gnl|my_center|LOCUS_14640 14231 14028 gene locus_tag LOCUS_14650 14231 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 16815 14308 gene locus_tag LOCUS_14660 16815 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 17410 16955 gene locus_tag LOCUS_14670 17410 16955 CDS product SET domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932632.1 protein_id gnl|my_center|LOCUS_14670 18160 17444 gene locus_tag LOCUS_14680 18160 17444 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932199.1 protein_id gnl|my_center|LOCUS_14680 20407 18350 gene locus_tag LOCUS_14690 gene katG 20407 18350 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 protein_id gnl|my_center|LOCUS_14690 21405 20662 gene locus_tag LOCUS_14700 gene fabG 21405 20662 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_14700 21736 21882 gene locus_tag LOCUS_14710 21736 21882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 21957 22427 gene locus_tag LOCUS_14720 gene bfr 21957 22427 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_14720 22431 23318 gene locus_tag LOCUS_14730 22431 23318 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_14730 24134 25522 gene locus_tag LOCUS_14740 24134 25522 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933561.1 protein_id gnl|my_center|LOCUS_14740 27206 25599 gene locus_tag LOCUS_14750 27206 25599 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963143.1 protein_id gnl|my_center|LOCUS_14750 27435 28271 gene locus_tag LOCUS_14760 27435 28271 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926975.1 protein_id gnl|my_center|LOCUS_14760 28744 28965 gene locus_tag LOCUS_14770 28744 28965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 29127 29582 gene locus_tag LOCUS_14780 gene tsaA 29127 29582 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_14780 30775 33147 gene locus_tag LOCUS_14790 30775 33147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 33140 36799 gene locus_tag LOCUS_14800 33140 36799 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861850.1 protein_id gnl|my_center|LOCUS_14800 36802 38850 gene locus_tag LOCUS_14810 36802 38850 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 protein_id gnl|my_center|LOCUS_14810 39796 39275 gene locus_tag LOCUS_14820 39796 39275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 40695 40372 gene locus_tag LOCUS_14830 40695 40372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064810.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence23 2362 2171 gene locus_tag LOCUS_14840 2362 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3525 2359 gene locus_tag LOCUS_14850 3525 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3845 3525 gene locus_tag LOCUS_14860 3845 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 5395 3845 gene locus_tag LOCUS_14870 5395 3845 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_14870 5828 6247 gene locus_tag LOCUS_14880 5828 6247 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933077.1 protein_id gnl|my_center|LOCUS_14880 7095 6349 gene locus_tag LOCUS_14890 7095 6349 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_14890 7334 7879 gene locus_tag LOCUS_14900 7334 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 8298 7957 gene locus_tag LOCUS_14910 8298 7957 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931828.1 protein_id gnl|my_center|LOCUS_14910 9642 8308 gene locus_tag LOCUS_14920 9642 8308 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931827.1 protein_id gnl|my_center|LOCUS_14920 10362 9865 gene locus_tag LOCUS_14930 10362 9865 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_14930 11338 10397 gene locus_tag LOCUS_14940 11338 10397 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931825.1 protein_id gnl|my_center|LOCUS_14940 13215 11371 gene locus_tag LOCUS_14950 gene glmS 13215 11371 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_14950 14153 13317 gene locus_tag LOCUS_14960 gene pyrF 14153 13317 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931823.1 protein_id gnl|my_center|LOCUS_14960 14474 16486 gene locus_tag LOCUS_14970 gene ftsH 14474 16486 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931821.1 protein_id gnl|my_center|LOCUS_14970 16608 16534 gene locus_tag LOCUS_t00330 16608 16534 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16772 17920 gene locus_tag LOCUS_14980 16772 17920 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_14980 18015 19376 gene locus_tag LOCUS_14990 gene rseP 18015 19376 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931818.1 protein_id gnl|my_center|LOCUS_14990 19395 20468 gene locus_tag LOCUS_15000 gene prfA 19395 20468 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931817.1 protein_id gnl|my_center|LOCUS_15000 20493 21104 gene locus_tag LOCUS_15010 20493 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927190.1 protein_id gnl|my_center|LOCUS_15010 21118 21633 gene locus_tag LOCUS_15020 21118 21633 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931814.1 protein_id gnl|my_center|LOCUS_15020 22235 21705 gene locus_tag LOCUS_15030 22235 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 22620 22219 gene locus_tag LOCUS_15040 22620 22219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 22871 24076 gene locus_tag LOCUS_15050 22871 24076 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931810.1 protein_id gnl|my_center|LOCUS_15050 24197 25804 gene locus_tag LOCUS_15060 24197 25804 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931808.1 protein_id gnl|my_center|LOCUS_15060 25813 26403 gene locus_tag LOCUS_15070 25813 26403 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931807.1 protein_id gnl|my_center|LOCUS_15070 26400 27701 gene locus_tag LOCUS_15080 26400 27701 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_15080 27706 28134 gene locus_tag LOCUS_15090 27706 28134 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931805.1 protein_id gnl|my_center|LOCUS_15090 28147 29340 gene locus_tag LOCUS_15100 28147 29340 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986826.1 protein_id gnl|my_center|LOCUS_15100 29620 30255 gene locus_tag LOCUS_15110 29620 30255 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933693.1 protein_id gnl|my_center|LOCUS_15110 30243 30749 gene locus_tag LOCUS_15120 gene ribE 30243 30749 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933692.1 protein_id gnl|my_center|LOCUS_15120 30991 30794 gene locus_tag LOCUS_15130 30991 30794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 33554 31083 gene locus_tag LOCUS_15140 33554 31083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 34297 33575 gene locus_tag LOCUS_15150 34297 33575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 35241 34294 gene locus_tag LOCUS_15160 35241 34294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 37245 35245 gene locus_tag LOCUS_15170 37245 35245 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974731.1 protein_id gnl|my_center|LOCUS_15170 37676 37242 gene locus_tag LOCUS_15180 37676 37242 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_15180 38086 37688 gene locus_tag LOCUS_15190 38086 37688 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065296.1 protein_id gnl|my_center|LOCUS_15190 38698 38096 gene locus_tag LOCUS_15200 38698 38096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 39768 38689 gene locus_tag LOCUS_15210 39768 38689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 40397 39771 gene locus_tag LOCUS_15220 40397 39771 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974728.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence24 3245 498 gene locus_tag LOCUS_15230 gene acnA 3245 498 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888355.1 protein_id gnl|my_center|LOCUS_15230 4560 3922 gene locus_tag LOCUS_15240 gene msrA 4560 3922 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928865.1 protein_id gnl|my_center|LOCUS_15240 5984 4569 gene locus_tag LOCUS_15250 5984 4569 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252802.1 protein_id gnl|my_center|LOCUS_15250 6778 6275 gene locus_tag LOCUS_15260 6778 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 7886 8167 gene locus_tag LOCUS_15270 7886 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15270 8171 8428 gene locus_tag LOCUS_15280 8171 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15280 8491 9267 gene locus_tag LOCUS_15290 8491 9267 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 protein_id gnl|my_center|LOCUS_15290 9351 9578 gene locus_tag LOCUS_15300 9351 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 9815 10429 gene locus_tag LOCUS_15310 9815 10429 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_15310 10780 10535 gene locus_tag LOCUS_15320 10780 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 11101 10910 gene locus_tag LOCUS_15330 11101 10910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 11479 11661 gene locus_tag LOCUS_15340 11479 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 12150 12374 gene locus_tag LOCUS_15350 12150 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 12468 13178 gene locus_tag LOCUS_15360 12468 13178 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069811042.1 protein_id gnl|my_center|LOCUS_15360 13424 13783 gene locus_tag LOCUS_15370 13424 13783 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049049137.1 protein_id gnl|my_center|LOCUS_15370 13860 14237 gene locus_tag LOCUS_15380 13860 14237 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_15380 14242 15297 gene locus_tag LOCUS_15390 gene arsB 14242 15297 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933386.1 protein_id gnl|my_center|LOCUS_15390 15380 15781 gene locus_tag LOCUS_15400 15380 15781 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_15400 15794 16156 gene locus_tag LOCUS_15410 gene arsD 15794 16156 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817072.1 protein_id gnl|my_center|LOCUS_15410 16183 17937 gene locus_tag LOCUS_15420 gene arsA 16183 17937 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705614.1 protein_id gnl|my_center|LOCUS_15420 18035 18120 gene locus_tag LOCUS_t00340 18035 18120 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18129 18220 gene locus_tag LOCUS_t00350 18129 18220 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18350 19363 gene locus_tag LOCUS_15430 18350 19363 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_15430 19360 19926 gene locus_tag LOCUS_15440 gene def 19360 19926 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933121.1 protein_id gnl|my_center|LOCUS_15440 19947 20879 gene locus_tag LOCUS_15450 gene fmt 19947 20879 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439259.1 protein_id gnl|my_center|LOCUS_15450 20958 22775 gene locus_tag LOCUS_15460 gene lepA 20958 22775 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_15460 22829 23659 gene locus_tag LOCUS_15470 gene lepB 22829 23659 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_15470 24069 23653 gene locus_tag LOCUS_15480 24069 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 24182 25678 gene locus_tag LOCUS_15490 gene trpE 24182 25678 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933115.1 protein_id gnl|my_center|LOCUS_15490 25700 27244 gene locus_tag LOCUS_15500 25700 27244 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_15500 27403 27882 gene locus_tag LOCUS_15510 gene greA 27403 27882 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933113.1 protein_id gnl|my_center|LOCUS_15510 27906 28130 gene locus_tag LOCUS_15520 27906 28130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933112.1 protein_id gnl|my_center|LOCUS_15520 28134 28889 gene locus_tag LOCUS_15530 gene tpiA 28134 28889 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927032.1 protein_id gnl|my_center|LOCUS_15530 30581 28947 gene locus_tag LOCUS_15540 gene thiC 30581 28947 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933109.1 protein_id gnl|my_center|LOCUS_15540 31005 31544 gene locus_tag LOCUS_15550 31005 31544 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_15550 31634 32344 gene locus_tag LOCUS_15560 31634 32344 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927160.1 protein_id gnl|my_center|LOCUS_15560 34146 32422 gene locus_tag LOCUS_15570 gene cydC 34146 32422 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933482.1 protein_id gnl|my_center|LOCUS_15570 35882 34143 gene locus_tag LOCUS_15580 gene cydD 35882 34143 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933481.1 protein_id gnl|my_center|LOCUS_15580 36488 36093 gene locus_tag LOCUS_15590 36488 36093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 36714 36523 gene locus_tag LOCUS_15600 36714 36523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 38044 36758 gene locus_tag LOCUS_15610 38044 36758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 39106 38390 gene locus_tag LOCUS_15620 39106 38390 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence25 843 328 gene locus_tag LOCUS_15630 gene nusB 843 328 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933372.1 protein_id gnl|my_center|LOCUS_15630 1555 854 gene locus_tag LOCUS_15640 1555 854 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_15640 5110 1574 gene locus_tag LOCUS_15650 gene smc 5110 1574 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933370.1 protein_id gnl|my_center|LOCUS_15650 6084 5194 gene locus_tag LOCUS_15660 gene folP 6084 5194 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927073.1 protein_id gnl|my_center|LOCUS_15660 7112 6084 gene locus_tag LOCUS_15670 7112 6084 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933368.1 protein_id gnl|my_center|LOCUS_15670 7659 7192 gene locus_tag LOCUS_15680 7659 7192 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927072.1 protein_id gnl|my_center|LOCUS_15680 8226 7768 gene locus_tag LOCUS_15690 8226 7768 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926900.1 protein_id gnl|my_center|LOCUS_15690 8381 8857 gene locus_tag LOCUS_15700 gene bcp 8381 8857 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_15700 8868 9431 gene locus_tag LOCUS_15710 8868 9431 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932347.1 protein_id gnl|my_center|LOCUS_15710 9626 10026 gene locus_tag LOCUS_tm00010 9626 10026 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 11068 12477 gene locus_tag LOCUS_15720 11068 12477 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965302.1 protein_id gnl|my_center|LOCUS_15720 12540 13085 gene locus_tag LOCUS_15730 12540 13085 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404314.1 protein_id gnl|my_center|LOCUS_15730 13426 14580 gene locus_tag LOCUS_15740 13426 14580 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_15740 14577 15083 gene locus_tag LOCUS_15750 14577 15083 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 protein_id gnl|my_center|LOCUS_15750 15203 15373 gene locus_tag LOCUS_15760 15203 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 15798 16784 gene locus_tag LOCUS_15770 15798 16784 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932763.1 protein_id gnl|my_center|LOCUS_15770 17787 16924 gene locus_tag LOCUS_15780 17787 16924 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080204.1 protein_id gnl|my_center|LOCUS_15780 19357 17780 gene locus_tag LOCUS_15790 19357 17780 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249768.1 protein_id gnl|my_center|LOCUS_15790 20937 19546 gene locus_tag LOCUS_15800 gene fumC 20937 19546 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650562.1 protein_id gnl|my_center|LOCUS_15800 21316 23340 gene locus_tag LOCUS_15810 21316 23340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 23503 24669 gene locus_tag LOCUS_15820 23503 24669 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927165.1 protein_id gnl|my_center|LOCUS_15820 25122 25349 gene locus_tag LOCUS_15830 25122 25349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 25649 26410 gene locus_tag LOCUS_15840 25649 26410 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973571.1 protein_id gnl|my_center|LOCUS_15840 26910 27734 gene locus_tag LOCUS_15850 gene cas6 26910 27734 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082360.1 protein_id gnl|my_center|LOCUS_15850 27759 28475 gene locus_tag LOCUS_15860 27759 28475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 28468 30036 gene locus_tag LOCUS_15870 28468 30036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 30072 31019 gene locus_tag LOCUS_15880 30072 31019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 31026 33245 gene locus_tag LOCUS_15890 31026 33245 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202915.1 protein_id gnl|my_center|LOCUS_15890 33249 34403 gene locus_tag LOCUS_15900 gene cas1b 33249 34403 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_15900 34431 34691 gene locus_tag LOCUS_15910 gene cas2 34431 34691 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_15910 34698 35198 gene locus_tag LOCUS_15920 gene cas4 34698 35198 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930592.1 protein_id gnl|my_center|LOCUS_15920 35431 35987 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attctaattgcaccaatatggaattgaaac >Feature sequence26 1105 107 gene locus_tag LOCUS_15930 1105 107 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_15930 2081 1521 gene locus_tag LOCUS_15940 2081 1521 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927164.1 protein_id gnl|my_center|LOCUS_15940 2698 2342 gene locus_tag LOCUS_15950 2698 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3552 3938 gene locus_tag LOCUS_15960 3552 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 4486 6522 gene locus_tag LOCUS_15970 4486 6522 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926974.1 protein_id gnl|my_center|LOCUS_15970 6551 7303 gene locus_tag LOCUS_15980 6551 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926870.1 protein_id gnl|my_center|LOCUS_15980 10305 7402 gene locus_tag LOCUS_15990 10305 7402 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_15990 10828 10583 gene locus_tag LOCUS_16000 gene tatA 10828 10583 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_16000 11264 11659 gene locus_tag LOCUS_16010 11264 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941417.1 protein_id gnl|my_center|LOCUS_16010 11901 13022 gene locus_tag LOCUS_16020 gene cfa 11901 13022 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933625.1 protein_id gnl|my_center|LOCUS_16020 15711 13066 gene locus_tag LOCUS_16030 15711 13066 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_16030 16003 16380 gene locus_tag LOCUS_16040 16003 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_16040 16484 17209 gene locus_tag LOCUS_16050 16484 17209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 17273 17827 gene locus_tag LOCUS_16060 17273 17827 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_16060 18169 17876 gene locus_tag LOCUS_16070 18169 17876 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931769.1 protein_id gnl|my_center|LOCUS_16070 18820 18353 gene locus_tag LOCUS_16080 18820 18353 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933002.1 protein_id gnl|my_center|LOCUS_16080 21990 18820 gene locus_tag LOCUS_16090 21990 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 22478 22029 gene locus_tag LOCUS_16100 22478 22029 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_16100 23102 25498 gene locus_tag LOCUS_16110 23102 25498 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933627.1 protein_id gnl|my_center|LOCUS_16110 25518 27071 gene locus_tag LOCUS_16120 gene casA 25518 27071 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933628.1 protein_id gnl|my_center|LOCUS_16120 27084 27617 gene locus_tag LOCUS_16130 gene casB 27084 27617 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933629.1 protein_id gnl|my_center|LOCUS_16130 27614 28240 gene locus_tag LOCUS_16140 gene cas6e 27614 28240 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933630.1 protein_id gnl|my_center|LOCUS_16140 28252 29295 gene locus_tag LOCUS_16150 gene cas7e 28252 29295 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933631.1 protein_id gnl|my_center|LOCUS_16150 29292 30023 gene locus_tag LOCUS_16160 gene cas5e 29292 30023 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933632.1 protein_id gnl|my_center|LOCUS_16160 30016 30891 gene locus_tag LOCUS_16170 gene cas1e 30016 30891 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933633.1 protein_id gnl|my_center|LOCUS_16170 30891 31202 gene locus_tag LOCUS_16180 gene cas2e 30891 31202 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933634.1 protein_id gnl|my_center|LOCUS_16180 31230 32966 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttccccacaggcgtgggggtgtttc 33818 33078 gene locus_tag LOCUS_16190 gene istB 33818 33078 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence27 1116 424 gene locus_tag LOCUS_16200 1116 424 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932754.1 protein_id gnl|my_center|LOCUS_16200 2473 1346 gene locus_tag LOCUS_16210 2473 1346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301659.1 protein_id gnl|my_center|LOCUS_16210 5217 2476 gene locus_tag LOCUS_16220 gene rbbA 5217 2476 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_16220 6209 5214 gene locus_tag LOCUS_16230 6209 5214 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 protein_id gnl|my_center|LOCUS_16230 6551 6297 gene locus_tag LOCUS_16240 6551 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 7892 6567 gene locus_tag LOCUS_16250 7892 6567 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_16250 8198 7977 gene locus_tag LOCUS_16260 8198 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 8790 8230 gene locus_tag LOCUS_16270 8790 8230 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927164.1 protein_id gnl|my_center|LOCUS_16270 9087 11225 gene locus_tag LOCUS_16280 9087 11225 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926802.1 protein_id gnl|my_center|LOCUS_16280 11222 12298 gene locus_tag LOCUS_16290 11222 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 12999 12430 gene locus_tag LOCUS_16300 gene bciC 12999 12430 CDS product chlorophyllide a hydrolase BciC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932755.1 protein_id gnl|my_center|LOCUS_16300 13896 13021 gene locus_tag LOCUS_16310 gene lipA 13896 13021 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932756.1 protein_id gnl|my_center|LOCUS_16310 14196 15464 gene locus_tag LOCUS_16320 14196 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 15471 15647 gene locus_tag LOCUS_16330 15471 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 15661 16911 gene locus_tag LOCUS_16340 15661 16911 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_16340 16989 17930 gene locus_tag LOCUS_16350 gene moaCB 16989 17930 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932998.1 protein_id gnl|my_center|LOCUS_16350 17927 19153 gene locus_tag LOCUS_16360 17927 19153 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927020.1 protein_id gnl|my_center|LOCUS_16360 19159 20307 gene locus_tag LOCUS_16370 gene mobAB 19159 20307 CDS product bifunctional molybdenum cofactor guanylyltransferase MobA/molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927249.1 protein_id gnl|my_center|LOCUS_16370 21168 20317 gene locus_tag LOCUS_16380 gene modD 21168 20317 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932141.1 protein_id gnl|my_center|LOCUS_16380 21539 21940 gene locus_tag LOCUS_16390 21539 21940 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_16390 21966 22289 gene locus_tag LOCUS_16400 21966 22289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 22378 22626 gene locus_tag LOCUS_16410 22378 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 22923 23171 gene locus_tag LOCUS_16420 22923 23171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932800.1 protein_id gnl|my_center|LOCUS_16420 23837 23271 gene locus_tag LOCUS_16430 23837 23271 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389495.1 protein_id gnl|my_center|LOCUS_16430 25027 23897 gene locus_tag LOCUS_16440 gene scfB 25027 23897 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965577.1 protein_id gnl|my_center|LOCUS_16440 25541 25083 gene locus_tag LOCUS_16450 25541 25083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 26998 25859 gene locus_tag LOCUS_16460 26998 25859 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037397.1 protein_id gnl|my_center|LOCUS_16460 27650 28801 gene locus_tag LOCUS_16470 27650 28801 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927091.1 protein_id gnl|my_center|LOCUS_16470 28909 28983 gene locus_tag LOCUS_t00360 28909 28983 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 29254 30144 gene locus_tag LOCUS_16480 29254 30144 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_16480 30193 30906 gene locus_tag LOCUS_16490 30193 30906 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816178.1 protein_id gnl|my_center|LOCUS_16490 30928 31806 gene locus_tag LOCUS_16500 30928 31806 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460731.1 protein_id gnl|my_center|LOCUS_16500 31863 33662 gene locus_tag LOCUS_16510 31863 33662 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945027.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence28 1440 394 gene locus_tag LOCUS_16520 gene hypE 1440 394 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_16520 2534 1437 gene locus_tag LOCUS_16530 gene hypD 2534 1437 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933454.1 protein_id gnl|my_center|LOCUS_16530 2823 2551 gene locus_tag LOCUS_16540 2823 2551 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927089.1 protein_id gnl|my_center|LOCUS_16540 5250 2878 gene locus_tag LOCUS_16550 gene hypF 5250 2878 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933457.1 protein_id gnl|my_center|LOCUS_16550 6062 5211 gene locus_tag LOCUS_16560 gene hypB 6062 5211 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_16560 6420 6067 gene locus_tag LOCUS_16570 gene hypA 6420 6067 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933459.1 protein_id gnl|my_center|LOCUS_16570 6831 7724 gene locus_tag LOCUS_16580 6831 7724 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933460.1 protein_id gnl|my_center|LOCUS_16580 7779 8621 gene locus_tag LOCUS_16590 7779 8621 CDS product DUF1207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933461.1 protein_id gnl|my_center|LOCUS_16590 9152 8646 gene locus_tag LOCUS_16600 9152 8646 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927090.1 protein_id gnl|my_center|LOCUS_16600 9386 10531 gene locus_tag LOCUS_16610 9386 10531 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927091.1 protein_id gnl|my_center|LOCUS_16610 10941 11378 gene locus_tag LOCUS_16620 10941 11378 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_16620 11453 13030 gene locus_tag LOCUS_16630 11453 13030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820458.1 protein_id gnl|my_center|LOCUS_16630 13057 13281 gene locus_tag LOCUS_16640 13057 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 13383 15266 gene locus_tag LOCUS_16650 gene uvrC 13383 15266 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933467.1 protein_id gnl|my_center|LOCUS_16650 15372 16769 gene locus_tag LOCUS_16660 15372 16769 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933468.1 protein_id gnl|my_center|LOCUS_16660 16766 17638 gene locus_tag LOCUS_16670 gene aroE 16766 17638 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933469.1 protein_id gnl|my_center|LOCUS_16670 17646 18155 gene locus_tag LOCUS_16680 gene lspA 17646 18155 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933470.1 protein_id gnl|my_center|LOCUS_16680 18145 18918 gene locus_tag LOCUS_16690 18145 18918 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933471.1 protein_id gnl|my_center|LOCUS_16690 19028 19693 gene locus_tag LOCUS_16700 19028 19693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 19727 20218 gene locus_tag LOCUS_16710 19727 20218 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933473.1 protein_id gnl|my_center|LOCUS_16710 20228 20917 gene locus_tag LOCUS_16720 20228 20917 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933474.1 protein_id gnl|my_center|LOCUS_16720 20976 21797 gene locus_tag LOCUS_16730 20976 21797 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_16730 21813 22877 gene locus_tag LOCUS_16740 gene mtnA 21813 22877 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933476.1 protein_id gnl|my_center|LOCUS_16740 23016 24407 gene locus_tag LOCUS_16750 gene ccoN 23016 24407 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063997.1 protein_id gnl|my_center|LOCUS_16750 24439 25110 gene locus_tag LOCUS_16760 24439 25110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16760 25107 25250 gene locus_tag LOCUS_16770 25107 25250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 25281 25742 gene locus_tag LOCUS_16780 25281 25742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 25770 26873 gene locus_tag LOCUS_16790 25770 26873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 26870 27343 gene locus_tag LOCUS_16800 26870 27343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 27330 29756 gene locus_tag LOCUS_16810 27330 29756 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289041.1 protein_id gnl|my_center|LOCUS_16810 29767 29967 gene locus_tag LOCUS_16820 29767 29967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 29964 30641 gene locus_tag LOCUS_16830 29964 30641 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_16830 30572 30949 gene locus_tag LOCUS_16840 30572 30949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 30909 31169 gene locus_tag LOCUS_16850 30909 31169 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_16850 31491 31955 gene locus_tag LOCUS_16860 31491 31955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 32171 32653 gene locus_tag LOCUS_16870 32171 32653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 32805 32987 gene locus_tag LOCUS_16880 32805 32987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 33011 33253 gene locus_tag LOCUS_16890 33011 33253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 33250 33489 gene locus_tag LOCUS_16900 33250 33489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence29 2562 466 gene locus_tag LOCUS_16910 gene glgX 2562 466 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 protein_id gnl|my_center|LOCUS_16910 2978 2565 gene locus_tag LOCUS_16920 2978 2565 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027277.1 protein_id gnl|my_center|LOCUS_16920 3560 2994 gene locus_tag LOCUS_16930 gene pfpI 3560 2994 CDS product protease PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102879.1 protein_id gnl|my_center|LOCUS_16930 5339 3618 gene locus_tag LOCUS_16940 5339 3618 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_16940 6144 5314 gene locus_tag LOCUS_16950 6144 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 6591 6199 gene locus_tag LOCUS_16960 6591 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 7091 6654 gene locus_tag LOCUS_16970 7091 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 8726 7233 gene locus_tag LOCUS_16980 8726 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 9572 8748 gene locus_tag LOCUS_16990 9572 8748 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970774.1 protein_id gnl|my_center|LOCUS_16990 10397 9648 gene locus_tag LOCUS_17000 10397 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 10764 10426 gene locus_tag LOCUS_17010 10764 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 11621 10824 gene locus_tag LOCUS_17020 11621 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 11933 12115 gene locus_tag LOCUS_17030 11933 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129052038.1 protein_id gnl|my_center|LOCUS_17030 13129 12167 gene locus_tag LOCUS_17040 13129 12167 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_17040 13287 13856 gene locus_tag LOCUS_17050 13287 13856 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926845.1 protein_id gnl|my_center|LOCUS_17050 13831 15378 gene locus_tag LOCUS_17060 13831 15378 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_17060 15389 16321 gene locus_tag LOCUS_17070 15389 16321 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_17070 16308 17192 gene locus_tag LOCUS_17080 16308 17192 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926844.1 protein_id gnl|my_center|LOCUS_17080 18901 17189 gene locus_tag LOCUS_17090 gene recJ 18901 17189 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932052.1 protein_id gnl|my_center|LOCUS_17090 19086 20087 gene locus_tag LOCUS_17100 gene fbp 19086 20087 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932050.1 protein_id gnl|my_center|LOCUS_17100 20974 20144 gene locus_tag LOCUS_17110 20974 20144 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932049.1 protein_id gnl|my_center|LOCUS_17110 21170 22525 gene locus_tag LOCUS_17120 21170 22525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 24863 22638 gene locus_tag LOCUS_17130 24863 22638 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932043.1 protein_id gnl|my_center|LOCUS_17130 26026 25148 gene locus_tag LOCUS_17140 26026 25148 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932042.1 protein_id gnl|my_center|LOCUS_17140 27467 26166 gene locus_tag LOCUS_17150 27467 26166 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926842.1 protein_id gnl|my_center|LOCUS_17150 28190 27612 gene locus_tag LOCUS_17160 28190 27612 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_17160 29233 28202 gene locus_tag LOCUS_17170 29233 28202 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926841.1 protein_id gnl|my_center|LOCUS_17170 31445 29235 gene locus_tag LOCUS_17180 31445 29235 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926840.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence30 <1 966 gene locus_tag LOCUS_17190 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948400.1:class I SAM-dependent DNA methyltransferase 963 2570 gene locus_tag LOCUS_17200 963 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2567 4333 gene locus_tag LOCUS_17210 2567 4333 CDS product restriction system-associated AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123252.1 protein_id gnl|my_center|LOCUS_17210 4375 5457 gene locus_tag LOCUS_17220 4375 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123253.1 protein_id gnl|my_center|LOCUS_17220 5900 6802 gene locus_tag LOCUS_17230 5900 6802 CDS product sce7726 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459264.1 protein_id gnl|my_center|LOCUS_17230 6810 7760 gene locus_tag LOCUS_17240 6810 7760 CDS product sce7725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295913.1 protein_id gnl|my_center|LOCUS_17240 7757 8782 gene locus_tag LOCUS_17250 7757 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 8785 9060 gene locus_tag LOCUS_17260 8785 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 9075 9932 gene locus_tag LOCUS_17270 9075 9932 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016475763.1 protein_id gnl|my_center|LOCUS_17270 10093 10437 gene locus_tag LOCUS_17280 10093 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 11246 12688 gene locus_tag LOCUS_17290 11246 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 12718 12930 gene locus_tag LOCUS_17300 12718 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 13497 13339 gene locus_tag LOCUS_17310 13497 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 13747 13484 gene locus_tag LOCUS_17320 13747 13484 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816235.1 protein_id gnl|my_center|LOCUS_17320 14317 14661 gene locus_tag LOCUS_17330 14317 14661 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208381.1 protein_id gnl|my_center|LOCUS_17330 14772 15011 gene locus_tag LOCUS_17340 14772 15011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 15093 15362 gene locus_tag LOCUS_17350 15093 15362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 16034 15396 gene locus_tag LOCUS_17360 16034 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 16326 16484 gene locus_tag LOCUS_17370 16326 16484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 16835 17113 gene locus_tag LOCUS_17380 16835 17113 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_17380 17097 17336 gene locus_tag LOCUS_17390 17097 17336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 18238 18011 gene locus_tag LOCUS_17400 18238 18011 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079902.1 protein_id gnl|my_center|LOCUS_17400 18450 18241 gene locus_tag LOCUS_17410 18450 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 18898 19134 gene locus_tag LOCUS_17420 18898 19134 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_17420 19115 19423 gene locus_tag LOCUS_17430 19115 19423 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_17430 19450 19686 gene locus_tag LOCUS_17440 19450 19686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 19732 20610 gene locus_tag LOCUS_17450 19732 20610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 20991 22130 gene locus_tag LOCUS_17460 20991 22130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 22152 22832 gene locus_tag LOCUS_17470 22152 22832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 22917 23216 gene locus_tag LOCUS_17480 22917 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 23210 24622 gene locus_tag LOCUS_17490 23210 24622 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_17490 24619 25149 gene locus_tag LOCUS_17500 24619 25149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_17500 25146 25823 gene locus_tag LOCUS_17510 25146 25823 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_17510 26187 26768 gene locus_tag LOCUS_17520 26187 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 28265 28822 gene locus_tag LOCUS_17530 28265 28822 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 protein_id gnl|my_center|LOCUS_17530 29474 28851 gene locus_tag LOCUS_17540 29474 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 30040 29729 gene locus_tag LOCUS_17550 30040 29729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17550 >Feature sequence31 717 46 gene locus_tag LOCUS_17560 717 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1080 1448 gene locus_tag LOCUS_17570 1080 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1784 2065 gene locus_tag LOCUS_17580 1784 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672992.1 protein_id gnl|my_center|LOCUS_17580 3637 2219 gene locus_tag LOCUS_17590 gene hemN 3637 2219 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932064.1 protein_id gnl|my_center|LOCUS_17590 3938 4462 gene locus_tag LOCUS_17600 gene purE 3938 4462 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932063.1 protein_id gnl|my_center|LOCUS_17600 4449 4949 gene locus_tag LOCUS_17610 4449 4949 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932062.1 protein_id gnl|my_center|LOCUS_17610 5061 6365 gene locus_tag LOCUS_17620 5061 6365 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_17620 6362 6574 gene locus_tag LOCUS_17630 6362 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 6773 7984 gene locus_tag LOCUS_17640 6773 7984 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932059.1 protein_id gnl|my_center|LOCUS_17640 7998 8201 gene locus_tag LOCUS_17650 7998 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 9007 8198 gene locus_tag LOCUS_17660 9007 8198 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933247.1 protein_id gnl|my_center|LOCUS_17660 9552 9037 gene locus_tag LOCUS_17670 9552 9037 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933248.1 protein_id gnl|my_center|LOCUS_17670 10088 9555 gene locus_tag LOCUS_17680 10088 9555 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933249.1 protein_id gnl|my_center|LOCUS_17680 10837 10088 gene locus_tag LOCUS_17690 10837 10088 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933250.1 protein_id gnl|my_center|LOCUS_17690 11140 13035 gene locus_tag LOCUS_17700 gene dnaG 11140 13035 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933252.1 protein_id gnl|my_center|LOCUS_17700 14392 13076 gene locus_tag LOCUS_17710 14392 13076 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933254.1 protein_id gnl|my_center|LOCUS_17710 15682 14429 gene locus_tag LOCUS_17720 15682 14429 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927057.1 protein_id gnl|my_center|LOCUS_17720 15912 17768 gene locus_tag LOCUS_17730 gene carB 15912 17768 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933256.1 protein_id gnl|my_center|LOCUS_17730 17786 18262 gene locus_tag LOCUS_17740 17786 18262 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927059.1 protein_id gnl|my_center|LOCUS_17740 19140 18274 gene locus_tag LOCUS_17750 19140 18274 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933259.1 protein_id gnl|my_center|LOCUS_17750 19293 21419 gene locus_tag LOCUS_17760 gene glgP 19293 21419 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933260.1 protein_id gnl|my_center|LOCUS_17760 21497 22441 gene locus_tag LOCUS_17770 21497 22441 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927060.1 protein_id gnl|my_center|LOCUS_17770 23553 22459 gene locus_tag LOCUS_17780 23553 22459 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_17780 23722 24195 gene locus_tag LOCUS_17790 gene ispF 23722 24195 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933265.1 protein_id gnl|my_center|LOCUS_17790 25466 24192 gene locus_tag LOCUS_17800 25466 24192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933266.1 protein_id gnl|my_center|LOCUS_17800 25648 26853 gene locus_tag LOCUS_17810 25648 26853 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933267.1 protein_id gnl|my_center|LOCUS_17810 26955 27866 gene locus_tag LOCUS_17820 26955 27866 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933269.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence32 1670 96 gene locus_tag LOCUS_17830 gene istA 1670 96 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_17830 2868 2218 gene locus_tag LOCUS_17840 2868 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 4202 2865 gene locus_tag LOCUS_17850 4202 2865 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_17850 5233 4607 gene locus_tag LOCUS_17860 5233 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 6040 5384 gene locus_tag LOCUS_17870 6040 5384 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977985.1 protein_id gnl|my_center|LOCUS_17870 6700 6176 gene locus_tag LOCUS_17880 6700 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 7428 6772 gene locus_tag LOCUS_17890 7428 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926920.1 protein_id gnl|my_center|LOCUS_17890 7576 8451 gene locus_tag LOCUS_17900 gene pgl 7576 8451 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933529.1 protein_id gnl|my_center|LOCUS_17900 9802 8366 gene locus_tag LOCUS_17910 gene zwf 9802 8366 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933531.1 protein_id gnl|my_center|LOCUS_17910 10714 9815 gene locus_tag LOCUS_17920 gene gnd 10714 9815 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933532.1 protein_id gnl|my_center|LOCUS_17920 11900 10722 gene locus_tag LOCUS_17930 11900 10722 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933540.1 protein_id gnl|my_center|LOCUS_17930 12482 12012 gene locus_tag LOCUS_17940 12482 12012 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933541.1 protein_id gnl|my_center|LOCUS_17940 14020 12611 gene locus_tag LOCUS_17950 14020 12611 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933544.1 protein_id gnl|my_center|LOCUS_17950 14192 14950 gene locus_tag LOCUS_17960 14192 14950 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933545.1 protein_id gnl|my_center|LOCUS_17960 15943 15152 gene locus_tag LOCUS_17970 15943 15152 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933546.1 protein_id gnl|my_center|LOCUS_17970 16746 15940 gene locus_tag LOCUS_17980 16746 15940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933547.1 protein_id gnl|my_center|LOCUS_17980 16972 18261 gene locus_tag LOCUS_17990 16972 18261 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933548.1 protein_id gnl|my_center|LOCUS_17990 18489 19088 gene locus_tag LOCUS_18000 18489 19088 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927164.1 protein_id gnl|my_center|LOCUS_18000 19308 20387 gene locus_tag LOCUS_18010 19308 20387 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933549.1 protein_id gnl|my_center|LOCUS_18010 20348 21265 gene locus_tag LOCUS_18020 20348 21265 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986803.1 protein_id gnl|my_center|LOCUS_18020 21276 22040 gene locus_tag LOCUS_18030 21276 22040 CDS product NADH ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933551.1 protein_id gnl|my_center|LOCUS_18030 22030 23304 gene locus_tag LOCUS_18040 22030 23304 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933552.1 protein_id gnl|my_center|LOCUS_18040 23771 23343 gene locus_tag LOCUS_18050 23771 23343 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_18050 24900 23812 gene locus_tag LOCUS_18060 24900 23812 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927112.1 protein_id gnl|my_center|LOCUS_18060 26152 24956 gene locus_tag LOCUS_18070 26152 24956 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933556.1 protein_id gnl|my_center|LOCUS_18070 26816 26289 gene locus_tag LOCUS_18080 26816 26289 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927113.1 protein_id gnl|my_center|LOCUS_18080 27112 27363 gene locus_tag LOCUS_18090 27112 27363 CDS product bacteriochlorophyll c-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933717.1 protein_id gnl|my_center|LOCUS_18090 27477 28211 gene locus_tag LOCUS_18100 gene lptB 27477 28211 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence33 1584 1156 gene locus_tag LOCUS_18110 1584 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2195 1689 gene locus_tag LOCUS_18120 2195 1689 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933430.1 protein_id gnl|my_center|LOCUS_18120 3033 2209 gene locus_tag LOCUS_18130 3033 2209 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933431.1 protein_id gnl|my_center|LOCUS_18130 4341 3040 gene locus_tag LOCUS_18140 4341 3040 CDS product RuBisCO large subunit C-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933432.1 protein_id gnl|my_center|LOCUS_18140 5310 4429 gene locus_tag LOCUS_18150 gene lsrF 5310 4429 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_18150 7481 5361 gene locus_tag LOCUS_18160 7481 5361 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927084.1 protein_id gnl|my_center|LOCUS_18160 8265 7792 gene locus_tag LOCUS_18170 gene bchF 8265 7792 CDS product 2-vinyl bacteriochlorophyllide hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927085.1 protein_id gnl|my_center|LOCUS_18170 8327 8482 gene locus_tag LOCUS_18180 8327 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 8499 8981 gene locus_tag LOCUS_18190 gene recX 8499 8981 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933438.1 protein_id gnl|my_center|LOCUS_18190 9697 8978 gene locus_tag LOCUS_18200 gene pyrH 9697 8978 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933439.1 protein_id gnl|my_center|LOCUS_18200 10650 9784 gene locus_tag LOCUS_18210 gene tsf 10650 9784 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933440.1 protein_id gnl|my_center|LOCUS_18210 11456 10692 gene locus_tag LOCUS_18220 gene rpsB 11456 10692 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933441.1 protein_id gnl|my_center|LOCUS_18220 12013 11624 gene locus_tag LOCUS_18230 gene rpsI 12013 11624 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933442.1 protein_id gnl|my_center|LOCUS_18230 12481 12032 gene locus_tag LOCUS_18240 gene rplM 12481 12032 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933443.1 protein_id gnl|my_center|LOCUS_18240 12635 13948 gene locus_tag LOCUS_18250 gene der 12635 13948 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933444.1 protein_id gnl|my_center|LOCUS_18250 14012 14923 gene locus_tag LOCUS_18260 14012 14923 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933445.1 protein_id gnl|my_center|LOCUS_18260 15033 15293 gene locus_tag LOCUS_18270 15033 15293 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933446.1 protein_id gnl|my_center|LOCUS_18270 17719 15299 gene locus_tag LOCUS_18280 17719 15299 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927087.1 protein_id gnl|my_center|LOCUS_18280 18848 17751 gene locus_tag LOCUS_18290 gene gcvT 18848 17751 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933448.1 protein_id gnl|my_center|LOCUS_18290 20062 19394 gene locus_tag LOCUS_18300 20062 19394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942125.1 protein_id gnl|my_center|LOCUS_18300 20731 20063 gene locus_tag LOCUS_18310 20731 20063 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986895.1 protein_id gnl|my_center|LOCUS_18310 21417 20830 gene locus_tag LOCUS_18320 21417 20830 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942123.1 protein_id gnl|my_center|LOCUS_18320 23695 21488 gene locus_tag LOCUS_18330 23695 21488 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933210.1 protein_id gnl|my_center|LOCUS_18330 25856 23802 gene locus_tag LOCUS_18340 gene uvrB 25856 23802 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933211.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence34 465 118 gene locus_tag LOCUS_18350 gene rplT 465 118 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933783.1 protein_id gnl|my_center|LOCUS_18350 686 492 gene locus_tag LOCUS_18360 gene rpmI 686 492 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933782.1 protein_id gnl|my_center|LOCUS_18360 1366 734 gene locus_tag LOCUS_18370 gene infC 1366 734 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933781.1 protein_id gnl|my_center|LOCUS_18370 3363 1390 gene locus_tag LOCUS_18380 gene thrS 3363 1390 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933780.1 protein_id gnl|my_center|LOCUS_18380 4961 3549 gene locus_tag LOCUS_18390 gene bchZ 4961 3549 CDS product chlorophyllide a reductase subunit Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933779.1 protein_id gnl|my_center|LOCUS_18390 6561 4981 gene locus_tag LOCUS_18400 6561 4981 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933778.1 protein_id gnl|my_center|LOCUS_18400 7545 7033 gene locus_tag LOCUS_18410 7545 7033 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932408.1 protein_id gnl|my_center|LOCUS_18410 9083 7635 gene locus_tag LOCUS_18420 gene gcvPB 9083 7635 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933777.1 protein_id gnl|my_center|LOCUS_18420 9994 9188 gene locus_tag LOCUS_18430 gene rnc 9994 9188 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933773.1 protein_id gnl|my_center|LOCUS_18430 11256 10003 gene locus_tag LOCUS_18440 gene fabF 11256 10003 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927158.1 protein_id gnl|my_center|LOCUS_18440 11541 11305 gene locus_tag LOCUS_18450 gene acpP 11541 11305 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933771.1 protein_id gnl|my_center|LOCUS_18450 12366 11629 gene locus_tag LOCUS_18460 gene fabG 12366 11629 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933770.1 protein_id gnl|my_center|LOCUS_18460 13300 12392 gene locus_tag LOCUS_18470 gene fabD 13300 12392 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933769.1 protein_id gnl|my_center|LOCUS_18470 14297 13308 gene locus_tag LOCUS_18480 14297 13308 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933768.1 protein_id gnl|my_center|LOCUS_18480 15342 14317 gene locus_tag LOCUS_18490 gene plsX 15342 14317 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927157.1 protein_id gnl|my_center|LOCUS_18490 16135 15590 gene locus_tag LOCUS_18500 16135 15590 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986813.1 protein_id gnl|my_center|LOCUS_18500 16285 16358 gene locus_tag LOCUS_t00370 16285 16358 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 16478 17809 gene locus_tag LOCUS_18510 gene algB 16478 17809 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_18510 17928 19922 gene locus_tag LOCUS_18520 17928 19922 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_18520 20112 21932 gene locus_tag LOCUS_18530 20112 21932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 22184 23854 gene locus_tag LOCUS_18540 gene kdpA 22184 23854 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638330.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence35 746 1831 gene locus_tag LOCUS_18550 gene mnmA 746 1831 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933514.1 protein_id gnl|my_center|LOCUS_18550 1847 2518 gene locus_tag LOCUS_18560 1847 2518 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927102.1 protein_id gnl|my_center|LOCUS_18560 2595 6332 gene locus_tag LOCUS_18570 gene metH 2595 6332 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_18570 7124 6564 gene locus_tag LOCUS_18580 7124 6564 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986783.1 protein_id gnl|my_center|LOCUS_18580 10257 7198 gene locus_tag LOCUS_18590 10257 7198 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011114777.1 protein_id gnl|my_center|LOCUS_18590 10459 10686 gene locus_tag LOCUS_18600 10459 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 10969 11682 gene locus_tag LOCUS_18610 10969 11682 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932023.1 protein_id gnl|my_center|LOCUS_18610 11685 12395 gene locus_tag LOCUS_18620 gene rdgB 11685 12395 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932022.1 protein_id gnl|my_center|LOCUS_18620 12392 13240 gene locus_tag LOCUS_18630 12392 13240 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_18630 13355 14218 gene locus_tag LOCUS_18640 13355 14218 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_18640 14262 15056 gene locus_tag LOCUS_18650 14262 15056 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932019.1 protein_id gnl|my_center|LOCUS_18650 15061 15795 gene locus_tag LOCUS_18660 15061 15795 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932018.1 protein_id gnl|my_center|LOCUS_18660 15820 16698 gene locus_tag LOCUS_18670 15820 16698 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932017.1 protein_id gnl|my_center|LOCUS_18670 16751 17875 gene locus_tag LOCUS_18680 16751 17875 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_18680 19784 17853 gene locus_tag LOCUS_18690 19784 17853 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932015.1 protein_id gnl|my_center|LOCUS_18690 20198 19902 gene locus_tag LOCUS_18700 20198 19902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 21360 20218 gene locus_tag LOCUS_18710 gene lpxB 21360 20218 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931972.1 protein_id gnl|my_center|LOCUS_18710 21480 22862 gene locus_tag LOCUS_18720 21480 22862 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931971.1 protein_id gnl|my_center|LOCUS_18720 22954 23496 gene locus_tag LOCUS_18730 22954 23496 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_18730 23562 23930 gene locus_tag LOCUS_18740 23562 23930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 23927 24424 gene locus_tag LOCUS_18750 23927 24424 CDS product periplasmic heavy metal sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926828.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence36 1227 1493 gene locus_tag LOCUS_18760 1227 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2843 3238 gene locus_tag LOCUS_18770 2843 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3382 3933 gene locus_tag LOCUS_18780 3382 3933 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308669.1 protein_id gnl|my_center|LOCUS_18780 3930 4202 gene locus_tag LOCUS_18790 3930 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 7939 4955 gene locus_tag LOCUS_18800 7939 4955 CDS product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 protein_id gnl|my_center|LOCUS_18800 9021 7936 gene locus_tag LOCUS_18810 9021 7936 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_18810 9507 9058 gene locus_tag LOCUS_18820 9507 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 11514 9520 gene locus_tag LOCUS_18830 11514 9520 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555499.1 protein_id gnl|my_center|LOCUS_18830 14381 11535 gene locus_tag LOCUS_18840 14381 11535 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_18840 14885 16087 gene locus_tag LOCUS_18850 14885 16087 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932911.1 protein_id gnl|my_center|LOCUS_18850 17666 16065 gene locus_tag LOCUS_18860 17666 16065 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932910.1 protein_id gnl|my_center|LOCUS_18860 19981 17699 gene locus_tag LOCUS_18870 gene purL 19981 17699 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_18870 23082 20008 gene locus_tag LOCUS_18880 gene secA 23082 20008 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence37 648 229 gene locus_tag LOCUS_18890 648 229 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 protein_id gnl|my_center|LOCUS_18890 1296 901 gene locus_tag LOCUS_18900 1296 901 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927253.1 protein_id gnl|my_center|LOCUS_18900 2166 1444 gene locus_tag LOCUS_18910 2166 1444 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927022.1 protein_id gnl|my_center|LOCUS_18910 3533 2298 gene locus_tag LOCUS_18920 3533 2298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_18920 4811 3543 gene locus_tag LOCUS_18930 4811 3543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933018.1 protein_id gnl|my_center|LOCUS_18930 5485 4808 gene locus_tag LOCUS_18940 5485 4808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439273.1 protein_id gnl|my_center|LOCUS_18940 6750 5497 gene locus_tag LOCUS_18950 6750 5497 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933016.1 protein_id gnl|my_center|LOCUS_18950 8086 6776 gene locus_tag LOCUS_18960 8086 6776 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933015.1 protein_id gnl|my_center|LOCUS_18960 8842 8267 gene locus_tag LOCUS_18970 8842 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933014.1 protein_id gnl|my_center|LOCUS_18970 9987 8839 gene locus_tag LOCUS_18980 9987 8839 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933013.1 protein_id gnl|my_center|LOCUS_18980 10048 10845 gene locus_tag LOCUS_18990 10048 10845 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986778.1 protein_id gnl|my_center|LOCUS_18990 10889 11722 gene locus_tag LOCUS_19000 gene panB 10889 11722 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933009.1 protein_id gnl|my_center|LOCUS_19000 11988 12659 gene locus_tag LOCUS_19010 gene pssA 11988 12659 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933008.1 protein_id gnl|my_center|LOCUS_19010 12689 12943 gene locus_tag LOCUS_19020 gene purS 12689 12943 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933007.1 protein_id gnl|my_center|LOCUS_19020 13017 13721 gene locus_tag LOCUS_19030 gene purQ 13017 13721 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933006.1 protein_id gnl|my_center|LOCUS_19030 13729 14985 gene locus_tag LOCUS_19040 13729 14985 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_19040 15031 16311 gene locus_tag LOCUS_19050 15031 16311 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932994.1 protein_id gnl|my_center|LOCUS_19050 16308 17504 gene locus_tag LOCUS_19060 16308 17504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19060 17780 18073 gene locus_tag LOCUS_19070 17780 18073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 18171 19985 gene locus_tag LOCUS_19080 gene aspS 18171 19985 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932992.1 protein_id gnl|my_center|LOCUS_19080 21289 20021 gene locus_tag LOCUS_19090 21289 20021 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932989.1 protein_id gnl|my_center|LOCUS_19090 21992 21540 gene locus_tag LOCUS_19100 21992 21540 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932987.1 protein_id gnl|my_center|LOCUS_19100 22110 22035 gene locus_tag LOCUS_t00380 22110 22035 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence38 <1 616 gene locus_tag LOCUS_19110 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766357.1:PDDEXK nuclease domain-containing protein 822 1226 gene locus_tag LOCUS_19120 822 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 1255 3390 gene locus_tag LOCUS_19130 1255 3390 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932948.1 protein_id gnl|my_center|LOCUS_19130 3516 3686 gene locus_tag LOCUS_19140 3516 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 3819 4529 gene locus_tag LOCUS_19150 3819 4529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926963.1 protein_id gnl|my_center|LOCUS_19150 4539 6902 gene locus_tag LOCUS_19160 4539 6902 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932893.1 protein_id gnl|my_center|LOCUS_19160 7121 7363 gene locus_tag LOCUS_19170 7121 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 7357 7623 gene locus_tag LOCUS_19180 7357 7623 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_19180 7733 8896 gene locus_tag LOCUS_19190 7733 8896 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932892.1 protein_id gnl|my_center|LOCUS_19190 9265 8981 gene locus_tag LOCUS_19200 9265 8981 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_19200 9540 9268 gene locus_tag LOCUS_19210 9540 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_19210 9635 9910 gene locus_tag LOCUS_19220 9635 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 9999 10190 gene locus_tag LOCUS_19230 9999 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 10985 11782 gene locus_tag LOCUS_19240 10985 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 12096 12410 gene locus_tag LOCUS_19250 12096 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 12598 12383 gene locus_tag LOCUS_19260 12598 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 12878 12624 gene locus_tag LOCUS_19270 12878 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 13969 12887 gene locus_tag LOCUS_19280 13969 12887 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_19280 15141 14146 gene locus_tag LOCUS_19290 15141 14146 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_19290 16365 15178 gene locus_tag LOCUS_19300 16365 15178 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870366.1 protein_id gnl|my_center|LOCUS_19300 17081 16464 gene locus_tag LOCUS_19310 17081 16464 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938929.1 protein_id gnl|my_center|LOCUS_19310 19356 18172 gene locus_tag LOCUS_19320 19356 18172 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_19320 <22104 19353 gene locus_tag LOCUS_19330 <22104 19353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039227.1:ATP-binding protein >Feature sequence39 2097 400 gene locus_tag LOCUS_19340 2097 400 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931836.1 protein_id gnl|my_center|LOCUS_19340 2364 2140 gene locus_tag LOCUS_19350 2364 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 4887 2401 gene locus_tag LOCUS_19360 gene gyrA 4887 2401 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_19360 5406 5011 gene locus_tag LOCUS_19370 gene rsfS 5406 5011 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926804.1 protein_id gnl|my_center|LOCUS_19370 5700 5969 gene locus_tag LOCUS_19380 5700 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 6107 6427 gene locus_tag LOCUS_19390 6107 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 8749 6686 gene locus_tag LOCUS_19400 8749 6686 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926802.1 protein_id gnl|my_center|LOCUS_19400 8967 10313 gene locus_tag LOCUS_19410 8967 10313 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_19410 10315 10746 gene locus_tag LOCUS_19420 10315 10746 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931800.1 protein_id gnl|my_center|LOCUS_19420 10733 11773 gene locus_tag LOCUS_19430 10733 11773 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931799.1 protein_id gnl|my_center|LOCUS_19430 13033 11864 gene locus_tag LOCUS_19440 13033 11864 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_19440 13221 14840 gene locus_tag LOCUS_19450 13221 14840 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931798.1 protein_id gnl|my_center|LOCUS_19450 15277 14885 gene locus_tag LOCUS_19460 15277 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 15494 15255 gene locus_tag LOCUS_19470 15494 15255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 15914 16099 gene locus_tag LOCUS_19480 15914 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 16160 17260 gene locus_tag LOCUS_19490 16160 17260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 18645 17323 gene locus_tag LOCUS_19500 18645 17323 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141207.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence40 104 1090 gene locus_tag LOCUS_19510 gene hemE 104 1090 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933694.1 protein_id gnl|my_center|LOCUS_19510 1385 2647 gene locus_tag LOCUS_19520 1385 2647 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931794.1 protein_id gnl|my_center|LOCUS_19520 4024 2720 gene locus_tag LOCUS_19530 4024 2720 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_19530 5127 4189 gene locus_tag LOCUS_19540 5127 4189 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926799.1 protein_id gnl|my_center|LOCUS_19540 5990 5124 gene locus_tag LOCUS_19550 gene prmA 5990 5124 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931792.1 protein_id gnl|my_center|LOCUS_19550 6498 6067 gene locus_tag LOCUS_19560 6498 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 6724 8139 gene locus_tag LOCUS_19570 gene lysC 6724 8139 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_19570 8158 9147 gene locus_tag LOCUS_19580 gene purM 8158 9147 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931788.1 protein_id gnl|my_center|LOCUS_19580 9163 9870 gene locus_tag LOCUS_19590 gene plsY 9163 9870 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_19590 9887 10888 gene locus_tag LOCUS_19600 9887 10888 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_19600 11385 10891 gene locus_tag LOCUS_19610 gene sixA 11385 10891 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_19610 12506 11382 gene locus_tag LOCUS_19620 12506 11382 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_19620 13822 12503 gene locus_tag LOCUS_19630 13822 12503 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931783.1 protein_id gnl|my_center|LOCUS_19630 13937 14767 gene locus_tag LOCUS_19640 gene kdsA 13937 14767 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931782.1 protein_id gnl|my_center|LOCUS_19640 14806 15357 gene locus_tag LOCUS_19650 14806 15357 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927188.1 protein_id gnl|my_center|LOCUS_19650 16837 15380 gene locus_tag LOCUS_19660 16837 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926798.1 protein_id gnl|my_center|LOCUS_19660 17738 16881 gene locus_tag LOCUS_19670 17738 16881 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931779.1 protein_id gnl|my_center|LOCUS_19670 18604 17735 gene locus_tag LOCUS_19680 18604 17735 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931778.1 protein_id gnl|my_center|LOCUS_19680 19176 18610 gene locus_tag LOCUS_19690 gene pyrE 19176 18610 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926797.1 protein_id gnl|my_center|LOCUS_19690 19578 19312 gene locus_tag LOCUS_19700 19578 19312 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_19700 19762 19565 gene locus_tag LOCUS_19710 19762 19565 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755892.1 protein_id gnl|my_center|LOCUS_19710 20297 19860 gene locus_tag LOCUS_19720 gene ruvX 20297 19860 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931776.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence41 286 576 gene locus_tag LOCUS_19730 286 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1018 3873 gene locus_tag LOCUS_19740 1018 3873 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_19740 3910 4989 gene locus_tag LOCUS_19750 gene lptG 3910 4989 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_19750 6005 5106 gene locus_tag LOCUS_19760 6005 5106 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_19760 8886 6175 gene locus_tag LOCUS_19770 8886 6175 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933216.1 protein_id gnl|my_center|LOCUS_19770 9580 8903 gene locus_tag LOCUS_19780 gene clpP 9580 8903 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933217.1 protein_id gnl|my_center|LOCUS_19780 9814 10464 gene locus_tag LOCUS_19790 gene thyX 9814 10464 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933218.1 protein_id gnl|my_center|LOCUS_19790 11300 10461 gene locus_tag LOCUS_19800 gene accD 11300 10461 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933219.1 protein_id gnl|my_center|LOCUS_19800 11482 14151 gene locus_tag LOCUS_19810 11482 14151 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927267.1 protein_id gnl|my_center|LOCUS_19810 14206 15003 gene locus_tag LOCUS_19820 gene surE 14206 15003 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933221.1 protein_id gnl|my_center|LOCUS_19820 15296 16699 gene locus_tag LOCUS_19830 gene bshC 15296 16699 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933222.1 protein_id gnl|my_center|LOCUS_19830 16994 16683 gene locus_tag LOCUS_19840 16994 16683 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933225.1 protein_id gnl|my_center|LOCUS_19840 17138 17512 gene locus_tag LOCUS_19850 17138 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 18166 17603 gene locus_tag LOCUS_19860 18166 17603 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933229.1 protein_id gnl|my_center|LOCUS_19860 19432 18173 gene locus_tag LOCUS_19870 19432 18173 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933230.1 protein_id gnl|my_center|LOCUS_19870 19643 20863 gene locus_tag LOCUS_19880 19643 20863 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927053.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence42 1194 823 gene locus_tag LOCUS_19890 1194 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_19890 1619 1191 gene locus_tag LOCUS_19900 1619 1191 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_19900 2942 1653 gene locus_tag LOCUS_19910 2942 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 3833 2958 gene locus_tag LOCUS_19920 3833 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 6514 4013 gene locus_tag LOCUS_19930 6514 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 8865 6601 gene locus_tag LOCUS_19940 8865 6601 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_19940 9588 8914 gene locus_tag LOCUS_19950 9588 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 10827 10117 gene locus_tag LOCUS_19960 10827 10117 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933691.1 protein_id gnl|my_center|LOCUS_19960 12163 10847 gene locus_tag LOCUS_19970 gene thrC 12163 10847 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933690.1 protein_id gnl|my_center|LOCUS_19970 13157 12195 gene locus_tag LOCUS_19980 13157 12195 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_19980 13385 14965 gene locus_tag LOCUS_19990 gene atpA 13385 14965 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933688.1 protein_id gnl|my_center|LOCUS_19990 15014 15889 gene locus_tag LOCUS_20000 15014 15889 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_20000 16069 18528 gene locus_tag LOCUS_20010 gene thrA 16069 18528 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_20010 18541 19797 gene locus_tag LOCUS_20020 18541 19797 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933684.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence43 1299 376 gene locus_tag LOCUS_20030 1299 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931755.1 protein_id gnl|my_center|LOCUS_20030 2212 1322 gene locus_tag LOCUS_20040 2212 1322 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139456841.1 protein_id gnl|my_center|LOCUS_20040 3243 2245 gene locus_tag LOCUS_20050 3243 2245 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931757.1 protein_id gnl|my_center|LOCUS_20050 3511 3287 gene locus_tag LOCUS_20060 3511 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3536 4588 gene locus_tag LOCUS_20070 gene tsaD 3536 4588 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931758.1 protein_id gnl|my_center|LOCUS_20070 4798 5685 gene locus_tag LOCUS_20080 4798 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931739.1 protein_id gnl|my_center|LOCUS_20080 5980 6267 gene locus_tag LOCUS_20090 gene yajC 5980 6267 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_20090 6277 7401 gene locus_tag LOCUS_20100 gene carA 6277 7401 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931760.1 protein_id gnl|my_center|LOCUS_20100 7398 8537 gene locus_tag LOCUS_20110 7398 8537 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931764.1 protein_id gnl|my_center|LOCUS_20110 8559 9227 gene locus_tag LOCUS_20120 8559 9227 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931765.1 protein_id gnl|my_center|LOCUS_20120 9234 10679 gene locus_tag LOCUS_20130 9234 10679 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931766.1 protein_id gnl|my_center|LOCUS_20130 10747 11184 gene locus_tag LOCUS_20140 10747 11184 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931767.1 protein_id gnl|my_center|LOCUS_20140 11314 12114 gene locus_tag LOCUS_20150 gene proC 11314 12114 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931771.1 protein_id gnl|my_center|LOCUS_20150 12120 13460 gene locus_tag LOCUS_20160 12120 13460 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986875.1 protein_id gnl|my_center|LOCUS_20160 13894 13592 gene locus_tag LOCUS_20170 13894 13592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931774.1 protein_id gnl|my_center|LOCUS_20170 14112 14282 gene locus_tag LOCUS_20180 14112 14282 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931775.1 protein_id gnl|my_center|LOCUS_20180 14292 14756 gene locus_tag LOCUS_20190 14292 14756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 16489 14813 gene locus_tag LOCUS_20200 gene leuA 16489 14813 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933761.1 protein_id gnl|my_center|LOCUS_20200 18545 16890 gene locus_tag LOCUS_20210 18545 16890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 19168 18581 gene locus_tag LOCUS_20220 gene kdpC 19168 18581 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930951.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence44 <1 1346 gene locus_tag LOCUS_20230 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933887.1:F0F1 ATP synthase subunit beta 1363 1629 gene locus_tag LOCUS_20240 1363 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1677 2642 gene locus_tag LOCUS_20250 1677 2642 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933889.1 protein_id gnl|my_center|LOCUS_20250 2715 3032 gene locus_tag LOCUS_20260 2715 3032 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933890.1 protein_id gnl|my_center|LOCUS_20260 3350 4840 gene locus_tag LOCUS_20270 3350 4840 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927177.1 protein_id gnl|my_center|LOCUS_20270 4844 5986 gene locus_tag LOCUS_20280 4844 5986 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933906.1 protein_id gnl|my_center|LOCUS_20280 5987 6673 gene locus_tag LOCUS_20290 5987 6673 CDS product DUF3593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933907.1 protein_id gnl|my_center|LOCUS_20290 8385 6664 gene locus_tag LOCUS_20300 8385 6664 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933908.1 protein_id gnl|my_center|LOCUS_20300 9252 8389 gene locus_tag LOCUS_20310 9252 8389 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_20310 10937 9267 gene locus_tag LOCUS_20320 10937 9267 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933910.1 protein_id gnl|my_center|LOCUS_20320 11198 12034 gene locus_tag LOCUS_20330 11198 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20330 11953 13995 gene locus_tag LOCUS_20340 11953 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20340 14056 14934 gene locus_tag LOCUS_20350 14056 14934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 14936 15145 gene locus_tag LOCUS_20360 14936 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 15205 15936 gene locus_tag LOCUS_20370 15205 15936 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_20370 15961 17451 gene locus_tag LOCUS_20380 15961 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 17463 18947 gene locus_tag LOCUS_20390 17463 18947 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence45 149 508 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attctaattgcaccaatatggaattgaaac 538 765 gene locus_tag LOCUS_20400 538 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 882 1082 gene locus_tag LOCUS_20410 882 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1385 3208 gene locus_tag LOCUS_20420 gene batA 1385 3208 CDS product autotransporter BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195901.1 protein_id gnl|my_center|LOCUS_20420 3474 5711 gene locus_tag LOCUS_20430 3474 5711 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_20430 5741 7087 gene locus_tag LOCUS_20440 5741 7087 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927031.1 protein_id gnl|my_center|LOCUS_20440 7092 8051 gene locus_tag LOCUS_20450 7092 8051 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_20450 9510 8041 gene locus_tag LOCUS_20460 9510 8041 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_20460 10184 9507 gene locus_tag LOCUS_20470 10184 9507 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_20470 10410 11288 gene locus_tag LOCUS_20480 10410 11288 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_20480 11348 12301 gene locus_tag LOCUS_20490 11348 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 13005 12298 gene locus_tag LOCUS_20500 gene hisF 13005 12298 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933180.1 protein_id gnl|my_center|LOCUS_20500 13243 13776 gene locus_tag LOCUS_20510 13243 13776 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926937.1 protein_id gnl|my_center|LOCUS_20510 15010 13898 gene locus_tag LOCUS_20520 15010 13898 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_20520 15184 16617 gene locus_tag LOCUS_20530 gene mpl 15184 16617 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_20530 17195 16854 gene locus_tag LOCUS_20540 17195 16854 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_20540 17409 17185 gene locus_tag LOCUS_20550 17409 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 17734 18738 gene locus_tag LOCUS_20560 gene gap 17734 18738 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence46 5770 2108 gene locus_tag LOCUS_20570 5770 2108 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932819.1 protein_id gnl|my_center|LOCUS_20570 7048 5801 gene locus_tag LOCUS_20580 7048 5801 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_20580 7286 7978 gene locus_tag LOCUS_20590 7286 7978 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_20590 7980 9467 gene locus_tag LOCUS_20600 7980 9467 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932603.1 protein_id gnl|my_center|LOCUS_20600 9482 10180 gene locus_tag LOCUS_20610 9482 10180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932977.1 protein_id gnl|my_center|LOCUS_20610 10228 10914 gene locus_tag LOCUS_20620 gene tmk 10228 10914 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932982.1 protein_id gnl|my_center|LOCUS_20620 11048 12310 gene locus_tag LOCUS_20630 11048 12310 CDS product trehalose 6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927019.1 protein_id gnl|my_center|LOCUS_20630 12348 15512 gene locus_tag LOCUS_20640 12348 15512 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932984.1 protein_id gnl|my_center|LOCUS_20640 15688 16647 gene locus_tag LOCUS_20650 gene queA 15688 16647 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932985.1 protein_id gnl|my_center|LOCUS_20650 16655 17407 gene locus_tag LOCUS_20660 16655 17407 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932986.1 protein_id gnl|my_center|LOCUS_20660 17474 17550 gene locus_tag LOCUS_t00390 17474 17550 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence47 1355 477 gene locus_tag LOCUS_20670 1355 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1708 1352 gene locus_tag LOCUS_20680 1708 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 3379 2186 gene locus_tag LOCUS_20690 gene dnaJ 3379 2186 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933150.1 protein_id gnl|my_center|LOCUS_20690 4014 3415 gene locus_tag LOCUS_20700 4014 3415 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933151.1 protein_id gnl|my_center|LOCUS_20700 5089 4031 gene locus_tag LOCUS_20710 gene hrcA 5089 4031 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933152.1 protein_id gnl|my_center|LOCUS_20710 6134 5244 gene locus_tag LOCUS_20720 gene prmC 6134 5244 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933153.1 protein_id gnl|my_center|LOCUS_20720 6241 7077 gene locus_tag LOCUS_20730 6241 7077 CDS product DUF4412 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927039.1 protein_id gnl|my_center|LOCUS_20730 7133 8578 gene locus_tag LOCUS_20740 gene proS 7133 8578 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933157.1 protein_id gnl|my_center|LOCUS_20740 9284 8694 gene locus_tag LOCUS_20750 9284 8694 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933158.1 protein_id gnl|my_center|LOCUS_20750 9535 9801 gene locus_tag LOCUS_20760 9535 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 9884 10369 gene locus_tag LOCUS_20770 9884 10369 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083317.1 protein_id gnl|my_center|LOCUS_20770 10436 11131 gene locus_tag LOCUS_20780 10436 11131 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974661.1 protein_id gnl|my_center|LOCUS_20780 11128 12432 gene locus_tag LOCUS_20790 11128 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 13201 12533 gene locus_tag LOCUS_20800 13201 12533 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 protein_id gnl|my_center|LOCUS_20800 14140 14358 gene locus_tag LOCUS_20810 14140 14358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence48 2494 668 gene locus_tag LOCUS_20820 2494 668 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933361.1 protein_id gnl|my_center|LOCUS_20820 3623 2607 gene locus_tag LOCUS_20830 gene bchU 3623 2607 CDS product C-20 methyltransferase BchU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931722.1 protein_id gnl|my_center|LOCUS_20830 5113 3728 gene locus_tag LOCUS_20840 5113 3728 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927086.1 protein_id gnl|my_center|LOCUS_20840 6392 5169 gene locus_tag LOCUS_20850 6392 5169 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933602.1 protein_id gnl|my_center|LOCUS_20850 6637 6951 gene locus_tag LOCUS_20860 6637 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 7003 7626 gene locus_tag LOCUS_20870 7003 7626 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439260.1 protein_id gnl|my_center|LOCUS_20870 8012 8380 gene locus_tag LOCUS_20880 8012 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 8436 8684 gene locus_tag LOCUS_20890 8436 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 8767 9396 gene locus_tag LOCUS_20900 8767 9396 CDS product DUF1997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933706.1 protein_id gnl|my_center|LOCUS_20900 9419 10075 gene locus_tag LOCUS_20910 9419 10075 CDS product hydroxyacylglutathione hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933700.1 protein_id gnl|my_center|LOCUS_20910 10287 10733 gene locus_tag LOCUS_20920 10287 10733 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933699.1 protein_id gnl|my_center|LOCUS_20920 10871 12574 gene locus_tag LOCUS_20930 10871 12574 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933697.1 protein_id gnl|my_center|LOCUS_20930 12587 13624 gene locus_tag LOCUS_20940 12587 13624 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933696.1 protein_id gnl|my_center|LOCUS_20940 13684 14490 gene locus_tag LOCUS_20950 13684 14490 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933695.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence49 3219 2467 gene locus_tag LOCUS_20960 gene cobS 3219 2467 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926961.1 protein_id gnl|my_center|LOCUS_20960 4287 3223 gene locus_tag LOCUS_20970 gene cobT 4287 3223 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932626.1 protein_id gnl|my_center|LOCUS_20970 5369 4353 gene locus_tag LOCUS_20980 gene bciA 5369 4353 CDS product NADPH-dependent 3,8-divinyl protochlorophyllide a 8-vinyl-reductase BciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932741.1 protein_id gnl|my_center|LOCUS_20980 5657 5884 gene locus_tag LOCUS_20990 5657 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 6690 5995 gene locus_tag LOCUS_21000 6690 5995 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 protein_id gnl|my_center|LOCUS_21000 7284 8153 gene locus_tag LOCUS_21010 7284 8153 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_21010 8297 8515 gene locus_tag LOCUS_21020 8297 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 8943 9125 gene locus_tag LOCUS_21030 8943 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 9795 9358 gene locus_tag LOCUS_21040 9795 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 10274 10092 gene locus_tag LOCUS_21050 10274 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 11493 10402 gene locus_tag LOCUS_21060 11493 10402 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_21060 11837 11496 gene locus_tag LOCUS_21070 11837 11496 CDS product killer suppression protein HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387766.1 protein_id gnl|my_center|LOCUS_21070 13759 11978 gene locus_tag LOCUS_21080 13759 11978 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_21080 <14675 13763 gene locus_tag LOCUS_21090 <14675 13763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918507.1:restriction endonuclease subunit S >Feature sequence50 3542 411 gene locus_tag LOCUS_21100 3542 411 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_21100 3908 4168 gene locus_tag LOCUS_21110 3908 4168 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085222.1 protein_id gnl|my_center|LOCUS_21110 4165 4596 gene locus_tag LOCUS_21120 4165 4596 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_21120 6255 4738 gene locus_tag LOCUS_21130 6255 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 8290 6338 gene locus_tag LOCUS_21140 8290 6338 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870222.1 protein_id gnl|my_center|LOCUS_21140 10889 8301 gene locus_tag LOCUS_21150 10889 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038875.1 protein_id gnl|my_center|LOCUS_21150 12169 10886 gene locus_tag LOCUS_21160 12169 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 <13786 12234 gene locus_tag LOCUS_21170 <13786 12234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000985413.1:type I restriction-modification system subunit M >Feature sequence51 <1 3291 gene locus_tag LOCUS_21180 <1 3291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein 3278 3859 gene locus_tag LOCUS_21190 3278 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3961 5712 gene locus_tag LOCUS_21200 3961 5712 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214693.1 protein_id gnl|my_center|LOCUS_21200 5855 7123 gene locus_tag LOCUS_21210 5855 7123 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932891.1 protein_id gnl|my_center|LOCUS_21210 8086 7154 gene locus_tag LOCUS_21220 8086 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932890.1 protein_id gnl|my_center|LOCUS_21220 8411 9619 gene locus_tag LOCUS_21230 8411 9619 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927045.1 protein_id gnl|my_center|LOCUS_21230 9627 12026 gene locus_tag LOCUS_21240 9627 12026 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927044.1 protein_id gnl|my_center|LOCUS_21240 12223 12471 gene locus_tag LOCUS_21250 12223 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 12475 12903 gene locus_tag LOCUS_21260 12475 12903 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence52 1735 221 gene locus_tag LOCUS_21270 1735 221 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_21270 2103 1756 gene locus_tag LOCUS_21280 2103 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926827.1 protein_id gnl|my_center|LOCUS_21280 2220 3200 gene locus_tag LOCUS_21290 2220 3200 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931962.1 protein_id gnl|my_center|LOCUS_21290 4170 3271 gene locus_tag LOCUS_21300 gene sucD 4170 3271 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_21300 5642 4215 gene locus_tag LOCUS_21310 gene gatA 5642 4215 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931960.1 protein_id gnl|my_center|LOCUS_21310 5862 6710 gene locus_tag LOCUS_21320 5862 6710 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_21320 6733 9240 gene locus_tag LOCUS_21330 gene bamA 6733 9240 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_21330 9876 9286 gene locus_tag LOCUS_21340 9876 9286 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_21340 10941 9949 gene locus_tag LOCUS_21350 10941 9949 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_21350 11719 10973 gene locus_tag LOCUS_21360 11719 10973 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_21360 11880 11798 gene locus_tag LOCUS_t00400 11880 11798 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11984 11911 gene locus_tag LOCUS_t00410 11984 11911 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence53 <1 709 gene locus_tag LOCUS_21370 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926839.1:alpha-amylase family glycosyl hydrolase 735 1160 gene locus_tag LOCUS_21380 735 1160 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932031.1 protein_id gnl|my_center|LOCUS_21380 1163 3058 gene locus_tag LOCUS_21390 gene dxs 1163 3058 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932029.1 protein_id gnl|my_center|LOCUS_21390 3513 3037 gene locus_tag LOCUS_21400 3513 3037 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_21400 4150 3518 gene locus_tag LOCUS_21410 gene pgsA 4150 3518 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932027.1 protein_id gnl|my_center|LOCUS_21410 6628 4247 gene locus_tag LOCUS_21420 6628 4247 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926838.1 protein_id gnl|my_center|LOCUS_21420 7033 7428 gene locus_tag LOCUS_21430 7033 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 7442 8161 gene locus_tag LOCUS_21440 7442 8161 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338238.1 protein_id gnl|my_center|LOCUS_21440 8681 8220 gene locus_tag LOCUS_21450 8681 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 9084 8662 gene locus_tag LOCUS_21460 9084 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 9645 10532 gene locus_tag LOCUS_21470 9645 10532 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105445.1 protein_id gnl|my_center|LOCUS_21470 10667 11287 gene locus_tag LOCUS_21480 10667 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence54 426 133 gene locus_tag LOCUS_21490 426 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 575 426 gene locus_tag LOCUS_21500 575 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 894 1073 gene locus_tag LOCUS_21510 894 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1391 2773 gene locus_tag LOCUS_21520 1391 2773 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932914.1 protein_id gnl|my_center|LOCUS_21520 2870 4840 gene locus_tag LOCUS_21530 2870 4840 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927008.1 protein_id gnl|my_center|LOCUS_21530 4893 5342 gene locus_tag LOCUS_21540 4893 5342 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932916.1 protein_id gnl|my_center|LOCUS_21540 5356 6186 gene locus_tag LOCUS_21550 5356 6186 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932917.1 protein_id gnl|my_center|LOCUS_21550 6269 7213 gene locus_tag LOCUS_21560 6269 7213 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932918.1 protein_id gnl|my_center|LOCUS_21560 7210 8076 gene locus_tag LOCUS_21570 7210 8076 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932919.1 protein_id gnl|my_center|LOCUS_21570 8153 8623 gene locus_tag LOCUS_21580 8153 8623 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 protein_id gnl|my_center|LOCUS_21580 8630 8869 gene locus_tag LOCUS_21590 8630 8869 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927077.1 protein_id gnl|my_center|LOCUS_21590 8886 9233 gene locus_tag LOCUS_21600 8886 9233 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986793.1 protein_id gnl|my_center|LOCUS_21600 9249 11396 gene locus_tag LOCUS_21610 9249 11396 CDS product YdbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933383.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence55 1444 1647 gene locus_tag LOCUS_21620 1444 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1669 1851 gene locus_tag LOCUS_21630 1669 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1915 2064 gene locus_tag LOCUS_21640 1915 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2783 4312 gene locus_tag LOCUS_21650 2783 4312 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932736.1 protein_id gnl|my_center|LOCUS_21650 4557 4276 gene locus_tag LOCUS_21660 4557 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 4729 4541 gene locus_tag LOCUS_21670 4729 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 4712 4924 gene locus_tag LOCUS_21680 4712 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 5155 6657 gene locus_tag LOCUS_21690 5155 6657 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_21690 6867 10292 gene locus_tag LOCUS_21700 6867 10292 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926886.1 protein_id gnl|my_center|LOCUS_21700 10350 10610 gene locus_tag LOCUS_21710 10350 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 10595 10849 gene locus_tag LOCUS_21720 10595 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence56 243 809 gene locus_tag LOCUS_21730 243 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1086 996 gene locus_tag LOCUS_t00420 1086 996 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1304 2797 gene locus_tag LOCUS_21740 gene guaB 1304 2797 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932962.1 protein_id gnl|my_center|LOCUS_21740 6678 2842 gene locus_tag LOCUS_21750 gene bchH 6678 2842 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932964.1 protein_id gnl|my_center|LOCUS_21750 8659 6803 gene locus_tag LOCUS_21760 gene bchD 8659 6803 CDS product magnesium chelatase ATPase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932965.1 protein_id gnl|my_center|LOCUS_21760 9834 8659 gene locus_tag LOCUS_21770 gene bchI 9834 8659 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932966.1 protein_id gnl|my_center|LOCUS_21770 10126 11169 gene locus_tag LOCUS_21780 10126 11169 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927015.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence57 791 357 gene locus_tag LOCUS_21790 791 357 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926834.1 protein_id gnl|my_center|LOCUS_21790 4108 851 gene locus_tag LOCUS_21800 gene ileS 4108 851 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932003.1 protein_id gnl|my_center|LOCUS_21800 4493 4278 gene locus_tag LOCUS_21810 4493 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932002.1 protein_id gnl|my_center|LOCUS_21810 6056 4641 gene locus_tag LOCUS_21820 6056 4641 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932001.1 protein_id gnl|my_center|LOCUS_21820 7051 6074 gene locus_tag LOCUS_21830 gene galE 7051 6074 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_21830 8129 7080 gene locus_tag LOCUS_21840 gene rfbB 8129 7080 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932000.1 protein_id gnl|my_center|LOCUS_21840 9122 8184 gene locus_tag LOCUS_21850 gene rfbD 9122 8184 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931999.1 protein_id gnl|my_center|LOCUS_21850 9712 9119 gene locus_tag LOCUS_21860 gene rfbC 9712 9119 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931998.1 protein_id gnl|my_center|LOCUS_21860 10692 9805 gene locus_tag LOCUS_21870 gene rfbA 10692 9805 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931997.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence58 1228 278 gene locus_tag LOCUS_21880 1228 278 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927129.1 protein_id gnl|my_center|LOCUS_21880 2488 1349 gene locus_tag LOCUS_21890 gene cruC 2488 1349 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_21890 3436 2552 gene locus_tag LOCUS_21900 gene hisG 3436 2552 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_21900 4195 3464 gene locus_tag LOCUS_21910 4195 3464 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933645.1 protein_id gnl|my_center|LOCUS_21910 4930 4217 gene locus_tag LOCUS_21920 4930 4217 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933646.1 protein_id gnl|my_center|LOCUS_21920 5992 4985 gene locus_tag LOCUS_21930 5992 4985 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927130.1 protein_id gnl|my_center|LOCUS_21930 7459 6131 gene locus_tag LOCUS_21940 gene miaB 7459 6131 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986807.1 protein_id gnl|my_center|LOCUS_21940 8075 7464 gene locus_tag LOCUS_21950 8075 7464 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933650.1 protein_id gnl|my_center|LOCUS_21950 9261 8059 gene locus_tag LOCUS_21960 9261 8059 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933651.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence59 693 1772 gene locus_tag LOCUS_21970 gene rlmN 693 1772 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932855.1 protein_id gnl|my_center|LOCUS_21970 1792 2571 gene locus_tag LOCUS_21980 1792 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932856.1 protein_id gnl|my_center|LOCUS_21980 2582 3238 gene locus_tag LOCUS_21990 gene adk 2582 3238 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_21990 3306 5741 gene locus_tag LOCUS_22000 gene priA 3306 5741 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926999.1 protein_id gnl|my_center|LOCUS_22000 5910 7358 gene locus_tag LOCUS_22010 5910 7358 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_22010 7355 7990 gene locus_tag LOCUS_22020 7355 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence60 4870 680 gene locus_tag LOCUS_22030 4870 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 6125 5127 gene locus_tag LOCUS_22040 6125 5127 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927130.1 protein_id gnl|my_center|LOCUS_22040 7108 7764 gene locus_tag LOCUS_22050 7108 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 7840 8067 gene locus_tag LOCUS_22060 7840 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 8817 9356 gene locus_tag LOCUS_22070 8817 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence61 <1 619 gene locus_tag LOCUS_22080 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932853.1:bifunctional oligoribonuclease/PAP phosphatase NrnA 667 2181 gene locus_tag LOCUS_22090 667 2181 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932852.1 protein_id gnl|my_center|LOCUS_22090 2224 2928 gene locus_tag LOCUS_22100 2224 2928 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057817.1 protein_id gnl|my_center|LOCUS_22100 2910 3761 gene locus_tag LOCUS_22110 2910 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139456507.1 protein_id gnl|my_center|LOCUS_22110 3776 5113 gene locus_tag LOCUS_22120 3776 5113 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_22120 5930 5115 gene locus_tag LOCUS_22130 gene thiD 5930 5115 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932848.1 protein_id gnl|my_center|LOCUS_22130 6550 5927 gene locus_tag LOCUS_22140 gene thiE 6550 5927 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932847.1 protein_id gnl|my_center|LOCUS_22140 7065 6547 gene locus_tag LOCUS_22150 7065 6547 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926997.1 protein_id gnl|my_center|LOCUS_22150 7324 7806 gene locus_tag LOCUS_22160 7324 7806 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932845.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence62 85 759 gene locus_tag LOCUS_22170 85 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1039 952 gene locus_tag LOCUS_t00430 1039 952 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1597 1743 gene locus_tag LOCUS_22180 1597 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1934 2224 gene locus_tag LOCUS_22190 1934 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2354 2851 gene locus_tag LOCUS_22200 2354 2851 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932926.1 protein_id gnl|my_center|LOCUS_22200 2996 3217 gene locus_tag LOCUS_22210 2996 3217 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704042.1 protein_id gnl|my_center|LOCUS_22210 3237 3641 gene locus_tag LOCUS_22220 3237 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3832 4206 gene locus_tag LOCUS_22230 3832 4206 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_22230 4239 4625 gene locus_tag LOCUS_22240 4239 4625 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930621.1 protein_id gnl|my_center|LOCUS_22240 4686 4976 gene locus_tag LOCUS_22250 4686 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 5050 5487 gene locus_tag LOCUS_22260 5050 5487 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_22260 5610 6245 gene locus_tag LOCUS_22270 5610 6245 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940854.1 protein_id gnl|my_center|LOCUS_22270 6327 7493 gene locus_tag LOCUS_22280 6327 7493 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence63 2074 992 gene locus_tag LOCUS_22290 2074 992 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_22290 3615 2071 gene locus_tag LOCUS_22300 3615 2071 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_22300 3773 3585 gene locus_tag LOCUS_22310 3773 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4788 3718 gene locus_tag LOCUS_22320 4788 3718 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927150.1 protein_id gnl|my_center|LOCUS_22320 4960 5874 gene locus_tag LOCUS_22330 4960 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933750.1 protein_id gnl|my_center|LOCUS_22330 6165 5899 gene locus_tag LOCUS_22340 6165 5899 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933751.1 protein_id gnl|my_center|LOCUS_22340 6279 7064 gene locus_tag LOCUS_22350 gene recO 6279 7064 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927151.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence64 12 257 gene locus_tag LOCUS_22360 12 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1365 2255 gene locus_tag LOCUS_22370 1365 2255 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_22370 2346 2615 gene locus_tag LOCUS_22380 2346 2615 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213585.1 protein_id gnl|my_center|LOCUS_22380 2599 2898 gene locus_tag LOCUS_22390 2599 2898 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525420.1 protein_id gnl|my_center|LOCUS_22390 2924 3106 gene locus_tag LOCUS_22400 2924 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3387 3581 gene locus_tag LOCUS_22410 3387 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3569 3862 gene locus_tag LOCUS_22420 3569 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 5313 4093 gene locus_tag LOCUS_22430 5313 4093 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence65 386 2038 gene locus_tag LOCUS_22440 386 2038 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932843.1 protein_id gnl|my_center|LOCUS_22440 2099 2755 gene locus_tag LOCUS_22450 2099 2755 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932842.1 protein_id gnl|my_center|LOCUS_22450 2796 3434 gene locus_tag LOCUS_22460 2796 3434 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932841.1 protein_id gnl|my_center|LOCUS_22460 4389 3406 gene locus_tag LOCUS_22470 gene rfaE1 4389 3406 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_22470 4555 5904 gene locus_tag LOCUS_22480 gene ffh 4555 5904 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932839.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence66 1079 4246 gene locus_tag LOCUS_22490 1079 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 4550 5881 gene locus_tag LOCUS_22500 4550 5881 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence67 643 3474 gene locus_tag LOCUS_22510 643 3474 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_22510 3484 4713 gene locus_tag LOCUS_22520 gene odhB 3484 4713 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521670.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence68 312 106 gene locus_tag LOCUS_22530 312 106 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_22530 795 1877 gene locus_tag LOCUS_22540 795 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 4426 2150 gene locus_tag LOCUS_22550 4426 2150 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080141.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence69 3083 1101 gene locus_tag LOCUS_22560 3083 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 4107 3214 gene locus_tag LOCUS_22570 4107 3214 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927126.1 protein_id gnl|my_center|LOCUS_22570 4884 4150 gene locus_tag LOCUS_22580 4884 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 5198 4989 gene locus_tag LOCUS_22590 5198 4989 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence70 384 199 gene locus_tag LOCUS_22600 384 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 810 574 gene locus_tag LOCUS_22610 810 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1193 1477 gene locus_tag LOCUS_22620 1193 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1458 1748 gene locus_tag LOCUS_22630 1458 1748 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626476.1 protein_id gnl|my_center|LOCUS_22630 2875 1838 gene locus_tag LOCUS_22640 2875 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 3646 3849 gene locus_tag LOCUS_22650 3646 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 4116 5072 gene locus_tag LOCUS_22660 4116 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence71 592 56 gene locus_tag LOCUS_22670 592 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 1228 953 gene locus_tag LOCUS_22680 1228 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1400 1221 gene locus_tag LOCUS_22690 1400 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3628 1952 gene locus_tag LOCUS_22700 3628 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence72 1066 1944 gene locus_tag LOCUS_22710 1066 1944 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_22710 1972 2928 gene locus_tag LOCUS_22720 gene cbiB 1972 2928 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932620.1 protein_id gnl|my_center|LOCUS_22720 3105 3941 gene locus_tag LOCUS_22730 3105 3941 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_22730 4101 4466 gene locus_tag LOCUS_22740 4101 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence73 876 313 gene locus_tag LOCUS_22750 876 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 1530 3098 gene locus_tag LOCUS_22760 1530 3098 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090936308.1 protein_id gnl|my_center|LOCUS_22760 3820 3047 gene locus_tag LOCUS_22770 3820 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 <4471 3879 gene locus_tag LOCUS_22780 <4471 3879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108005.1:IS4 family transposase >Feature sequence74 690 1319 gene locus_tag LOCUS_22790 690 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 1323 1481 gene locus_tag LOCUS_22800 1323 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1711 4356 gene locus_tag LOCUS_22810 1711 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876271.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence75 3538 2072 gene locus_tag LOCUS_22820 3538 2072 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_22820 <4301 3535 gene locus_tag LOCUS_22830 <4301 3535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124859.1:restriction endonuclease subunit S >Feature sequence76 920 534 gene locus_tag LOCUS_22840 920 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1107 1400 gene locus_tag LOCUS_22850 1107 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2138 1605 gene locus_tag LOCUS_22860 2138 1605 CDS product DUF2939 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036733.1 protein_id gnl|my_center|LOCUS_22860 2532 3017 gene locus_tag LOCUS_22870 2532 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3104 4033 gene locus_tag LOCUS_22880 3104 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22880 >Feature sequence77 860 24 gene locus_tag LOCUS_22890 gene istB 860 24 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268417.1 protein_id gnl|my_center|LOCUS_22890 2410 866 gene locus_tag LOCUS_22900 gene istA 2410 866 CDS product IS21-like element ISBf2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203618.1 protein_id gnl|my_center|LOCUS_22900 3277 2678 gene locus_tag LOCUS_22910 3277 2678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence78 <1 744 gene locus_tag LOCUS_22920 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123249.1:type I restriction-modification enzyme R subunit C-terminal domain-containing protein 746 2188 gene locus_tag LOCUS_22930 746 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence79 319 546 gene locus_tag LOCUS_22940 319 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933757.1 protein_id gnl|my_center|LOCUS_22940 589 972 gene locus_tag LOCUS_22950 gene crcB 589 972 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927153.1 protein_id gnl|my_center|LOCUS_22950 984 1319 gene locus_tag LOCUS_22960 984 1319 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927152.1 protein_id gnl|my_center|LOCUS_22960 2724 1429 gene locus_tag LOCUS_22970 gene hemL 2724 1429 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933753.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence80 2 172 gene locus_tag LOCUS_22980 2 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 533 1564 gene locus_tag LOCUS_22990 533 1564 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083854.1 protein_id gnl|my_center|LOCUS_22990 1554 1889 gene locus_tag LOCUS_23000 1554 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 <2578 2071 gene locus_tag LOCUS_23010 <2578 2071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165439260.1:flavodoxin domain-containing protein >Feature sequence81 1893 235 gene locus_tag LOCUS_23020 1893 235 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence82 1108 23 gene locus_tag LOCUS_23030 1108 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 <2158 1405 gene locus_tag LOCUS_23040 <2158 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108005.1:IS4 family transposase >Feature sequence83 360 1637 gene locus_tag LOCUS_23050 360 1637 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence84 258 1820 gene locus_tag LOCUS_23060 258 1820 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090936308.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence85 1237 665 gene locus_tag LOCUS_23070 1237 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070