>Feature sequence001 84 1052 gene locus_tag LOCUS_00010 84 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1049 1684 gene locus_tag LOCUS_00020 1049 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1681 2451 gene locus_tag LOCUS_00030 1681 2451 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 protein_id gnl|my_center|LOCUS_00030 2587 3660 gene locus_tag LOCUS_00040 2587 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3792 4091 gene locus_tag LOCUS_00050 3792 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6851 4158 gene locus_tag LOCUS_00060 gene acnA 6851 4158 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391258.1 protein_id gnl|my_center|LOCUS_00060 7013 7612 gene locus_tag LOCUS_00070 gene ccmA 7013 7612 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 protein_id gnl|my_center|LOCUS_00070 7609 8274 gene locus_tag LOCUS_00080 gene ccmB 7609 8274 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387800.1 protein_id gnl|my_center|LOCUS_00080 8353 9051 gene locus_tag LOCUS_00090 8353 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10064 9156 gene locus_tag LOCUS_00100 10064 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10283 10795 gene locus_tag LOCUS_00110 10283 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12224 10827 gene locus_tag LOCUS_00120 12224 10827 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969867.1 protein_id gnl|my_center|LOCUS_00120 12377 13705 gene locus_tag LOCUS_00130 gene aceA 12377 13705 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_00130 14066 15100 gene locus_tag LOCUS_00140 gene pstS 14066 15100 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809635.1 protein_id gnl|my_center|LOCUS_00140 15183 16142 gene locus_tag LOCUS_00150 gene pstC 15183 16142 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 protein_id gnl|my_center|LOCUS_00150 16139 17026 gene locus_tag LOCUS_00160 gene pstA 16139 17026 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_00160 17068 17898 gene locus_tag LOCUS_00170 gene pstB 17068 17898 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083914.1 protein_id gnl|my_center|LOCUS_00170 17919 18638 gene locus_tag LOCUS_00180 gene phoU 17919 18638 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_00180 18650 19357 gene locus_tag LOCUS_00190 gene phoB 18650 19357 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_00190 19459 20541 gene locus_tag LOCUS_00200 19459 20541 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970056.1 protein_id gnl|my_center|LOCUS_00200 20621 21133 gene locus_tag LOCUS_00210 20621 21133 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088243.1 protein_id gnl|my_center|LOCUS_00210 21130 21894 gene locus_tag LOCUS_00220 21130 21894 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_00220 21951 23504 gene locus_tag LOCUS_00230 21951 23504 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086821.1 protein_id gnl|my_center|LOCUS_00230 23545 25209 gene locus_tag LOCUS_00240 23545 25209 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228821.1 protein_id gnl|my_center|LOCUS_00240 25329 26333 gene locus_tag LOCUS_00250 25329 26333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966002.1 protein_id gnl|my_center|LOCUS_00250 26330 27298 gene locus_tag LOCUS_00260 26330 27298 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943262.1 protein_id gnl|my_center|LOCUS_00260 27304 28257 gene locus_tag LOCUS_00270 27304 28257 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705201.1 protein_id gnl|my_center|LOCUS_00270 28309 28839 gene locus_tag LOCUS_00280 28309 28839 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_00280 29028 29207 gene locus_tag LOCUS_00290 29028 29207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30704 29220 gene locus_tag LOCUS_00300 30704 29220 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537520.1 protein_id gnl|my_center|LOCUS_00300 31903 30701 gene locus_tag LOCUS_00310 31903 30701 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 protein_id gnl|my_center|LOCUS_00310 32185 32388 gene locus_tag LOCUS_00320 gene rpmI 32185 32388 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918930.1 protein_id gnl|my_center|LOCUS_00320 32401 32775 gene locus_tag LOCUS_00330 gene rplT 32401 32775 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528310.1 protein_id gnl|my_center|LOCUS_00330 32891 33961 gene locus_tag LOCUS_00340 gene pheS 32891 33961 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 protein_id gnl|my_center|LOCUS_00340 33966 36431 gene locus_tag LOCUS_00350 gene pheT 33966 36431 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391271.1 protein_id gnl|my_center|LOCUS_00350 36588 36866 gene locus_tag LOCUS_00360 36588 36866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36898 37251 gene locus_tag LOCUS_00370 36898 37251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37317 39122 gene locus_tag LOCUS_00380 gene lepA 37317 39122 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626581.1 protein_id gnl|my_center|LOCUS_00380 39854 39195 gene locus_tag LOCUS_00390 gene rpe 39854 39195 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969559.1 protein_id gnl|my_center|LOCUS_00390 40750 39851 gene locus_tag LOCUS_00400 gene cbbX 40750 39851 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969558.1 protein_id gnl|my_center|LOCUS_00400 41169 40750 gene locus_tag LOCUS_00410 41169 40750 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532057.1 protein_id gnl|my_center|LOCUS_00410 42651 41194 gene locus_tag LOCUS_00420 42651 41194 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085371.1 protein_id gnl|my_center|LOCUS_00420 43778 42699 gene locus_tag LOCUS_00430 gene fba 43778 42699 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532055.1 protein_id gnl|my_center|LOCUS_00430 45801 43810 gene locus_tag LOCUS_00440 gene tkt 45801 43810 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532054.1 protein_id gnl|my_center|LOCUS_00440 46812 45886 gene locus_tag LOCUS_00450 46812 45886 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085368.1 protein_id gnl|my_center|LOCUS_00450 47964 46933 gene locus_tag LOCUS_00460 47964 46933 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528720.1 protein_id gnl|my_center|LOCUS_00460 48126 49049 gene locus_tag LOCUS_00470 48126 49049 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085366.1 protein_id gnl|my_center|LOCUS_00470 49574 49356 gene locus_tag LOCUS_00480 49574 49356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 49461 50819 gene locus_tag LOCUS_00490 49461 50819 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_00490 50994 51416 gene locus_tag LOCUS_00500 50994 51416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 51419 51682 gene locus_tag LOCUS_00510 51419 51682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 52292 51741 gene locus_tag LOCUS_00520 52292 51741 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 protein_id gnl|my_center|LOCUS_00520 53633 52470 gene locus_tag LOCUS_00530 53633 52470 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114048.1 protein_id gnl|my_center|LOCUS_00530 54427 53630 gene locus_tag LOCUS_00540 54427 53630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00540 54937 54494 gene locus_tag LOCUS_00550 54937 54494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 55180 56769 gene locus_tag LOCUS_00560 55180 56769 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_00560 56867 56664 gene locus_tag LOCUS_00570 56867 56664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 57401 56883 gene locus_tag LOCUS_00580 57401 56883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57729 58226 gene locus_tag LOCUS_00590 57729 58226 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175651.1 protein_id gnl|my_center|LOCUS_00590 58239 59030 gene locus_tag LOCUS_00600 58239 59030 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_00600 60121 59135 gene locus_tag LOCUS_00610 60121 59135 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892059.1 protein_id gnl|my_center|LOCUS_00610 60948 60118 gene locus_tag LOCUS_00620 60948 60118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867268.1 protein_id gnl|my_center|LOCUS_00620 61889 60948 gene locus_tag LOCUS_00630 61889 60948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_00630 63427 61886 gene locus_tag LOCUS_00640 63427 61886 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080855420.1 protein_id gnl|my_center|LOCUS_00640 64519 63527 gene locus_tag LOCUS_00650 64519 63527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084174.1 protein_id gnl|my_center|LOCUS_00650 64647 64571 gene locus_tag LOCUS_t00010 64647 64571 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 65181 64705 gene locus_tag LOCUS_00660 65181 64705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 65329 65796 gene locus_tag LOCUS_00670 65329 65796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 66718 65804 gene locus_tag LOCUS_00680 gene prpB 66718 65804 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390073.1 protein_id gnl|my_center|LOCUS_00680 68114 66732 gene locus_tag LOCUS_00690 68114 66732 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222877.1 protein_id gnl|my_center|LOCUS_00690 68230 68811 gene locus_tag LOCUS_00700 68230 68811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 68811 69713 gene locus_tag LOCUS_00710 68811 69713 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388723.1 protein_id gnl|my_center|LOCUS_00710 69710 70924 gene locus_tag LOCUS_00720 69710 70924 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967595.1 protein_id gnl|my_center|LOCUS_00720 70921 71247 gene locus_tag LOCUS_00730 70921 71247 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532112.1 protein_id gnl|my_center|LOCUS_00730 71244 71939 gene locus_tag LOCUS_00740 71244 71939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00740 72062 72146 gene locus_tag LOCUS_t00020 72062 72146 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 72190 73593 gene locus_tag LOCUS_00750 gene tig 72190 73593 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922580.1 protein_id gnl|my_center|LOCUS_00750 73736 74377 gene locus_tag LOCUS_00760 gene clpP 73736 74377 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389425.1 protein_id gnl|my_center|LOCUS_00760 74658 75911 gene locus_tag LOCUS_00770 gene clpX 74658 75911 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389426.1 protein_id gnl|my_center|LOCUS_00770 76151 78634 gene locus_tag LOCUS_00780 gene lon 76151 78634 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_00780 78859 79149 gene locus_tag LOCUS_00790 78859 79149 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_00790 79174 79245 gene locus_tag LOCUS_t00030 79174 79245 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 79350 79426 gene locus_tag LOCUS_t00040 79350 79426 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 79617 79982 gene locus_tag LOCUS_00800 79617 79982 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_00800 79987 80562 gene locus_tag LOCUS_00810 79987 80562 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389431.1 protein_id gnl|my_center|LOCUS_00810 80555 81196 gene locus_tag LOCUS_00820 80555 81196 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969144.1 protein_id gnl|my_center|LOCUS_00820 81193 82395 gene locus_tag LOCUS_00830 81193 82395 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389433.1 protein_id gnl|my_center|LOCUS_00830 82432 83058 gene locus_tag LOCUS_00840 82432 83058 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_00840 83063 84364 gene locus_tag LOCUS_00850 gene nuoF 83063 84364 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_00850 84369 86441 gene locus_tag LOCUS_00860 gene nuoG 84369 86441 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_00860 86464 87477 gene locus_tag LOCUS_00870 gene nuoH 86464 87477 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_00870 87517 88005 gene locus_tag LOCUS_00880 gene nuoI 87517 88005 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389438.1 protein_id gnl|my_center|LOCUS_00880 88074 88763 gene locus_tag LOCUS_00890 88074 88763 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389439.1 protein_id gnl|my_center|LOCUS_00890 88763 89071 gene locus_tag LOCUS_00900 gene nuoK 88763 89071 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_00900 89076 91013 gene locus_tag LOCUS_00910 gene nuoL 89076 91013 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 protein_id gnl|my_center|LOCUS_00910 91019 92539 gene locus_tag LOCUS_00920 91019 92539 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_00920 92539 93960 gene locus_tag LOCUS_00930 gene nuoN 92539 93960 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_00930 93957 94718 gene locus_tag LOCUS_00940 93957 94718 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_00940 94708 95544 gene locus_tag LOCUS_00950 94708 95544 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_00950 95585 97234 gene locus_tag LOCUS_00960 95585 97234 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_00960 97775 99079 gene locus_tag LOCUS_00970 97775 99079 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389451.1 protein_id gnl|my_center|LOCUS_00970 99353 100606 gene locus_tag LOCUS_00980 99353 100606 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_00980 100599 101282 gene locus_tag LOCUS_00990 100599 101282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160544.1 protein_id gnl|my_center|LOCUS_00990 101390 104809 gene locus_tag LOCUS_01000 gene dnaE 101390 104809 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389457.1 protein_id gnl|my_center|LOCUS_01000 105208 104822 gene locus_tag LOCUS_01010 105208 104822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 106391 105219 gene locus_tag LOCUS_01020 106391 105219 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 protein_id gnl|my_center|LOCUS_01020 106690 106406 gene locus_tag LOCUS_01030 106690 106406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 107125 107973 gene locus_tag LOCUS_01040 107125 107973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 107987 109159 gene locus_tag LOCUS_01050 107987 109159 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085805.1 protein_id gnl|my_center|LOCUS_01050 109306 109698 gene locus_tag LOCUS_01060 109306 109698 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085958.1 protein_id gnl|my_center|LOCUS_01060 110220 109744 gene locus_tag LOCUS_01070 110220 109744 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403541.1 protein_id gnl|my_center|LOCUS_01070 110748 110242 gene locus_tag LOCUS_01080 110748 110242 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388985.1 protein_id gnl|my_center|LOCUS_01080 111845 110745 gene locus_tag LOCUS_01090 111845 110745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 113300 111915 gene locus_tag LOCUS_01100 113300 111915 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 protein_id gnl|my_center|LOCUS_01100 114588 113443 gene locus_tag LOCUS_01110 114588 113443 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_01110 116299 114776 gene locus_tag LOCUS_01120 gene gpmI 116299 114776 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388989.1 protein_id gnl|my_center|LOCUS_01120 117272 116388 gene locus_tag LOCUS_01130 117272 116388 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388114.1 protein_id gnl|my_center|LOCUS_01130 118270 117485 gene locus_tag LOCUS_01140 118270 117485 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 protein_id gnl|my_center|LOCUS_01140 119532 118267 gene locus_tag LOCUS_01150 119532 118267 CDS product cytochrome b/b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388116.1 protein_id gnl|my_center|LOCUS_01150 120105 119545 gene locus_tag LOCUS_01160 gene petA 120105 119545 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597339.1 protein_id gnl|my_center|LOCUS_01160 120329 121222 gene locus_tag LOCUS_01170 gene hemF 120329 121222 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918394.1 protein_id gnl|my_center|LOCUS_01170 122992 121370 gene locus_tag LOCUS_01180 122992 121370 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_01180 123912 122989 gene locus_tag LOCUS_01190 gene hflC 123912 122989 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_01190 125204 123909 gene locus_tag LOCUS_01200 gene hflK 125204 123909 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_01200 125349 126476 gene locus_tag LOCUS_01210 125349 126476 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390053.1 protein_id gnl|my_center|LOCUS_01210 127087 126620 gene locus_tag LOCUS_01220 127087 126620 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_01220 128555 127443 gene locus_tag LOCUS_01230 128555 127443 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_01230 129979 128891 gene locus_tag LOCUS_01240 129979 128891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 131833 130742 gene locus_tag LOCUS_01250 gene tcuB 131833 130742 CDS product tricarballylate utilization protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811143.1 protein_id gnl|my_center|LOCUS_01250 133079 132027 gene locus_tag LOCUS_01260 133079 132027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 134058 133096 gene locus_tag LOCUS_01270 gene pufM 134058 133096 CDS product photosynthetic reaction center subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390722.1 protein_id gnl|my_center|LOCUS_01270 134898 134074 gene locus_tag LOCUS_01280 gene pufL 134898 134074 CDS product photosynthetic reaction center subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390723.1 protein_id gnl|my_center|LOCUS_01280 135207 135013 gene locus_tag LOCUS_01290 gene pufA 135207 135013 CDS product light-harvesting antenna LH1, alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390724.1 protein_id gnl|my_center|LOCUS_01290 135429 135220 gene locus_tag LOCUS_01300 gene pufB 135429 135220 CDS product light-harvesting antenna LH1, beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390725.1 protein_id gnl|my_center|LOCUS_01300 135627 135442 gene locus_tag LOCUS_01310 135627 135442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 137081 135624 gene locus_tag LOCUS_01320 gene bchZ 137081 135624 CDS product chlorophyllide a reductase subunit Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390726.1 protein_id gnl|my_center|LOCUS_01320 138627 137086 gene locus_tag LOCUS_01330 gene bchY 138627 137086 CDS product chlorophyllide a reductase subunit Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338110.1 protein_id gnl|my_center|LOCUS_01330 139652 138633 gene locus_tag LOCUS_01340 139652 138633 CDS product chlorophyllide a reductase iron protein subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390728.1 protein_id gnl|my_center|LOCUS_01340 140594 139659 gene locus_tag LOCUS_01350 gene bchC 140594 139659 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390729.1 protein_id gnl|my_center|LOCUS_01350 141833 140676 gene locus_tag LOCUS_01360 141833 140676 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390730.1 protein_id gnl|my_center|LOCUS_01360 142756 141875 gene locus_tag LOCUS_01370 142756 141875 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390731.1 protein_id gnl|my_center|LOCUS_01370 142870 144435 gene locus_tag LOCUS_01380 gene crtI 142870 144435 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_01380 144459 145280 gene locus_tag LOCUS_01390 144459 145280 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390733.1 protein_id gnl|my_center|LOCUS_01390 145704 145336 gene locus_tag LOCUS_01400 145704 145336 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563670.1 protein_id gnl|my_center|LOCUS_01400 146491 145868 gene locus_tag LOCUS_01410 gene bchJ 146491 145868 CDS product bacteriochlorophyll 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388371.1 protein_id gnl|my_center|LOCUS_01410 148299 146509 gene locus_tag LOCUS_01420 gene bchE 148299 146509 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259511.1 protein_id gnl|my_center|LOCUS_01420 148848 148462 gene locus_tag LOCUS_01430 148848 148462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 150142 149030 gene locus_tag LOCUS_01440 150142 149030 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_01440 151661 150123 gene locus_tag LOCUS_01450 151661 150123 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388252.1 protein_id gnl|my_center|LOCUS_01450 153065 151737 gene locus_tag LOCUS_01460 153065 151737 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_01460 154001 153084 gene locus_tag LOCUS_01470 154001 153084 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388246.1 protein_id gnl|my_center|LOCUS_01470 155849 154068 gene locus_tag LOCUS_01480 155849 154068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 156937 155957 gene locus_tag LOCUS_01490 gene bchI 156937 155957 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625950.1 protein_id gnl|my_center|LOCUS_01490 156976 157230 gene locus_tag LOCUS_01500 156976 157230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 157584 157327 gene locus_tag LOCUS_01510 157584 157327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 158929 157718 gene locus_tag LOCUS_01520 gene hemA 158929 157718 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844889.1 protein_id gnl|my_center|LOCUS_01520 160784 159012 gene locus_tag LOCUS_01530 160784 159012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 161873 160800 gene locus_tag LOCUS_01540 gene acsF 161873 160800 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338129.1 protein_id gnl|my_center|LOCUS_01540 162158 161874 gene locus_tag LOCUS_01550 162158 161874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720458.1 protein_id gnl|my_center|LOCUS_01550 162622 162155 gene locus_tag LOCUS_01560 162622 162155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 163283 162636 gene locus_tag LOCUS_01570 gene puhB 163283 162636 CDS product photosynthetic complex putative assembly protein PuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388374.1 protein_id gnl|my_center|LOCUS_01570 164047 163280 gene locus_tag LOCUS_01580 gene puhA 164047 163280 CDS product photosynthetic reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388375.1 protein_id gnl|my_center|LOCUS_01580 165474 164098 gene locus_tag LOCUS_01590 165474 164098 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388376.1 protein_id gnl|my_center|LOCUS_01590 166208 165507 gene locus_tag LOCUS_01600 gene bchM 166208 165507 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388377.1 protein_id gnl|my_center|LOCUS_01600 167134 166208 gene locus_tag LOCUS_01610 gene bchL 167134 166208 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388378.1 protein_id gnl|my_center|LOCUS_01610 170742 167131 gene locus_tag LOCUS_01620 170742 167131 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_01620 172327 170717 gene locus_tag LOCUS_01630 gene bchB 172327 170717 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338124.1 protein_id gnl|my_center|LOCUS_01630 173624 172332 gene locus_tag LOCUS_01640 173624 172332 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388381.1 protein_id gnl|my_center|LOCUS_01640 174217 173621 gene locus_tag LOCUS_01650 gene bchF 174217 173621 CDS product 2-vinyl bacteriochlorophyllide hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388382.1 protein_id gnl|my_center|LOCUS_01650 174618 175385 gene locus_tag LOCUS_01660 174618 175385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 175460 176875 gene locus_tag LOCUS_01670 gene ppsR 175460 176875 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_01670 176862 177800 gene locus_tag LOCUS_01680 gene chlG 176862 177800 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388385.1 protein_id gnl|my_center|LOCUS_01680 177797 179128 gene locus_tag LOCUS_01690 177797 179128 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388386.1 protein_id gnl|my_center|LOCUS_01690 179134 180327 gene locus_tag LOCUS_01700 179134 180327 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720441.1 protein_id gnl|my_center|LOCUS_01700 181446 180514 gene locus_tag LOCUS_01710 181446 180514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 181721 183385 gene locus_tag LOCUS_01720 181721 183385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 183382 184005 gene locus_tag LOCUS_01730 183382 184005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 184186 184920 gene locus_tag LOCUS_01740 184186 184920 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226141.1 protein_id gnl|my_center|LOCUS_01740 186048 184939 gene locus_tag LOCUS_01750 186048 184939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 187860 186223 gene locus_tag LOCUS_01760 187860 186223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 188110 188472 gene locus_tag LOCUS_01770 188110 188472 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965665.1 protein_id gnl|my_center|LOCUS_01770 188476 190125 gene locus_tag LOCUS_01780 188476 190125 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089646.1 protein_id gnl|my_center|LOCUS_01780 190520 190299 gene locus_tag LOCUS_01790 190520 190299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 191001 191210 gene locus_tag LOCUS_01800 191001 191210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 192319 191375 gene locus_tag LOCUS_01810 192319 191375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 194025 192316 gene locus_tag LOCUS_01820 194025 192316 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104950.1 protein_id gnl|my_center|LOCUS_01820 194715 194107 gene locus_tag LOCUS_01830 194715 194107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 195056 195571 gene locus_tag LOCUS_01840 195056 195571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 195639 197300 gene locus_tag LOCUS_01850 195639 197300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 197304 198455 gene locus_tag LOCUS_01860 197304 198455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 198498 200411 gene locus_tag LOCUS_01870 198498 200411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 200572 201597 gene locus_tag LOCUS_01880 200572 201597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 201709 201879 gene locus_tag LOCUS_01890 201709 201879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 201980 203314 gene locus_tag LOCUS_01900 201980 203314 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085342.1 protein_id gnl|my_center|LOCUS_01900 203610 203329 gene locus_tag LOCUS_01910 203610 203329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 203714 204367 gene locus_tag LOCUS_01920 203714 204367 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_01920 204364 205704 gene locus_tag LOCUS_01930 204364 205704 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 protein_id gnl|my_center|LOCUS_01930 205749 207050 gene locus_tag LOCUS_01940 gene der 205749 207050 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086828.1 protein_id gnl|my_center|LOCUS_01940 207788 207192 gene locus_tag LOCUS_01950 207788 207192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 207679 208572 gene locus_tag LOCUS_01960 207679 208572 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390493.1 protein_id gnl|my_center|LOCUS_01960 208291 208375 gene locus_tag LOCUS_t00050 208291 208375 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 208984 208658 gene locus_tag LOCUS_01970 208984 208658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 209199 210962 gene locus_tag LOCUS_01980 209199 210962 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 protein_id gnl|my_center|LOCUS_01980 211088 211372 gene locus_tag LOCUS_01990 211088 211372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 211940 211392 gene locus_tag LOCUS_02000 gene rsmD 211940 211392 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388411.1 protein_id gnl|my_center|LOCUS_02000 212707 211943 gene locus_tag LOCUS_02010 212707 211943 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388410.1 protein_id gnl|my_center|LOCUS_02010 213423 212704 gene locus_tag LOCUS_02020 213423 212704 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_02020 213470 214012 gene locus_tag LOCUS_02030 213470 214012 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388408.1 protein_id gnl|my_center|LOCUS_02030 214538 215593 gene locus_tag LOCUS_02040 214538 215593 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 protein_id gnl|my_center|LOCUS_02040 216972 215698 gene locus_tag LOCUS_02050 gene purD 216972 215698 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090230.1 protein_id gnl|my_center|LOCUS_02050 217022 218476 gene locus_tag LOCUS_02060 gene xseA 217022 218476 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387920.1 protein_id gnl|my_center|LOCUS_02060 218560 218751 gene locus_tag LOCUS_02070 218560 218751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 219177 218866 gene locus_tag LOCUS_02080 219177 218866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 219411 219190 gene locus_tag LOCUS_02090 219411 219190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 221291 219468 gene locus_tag LOCUS_02100 gene glmS 221291 219468 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 protein_id gnl|my_center|LOCUS_02100 222682 221369 gene locus_tag LOCUS_02110 gene glmU 222682 221369 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337537.1 protein_id gnl|my_center|LOCUS_02110 222819 223550 gene locus_tag LOCUS_02120 222819 223550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 223447 224544 gene locus_tag LOCUS_02130 223447 224544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 224677 225351 gene locus_tag LOCUS_02140 224677 225351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 225386 225898 gene locus_tag LOCUS_02150 225386 225898 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085887.1 protein_id gnl|my_center|LOCUS_02150 225895 226815 gene locus_tag LOCUS_02160 225895 226815 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170938.1 protein_id gnl|my_center|LOCUS_02160 227116 227817 gene locus_tag LOCUS_02170 227116 227817 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02170 227853 228395 gene locus_tag LOCUS_02180 227853 228395 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084272.1 protein_id gnl|my_center|LOCUS_02180 228604 228858 gene locus_tag LOCUS_02190 228604 228858 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626232.1 protein_id gnl|my_center|LOCUS_02190 229189 229824 gene locus_tag LOCUS_02200 229189 229824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 230325 231146 gene locus_tag LOCUS_02210 230325 231146 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_02210 233118 231343 gene locus_tag LOCUS_02220 233118 231343 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 protein_id gnl|my_center|LOCUS_02220 233269 233922 gene locus_tag LOCUS_02230 233269 233922 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197238.1 protein_id gnl|my_center|LOCUS_02230 234009 234575 gene locus_tag LOCUS_02240 234009 234575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 234601 235731 gene locus_tag LOCUS_02250 234601 235731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 235765 236739 gene locus_tag LOCUS_02260 235765 236739 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_02260 236736 237773 gene locus_tag LOCUS_02270 236736 237773 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528226.1 protein_id gnl|my_center|LOCUS_02270 238248 237949 gene locus_tag LOCUS_02280 238248 237949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 239162 238245 gene locus_tag LOCUS_02290 gene nudC 239162 238245 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_02290 239426 241291 gene locus_tag LOCUS_02300 239426 241291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 241295 241618 gene locus_tag LOCUS_02310 241295 241618 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309920.1 protein_id gnl|my_center|LOCUS_02310 241662 242255 gene locus_tag LOCUS_02320 gene recR 241662 242255 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391218.1 protein_id gnl|my_center|LOCUS_02320 242328 242855 gene locus_tag LOCUS_02330 242328 242855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 243742 243059 gene locus_tag LOCUS_02340 243742 243059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 243827 245830 gene locus_tag LOCUS_02350 243827 245830 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086957.1 protein_id gnl|my_center|LOCUS_02350 246211 245891 gene locus_tag LOCUS_02360 246211 245891 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 protein_id gnl|my_center|LOCUS_02360 247059 246487 gene locus_tag LOCUS_02370 247059 246487 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086823.1 protein_id gnl|my_center|LOCUS_02370 247648 247154 gene locus_tag LOCUS_02380 247648 247154 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036604.1 protein_id gnl|my_center|LOCUS_02380 247848 248489 gene locus_tag LOCUS_02390 247848 248489 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_02390 248940 248596 gene locus_tag LOCUS_02400 248940 248596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 250673 248967 gene locus_tag LOCUS_02410 250673 248967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 251178 250798 gene locus_tag LOCUS_02420 gene iscA 251178 250798 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 protein_id gnl|my_center|LOCUS_02420 251570 251193 gene locus_tag LOCUS_02430 251570 251193 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087115.1 protein_id gnl|my_center|LOCUS_02430 252018 251563 gene locus_tag LOCUS_02440 252018 251563 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_02440 253256 252015 gene locus_tag LOCUS_02450 253256 252015 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390320.1 protein_id gnl|my_center|LOCUS_02450 254494 253253 gene locus_tag LOCUS_02460 gene sufD 254494 253253 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_02460 255240 254491 gene locus_tag LOCUS_02470 gene sufC 255240 254491 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720602.1 protein_id gnl|my_center|LOCUS_02470 256736 255252 gene locus_tag LOCUS_02480 gene sufB 256736 255252 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_02480 257227 256748 gene locus_tag LOCUS_02490 257227 256748 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_02490 257404 258042 gene locus_tag LOCUS_02500 257404 258042 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338219.1 protein_id gnl|my_center|LOCUS_02500 >Feature sequence002 1243 1680 gene locus_tag LOCUS_02510 1243 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 1841 2242 gene locus_tag LOCUS_02520 1841 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 3715 2384 gene locus_tag LOCUS_02530 3715 2384 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_02530 4426 3725 gene locus_tag LOCUS_02540 4426 3725 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 protein_id gnl|my_center|LOCUS_02540 4983 4441 gene locus_tag LOCUS_02550 4983 4441 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_02550 5129 6031 gene locus_tag LOCUS_02560 5129 6031 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_02560 6464 7591 gene locus_tag LOCUS_02570 6464 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 7650 8219 gene locus_tag LOCUS_02580 7650 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 8265 8963 gene locus_tag LOCUS_02590 gene hisG 8265 8963 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390582.1 protein_id gnl|my_center|LOCUS_02590 8960 10279 gene locus_tag LOCUS_02600 gene hisD 8960 10279 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338373.1 protein_id gnl|my_center|LOCUS_02600 10385 10603 gene locus_tag LOCUS_02610 gene infA 10385 10603 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617696.1 protein_id gnl|my_center|LOCUS_02610 10605 11192 gene locus_tag LOCUS_02620 10605 11192 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640472.1 protein_id gnl|my_center|LOCUS_02620 11189 12295 gene locus_tag LOCUS_02630 11189 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 12292 12501 gene locus_tag LOCUS_02640 12292 12501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 12553 12628 gene locus_tag LOCUS_t00060 12553 12628 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 13751 12870 gene locus_tag LOCUS_02650 13751 12870 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389519.1 protein_id gnl|my_center|LOCUS_02650 13837 14283 gene locus_tag LOCUS_02660 gene yajC 13837 14283 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626242.1 protein_id gnl|my_center|LOCUS_02660 14908 14330 gene locus_tag LOCUS_02670 14908 14330 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_02670 15164 15949 gene locus_tag LOCUS_02680 15164 15949 CDS product squalene/phytoene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389512.1 protein_id gnl|my_center|LOCUS_02680 16564 16052 gene locus_tag LOCUS_02690 16564 16052 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720333.1 protein_id gnl|my_center|LOCUS_02690 16843 16568 gene locus_tag LOCUS_02700 16843 16568 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392730.1 protein_id gnl|my_center|LOCUS_02700 17547 16843 gene locus_tag LOCUS_02710 17547 16843 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_02710 20177 17544 gene locus_tag LOCUS_02720 20177 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 23061 20572 gene locus_tag LOCUS_02730 23061 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 24058 23054 gene locus_tag LOCUS_02740 24058 23054 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390409.1 protein_id gnl|my_center|LOCUS_02740 25326 24055 gene locus_tag LOCUS_02750 25326 24055 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_02750 25893 25471 gene locus_tag LOCUS_02760 gene rplQ 25893 25471 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390413.1 protein_id gnl|my_center|LOCUS_02760 26935 25916 gene locus_tag LOCUS_02770 26935 25916 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626433.1 protein_id gnl|my_center|LOCUS_02770 27433 27035 gene locus_tag LOCUS_02780 gene rpsK 27433 27035 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390415.1 protein_id gnl|my_center|LOCUS_02780 27898 27515 gene locus_tag LOCUS_02790 gene rpsM 27898 27515 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_02790 28788 28132 gene locus_tag LOCUS_02800 28788 28132 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561944.1 protein_id gnl|my_center|LOCUS_02800 30131 28785 gene locus_tag LOCUS_02810 gene secY 30131 28785 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 protein_id gnl|my_center|LOCUS_02810 30723 30229 gene locus_tag LOCUS_02820 gene rplO 30723 30229 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563657.1 protein_id gnl|my_center|LOCUS_02820 30964 30773 gene locus_tag LOCUS_02830 gene rpmD 30964 30773 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390420.1 protein_id gnl|my_center|LOCUS_02830 31550 30957 gene locus_tag LOCUS_02840 gene rpsE 31550 30957 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390421.1 protein_id gnl|my_center|LOCUS_02840 31926 31564 gene locus_tag LOCUS_02850 gene rplR 31926 31564 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383041.1 protein_id gnl|my_center|LOCUS_02850 32461 31928 gene locus_tag LOCUS_02860 gene rplF 32461 31928 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531432.1 protein_id gnl|my_center|LOCUS_02860 32870 32472 gene locus_tag LOCUS_02870 gene rpsH 32870 32472 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390424.1 protein_id gnl|my_center|LOCUS_02870 33188 32883 gene locus_tag LOCUS_02880 gene rpsN 33188 32883 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390425.1 protein_id gnl|my_center|LOCUS_02880 34021 33269 gene locus_tag LOCUS_02890 34021 33269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 34352 34032 gene locus_tag LOCUS_02900 gene rplX 34352 34032 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_02900 34720 34352 gene locus_tag LOCUS_02910 gene rplN 34720 34352 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390428.1 protein_id gnl|my_center|LOCUS_02910 35026 34733 gene locus_tag LOCUS_02920 35026 34733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 35264 35037 gene locus_tag LOCUS_02930 gene rpmC 35264 35037 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 protein_id gnl|my_center|LOCUS_02930 35673 35257 gene locus_tag LOCUS_02940 gene rplP 35673 35257 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_02940 36363 35686 gene locus_tag LOCUS_02950 gene rpsC 36363 35686 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_02950 36770 36363 gene locus_tag LOCUS_02960 gene rplV 36770 36363 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205462.1 protein_id gnl|my_center|LOCUS_02960 37050 36772 gene locus_tag LOCUS_02970 gene rpsS 37050 36772 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390434.1 protein_id gnl|my_center|LOCUS_02970 37887 37054 gene locus_tag LOCUS_02980 gene rplB 37887 37054 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390435.1 protein_id gnl|my_center|LOCUS_02980 38259 37903 gene locus_tag LOCUS_02990 38259 37903 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440457.1 protein_id gnl|my_center|LOCUS_02990 38870 38256 gene locus_tag LOCUS_03000 gene rplD 38870 38256 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390437.1 protein_id gnl|my_center|LOCUS_03000 39565 38882 gene locus_tag LOCUS_03010 gene rplC 39565 38882 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390498.1 protein_id gnl|my_center|LOCUS_03010 39929 39621 gene locus_tag LOCUS_03020 gene rpsJ 39929 39621 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_03020 41155 39968 gene locus_tag LOCUS_03030 gene tuf 41155 39968 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088152.1 protein_id gnl|my_center|LOCUS_03030 41697 41221 gene locus_tag LOCUS_03040 gene rpsG 41697 41221 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722484.1 protein_id gnl|my_center|LOCUS_03040 42079 41708 gene locus_tag LOCUS_03050 gene rpsL 42079 41708 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_03050 46691 42459 gene locus_tag LOCUS_03060 gene rpoC 46691 42459 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390504.1 protein_id gnl|my_center|LOCUS_03060 50985 46810 gene locus_tag LOCUS_03070 gene rpoB 50985 46810 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390505.1 protein_id gnl|my_center|LOCUS_03070 49870 49952 gene locus_tag LOCUS_t00070 49870 49952 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 51664 51287 gene locus_tag LOCUS_03080 gene rplL 51664 51287 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 protein_id gnl|my_center|LOCUS_03080 52335 51799 gene locus_tag LOCUS_03090 gene rplJ 52335 51799 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390507.1 protein_id gnl|my_center|LOCUS_03090 53376 52684 gene locus_tag LOCUS_03100 gene rplA 53376 52684 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088163.1 protein_id gnl|my_center|LOCUS_03100 53815 53381 gene locus_tag LOCUS_03110 gene rplK 53815 53381 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390509.1 protein_id gnl|my_center|LOCUS_03110 54708 54043 gene locus_tag LOCUS_03120 54708 54043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 56109 54766 gene locus_tag LOCUS_03130 56109 54766 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919065.1 protein_id gnl|my_center|LOCUS_03130 56875 56132 gene locus_tag LOCUS_03140 56875 56132 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_03140 56981 57637 gene locus_tag LOCUS_03150 56981 57637 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920062.1 protein_id gnl|my_center|LOCUS_03150 57696 58763 gene locus_tag LOCUS_03160 57696 58763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 58767 59975 gene locus_tag LOCUS_03170 58767 59975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 60018 60989 gene locus_tag LOCUS_03180 60018 60989 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626403.1 protein_id gnl|my_center|LOCUS_03180 61348 62112 gene locus_tag LOCUS_03190 61348 62112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 63401 62307 gene locus_tag LOCUS_03200 gene modC 63401 62307 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836198.1 protein_id gnl|my_center|LOCUS_03200 64012 63398 gene locus_tag LOCUS_03210 gene modB 64012 63398 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388461.1 protein_id gnl|my_center|LOCUS_03210 64840 64091 gene locus_tag LOCUS_03220 gene modA 64840 64091 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388462.1 protein_id gnl|my_center|LOCUS_03220 65704 64889 gene locus_tag LOCUS_03230 65704 64889 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836201.1 protein_id gnl|my_center|LOCUS_03230 66022 65816 gene locus_tag LOCUS_03240 66022 65816 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724678.1 protein_id gnl|my_center|LOCUS_03240 69667 66284 gene locus_tag LOCUS_03250 69667 66284 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085112.1 protein_id gnl|my_center|LOCUS_03250 72352 70034 gene locus_tag LOCUS_03260 72352 70034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 72236 72445 gene locus_tag LOCUS_03270 72236 72445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 73267 72485 gene locus_tag LOCUS_03280 73267 72485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 94208 73302 gene locus_tag LOCUS_03290 94208 73302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 96267 94747 gene locus_tag LOCUS_03300 96267 94747 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525355.1 protein_id gnl|my_center|LOCUS_03300 96266 96496 gene locus_tag LOCUS_03310 96266 96496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 97580 96453 gene locus_tag LOCUS_03320 97580 96453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269125.1 protein_id gnl|my_center|LOCUS_03320 97731 98735 gene locus_tag LOCUS_03330 97731 98735 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_03330 98974 99690 gene locus_tag LOCUS_03340 98974 99690 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_03340 100940 101368 gene locus_tag LOCUS_03350 100940 101368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 102466 101465 gene locus_tag LOCUS_03360 102466 101465 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390645.1 protein_id gnl|my_center|LOCUS_03360 103110 102478 gene locus_tag LOCUS_03370 103110 102478 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968411.1 protein_id gnl|my_center|LOCUS_03370 103784 103341 gene locus_tag LOCUS_03380 103784 103341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 105016 103844 gene locus_tag LOCUS_03390 105016 103844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 105527 105147 gene locus_tag LOCUS_03400 105527 105147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 105757 106410 gene locus_tag LOCUS_03410 105757 106410 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327211.1 protein_id gnl|my_center|LOCUS_03410 106997 106590 gene locus_tag LOCUS_03420 106997 106590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 107177 108451 gene locus_tag LOCUS_03430 107177 108451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 108521 108721 gene locus_tag LOCUS_03440 108521 108721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 109136 108696 gene locus_tag LOCUS_03450 109136 108696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 109917 109390 gene locus_tag LOCUS_03460 109917 109390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 110155 109928 gene locus_tag LOCUS_03470 110155 109928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 110805 110392 gene locus_tag LOCUS_03480 110805 110392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 111173 110817 gene locus_tag LOCUS_03490 111173 110817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 113500 111236 gene locus_tag LOCUS_03500 113500 111236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 113990 113505 gene locus_tag LOCUS_03510 113990 113505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 115347 114229 gene locus_tag LOCUS_03520 115347 114229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 116060 115359 gene locus_tag LOCUS_03530 116060 115359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 117183 116062 gene locus_tag LOCUS_03540 117183 116062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 117561 117187 gene locus_tag LOCUS_03550 117561 117187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 118093 117590 gene locus_tag LOCUS_03560 118093 117590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 119173 118115 gene locus_tag LOCUS_03570 119173 118115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 119345 119160 gene locus_tag LOCUS_03580 119345 119160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 120065 119352 gene locus_tag LOCUS_03590 120065 119352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 121043 120084 gene locus_tag LOCUS_03600 121043 120084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 121363 121043 gene locus_tag LOCUS_03610 121363 121043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 121515 121363 gene locus_tag LOCUS_03620 121515 121363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 121895 121533 gene locus_tag LOCUS_03630 121895 121533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 122326 121895 gene locus_tag LOCUS_03640 122326 121895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 123934 122336 gene locus_tag LOCUS_03650 123934 122336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 124943 124113 gene locus_tag LOCUS_03660 124943 124113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 125223 125014 gene locus_tag LOCUS_03670 125223 125014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 125990 125343 gene locus_tag LOCUS_03680 125990 125343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 126364 125990 gene locus_tag LOCUS_03690 126364 125990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 127816 126494 gene locus_tag LOCUS_03700 127816 126494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 128319 127924 gene locus_tag LOCUS_03710 128319 127924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 129707 128316 gene locus_tag LOCUS_03720 129707 128316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 131076 129721 gene locus_tag LOCUS_03730 gene terL 131076 129721 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697216.1 protein_id gnl|my_center|LOCUS_03730 131521 132090 gene locus_tag LOCUS_03740 131521 132090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 132385 132167 gene locus_tag LOCUS_03750 132385 132167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 132267 132491 gene locus_tag LOCUS_03760 132267 132491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 133085 132561 gene locus_tag LOCUS_03770 133085 132561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 133372 133073 gene locus_tag LOCUS_03780 133372 133073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 133475 133867 gene locus_tag LOCUS_03790 133475 133867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 134405 136369 gene locus_tag LOCUS_03800 134405 136369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 137366 136572 gene locus_tag LOCUS_03810 137366 136572 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393449.1 protein_id gnl|my_center|LOCUS_03810 139326 137542 gene locus_tag LOCUS_03820 gene aspS 139326 137542 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_03820 140368 139436 gene locus_tag LOCUS_03830 140368 139436 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085408.1 protein_id gnl|my_center|LOCUS_03830 140495 141682 gene locus_tag LOCUS_03840 gene rnd 140495 141682 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_03840 143403 141886 gene locus_tag LOCUS_03850 gene ppx 143403 141886 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_03850 145755 143509 gene locus_tag LOCUS_03860 145755 143509 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390010.1 protein_id gnl|my_center|LOCUS_03860 146493 145765 gene locus_tag LOCUS_03870 gene hdaA 146493 145765 CDS product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 protein_id gnl|my_center|LOCUS_03870 147695 146523 gene locus_tag LOCUS_03880 147695 146523 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 protein_id gnl|my_center|LOCUS_03880 148258 147692 gene locus_tag LOCUS_03890 148258 147692 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 protein_id gnl|my_center|LOCUS_03890 148383 149450 gene locus_tag LOCUS_03900 gene purM 148383 149450 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532445.1 protein_id gnl|my_center|LOCUS_03900 149447 150070 gene locus_tag LOCUS_03910 gene purN 149447 150070 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919571.1 protein_id gnl|my_center|LOCUS_03910 150560 150138 gene locus_tag LOCUS_03920 gene ndk 150560 150138 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390018.1 protein_id gnl|my_center|LOCUS_03920 150654 152528 gene locus_tag LOCUS_03930 150654 152528 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_03930 152572 153318 gene locus_tag LOCUS_03940 gene pdeM 152572 153318 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000237.1 protein_id gnl|my_center|LOCUS_03940 153416 154624 gene locus_tag LOCUS_03950 153416 154624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 155704 154829 gene locus_tag LOCUS_03960 155704 154829 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932075.1 protein_id gnl|my_center|LOCUS_03960 155948 157354 gene locus_tag LOCUS_03970 155948 157354 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 protein_id gnl|my_center|LOCUS_03970 157559 158233 gene locus_tag LOCUS_03980 157559 158233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 158239 159075 gene locus_tag LOCUS_03990 158239 159075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 159513 159100 gene locus_tag LOCUS_04000 159513 159100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 159512 160930 gene locus_tag LOCUS_04010 159512 160930 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_04010 161214 161140 gene locus_tag LOCUS_t00080 161214 161140 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 162335 161268 gene locus_tag LOCUS_04020 gene mnmA 162335 161268 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337613.1 protein_id gnl|my_center|LOCUS_04020 162752 162429 gene locus_tag LOCUS_04030 162752 162429 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_04030 163947 162769 gene locus_tag LOCUS_04040 163947 162769 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 protein_id gnl|my_center|LOCUS_04040 165051 163963 gene locus_tag LOCUS_04050 165051 163963 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 protein_id gnl|my_center|LOCUS_04050 165530 165048 gene locus_tag LOCUS_04060 165530 165048 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919732.1 protein_id gnl|my_center|LOCUS_04060 166306 166971 gene locus_tag LOCUS_04070 166306 166971 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_04070 168114 166990 gene locus_tag LOCUS_04080 168114 166990 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 protein_id gnl|my_center|LOCUS_04080 168077 169417 gene locus_tag LOCUS_04090 gene tyrS 168077 169417 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 protein_id gnl|my_center|LOCUS_04090 170747 169404 gene locus_tag LOCUS_04100 170747 169404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 171454 170747 gene locus_tag LOCUS_04110 171454 170747 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 protein_id gnl|my_center|LOCUS_04110 174849 171508 gene locus_tag LOCUS_04120 174849 171508 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_04120 174867 177839 gene locus_tag LOCUS_04130 174867 177839 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389791.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 177839 178303 gene locus_tag LOCUS_04140 gene bcp 177839 178303 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975630.1 protein_id gnl|my_center|LOCUS_04140 178980 178345 gene locus_tag LOCUS_04150 178980 178345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 179271 180944 gene locus_tag LOCUS_04160 179271 180944 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205212.1 protein_id gnl|my_center|LOCUS_04160 180941 181168 gene locus_tag LOCUS_04170 180941 181168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 181179 182150 gene locus_tag LOCUS_04180 181179 182150 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827650.1 protein_id gnl|my_center|LOCUS_04180 182793 182140 gene locus_tag LOCUS_04190 182793 182140 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388305.1 protein_id gnl|my_center|LOCUS_04190 184378 182807 gene locus_tag LOCUS_04200 184378 182807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 184842 187064 gene locus_tag LOCUS_04210 184842 187064 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088595.1 protein_id gnl|my_center|LOCUS_04210 187120 188574 gene locus_tag LOCUS_04220 187120 188574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 188574 189620 gene locus_tag LOCUS_04230 188574 189620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 189718 190122 gene locus_tag LOCUS_04240 189718 190122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 191904 190129 gene locus_tag LOCUS_04250 191904 190129 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389063.1 protein_id gnl|my_center|LOCUS_04250 194216 191916 gene locus_tag LOCUS_04260 194216 191916 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389064.1 protein_id gnl|my_center|LOCUS_04260 195340 194213 gene locus_tag LOCUS_04270 195340 194213 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389065.1 protein_id gnl|my_center|LOCUS_04270 195808 195365 gene locus_tag LOCUS_04280 195808 195365 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389066.1 protein_id gnl|my_center|LOCUS_04280 197548 195821 gene locus_tag LOCUS_04290 197548 195821 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 protein_id gnl|my_center|LOCUS_04290 198901 197585 gene locus_tag LOCUS_04300 198901 197585 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_04300 200358 199003 gene locus_tag LOCUS_04310 200358 199003 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 protein_id gnl|my_center|LOCUS_04310 200769 201677 gene locus_tag LOCUS_04320 200769 201677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 201674 202123 gene locus_tag LOCUS_04330 201674 202123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 202693 202400 gene locus_tag LOCUS_04340 202693 202400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 204487 202781 gene locus_tag LOCUS_04350 204487 202781 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_04350 205521 204616 gene locus_tag LOCUS_04360 205521 204616 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388364.1 protein_id gnl|my_center|LOCUS_04360 206572 205529 gene locus_tag LOCUS_04370 206572 205529 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530538.1 protein_id gnl|my_center|LOCUS_04370 206825 206909 gene locus_tag LOCUS_t00090 206825 206909 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 207053 207128 gene locus_tag LOCUS_t00100 207053 207128 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 207424 209055 gene locus_tag LOCUS_04380 207424 209055 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974092.1 protein_id gnl|my_center|LOCUS_04380 209126 209908 gene locus_tag LOCUS_04390 209126 209908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence003 2422 959 gene locus_tag LOCUS_04400 gene tldD 2422 959 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_04400 3696 2419 gene locus_tag LOCUS_04410 3696 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 5328 3697 gene locus_tag LOCUS_04420 5328 3697 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 protein_id gnl|my_center|LOCUS_04420 5761 5489 gene locus_tag LOCUS_04430 5761 5489 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387921.1 protein_id gnl|my_center|LOCUS_04430 6023 6376 gene locus_tag LOCUS_04440 gene groES 6023 6376 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975851.1 protein_id gnl|my_center|LOCUS_04440 6439 8085 gene locus_tag LOCUS_04450 gene groL 6439 8085 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530719.1 protein_id gnl|my_center|LOCUS_04450 8432 8635 gene locus_tag LOCUS_04460 8432 8635 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008141931.1 protein_id gnl|my_center|LOCUS_04460 9171 8752 gene locus_tag LOCUS_04470 9171 8752 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390786.1 protein_id gnl|my_center|LOCUS_04470 11312 9279 gene locus_tag LOCUS_04480 11312 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 12907 11324 gene locus_tag LOCUS_04490 12907 11324 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470643.1 protein_id gnl|my_center|LOCUS_04490 12971 15781 gene locus_tag LOCUS_04500 12971 15781 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_04500 15938 16552 gene locus_tag LOCUS_04510 gene gmhA 15938 16552 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205222.1 protein_id gnl|my_center|LOCUS_04510 16664 17968 gene locus_tag LOCUS_04520 16664 17968 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967022.1 protein_id gnl|my_center|LOCUS_04520 18546 18139 gene locus_tag LOCUS_04530 18546 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 19599 18784 gene locus_tag LOCUS_04540 19599 18784 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 protein_id gnl|my_center|LOCUS_04540 21085 19676 gene locus_tag LOCUS_04550 21085 19676 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_04550 21996 21121 gene locus_tag LOCUS_04560 gene galU 21996 21121 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_04560 22566 22120 gene locus_tag LOCUS_04570 22566 22120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 24858 22576 gene locus_tag LOCUS_04580 24858 22576 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920475.1 protein_id gnl|my_center|LOCUS_04580 25010 27322 gene locus_tag LOCUS_04590 25010 27322 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_04590 27404 27820 gene locus_tag LOCUS_04600 gene hisI 27404 27820 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_04600 27813 28850 gene locus_tag LOCUS_04610 27813 28850 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 protein_id gnl|my_center|LOCUS_04610 29048 28869 gene locus_tag LOCUS_04620 29048 28869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 29301 30581 gene locus_tag LOCUS_04630 29301 30581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 31459 30710 gene locus_tag LOCUS_04640 31459 30710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 32214 31555 gene locus_tag LOCUS_04650 32214 31555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 33758 32361 gene locus_tag LOCUS_04660 33758 32361 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_04660 36071 33780 gene locus_tag LOCUS_04670 36071 33780 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_04670 37605 36145 gene locus_tag LOCUS_04680 gene ntrC 37605 36145 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_04680 38765 37632 gene locus_tag LOCUS_04690 38765 37632 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_04690 39832 38774 gene locus_tag LOCUS_04700 gene dusB 39832 38774 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014411626.1 protein_id gnl|my_center|LOCUS_04700 39944 41086 gene locus_tag LOCUS_04710 39944 41086 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_04710 41203 41577 gene locus_tag LOCUS_04720 41203 41577 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_04720 41598 41780 gene locus_tag LOCUS_04730 41598 41780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 42084 43319 gene locus_tag LOCUS_04740 42084 43319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 43773 43291 gene locus_tag LOCUS_04750 43773 43291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 45080 43881 gene locus_tag LOCUS_04760 45080 43881 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026800.1 protein_id gnl|my_center|LOCUS_04760 45415 46557 gene locus_tag LOCUS_04770 45415 46557 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_04770 46585 49737 gene locus_tag LOCUS_04780 46585 49737 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086679.1 protein_id gnl|my_center|LOCUS_04780 50594 49725 gene locus_tag LOCUS_04790 gene cysE 50594 49725 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388550.1 protein_id gnl|my_center|LOCUS_04790 52248 50644 gene locus_tag LOCUS_04800 52248 50644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 53011 52241 gene locus_tag LOCUS_04810 53011 52241 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04810 54133 53363 gene locus_tag LOCUS_04820 gene lexA 54133 53363 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971587.1 protein_id gnl|my_center|LOCUS_04820 55487 54282 gene locus_tag LOCUS_04830 55487 54282 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_04830 55971 55495 gene locus_tag LOCUS_04840 gene moaC 55971 55495 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719152.1 protein_id gnl|my_center|LOCUS_04840 56828 55968 gene locus_tag LOCUS_04850 gene trpC 56828 55968 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389650.1 protein_id gnl|my_center|LOCUS_04850 57835 56825 gene locus_tag LOCUS_04860 gene trpD 57835 56825 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531738.1 protein_id gnl|my_center|LOCUS_04860 58453 57851 gene locus_tag LOCUS_04870 58453 57851 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_04870 58830 59804 gene locus_tag LOCUS_04880 58830 59804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 60491 59817 gene locus_tag LOCUS_04890 60491 59817 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_04890 61235 61369 gene locus_tag LOCUS_04900 61235 61369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 61389 61553 gene locus_tag LOCUS_04910 61389 61553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 61723 61857 gene locus_tag LOCUS_04920 61723 61857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 61869 62039 gene locus_tag LOCUS_04930 61869 62039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 62112 62246 gene locus_tag LOCUS_04940 62112 62246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 62263 62433 gene locus_tag LOCUS_04950 62263 62433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 62506 62643 gene locus_tag LOCUS_04960 62506 62643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 62654 62830 gene locus_tag LOCUS_04970 62654 62830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 63081 63374 gene locus_tag LOCUS_04980 63081 63374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 64029 63544 gene locus_tag LOCUS_04990 gene smpB 64029 63544 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389617.1 protein_id gnl|my_center|LOCUS_04990 64931 64053 gene locus_tag LOCUS_05000 gene dapA 64931 64053 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389618.1 protein_id gnl|my_center|LOCUS_05000 65026 66990 gene locus_tag LOCUS_05010 65026 66990 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 protein_id gnl|my_center|LOCUS_05010 66987 67859 gene locus_tag LOCUS_05020 66987 67859 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337350.1 protein_id gnl|my_center|LOCUS_05020 67856 68308 gene locus_tag LOCUS_05030 67856 68308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 68326 68823 gene locus_tag LOCUS_05040 68326 68823 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393487.1 protein_id gnl|my_center|LOCUS_05040 69549 69016 gene locus_tag LOCUS_05050 69549 69016 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_05050 71185 69641 gene locus_tag LOCUS_05060 71185 69641 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528494.1 protein_id gnl|my_center|LOCUS_05060 72333 71182 gene locus_tag LOCUS_05070 72333 71182 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387917.1 protein_id gnl|my_center|LOCUS_05070 72460 73107 gene locus_tag LOCUS_05080 72460 73107 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966858.1 protein_id gnl|my_center|LOCUS_05080 73543 73088 gene locus_tag LOCUS_05090 73543 73088 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_05090 74340 73546 gene locus_tag LOCUS_05100 74340 73546 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463734.1 protein_id gnl|my_center|LOCUS_05100 75597 74419 gene locus_tag LOCUS_05110 75597 74419 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337632.1 protein_id gnl|my_center|LOCUS_05110 76444 75602 gene locus_tag LOCUS_05120 76444 75602 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_05120 77137 76550 gene locus_tag LOCUS_05130 77137 76550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 77844 77542 gene locus_tag LOCUS_05140 77844 77542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 78460 77909 gene locus_tag LOCUS_05150 78460 77909 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_05150 78866 81031 gene locus_tag LOCUS_05160 78866 81031 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084290.1 protein_id gnl|my_center|LOCUS_05160 81194 82861 gene locus_tag LOCUS_05170 81194 82861 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_05170 84340 83117 gene locus_tag LOCUS_05180 84340 83117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 85419 84346 gene locus_tag LOCUS_05190 85419 84346 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_05190 86496 85423 gene locus_tag LOCUS_05200 86496 85423 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141179.1 protein_id gnl|my_center|LOCUS_05200 87893 86781 gene locus_tag LOCUS_05210 gene rseP 87893 86781 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389468.1 protein_id gnl|my_center|LOCUS_05210 89065 87902 gene locus_tag LOCUS_05220 89065 87902 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_05220 89928 89062 gene locus_tag LOCUS_05230 89928 89062 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389466.1 protein_id gnl|my_center|LOCUS_05230 90691 89888 gene locus_tag LOCUS_05240 90691 89888 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_05240 91317 90751 gene locus_tag LOCUS_05250 gene frr 91317 90751 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389464.1 protein_id gnl|my_center|LOCUS_05250 92214 91489 gene locus_tag LOCUS_05260 gene pyrH 92214 91489 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919787.1 protein_id gnl|my_center|LOCUS_05260 93292 92363 gene locus_tag LOCUS_05270 gene tsf 93292 92363 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_05270 94094 93315 gene locus_tag LOCUS_05280 gene rpsB 94094 93315 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389461.1 protein_id gnl|my_center|LOCUS_05280 94479 95093 gene locus_tag LOCUS_05290 94479 95093 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391445.1 protein_id gnl|my_center|LOCUS_05290 95212 95979 gene locus_tag LOCUS_05300 95212 95979 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104264.1 protein_id gnl|my_center|LOCUS_05300 96013 96771 gene locus_tag LOCUS_05310 96013 96771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 99051 96832 gene locus_tag LOCUS_05320 gene parC 99051 96832 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_05320 99829 99044 gene locus_tag LOCUS_05330 gene recO 99829 99044 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722424.1 protein_id gnl|my_center|LOCUS_05330 100050 101138 gene locus_tag LOCUS_05340 100050 101138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 102035 101244 gene locus_tag LOCUS_05350 102035 101244 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_05350 103409 102066 gene locus_tag LOCUS_05360 gene cysS 103409 102066 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 protein_id gnl|my_center|LOCUS_05360 103593 103988 gene locus_tag LOCUS_05370 103593 103988 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265601.1 protein_id gnl|my_center|LOCUS_05370 103985 105916 gene locus_tag LOCUS_05380 103985 105916 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089263.1 protein_id gnl|my_center|LOCUS_05380 107048 106179 gene locus_tag LOCUS_05390 gene motA 107048 106179 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 protein_id gnl|my_center|LOCUS_05390 108100 107060 gene locus_tag LOCUS_05400 108100 107060 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389596.1 protein_id gnl|my_center|LOCUS_05400 109593 108220 gene locus_tag LOCUS_05410 109593 108220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 109774 110457 gene locus_tag LOCUS_05420 109774 110457 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391460.1 protein_id gnl|my_center|LOCUS_05420 110548 110730 gene locus_tag LOCUS_05430 110548 110730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 111597 110749 gene locus_tag LOCUS_05440 gene gluQRS 111597 110749 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_05440 111645 112289 gene locus_tag LOCUS_05450 111645 112289 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 protein_id gnl|my_center|LOCUS_05450 112453 113013 gene locus_tag LOCUS_05460 112453 113013 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391480.1 protein_id gnl|my_center|LOCUS_05460 113235 113050 gene locus_tag LOCUS_05470 113235 113050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 113457 114116 gene locus_tag LOCUS_05480 113457 114116 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522352.1 protein_id gnl|my_center|LOCUS_05480 115118 114153 gene locus_tag LOCUS_05490 115118 114153 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_05490 115266 115670 gene locus_tag LOCUS_05500 115266 115670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 116621 115671 gene locus_tag LOCUS_05510 116621 115671 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974328.1 protein_id gnl|my_center|LOCUS_05510 117454 117221 gene locus_tag LOCUS_05520 117454 117221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 118103 117588 gene locus_tag LOCUS_05530 118103 117588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 119400 118165 gene locus_tag LOCUS_05540 119400 118165 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085364.1 protein_id gnl|my_center|LOCUS_05540 119733 120719 gene locus_tag LOCUS_05550 119733 120719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 120694 121104 gene locus_tag LOCUS_05560 120694 121104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 121399 122307 gene locus_tag LOCUS_05570 121399 122307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 122422 122979 gene locus_tag LOCUS_05580 122422 122979 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_05580 123433 123245 gene locus_tag LOCUS_05590 123433 123245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 123633 123430 gene locus_tag LOCUS_05600 123633 123430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 124873 123728 gene locus_tag LOCUS_05610 124873 123728 CDS product DUF3734 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089764.1 protein_id gnl|my_center|LOCUS_05610 125695 124922 gene locus_tag LOCUS_05620 125695 124922 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083528.1 protein_id gnl|my_center|LOCUS_05620 127327 125909 gene locus_tag LOCUS_05630 127327 125909 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_05630 129551 127341 gene locus_tag LOCUS_05640 129551 127341 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_05640 130822 129704 gene locus_tag LOCUS_05650 130822 129704 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_05650 131907 130819 gene locus_tag LOCUS_05660 131907 130819 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090338.1 protein_id gnl|my_center|LOCUS_05660 133083 132013 gene locus_tag LOCUS_05670 133083 132013 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765838.1 protein_id gnl|my_center|LOCUS_05670 132897 132804 gene locus_tag LOCUS_t00110 132897 132804 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 134285 133173 gene locus_tag LOCUS_05680 gene leuB 134285 133173 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388946.1 protein_id gnl|my_center|LOCUS_05680 134943 134323 gene locus_tag LOCUS_05690 gene leuD 134943 134323 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388945.1 protein_id gnl|my_center|LOCUS_05690 136355 134943 gene locus_tag LOCUS_05700 gene leuC 136355 134943 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_05700 136799 136386 gene locus_tag LOCUS_05710 gene rplS 136799 136386 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529750.1 protein_id gnl|my_center|LOCUS_05710 137567 136821 gene locus_tag LOCUS_05720 gene trmD 137567 136821 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388942.1 protein_id gnl|my_center|LOCUS_05720 138088 137564 gene locus_tag LOCUS_05730 gene rimM 138088 137564 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721394.1 protein_id gnl|my_center|LOCUS_05730 138428 138099 gene locus_tag LOCUS_05740 gene rpsP 138428 138099 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388940.1 protein_id gnl|my_center|LOCUS_05740 139847 138471 gene locus_tag LOCUS_05750 gene ffh 139847 138471 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388939.1 protein_id gnl|my_center|LOCUS_05750 140031 141152 gene locus_tag LOCUS_05760 140031 141152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144331.1 protein_id gnl|my_center|LOCUS_05760 141974 141225 gene locus_tag LOCUS_05770 141974 141225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 143798 142020 gene locus_tag LOCUS_05780 gene argS 143798 142020 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140224.1 protein_id gnl|my_center|LOCUS_05780 144967 143819 gene locus_tag LOCUS_05790 144967 143819 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389533.1 protein_id gnl|my_center|LOCUS_05790 144966 145358 gene locus_tag LOCUS_05800 gene erpA 144966 145358 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566170.1 protein_id gnl|my_center|LOCUS_05800 145366 146133 gene locus_tag LOCUS_05810 145366 146133 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_05810 <146719 146138 gene locus_tag LOCUS_05820 <146719 146138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149605307.1:tetratricopeptide repeat protein >Feature sequence004 541 161 gene locus_tag LOCUS_05830 541 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1288 545 gene locus_tag LOCUS_05840 1288 545 CDS product type IV secretion system lytic transglycosylase VirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970881.1 protein_id gnl|my_center|LOCUS_05840 1825 2304 gene locus_tag LOCUS_05850 1825 2304 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_05850 2301 3320 gene locus_tag LOCUS_05860 2301 3320 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164689163.1 protein_id gnl|my_center|LOCUS_05860 4146 4403 gene locus_tag LOCUS_05870 4146 4403 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390130.1 protein_id gnl|my_center|LOCUS_05870 4400 4714 gene locus_tag LOCUS_05880 4400 4714 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440152.1 protein_id gnl|my_center|LOCUS_05880 5545 4832 gene locus_tag LOCUS_05890 5545 4832 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532201.1 protein_id gnl|my_center|LOCUS_05890 6892 5549 gene locus_tag LOCUS_05900 6892 5549 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256441.1 protein_id gnl|my_center|LOCUS_05900 8580 6964 gene locus_tag LOCUS_05910 8580 6964 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727486.1 protein_id gnl|my_center|LOCUS_05910 9262 9531 gene locus_tag LOCUS_05920 9262 9531 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090956.1 protein_id gnl|my_center|LOCUS_05920 10919 9996 gene locus_tag LOCUS_05930 10919 9996 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_05930 11518 11183 gene locus_tag LOCUS_05940 11518 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 13262 11673 gene locus_tag LOCUS_05950 13262 11673 CDS product IS66-like element ISEc8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998051.1 protein_id gnl|my_center|LOCUS_05950 13675 13322 gene locus_tag LOCUS_05960 gene tnpB 13675 13322 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622996.1 protein_id gnl|my_center|LOCUS_05960 14097 13672 gene locus_tag LOCUS_05970 14097 13672 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084389.1 protein_id gnl|my_center|LOCUS_05970 15622 16269 gene locus_tag LOCUS_05980 gene parA 15622 16269 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194446.1 protein_id gnl|my_center|LOCUS_05980 16341 17045 gene locus_tag LOCUS_05990 16341 17045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 17291 16944 gene locus_tag LOCUS_06000 17291 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 18077 17466 gene locus_tag LOCUS_06010 18077 17466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06010 19283 18165 gene locus_tag LOCUS_06020 19283 18165 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_06020 19529 20335 gene locus_tag LOCUS_06030 19529 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 20340 21191 gene locus_tag LOCUS_06040 20340 21191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 21191 22063 gene locus_tag LOCUS_06050 21191 22063 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129796.1 protein_id gnl|my_center|LOCUS_06050 22060 22866 gene locus_tag LOCUS_06060 22060 22866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 23182 23466 gene locus_tag LOCUS_06070 23182 23466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 23734 24372 gene locus_tag LOCUS_06080 23734 24372 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 protein_id gnl|my_center|LOCUS_06080 25767 24412 gene locus_tag LOCUS_06090 25767 24412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 26179 27303 gene locus_tag LOCUS_06100 gene pdhA 26179 27303 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114486.1 protein_id gnl|my_center|LOCUS_06100 27296 28276 gene locus_tag LOCUS_06110 27296 28276 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006448747.1 protein_id gnl|my_center|LOCUS_06110 28289 29380 gene locus_tag LOCUS_06120 28289 29380 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114484.1 protein_id gnl|my_center|LOCUS_06120 29457 29810 gene locus_tag LOCUS_06130 29457 29810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 31339 29918 gene locus_tag LOCUS_06140 31339 29918 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563245.1 protein_id gnl|my_center|LOCUS_06140 31800 31438 gene locus_tag LOCUS_06150 31800 31438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 32268 31846 gene locus_tag LOCUS_06160 32268 31846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 32487 33758 gene locus_tag LOCUS_06170 32487 33758 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707052.1 protein_id gnl|my_center|LOCUS_06170 35213 33906 gene locus_tag LOCUS_06180 35213 33906 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_06180 36365 36165 gene locus_tag LOCUS_06190 36365 36165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 36989 36471 gene locus_tag LOCUS_06200 36989 36471 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227724.1 protein_id gnl|my_center|LOCUS_06200 37487 38371 gene locus_tag LOCUS_06210 37487 38371 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020389.1 protein_id gnl|my_center|LOCUS_06210 39156 38395 gene locus_tag LOCUS_06220 39156 38395 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083741.1 protein_id gnl|my_center|LOCUS_06220 40033 39161 gene locus_tag LOCUS_06230 40033 39161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965193.1 protein_id gnl|my_center|LOCUS_06230 40995 40030 gene locus_tag LOCUS_06240 40995 40030 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167770862.1 protein_id gnl|my_center|LOCUS_06240 42087 41233 gene locus_tag LOCUS_06250 42087 41233 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_06250 42172 43695 gene locus_tag LOCUS_06260 42172 43695 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972177.1 protein_id gnl|my_center|LOCUS_06260 44420 43716 gene locus_tag LOCUS_06270 44420 43716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970224.1 protein_id gnl|my_center|LOCUS_06270 46195 44420 gene locus_tag LOCUS_06280 46195 44420 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971602.1 protein_id gnl|my_center|LOCUS_06280 47091 46198 gene locus_tag LOCUS_06290 47091 46198 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870169.1 protein_id gnl|my_center|LOCUS_06290 48306 47155 gene locus_tag LOCUS_06300 48306 47155 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869357.1 protein_id gnl|my_center|LOCUS_06300 48516 50384 gene locus_tag LOCUS_06310 48516 50384 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942696.1 protein_id gnl|my_center|LOCUS_06310 50384 51022 gene locus_tag LOCUS_06320 gene iorB 50384 51022 CDS product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 protein_id gnl|my_center|LOCUS_06320 51016 52629 gene locus_tag LOCUS_06330 51016 52629 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929741.1 protein_id gnl|my_center|LOCUS_06330 52861 53568 gene locus_tag LOCUS_06340 52861 53568 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435816.1 protein_id gnl|my_center|LOCUS_06340 55577 53760 gene locus_tag LOCUS_06350 55577 53760 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079894.1 protein_id gnl|my_center|LOCUS_06350 56654 55608 gene locus_tag LOCUS_06360 56654 55608 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112406.1 protein_id gnl|my_center|LOCUS_06360 57551 56742 gene locus_tag LOCUS_06370 57551 56742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089193.1 protein_id gnl|my_center|LOCUS_06370 58552 57545 gene locus_tag LOCUS_06380 58552 57545 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089194.1 protein_id gnl|my_center|LOCUS_06380 59642 58566 gene locus_tag LOCUS_06390 59642 58566 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089195.1 protein_id gnl|my_center|LOCUS_06390 60687 59998 gene locus_tag LOCUS_06400 60687 59998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06400 60936 60718 gene locus_tag LOCUS_06410 60936 60718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06410 61767 60973 gene locus_tag LOCUS_06420 61767 60973 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406327.1 protein_id gnl|my_center|LOCUS_06420 62735 61764 gene locus_tag LOCUS_06430 62735 61764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 63432 62842 gene locus_tag LOCUS_06440 63432 62842 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807859.1 protein_id gnl|my_center|LOCUS_06440 65732 63579 gene locus_tag LOCUS_06450 65732 63579 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064833.1 protein_id gnl|my_center|LOCUS_06450 66119 66994 gene locus_tag LOCUS_06460 66119 66994 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267863.1 protein_id gnl|my_center|LOCUS_06460 68391 67039 gene locus_tag LOCUS_06470 68391 67039 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_06470 68748 69071 gene locus_tag LOCUS_06480 gene groES 68748 69071 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441664.1 protein_id gnl|my_center|LOCUS_06480 69106 70740 gene locus_tag LOCUS_06490 gene groL 69106 70740 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530719.1 protein_id gnl|my_center|LOCUS_06490 70883 71080 gene locus_tag LOCUS_06500 70883 71080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 71087 71725 gene locus_tag LOCUS_06510 71087 71725 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390364.1 protein_id gnl|my_center|LOCUS_06510 72556 71750 gene locus_tag LOCUS_06520 72556 71750 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921647.1 protein_id gnl|my_center|LOCUS_06520 73236 72571 gene locus_tag LOCUS_06530 73236 72571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066999.1 protein_id gnl|my_center|LOCUS_06530 74329 73226 gene locus_tag LOCUS_06540 74329 73226 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970269.1 protein_id gnl|my_center|LOCUS_06540 75140 74340 gene locus_tag LOCUS_06550 75140 74340 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388549.1 protein_id gnl|my_center|LOCUS_06550 75816 77249 gene locus_tag LOCUS_06560 75816 77249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 77246 77878 gene locus_tag LOCUS_06570 77246 77878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 79225 77867 gene locus_tag LOCUS_06580 79225 77867 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024749659.1 protein_id gnl|my_center|LOCUS_06580 79286 79687 gene locus_tag LOCUS_06590 79286 79687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 79778 81205 gene locus_tag LOCUS_06600 79778 81205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 81207 82205 gene locus_tag LOCUS_06610 81207 82205 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728489.1 protein_id gnl|my_center|LOCUS_06610 82981 82202 gene locus_tag LOCUS_06620 82981 82202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 83532 84800 gene locus_tag LOCUS_06630 83532 84800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 84833 85279 gene locus_tag LOCUS_06640 84833 85279 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479368.1 protein_id gnl|my_center|LOCUS_06640 85276 85749 gene locus_tag LOCUS_06650 85276 85749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 protein_id gnl|my_center|LOCUS_06650 86085 87014 gene locus_tag LOCUS_06660 86085 87014 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_06660 87007 88959 gene locus_tag LOCUS_06670 87007 88959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 88990 89859 gene locus_tag LOCUS_06680 gene cysE 88990 89859 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388550.1 protein_id gnl|my_center|LOCUS_06680 90808 89945 gene locus_tag LOCUS_06690 gene cysE 90808 89945 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388550.1 protein_id gnl|my_center|LOCUS_06690 92112 93935 gene locus_tag LOCUS_06700 92112 93935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 94046 94291 gene locus_tag LOCUS_06710 94046 94291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06710 94325 94630 gene locus_tag LOCUS_06720 94325 94630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06720 94624 95646 gene locus_tag LOCUS_06730 94624 95646 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_06730 96020 97672 gene locus_tag LOCUS_06740 96020 97672 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530815.1 protein_id gnl|my_center|LOCUS_06740 97669 98067 gene locus_tag LOCUS_06750 97669 98067 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530816.1 protein_id gnl|my_center|LOCUS_06750 98095 98859 gene locus_tag LOCUS_06760 98095 98859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 98856 99074 gene locus_tag LOCUS_06770 98856 99074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 99384 99599 gene locus_tag LOCUS_06780 99384 99599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 100160 102658 gene locus_tag LOCUS_06790 100160 102658 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 protein_id gnl|my_center|LOCUS_06790 102758 103597 gene locus_tag LOCUS_06800 102758 103597 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_06800 103919 104851 gene locus_tag LOCUS_06810 103919 104851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 104848 105738 gene locus_tag LOCUS_06820 104848 105738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_06820 105788 106975 gene locus_tag LOCUS_06830 105788 106975 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869500.1 protein_id gnl|my_center|LOCUS_06830 106972 108405 gene locus_tag LOCUS_06840 106972 108405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 108408 109406 gene locus_tag LOCUS_06850 108408 109406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 109446 110405 gene locus_tag LOCUS_06860 109446 110405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 110442 111950 gene locus_tag LOCUS_06870 110442 111950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 111947 112603 gene locus_tag LOCUS_06880 111947 112603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 112644 113624 gene locus_tag LOCUS_06890 112644 113624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 113626 114060 gene locus_tag LOCUS_06900 113626 114060 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_06900 114067 114495 gene locus_tag LOCUS_06910 114067 114495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 114508 115725 gene locus_tag LOCUS_06920 114508 115725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 115863 117569 gene locus_tag LOCUS_06930 115863 117569 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552510.1 protein_id gnl|my_center|LOCUS_06930 117566 119464 gene locus_tag LOCUS_06940 117566 119464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_06940 119489 119827 gene locus_tag LOCUS_06950 119489 119827 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597725.1 protein_id gnl|my_center|LOCUS_06950 119891 121285 gene locus_tag LOCUS_06960 119891 121285 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527331.1 protein_id gnl|my_center|LOCUS_06960 121916 121293 gene locus_tag LOCUS_06970 121916 121293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 122691 121918 gene locus_tag LOCUS_06980 gene istB 122691 121918 CDS product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 protein_id gnl|my_center|LOCUS_06980 123526 122681 gene locus_tag LOCUS_06990 123526 122681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06990 124305 123508 gene locus_tag LOCUS_07000 124305 123508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07000 125313 124360 gene locus_tag LOCUS_07010 125313 124360 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024078840.1 protein_id gnl|my_center|LOCUS_07010 125763 125401 gene locus_tag LOCUS_07020 125763 125401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 126394 125948 gene locus_tag LOCUS_07030 126394 125948 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388926.1 protein_id gnl|my_center|LOCUS_07030 126926 127729 gene locus_tag LOCUS_07040 126926 127729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 128878 127856 gene locus_tag LOCUS_07050 gene cysK 128878 127856 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527809.1 protein_id gnl|my_center|LOCUS_07050 128962 129414 gene locus_tag LOCUS_07060 128962 129414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 130649 129636 gene locus_tag LOCUS_07070 130649 129636 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266334.1 protein_id gnl|my_center|LOCUS_07070 <131524 130671 gene locus_tag LOCUS_07080 <131524 130671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582864.1:UxaA family hydrolase >Feature sequence005 634 2160 gene locus_tag LOCUS_07090 634 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 2157 2747 gene locus_tag LOCUS_07100 2157 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 2797 5859 gene locus_tag LOCUS_07110 2797 5859 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_07110 5964 6932 gene locus_tag LOCUS_07120 5964 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6929 8041 gene locus_tag LOCUS_07130 6929 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8038 9126 gene locus_tag LOCUS_07140 8038 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 9211 9675 gene locus_tag LOCUS_07150 9211 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 10777 9740 gene locus_tag LOCUS_07160 10777 9740 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938929.1 protein_id gnl|my_center|LOCUS_07160 11051 12841 gene locus_tag LOCUS_07170 11051 12841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192713.1 protein_id gnl|my_center|LOCUS_07170 13229 13750 gene locus_tag LOCUS_07180 13229 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 14090 15016 gene locus_tag LOCUS_07190 gene rihA 14090 15016 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071106.1 protein_id gnl|my_center|LOCUS_07190 15244 16095 gene locus_tag LOCUS_07200 gene mmsB 15244 16095 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086734.1 protein_id gnl|my_center|LOCUS_07200 16095 17774 gene locus_tag LOCUS_07210 16095 17774 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086735.1 protein_id gnl|my_center|LOCUS_07210 17781 18953 gene locus_tag LOCUS_07220 17781 18953 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_07220 18953 20557 gene locus_tag LOCUS_07230 18953 20557 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 protein_id gnl|my_center|LOCUS_07230 20563 22551 gene locus_tag LOCUS_07240 20563 22551 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_07240 22727 26185 gene locus_tag LOCUS_07250 22727 26185 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_07250 27779 26268 gene locus_tag LOCUS_07260 27779 26268 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483455.1 protein_id gnl|my_center|LOCUS_07260 28264 27776 gene locus_tag LOCUS_07270 28264 27776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 30625 28295 gene locus_tag LOCUS_07280 30625 28295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 31752 30622 gene locus_tag LOCUS_07290 31752 30622 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483463.1 protein_id gnl|my_center|LOCUS_07290 32459 31749 gene locus_tag LOCUS_07300 32459 31749 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263841.1 protein_id gnl|my_center|LOCUS_07300 34240 32456 gene locus_tag LOCUS_07310 gene glmS 34240 32456 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084447.1 protein_id gnl|my_center|LOCUS_07310 32849 32944 gene locus_tag LOCUS_t00120 32849 32944 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 34600 34388 gene locus_tag LOCUS_07320 34600 34388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 34711 35262 gene locus_tag LOCUS_07330 gene rutF 34711 35262 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816246.1 protein_id gnl|my_center|LOCUS_07330 35431 36318 gene locus_tag LOCUS_07340 35431 36318 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255985.1 protein_id gnl|my_center|LOCUS_07340 36332 37423 gene locus_tag LOCUS_07350 36332 37423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 38708 37608 gene locus_tag LOCUS_07360 38708 37608 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_07360 38962 41052 gene locus_tag LOCUS_07370 38962 41052 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529393.1 protein_id gnl|my_center|LOCUS_07370 41021 41242 gene locus_tag LOCUS_07380 41021 41242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 44079 42316 gene locus_tag LOCUS_07390 gene asnB 44079 42316 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_07390 44698 44216 gene locus_tag LOCUS_07400 gene mmcB 44698 44216 CDS product DNA repair putative endonuclease MmcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 protein_id gnl|my_center|LOCUS_07400 46154 44709 gene locus_tag LOCUS_07410 46154 44709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 46477 46187 gene locus_tag LOCUS_07420 46477 46187 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201313.1 protein_id gnl|my_center|LOCUS_07420 46559 46984 gene locus_tag LOCUS_07430 46559 46984 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391329.1 protein_id gnl|my_center|LOCUS_07430 47582 47151 gene locus_tag LOCUS_07440 47582 47151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 48515 47682 gene locus_tag LOCUS_07450 48515 47682 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_07450 48957 48751 gene locus_tag LOCUS_07460 48957 48751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 50636 49125 gene locus_tag LOCUS_07470 gene kaiC 50636 49125 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259117.1 protein_id gnl|my_center|LOCUS_07470 50967 50674 gene locus_tag LOCUS_07480 50967 50674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 51967 50960 gene locus_tag LOCUS_07490 51967 50960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 52586 51945 gene locus_tag LOCUS_07500 52586 51945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 53979 52756 gene locus_tag LOCUS_07510 53979 52756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 55064 53976 gene locus_tag LOCUS_07520 55064 53976 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875763.1 protein_id gnl|my_center|LOCUS_07520 55575 57254 gene locus_tag LOCUS_07530 gene cimA 55575 57254 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 protein_id gnl|my_center|LOCUS_07530 58216 57434 gene locus_tag LOCUS_07540 58216 57434 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_07540 59004 58213 gene locus_tag LOCUS_07550 59004 58213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_07550 60116 58995 gene locus_tag LOCUS_07560 gene alr 60116 58995 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529079.1 protein_id gnl|my_center|LOCUS_07560 61599 60103 gene locus_tag LOCUS_07570 61599 60103 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388169.1 protein_id gnl|my_center|LOCUS_07570 62407 62793 gene locus_tag LOCUS_07580 62407 62793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 63386 63072 gene locus_tag LOCUS_07590 63386 63072 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857655.1 protein_id gnl|my_center|LOCUS_07590 64687 63383 gene locus_tag LOCUS_07600 64687 63383 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084583.1 protein_id gnl|my_center|LOCUS_07600 65798 64698 gene locus_tag LOCUS_07610 65798 64698 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389921.1 protein_id gnl|my_center|LOCUS_07610 66669 65815 gene locus_tag LOCUS_07620 66669 65815 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533507.1 protein_id gnl|my_center|LOCUS_07620 67163 66828 gene locus_tag LOCUS_07630 gene nifW 67163 66828 CDS product nitrogenase stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084580.1 protein_id gnl|my_center|LOCUS_07630 68378 67173 gene locus_tag LOCUS_07640 gene nifS 68378 67173 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533504.1 protein_id gnl|my_center|LOCUS_07640 67608 67686 gene locus_tag LOCUS_t00130 67608 67686 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 68719 68408 gene locus_tag LOCUS_07650 68719 68408 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565964.1 protein_id gnl|my_center|LOCUS_07650 69482 68865 gene locus_tag LOCUS_07660 69482 68865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 69794 69501 gene locus_tag LOCUS_07670 gene fdxB 69794 69501 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_07670 70000 69791 gene locus_tag LOCUS_07680 70000 69791 CDS product CCE_0567 family metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533479.1 protein_id gnl|my_center|LOCUS_07680 70471 70013 gene locus_tag LOCUS_07690 70471 70013 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_07690 70963 70475 gene locus_tag LOCUS_07700 gene nifX 70963 70475 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440142.1 protein_id gnl|my_center|LOCUS_07700 72335 70935 gene locus_tag LOCUS_07710 gene nifN 72335 70935 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533487.1 protein_id gnl|my_center|LOCUS_07710 73770 72343 gene locus_tag LOCUS_07720 gene nifE 73770 72343 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389941.1 protein_id gnl|my_center|LOCUS_07720 75370 73838 gene locus_tag LOCUS_07730 gene nifK 75370 73838 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338303.1 protein_id gnl|my_center|LOCUS_07730 76892 75396 gene locus_tag LOCUS_07740 gene nifD 76892 75396 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720704.1 protein_id gnl|my_center|LOCUS_07740 77826 76942 gene locus_tag LOCUS_07750 gene nifH 77826 76942 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533491.1 protein_id gnl|my_center|LOCUS_07750 78986 78138 gene locus_tag LOCUS_07760 78986 78138 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338304.1 protein_id gnl|my_center|LOCUS_07760 79191 78979 gene locus_tag LOCUS_07770 gene nifT 79191 78979 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084566.1 protein_id gnl|my_center|LOCUS_07770 79475 79188 gene locus_tag LOCUS_07780 79475 79188 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533513.1 protein_id gnl|my_center|LOCUS_07780 79691 79497 gene locus_tag LOCUS_07790 79691 79497 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084548.1 protein_id gnl|my_center|LOCUS_07790 81191 79740 gene locus_tag LOCUS_07800 gene nifB 81191 79740 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606395.1 protein_id gnl|my_center|LOCUS_07800 81535 83286 gene locus_tag LOCUS_07810 81535 83286 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857748.1 protein_id gnl|my_center|LOCUS_07810 84478 83444 gene locus_tag LOCUS_07820 gene hypE 84478 83444 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089665.1 protein_id gnl|my_center|LOCUS_07820 85244 84498 gene locus_tag LOCUS_07830 85244 84498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 86488 85328 gene locus_tag LOCUS_07840 gene hypD 86488 85328 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_07840 86736 86485 gene locus_tag LOCUS_07850 86736 86485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 87624 86740 gene locus_tag LOCUS_07860 gene hypB 87624 86740 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338275.1 protein_id gnl|my_center|LOCUS_07860 87965 87624 gene locus_tag LOCUS_07870 gene hypA 87965 87624 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_07870 88968 87958 gene locus_tag LOCUS_07880 88968 87958 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089671.1 protein_id gnl|my_center|LOCUS_07880 89426 88965 gene locus_tag LOCUS_07890 89426 88965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 89626 89423 gene locus_tag LOCUS_07900 89626 89423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 90513 89623 gene locus_tag LOCUS_07910 90513 89623 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089674.1 protein_id gnl|my_center|LOCUS_07910 90944 90510 gene locus_tag LOCUS_07920 90944 90510 CDS product hydrogenase expression/formation protein HupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089675.1 protein_id gnl|my_center|LOCUS_07920 91970 91062 gene locus_tag LOCUS_07930 91970 91062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 91926 92282 gene locus_tag LOCUS_07940 91926 92282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 92412 92672 gene locus_tag LOCUS_07950 92412 92672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 94447 92771 gene locus_tag LOCUS_07960 gene nifA 94447 92771 CDS product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084834.1 protein_id gnl|my_center|LOCUS_07960 94642 95517 gene locus_tag LOCUS_07970 94642 95517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 96070 95522 gene locus_tag LOCUS_07980 96070 95522 CDS product DUF2478 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387896.1 protein_id gnl|my_center|LOCUS_07980 97264 96116 gene locus_tag LOCUS_07990 gene nifV 97264 96116 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_07990 97765 97358 gene locus_tag LOCUS_08000 97765 97358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 98236 97793 gene locus_tag LOCUS_08010 98236 97793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 98354 99952 gene locus_tag LOCUS_08020 98354 99952 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_08020 100410 99985 gene locus_tag LOCUS_08030 100410 99985 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_08030 101586 100690 gene locus_tag LOCUS_08040 gene rpoH 101586 100690 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_08040 102847 101846 gene locus_tag LOCUS_08050 102847 101846 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388866.1 protein_id gnl|my_center|LOCUS_08050 102897 103172 gene locus_tag LOCUS_08060 102897 103172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 103889 103629 gene locus_tag LOCUS_08070 103889 103629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 104078 106087 gene locus_tag LOCUS_08080 gene hyfB 104078 106087 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_08080 106164 107123 gene locus_tag LOCUS_08090 106164 107123 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_08090 107123 107791 gene locus_tag LOCUS_08100 107123 107791 CDS product hydrogenase-4 component E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548289.1 protein_id gnl|my_center|LOCUS_08100 107788 109266 gene locus_tag LOCUS_08110 107788 109266 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089082.1 protein_id gnl|my_center|LOCUS_08110 109263 110765 gene locus_tag LOCUS_08120 109263 110765 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089083.1 protein_id gnl|my_center|LOCUS_08120 110765 111286 gene locus_tag LOCUS_08130 110765 111286 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_08130 113075 111306 gene locus_tag LOCUS_08140 gene mutL 113075 111306 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918581.1 protein_id gnl|my_center|LOCUS_08140 115010 113349 gene locus_tag LOCUS_08150 gene pgi 115010 113349 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_08150 115737 115183 gene locus_tag LOCUS_08160 115737 115183 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_08160 116275 115748 gene locus_tag LOCUS_08170 gene lspA 116275 115748 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174654.1 protein_id gnl|my_center|LOCUS_08170 119073 116272 gene locus_tag LOCUS_08180 gene ileS 119073 116272 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390714.1 protein_id gnl|my_center|LOCUS_08180 120107 119070 gene locus_tag LOCUS_08190 120107 119070 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_08190 120523 120107 gene locus_tag LOCUS_08200 120523 120107 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_08200 121674 120643 gene locus_tag LOCUS_08210 121674 120643 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966616.1 protein_id gnl|my_center|LOCUS_08210 121627 121866 gene locus_tag LOCUS_08220 121627 121866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 122115 122873 gene locus_tag LOCUS_08230 122115 122873 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533001.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence006 273 2114 gene locus_tag LOCUS_08240 gene htpG 273 2114 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061603.1 protein_id gnl|my_center|LOCUS_08240 2326 3636 gene locus_tag LOCUS_08250 2326 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 4379 3645 gene locus_tag LOCUS_08260 4379 3645 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_08260 7202 4503 gene locus_tag LOCUS_08270 7202 4503 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389549.1 protein_id gnl|my_center|LOCUS_08270 7818 7288 gene locus_tag LOCUS_08280 7818 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 9271 7856 gene locus_tag LOCUS_08290 9271 7856 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_08290 10137 9448 gene locus_tag LOCUS_08300 10137 9448 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971822.1 protein_id gnl|my_center|LOCUS_08300 10275 10348 gene locus_tag LOCUS_t00140 10275 10348 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10630 10445 gene locus_tag LOCUS_08310 10630 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 12429 10855 gene locus_tag LOCUS_08320 12429 10855 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065470.1 protein_id gnl|my_center|LOCUS_08320 14014 12632 gene locus_tag LOCUS_08330 14014 12632 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918239.1 protein_id gnl|my_center|LOCUS_08330 14279 15103 gene locus_tag LOCUS_08340 14279 15103 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_08340 15637 15122 gene locus_tag LOCUS_08350 15637 15122 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_08350 16562 15660 gene locus_tag LOCUS_08360 16562 15660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 16757 17662 gene locus_tag LOCUS_08370 16757 17662 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_08370 17666 19702 gene locus_tag LOCUS_08380 gene glyS 17666 19702 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390705.1 protein_id gnl|my_center|LOCUS_08380 19722 22391 gene locus_tag LOCUS_08390 gene ppdK 19722 22391 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_08390 22440 22814 gene locus_tag LOCUS_08400 22440 22814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 22917 24119 gene locus_tag LOCUS_08410 22917 24119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083825.1 protein_id gnl|my_center|LOCUS_08410 24381 24130 gene locus_tag LOCUS_08420 24381 24130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 24869 24417 gene locus_tag LOCUS_08430 24869 24417 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 protein_id gnl|my_center|LOCUS_08430 25009 25599 gene locus_tag LOCUS_08440 gene def 25009 25599 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391097.1 protein_id gnl|my_center|LOCUS_08440 25612 26517 gene locus_tag LOCUS_08450 gene fmt 25612 26517 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_08450 26514 27362 gene locus_tag LOCUS_08460 gene truA 26514 27362 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 protein_id gnl|my_center|LOCUS_08460 27698 27414 gene locus_tag LOCUS_08470 27698 27414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 30623 27714 gene locus_tag LOCUS_08480 30623 27714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 31044 31472 gene locus_tag LOCUS_08490 31044 31472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 32325 31756 gene locus_tag LOCUS_08500 32325 31756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 32909 32322 gene locus_tag LOCUS_08510 32909 32322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 34027 32906 gene locus_tag LOCUS_08520 gene dapE 34027 32906 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918164.1 protein_id gnl|my_center|LOCUS_08520 34863 34024 gene locus_tag LOCUS_08530 gene dapD 34863 34024 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_08530 35123 36256 gene locus_tag LOCUS_08540 35123 36256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 36406 37842 gene locus_tag LOCUS_08550 36406 37842 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 protein_id gnl|my_center|LOCUS_08550 37839 39095 gene locus_tag LOCUS_08560 37839 39095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 40037 39129 gene locus_tag LOCUS_08570 gene argB 40037 39129 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528489.1 protein_id gnl|my_center|LOCUS_08570 40876 40151 gene locus_tag LOCUS_08580 gene yihA 40876 40151 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391087.1 protein_id gnl|my_center|LOCUS_08580 42644 40887 gene locus_tag LOCUS_08590 gene yidC 42644 40887 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_08590 42982 42644 gene locus_tag LOCUS_08600 42982 42644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 43323 42979 gene locus_tag LOCUS_08610 43323 42979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 43470 43336 gene locus_tag LOCUS_08620 gene rpmH 43470 43336 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391083.1 protein_id gnl|my_center|LOCUS_08620 43641 44339 gene locus_tag LOCUS_08630 43641 44339 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918417.1 protein_id gnl|my_center|LOCUS_08630 44332 45759 gene locus_tag LOCUS_08640 44332 45759 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_08640 46163 45960 gene locus_tag LOCUS_08650 46163 45960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 46050 46481 gene locus_tag LOCUS_08660 46050 46481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 46535 46897 gene locus_tag LOCUS_08670 46535 46897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 47125 47502 gene locus_tag LOCUS_08680 47125 47502 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532062.1 protein_id gnl|my_center|LOCUS_08680 47809 48186 gene locus_tag LOCUS_08690 47809 48186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 48540 48917 gene locus_tag LOCUS_08700 48540 48917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 49586 48975 gene locus_tag LOCUS_08710 49586 48975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 50177 49632 gene locus_tag LOCUS_08720 50177 49632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 51790 50276 gene locus_tag LOCUS_08730 51790 50276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 52092 53312 gene locus_tag LOCUS_08740 52092 53312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 53798 55033 gene locus_tag LOCUS_08750 gene spbR 53798 55033 CDS product pole-localized protein SpbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920182.1 protein_id gnl|my_center|LOCUS_08750 55300 54977 gene locus_tag LOCUS_08760 55300 54977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 56263 55307 gene locus_tag LOCUS_08770 56263 55307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08770 57856 56276 gene locus_tag LOCUS_08780 57856 56276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08780 57983 58294 gene locus_tag LOCUS_08790 57983 58294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967281.1 protein_id gnl|my_center|LOCUS_08790 58297 58746 gene locus_tag LOCUS_08800 58297 58746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 58855 59832 gene locus_tag LOCUS_08810 58855 59832 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_08810 60696 59833 gene locus_tag LOCUS_08820 60696 59833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 61068 61406 gene locus_tag LOCUS_08830 61068 61406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975314.1 protein_id gnl|my_center|LOCUS_08830 62685 61462 gene locus_tag LOCUS_08840 gene lpxB 62685 61462 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 protein_id gnl|my_center|LOCUS_08840 63023 62829 gene locus_tag LOCUS_08850 63023 62829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 63786 64289 gene locus_tag LOCUS_08860 63786 64289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 65806 64379 gene locus_tag LOCUS_08870 gene glnA 65806 64379 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389839.1 protein_id gnl|my_center|LOCUS_08870 66301 65963 gene locus_tag LOCUS_08880 66301 65963 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_08880 66694 67893 gene locus_tag LOCUS_08890 66694 67893 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150041682.1 protein_id gnl|my_center|LOCUS_08890 67915 67990 gene locus_tag LOCUS_t00150 67915 67990 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 68101 68922 gene locus_tag LOCUS_08900 68101 68922 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966449.1 protein_id gnl|my_center|LOCUS_08900 69203 70012 gene locus_tag LOCUS_08910 69203 70012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 70181 71782 gene locus_tag LOCUS_08920 70181 71782 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388557.1 protein_id gnl|my_center|LOCUS_08920 71796 72527 gene locus_tag LOCUS_08930 gene otsB 71796 72527 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533988.1 protein_id gnl|my_center|LOCUS_08930 72919 73776 gene locus_tag LOCUS_08940 72919 73776 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085546.1 protein_id gnl|my_center|LOCUS_08940 73910 74821 gene locus_tag LOCUS_08950 73910 74821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 74908 76611 gene locus_tag LOCUS_08960 74908 76611 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_08960 76608 79397 gene locus_tag LOCUS_08970 gene fdhF 76608 79397 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_08970 79594 80910 gene locus_tag LOCUS_08980 79594 80910 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434811.1 protein_id gnl|my_center|LOCUS_08980 80939 81706 gene locus_tag LOCUS_08990 80939 81706 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396345.1 protein_id gnl|my_center|LOCUS_08990 81743 83323 gene locus_tag LOCUS_09000 81743 83323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 84019 83336 gene locus_tag LOCUS_09010 84019 83336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 85456 84047 gene locus_tag LOCUS_09020 85456 84047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 85817 86206 gene locus_tag LOCUS_09030 85817 86206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 88377 86218 gene locus_tag LOCUS_09040 88377 86218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 94243 88490 gene locus_tag LOCUS_09050 94243 88490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence007 71 322 gene locus_tag LOCUS_09060 71 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 981 3635 gene locus_tag LOCUS_09070 981 3635 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_09070 6514 3734 gene locus_tag LOCUS_09080 6514 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 6686 7432 gene locus_tag LOCUS_09090 6686 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8761 7529 gene locus_tag LOCUS_09100 8761 7529 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128930908.1 protein_id gnl|my_center|LOCUS_09100 9901 9017 gene locus_tag LOCUS_09110 9901 9017 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_09110 10186 12846 gene locus_tag LOCUS_09120 10186 12846 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494176.1 protein_id gnl|my_center|LOCUS_09120 12846 16253 gene locus_tag LOCUS_09130 12846 16253 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090811.1 protein_id gnl|my_center|LOCUS_09130 16276 17460 gene locus_tag LOCUS_09140 16276 17460 CDS product DUF6361 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804170.1 protein_id gnl|my_center|LOCUS_09140 17450 19306 gene locus_tag LOCUS_09150 17450 19306 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804171.1 protein_id gnl|my_center|LOCUS_09150 19296 22424 gene locus_tag LOCUS_09160 19296 22424 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804172.1 protein_id gnl|my_center|LOCUS_09160 23890 22478 gene locus_tag LOCUS_09170 23890 22478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 23852 24016 gene locus_tag LOCUS_09180 23852 24016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 24167 24316 gene locus_tag LOCUS_09190 24167 24316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 24759 25664 gene locus_tag LOCUS_09200 24759 25664 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368621.1 protein_id gnl|my_center|LOCUS_09200 25664 26077 gene locus_tag LOCUS_09210 25664 26077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 26154 28244 gene locus_tag LOCUS_09220 26154 28244 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197967736.1 protein_id gnl|my_center|LOCUS_09220 29923 28469 gene locus_tag LOCUS_09230 29923 28469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 31649 29916 gene locus_tag LOCUS_09240 31649 29916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 31886 36232 gene locus_tag LOCUS_09250 31886 36232 CDS product strawberry notch family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145832032.1 protein_id gnl|my_center|LOCUS_09250 36235 37275 gene locus_tag LOCUS_09260 36235 37275 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091007.1 protein_id gnl|my_center|LOCUS_09260 37574 38545 gene locus_tag LOCUS_09270 37574 38545 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 protein_id gnl|my_center|LOCUS_09270 38814 38581 gene locus_tag LOCUS_09280 38814 38581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 38770 39180 gene locus_tag LOCUS_09290 38770 39180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 39256 39756 gene locus_tag LOCUS_09300 39256 39756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 41296 39938 gene locus_tag LOCUS_09310 41296 39938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 41725 41898 gene locus_tag LOCUS_09320 41725 41898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 42043 42504 gene locus_tag LOCUS_09330 42043 42504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368632.1 protein_id gnl|my_center|LOCUS_09330 43111 43434 gene locus_tag LOCUS_09340 43111 43434 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084751.1 protein_id gnl|my_center|LOCUS_09340 43751 43494 gene locus_tag LOCUS_09350 43751 43494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 43903 44172 gene locus_tag LOCUS_09360 43903 44172 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084140443.1 protein_id gnl|my_center|LOCUS_09360 44368 44574 gene locus_tag LOCUS_09370 44368 44574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 44690 45124 gene locus_tag LOCUS_09380 44690 45124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 45277 45561 gene locus_tag LOCUS_09390 45277 45561 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 protein_id gnl|my_center|LOCUS_09390 45582 46712 gene locus_tag LOCUS_09400 45582 46712 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490269.1 protein_id gnl|my_center|LOCUS_09400 46709 47347 gene locus_tag LOCUS_09410 gene parA 46709 47347 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_09410 47344 47598 gene locus_tag LOCUS_09420 47344 47598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082881.1 protein_id gnl|my_center|LOCUS_09420 47595 48116 gene locus_tag LOCUS_09430 47595 48116 CDS product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 protein_id gnl|my_center|LOCUS_09430 48113 48658 gene locus_tag LOCUS_09440 48113 48658 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082879.1 protein_id gnl|my_center|LOCUS_09440 48694 49032 gene locus_tag LOCUS_09450 48694 49032 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082878.1 protein_id gnl|my_center|LOCUS_09450 49036 49836 gene locus_tag LOCUS_09460 49036 49836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 50084 51844 gene locus_tag LOCUS_09470 50084 51844 CDS product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626034.1 protein_id gnl|my_center|LOCUS_09470 52599 51916 gene locus_tag LOCUS_09480 52599 51916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 52958 54946 gene locus_tag LOCUS_09490 52958 54946 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645922.1 protein_id gnl|my_center|LOCUS_09490 54957 55403 gene locus_tag LOCUS_09500 54957 55403 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 protein_id gnl|my_center|LOCUS_09500 55623 56543 gene locus_tag LOCUS_09510 gene trbB 55623 56543 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 protein_id gnl|my_center|LOCUS_09510 56540 56869 gene locus_tag LOCUS_09520 56540 56869 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 protein_id gnl|my_center|LOCUS_09520 56869 57147 gene locus_tag LOCUS_09530 56869 57147 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312513.1 protein_id gnl|my_center|LOCUS_09530 57172 59613 gene locus_tag LOCUS_09540 gene trbE 57172 59613 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 protein_id gnl|my_center|LOCUS_09540 59610 60350 gene locus_tag LOCUS_09550 gene trbJ 59610 60350 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 protein_id gnl|my_center|LOCUS_09550 60350 60727 gene locus_tag LOCUS_09560 60350 60727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 60729 62024 gene locus_tag LOCUS_09570 gene trbL 60729 62024 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041957456.1 protein_id gnl|my_center|LOCUS_09570 62045 62710 gene locus_tag LOCUS_09580 gene trbF 62045 62710 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084433.1 protein_id gnl|my_center|LOCUS_09580 62707 63729 gene locus_tag LOCUS_09590 gene trbG 62707 63729 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_09590 63726 64931 gene locus_tag LOCUS_09600 63726 64931 CDS product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090987.1 protein_id gnl|my_center|LOCUS_09600 64943 65218 gene locus_tag LOCUS_09610 64943 65218 CDS product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090986.1 protein_id gnl|my_center|LOCUS_09610 66074 65154 gene locus_tag LOCUS_09620 66074 65154 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 protein_id gnl|my_center|LOCUS_09620 66974 66198 gene locus_tag LOCUS_09630 66974 66198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 68367 67072 gene locus_tag LOCUS_09640 68367 67072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 70369 68387 gene locus_tag LOCUS_09650 70369 68387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 75182 70353 gene locus_tag LOCUS_09660 75182 70353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 77990 75192 gene locus_tag LOCUS_09670 77990 75192 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_09670 83212 77987 gene locus_tag LOCUS_09680 83212 77987 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 protein_id gnl|my_center|LOCUS_09680 83610 83416 gene locus_tag LOCUS_09690 83610 83416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 83906 84214 gene locus_tag LOCUS_09700 83906 84214 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530375.1 protein_id gnl|my_center|LOCUS_09700 85424 84168 gene locus_tag LOCUS_09710 85424 84168 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530374.1 protein_id gnl|my_center|LOCUS_09710 87303 85720 gene locus_tag LOCUS_09720 gene guaA 87303 85720 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388108.1 protein_id gnl|my_center|LOCUS_09720 87990 87418 gene locus_tag LOCUS_09730 87990 87418 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067716.1 protein_id gnl|my_center|LOCUS_09730 89282 87987 gene locus_tag LOCUS_09740 89282 87987 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_09740 90834 89317 gene locus_tag LOCUS_09750 gene guaB 90834 89317 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387997.1 protein_id gnl|my_center|LOCUS_09750 93428 91083 gene locus_tag LOCUS_09760 93428 91083 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965637.1 protein_id gnl|my_center|LOCUS_09760 94473 93478 gene locus_tag LOCUS_09770 94473 93478 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930890.1 protein_id gnl|my_center|LOCUS_09770 94692 94943 gene locus_tag LOCUS_09780 94692 94943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 95035 94850 gene locus_tag LOCUS_09790 95035 94850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 95047 95550 gene locus_tag LOCUS_09800 95047 95550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence008 449 210 gene locus_tag LOCUS_09810 449 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 609 1226 gene locus_tag LOCUS_09820 gene rpsD 609 1226 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388459.1 protein_id gnl|my_center|LOCUS_09820 3437 1794 gene locus_tag LOCUS_09830 gene pgm 3437 1794 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_09830 3586 3660 gene locus_tag LOCUS_t00160 3586 3660 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3743 4399 gene locus_tag LOCUS_09840 3743 4399 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338751.1 protein_id gnl|my_center|LOCUS_09840 4613 5617 gene locus_tag LOCUS_09850 4613 5617 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625856.1 protein_id gnl|my_center|LOCUS_09850 5614 6276 gene locus_tag LOCUS_09860 gene lptC 5614 6276 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387774.1 protein_id gnl|my_center|LOCUS_09860 6273 7214 gene locus_tag LOCUS_09870 6273 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 protein_id gnl|my_center|LOCUS_09870 7211 7981 gene locus_tag LOCUS_09880 gene lptB 7211 7981 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_09880 8137 9624 gene locus_tag LOCUS_09890 gene rpoN 8137 9624 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387771.1 protein_id gnl|my_center|LOCUS_09890 9743 10303 gene locus_tag LOCUS_09900 gene raiA 9743 10303 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527725.1 protein_id gnl|my_center|LOCUS_09900 10463 11443 gene locus_tag LOCUS_09910 10463 11443 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204261.1 protein_id gnl|my_center|LOCUS_09910 13202 11496 gene locus_tag LOCUS_09920 13202 11496 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_09920 13395 15221 gene locus_tag LOCUS_09930 13395 15221 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_09930 15269 16585 gene locus_tag LOCUS_09940 15269 16585 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_09940 16720 17406 gene locus_tag LOCUS_09950 16720 17406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 17828 18967 gene locus_tag LOCUS_09960 17828 18967 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965507.1 protein_id gnl|my_center|LOCUS_09960 18987 19373 gene locus_tag LOCUS_09970 18987 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 19384 20787 gene locus_tag LOCUS_09980 19384 20787 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390030.1 protein_id gnl|my_center|LOCUS_09980 21293 20865 gene locus_tag LOCUS_09990 21293 20865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 21693 21448 gene locus_tag LOCUS_10000 21693 21448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 23089 21812 gene locus_tag LOCUS_10010 23089 21812 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_10010 23940 23302 gene locus_tag LOCUS_10020 23940 23302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 25024 24476 gene locus_tag LOCUS_10030 25024 24476 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706837.1 protein_id gnl|my_center|LOCUS_10030 26072 25116 gene locus_tag LOCUS_10040 gene mbfA 26072 25116 CDS product iron exporter MbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090619.1 protein_id gnl|my_center|LOCUS_10040 26491 26285 gene locus_tag LOCUS_10050 26491 26285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 26820 27155 gene locus_tag LOCUS_10060 26820 27155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 27419 27213 gene locus_tag LOCUS_10070 27419 27213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 27576 28220 gene locus_tag LOCUS_10080 27576 28220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 28907 28467 gene locus_tag LOCUS_10090 28907 28467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 30210 28918 gene locus_tag LOCUS_10100 30210 28918 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_10100 30970 30203 gene locus_tag LOCUS_10110 30970 30203 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_10110 31800 30973 gene locus_tag LOCUS_10120 31800 30973 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_10120 32264 31797 gene locus_tag LOCUS_10130 32264 31797 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_10130 33408 32251 gene locus_tag LOCUS_10140 33408 32251 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_10140 33595 34065 gene locus_tag LOCUS_10150 33595 34065 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902978.1 protein_id gnl|my_center|LOCUS_10150 34136 34663 gene locus_tag LOCUS_10160 34136 34663 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_10160 34696 35169 gene locus_tag LOCUS_10170 34696 35169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 36784 35294 gene locus_tag LOCUS_10180 36784 35294 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337936.1 protein_id gnl|my_center|LOCUS_10180 37729 36974 gene locus_tag LOCUS_10190 37729 36974 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173829.1 protein_id gnl|my_center|LOCUS_10190 39069 38092 gene locus_tag LOCUS_10200 39069 38092 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_10200 39212 39409 gene locus_tag LOCUS_10210 39212 39409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 39551 39375 gene locus_tag LOCUS_10220 39551 39375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 39523 42225 gene locus_tag LOCUS_10230 gene polA 39523 42225 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537863.1 protein_id gnl|my_center|LOCUS_10230 42761 42282 gene locus_tag LOCUS_10240 42761 42282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 42874 43545 gene locus_tag LOCUS_10250 42874 43545 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_10250 43873 44343 gene locus_tag LOCUS_10260 43873 44343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 44448 44924 gene locus_tag LOCUS_10270 44448 44924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 44921 45355 gene locus_tag LOCUS_10280 44921 45355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 45365 45808 gene locus_tag LOCUS_10290 45365 45808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 45828 46232 gene locus_tag LOCUS_10300 45828 46232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 46911 46552 gene locus_tag LOCUS_10310 46911 46552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 47441 47295 gene locus_tag LOCUS_10320 47441 47295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 48029 47619 gene locus_tag LOCUS_10330 48029 47619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 48594 48971 gene locus_tag LOCUS_10340 48594 48971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 49040 49507 gene locus_tag LOCUS_10350 49040 49507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 50251 49580 gene locus_tag LOCUS_10360 50251 49580 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391167.1 protein_id gnl|my_center|LOCUS_10360 50410 51111 gene locus_tag LOCUS_10370 50410 51111 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_10370 51117 52805 gene locus_tag LOCUS_10380 51117 52805 CDS product stimulus-sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_10380 52802 53923 gene locus_tag LOCUS_10390 52802 53923 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398410.1 protein_id gnl|my_center|LOCUS_10390 54037 54303 gene locus_tag LOCUS_10400 54037 54303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 54365 54715 gene locus_tag LOCUS_10410 54365 54715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 55576 54719 gene locus_tag LOCUS_10420 gene hpnK 55576 54719 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552372.1 protein_id gnl|my_center|LOCUS_10420 57065 55593 gene locus_tag LOCUS_10430 gene hpnJ 57065 55593 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_10430 58270 57065 gene locus_tag LOCUS_10440 gene hpnI 58270 57065 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197829.1 protein_id gnl|my_center|LOCUS_10440 58892 58275 gene locus_tag LOCUS_10450 58892 58275 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921520.1 protein_id gnl|my_center|LOCUS_10450 59764 59141 gene locus_tag LOCUS_10460 59764 59141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 59882 61021 gene locus_tag LOCUS_10470 gene hpnH 59882 61021 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187762.1 protein_id gnl|my_center|LOCUS_10470 61636 61022 gene locus_tag LOCUS_10480 61636 61022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 61875 61633 gene locus_tag LOCUS_10490 61875 61633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 62194 61940 gene locus_tag LOCUS_10500 62194 61940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 64268 62322 gene locus_tag LOCUS_10510 gene shc 64268 62322 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529547.1 protein_id gnl|my_center|LOCUS_10510 65583 64291 gene locus_tag LOCUS_10520 gene hpnE 65583 64291 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_10520 66479 65625 gene locus_tag LOCUS_10530 66479 65625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 67315 66476 gene locus_tag LOCUS_10540 gene hpnC 67315 66476 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 protein_id gnl|my_center|LOCUS_10540 68427 67312 gene locus_tag LOCUS_10550 68427 67312 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484591.1 protein_id gnl|my_center|LOCUS_10550 69446 68424 gene locus_tag LOCUS_10560 69446 68424 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198871.1 protein_id gnl|my_center|LOCUS_10560 70291 69464 gene locus_tag LOCUS_10570 70291 69464 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463551.1 protein_id gnl|my_center|LOCUS_10570 70407 70661 gene locus_tag LOCUS_10580 70407 70661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 70851 71300 gene locus_tag LOCUS_10590 70851 71300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 71297 72319 gene locus_tag LOCUS_10600 gene rapZ 71297 72319 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470669.1 protein_id gnl|my_center|LOCUS_10600 72329 72859 gene locus_tag LOCUS_10610 72329 72859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 72856 73161 gene locus_tag LOCUS_10620 72856 73161 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 protein_id gnl|my_center|LOCUS_10620 73166 75022 gene locus_tag LOCUS_10630 gene ptsP 73166 75022 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391192.1 protein_id gnl|my_center|LOCUS_10630 76559 75099 gene locus_tag LOCUS_10640 76559 75099 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086748.1 protein_id gnl|my_center|LOCUS_10640 77545 76574 gene locus_tag LOCUS_10650 77545 76574 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_10650 78095 77586 gene locus_tag LOCUS_10660 78095 77586 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391368.1 protein_id gnl|my_center|LOCUS_10660 78330 78674 gene locus_tag LOCUS_10670 78330 78674 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_10670 78694 80007 gene locus_tag LOCUS_10680 gene mnmE 78694 80007 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391371.1 protein_id gnl|my_center|LOCUS_10680 80174 82042 gene locus_tag LOCUS_10690 gene mnmG 80174 82042 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391372.1 protein_id gnl|my_center|LOCUS_10690 82030 82653 gene locus_tag LOCUS_10700 gene rsmG 82030 82653 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391373.1 protein_id gnl|my_center|LOCUS_10700 82976 83530 gene locus_tag LOCUS_10710 82976 83530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 83527 84378 gene locus_tag LOCUS_10720 83527 84378 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_10720 85470 84457 gene locus_tag LOCUS_10730 gene holA 85470 84457 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083456.1 protein_id gnl|my_center|LOCUS_10730 86014 85484 gene locus_tag LOCUS_10740 86014 85484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 88656 86014 gene locus_tag LOCUS_10750 gene leuS 88656 86014 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391378.1 protein_id gnl|my_center|LOCUS_10750 89336 88803 gene locus_tag LOCUS_10760 89336 88803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 91142 89523 gene locus_tag LOCUS_10770 91142 89523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence009 649 62 gene locus_tag LOCUS_10780 649 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1004 2116 gene locus_tag LOCUS_10790 gene ydiK 1004 2116 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 protein_id gnl|my_center|LOCUS_10790 2911 2201 gene locus_tag LOCUS_10800 2911 2201 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_10800 3506 4303 gene locus_tag LOCUS_10810 3506 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4321 5325 gene locus_tag LOCUS_10820 4321 5325 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_10820 5325 5651 gene locus_tag LOCUS_10830 5325 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6362 5754 gene locus_tag LOCUS_10840 gene rdgB 6362 5754 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 protein_id gnl|my_center|LOCUS_10840 7081 6362 gene locus_tag LOCUS_10850 gene rph 7081 6362 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391388.1 protein_id gnl|my_center|LOCUS_10850 7271 8398 gene locus_tag LOCUS_10860 gene hrcA 7271 8398 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391389.1 protein_id gnl|my_center|LOCUS_10860 8508 9713 gene locus_tag LOCUS_10870 8508 9713 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391241.1 protein_id gnl|my_center|LOCUS_10870 9710 12538 gene locus_tag LOCUS_10880 9710 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 12615 13223 gene locus_tag LOCUS_10890 gene grpE 12615 13223 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974227.1 protein_id gnl|my_center|LOCUS_10890 13369 15318 gene locus_tag LOCUS_10900 gene dnaK 13369 15318 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391302.1 protein_id gnl|my_center|LOCUS_10900 15329 15520 gene locus_tag LOCUS_10910 15329 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 15522 16652 gene locus_tag LOCUS_10920 gene dnaJ 15522 16652 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626618.1 protein_id gnl|my_center|LOCUS_10920 16989 17450 gene locus_tag LOCUS_10930 16989 17450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 17491 19962 gene locus_tag LOCUS_10940 17491 19962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 20158 20009 gene locus_tag LOCUS_10950 gene ccoS 20158 20009 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720871.1 protein_id gnl|my_center|LOCUS_10950 22515 20155 gene locus_tag LOCUS_10960 22515 20155 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_10960 23047 22487 gene locus_tag LOCUS_10970 23047 22487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 24545 23070 gene locus_tag LOCUS_10980 gene ccoG 24545 23070 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 protein_id gnl|my_center|LOCUS_10980 25473 24586 gene locus_tag LOCUS_10990 gene ccoP 25473 24586 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085551.1 protein_id gnl|my_center|LOCUS_10990 25639 25487 gene locus_tag LOCUS_11000 25639 25487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 26367 25651 gene locus_tag LOCUS_11010 gene ccoO 26367 25651 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970734.1 protein_id gnl|my_center|LOCUS_11010 27849 26374 gene locus_tag LOCUS_11020 gene ccoN 27849 26374 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391079.1 protein_id gnl|my_center|LOCUS_11020 28057 27836 gene locus_tag LOCUS_11030 28057 27836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 28234 29043 gene locus_tag LOCUS_11040 28234 29043 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391108.1 protein_id gnl|my_center|LOCUS_11040 29600 29184 gene locus_tag LOCUS_11050 gene dksA 29600 29184 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390474.1 protein_id gnl|my_center|LOCUS_11050 30075 29746 gene locus_tag LOCUS_11060 30075 29746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 30008 31486 gene locus_tag LOCUS_11070 30008 31486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 31486 31776 gene locus_tag LOCUS_11080 31486 31776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 31773 32186 gene locus_tag LOCUS_11090 31773 32186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 32307 33263 gene locus_tag LOCUS_11100 32307 33263 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168117700.1 protein_id gnl|my_center|LOCUS_11100 33974 33384 gene locus_tag LOCUS_11110 33974 33384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 35595 34441 gene locus_tag LOCUS_11120 gene prpC 35595 34441 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065153.1 protein_id gnl|my_center|LOCUS_11120 37168 35645 gene locus_tag LOCUS_11130 37168 35645 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390071.1 protein_id gnl|my_center|LOCUS_11130 37425 37604 gene locus_tag LOCUS_11140 37425 37604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 37638 37961 gene locus_tag LOCUS_11150 37638 37961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 37958 38467 gene locus_tag LOCUS_11160 37958 38467 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084075.1 protein_id gnl|my_center|LOCUS_11160 38481 39593 gene locus_tag LOCUS_11170 gene mtnA 38481 39593 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_11170 40616 39606 gene locus_tag LOCUS_11180 40616 39606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 43333 40622 gene locus_tag LOCUS_11190 43333 40622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 43594 44256 gene locus_tag LOCUS_11200 43594 44256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 44751 44440 gene locus_tag LOCUS_11210 44751 44440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 45716 44748 gene locus_tag LOCUS_11220 gene msrP 45716 44748 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196774.1 protein_id gnl|my_center|LOCUS_11220 46480 45851 gene locus_tag LOCUS_11230 46480 45851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 48203 46641 gene locus_tag LOCUS_11240 48203 46641 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338253.1 protein_id gnl|my_center|LOCUS_11240 48221 48754 gene locus_tag LOCUS_11250 48221 48754 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815273.1 protein_id gnl|my_center|LOCUS_11250 48890 49600 gene locus_tag LOCUS_11260 48890 49600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 51151 49829 gene locus_tag LOCUS_11270 51151 49829 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388884.1 protein_id gnl|my_center|LOCUS_11270 52977 51922 gene locus_tag LOCUS_11280 52977 51922 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169951.1 protein_id gnl|my_center|LOCUS_11280 53069 53368 gene locus_tag LOCUS_11290 53069 53368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 53365 53733 gene locus_tag LOCUS_11300 53365 53733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11300 53921 54799 gene locus_tag LOCUS_11310 53921 54799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 55288 54812 gene locus_tag LOCUS_11320 55288 54812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 55409 56035 gene locus_tag LOCUS_11330 55409 56035 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_11330 56032 56871 gene locus_tag LOCUS_11340 gene sseA 56032 56871 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_11340 56877 58067 gene locus_tag LOCUS_11350 gene metC 56877 58067 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_11350 58678 58205 gene locus_tag LOCUS_11360 58678 58205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 61401 58804 gene locus_tag LOCUS_11370 61401 58804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 61896 61510 gene locus_tag LOCUS_11380 61896 61510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 62490 62134 gene locus_tag LOCUS_11390 62490 62134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 63197 62589 gene locus_tag LOCUS_11400 63197 62589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 64521 63208 gene locus_tag LOCUS_11410 gene glcF 64521 63208 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971053.1 protein_id gnl|my_center|LOCUS_11410 64810 64529 gene locus_tag LOCUS_11420 64810 64529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 66029 64815 gene locus_tag LOCUS_11430 gene glcE 66029 64815 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968809.1 protein_id gnl|my_center|LOCUS_11430 67456 66026 gene locus_tag LOCUS_11440 67456 66026 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401220.1 protein_id gnl|my_center|LOCUS_11440 67616 68551 gene locus_tag LOCUS_11450 67616 68551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 69701 68817 gene locus_tag LOCUS_11460 69701 68817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 70825 69935 gene locus_tag LOCUS_11470 70825 69935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 73335 70801 gene locus_tag LOCUS_11480 73335 70801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 74218 73346 gene locus_tag LOCUS_11490 74218 73346 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_11490 74261 74425 gene locus_tag LOCUS_11500 74261 74425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 74437 75729 gene locus_tag LOCUS_11510 74437 75729 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388993.1 protein_id gnl|my_center|LOCUS_11510 75754 76446 gene locus_tag LOCUS_11520 75754 76446 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388992.1 protein_id gnl|my_center|LOCUS_11520 76613 77017 gene locus_tag LOCUS_11530 gene rsfS 76613 77017 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529073.1 protein_id gnl|my_center|LOCUS_11530 76959 77474 gene locus_tag LOCUS_11540 gene rlmH 76959 77474 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972558.1 protein_id gnl|my_center|LOCUS_11540 78110 79165 gene locus_tag LOCUS_11550 78110 79165 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729558.1 protein_id gnl|my_center|LOCUS_11550 79174 80775 gene locus_tag LOCUS_11560 79174 80775 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_11560 81178 80837 gene locus_tag LOCUS_11570 81178 80837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 82818 81175 gene locus_tag LOCUS_11580 82818 81175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 84044 83700 gene locus_tag LOCUS_11590 84044 83700 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088450.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11590 84348 85256 gene locus_tag LOCUS_11600 84348 85256 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_11600 85348 85965 gene locus_tag LOCUS_11610 gene gmk 85348 85965 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240892.1 protein_id gnl|my_center|LOCUS_11610 85962 86843 gene locus_tag LOCUS_11620 85962 86843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 86840 87760 gene locus_tag LOCUS_11630 86840 87760 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 protein_id gnl|my_center|LOCUS_11630 89347 87857 gene locus_tag LOCUS_11640 89347 87857 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140137.1 protein_id gnl|my_center|LOCUS_11640 90537 89362 gene locus_tag LOCUS_11650 90537 89362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence010 1774 302 gene locus_tag LOCUS_11660 1774 302 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088262.1 protein_id gnl|my_center|LOCUS_11660 3533 1794 gene locus_tag LOCUS_11670 3533 1794 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720843.1 protein_id gnl|my_center|LOCUS_11670 4132 3572 gene locus_tag LOCUS_11680 4132 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 4213 4875 gene locus_tag LOCUS_11690 4213 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4944 5783 gene locus_tag LOCUS_11700 4944 5783 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339275.1 protein_id gnl|my_center|LOCUS_11700 5791 6603 gene locus_tag LOCUS_11710 5791 6603 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919103.1 protein_id gnl|my_center|LOCUS_11710 7483 6695 gene locus_tag LOCUS_11720 7483 6695 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_11720 7653 9032 gene locus_tag LOCUS_11730 gene fliI 7653 9032 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_11730 9029 9457 gene locus_tag LOCUS_11740 9029 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 9911 10819 gene locus_tag LOCUS_11750 9911 10819 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942175.1 protein_id gnl|my_center|LOCUS_11750 10840 13953 gene locus_tag LOCUS_11760 10840 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 16729 13979 gene locus_tag LOCUS_11770 16729 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 17837 16779 gene locus_tag LOCUS_11780 17837 16779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 19200 17812 gene locus_tag LOCUS_11790 19200 17812 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_11790 19778 19287 gene locus_tag LOCUS_11800 19778 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 20591 19935 gene locus_tag LOCUS_11810 20591 19935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 21458 20613 gene locus_tag LOCUS_11820 gene proC 21458 20613 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391029.1 protein_id gnl|my_center|LOCUS_11820 22028 21525 gene locus_tag LOCUS_11830 22028 21525 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_11830 22564 22247 gene locus_tag LOCUS_11840 22564 22247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 22637 23611 gene locus_tag LOCUS_11850 gene rfaD 22637 23611 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088669.1 protein_id gnl|my_center|LOCUS_11850 23619 24431 gene locus_tag LOCUS_11860 gene lgt 23619 24431 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_11860 24452 25399 gene locus_tag LOCUS_11870 24452 25399 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388400.1 protein_id gnl|my_center|LOCUS_11870 25428 26339 gene locus_tag LOCUS_11880 gene pgeF 25428 26339 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383754.1 protein_id gnl|my_center|LOCUS_11880 26405 27826 gene locus_tag LOCUS_11890 26405 27826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 27726 28415 gene locus_tag LOCUS_11900 27726 28415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 28522 29109 gene locus_tag LOCUS_11910 28522 29109 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085416.1 protein_id gnl|my_center|LOCUS_11910 31699 29060 gene locus_tag LOCUS_11920 31699 29060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 31825 32541 gene locus_tag LOCUS_11930 31825 32541 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391493.1 protein_id gnl|my_center|LOCUS_11930 32572 33150 gene locus_tag LOCUS_11940 gene pth 32572 33150 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090174.1 protein_id gnl|my_center|LOCUS_11940 33151 34245 gene locus_tag LOCUS_11950 gene ychF 33151 34245 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391495.1 protein_id gnl|my_center|LOCUS_11950 34266 35573 gene locus_tag LOCUS_11960 34266 35573 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_11960 35850 37166 gene locus_tag LOCUS_11970 35850 37166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 38557 37394 gene locus_tag LOCUS_11980 38557 37394 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181060039.1 protein_id gnl|my_center|LOCUS_11980 39474 38761 gene locus_tag LOCUS_11990 39474 38761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470636.1 protein_id gnl|my_center|LOCUS_11990 39473 40120 gene locus_tag LOCUS_12000 39473 40120 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_12000 40145 40678 gene locus_tag LOCUS_12010 gene thpR 40145 40678 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391396.1 protein_id gnl|my_center|LOCUS_12010 40698 41390 gene locus_tag LOCUS_12020 gene cobB 40698 41390 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 protein_id gnl|my_center|LOCUS_12020 41387 41968 gene locus_tag LOCUS_12030 41387 41968 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391391.1 protein_id gnl|my_center|LOCUS_12030 43055 41994 gene locus_tag LOCUS_12040 43055 41994 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_12040 43860 43030 gene locus_tag LOCUS_12050 43860 43030 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_12050 44065 44946 gene locus_tag LOCUS_12060 44065 44946 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_12060 45904 44972 gene locus_tag LOCUS_12070 45904 44972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 46012 46749 gene locus_tag LOCUS_12080 46012 46749 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_12080 47004 47459 gene locus_tag LOCUS_12090 47004 47459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 47437 48549 gene locus_tag LOCUS_12100 47437 48549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 48956 50284 gene locus_tag LOCUS_12110 48956 50284 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531469.1 protein_id gnl|my_center|LOCUS_12110 51333 50353 gene locus_tag LOCUS_12120 51333 50353 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_12120 52998 51364 gene locus_tag LOCUS_12130 52998 51364 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_12130 55182 53119 gene locus_tag LOCUS_12140 55182 53119 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921376.1 protein_id gnl|my_center|LOCUS_12140 55323 56438 gene locus_tag LOCUS_12150 gene dauA 55323 56438 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_12150 56480 59773 gene locus_tag LOCUS_12160 56480 59773 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205417.1 protein_id gnl|my_center|LOCUS_12160 59815 62379 gene locus_tag LOCUS_12170 59815 62379 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_12170 62384 63265 gene locus_tag LOCUS_12180 62384 63265 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_12180 63553 64011 gene locus_tag LOCUS_12190 63553 64011 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083047.1 protein_id gnl|my_center|LOCUS_12190 64817 64602 gene locus_tag LOCUS_12200 64817 64602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 64738 65145 gene locus_tag LOCUS_12210 64738 65145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 65267 65917 gene locus_tag LOCUS_12220 65267 65917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 66995 66141 gene locus_tag LOCUS_12230 66995 66141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 67599 67249 gene locus_tag LOCUS_12240 67599 67249 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705113.1 protein_id gnl|my_center|LOCUS_12240 68165 67725 gene locus_tag LOCUS_12250 68165 67725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 68728 68162 gene locus_tag LOCUS_12260 68728 68162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 69999 68905 gene locus_tag LOCUS_12270 69999 68905 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090540.1 protein_id gnl|my_center|LOCUS_12270 72821 70089 gene locus_tag LOCUS_12280 gene secA 72821 70089 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387988.1 protein_id gnl|my_center|LOCUS_12280 73110 73982 gene locus_tag LOCUS_12290 73110 73982 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529440.1 protein_id gnl|my_center|LOCUS_12290 74008 75237 gene locus_tag LOCUS_12300 gene argJ 74008 75237 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 protein_id gnl|my_center|LOCUS_12300 75324 76361 gene locus_tag LOCUS_12310 75324 76361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 76938 76501 gene locus_tag LOCUS_12320 76938 76501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 77209 77973 gene locus_tag LOCUS_12330 77209 77973 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_12330 77991 78596 gene locus_tag LOCUS_12340 77991 78596 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_12340 78884 78597 gene locus_tag LOCUS_12350 78884 78597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 79246 78953 gene locus_tag LOCUS_12360 79246 78953 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199503.1 protein_id gnl|my_center|LOCUS_12360 79512 79961 gene locus_tag LOCUS_12370 79512 79961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 80039 81067 gene locus_tag LOCUS_12380 gene cobS 80039 81067 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_12380 81099 82979 gene locus_tag LOCUS_12390 gene cobT 81099 82979 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388602.1 protein_id gnl|my_center|LOCUS_12390 85655 83199 gene locus_tag LOCUS_12400 85655 83199 CDS product MtrB/PioB family decaheme-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071899.1 protein_id gnl|my_center|LOCUS_12400 86660 85674 gene locus_tag LOCUS_12410 gene mtrA 86660 85674 CDS product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_12410 87678 86689 gene locus_tag LOCUS_12420 87678 86689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 88323 90305 gene locus_tag LOCUS_12430 88323 90305 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence011 1521 442 gene locus_tag LOCUS_12440 1521 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1715 1524 gene locus_tag LOCUS_12450 1715 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 4288 1697 gene locus_tag LOCUS_12460 4288 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12460 4859 4659 gene locus_tag LOCUS_12470 4859 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 4992 6296 gene locus_tag LOCUS_12480 4992 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 7225 6239 gene locus_tag LOCUS_12490 7225 6239 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976038.1 protein_id gnl|my_center|LOCUS_12490 8479 7313 gene locus_tag LOCUS_12500 8479 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 8814 10007 gene locus_tag LOCUS_12510 8814 10007 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172709.1 protein_id gnl|my_center|LOCUS_12510 10017 10883 gene locus_tag LOCUS_12520 10017 10883 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_12520 10888 11832 gene locus_tag LOCUS_12530 10888 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 11829 12575 gene locus_tag LOCUS_12540 11829 12575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_12540 12584 13303 gene locus_tag LOCUS_12550 12584 13303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_12550 13333 14028 gene locus_tag LOCUS_12560 13333 14028 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446421.1 protein_id gnl|my_center|LOCUS_12560 14138 15508 gene locus_tag LOCUS_12570 14138 15508 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_12570 15688 15521 gene locus_tag LOCUS_12580 gene rpmG 15688 15521 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006201775.1 protein_id gnl|my_center|LOCUS_12580 17302 15788 gene locus_tag LOCUS_12590 17302 15788 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470630.1 protein_id gnl|my_center|LOCUS_12590 19494 17299 gene locus_tag LOCUS_12600 gene rnr 19494 17299 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390951.1 protein_id gnl|my_center|LOCUS_12600 22233 19528 gene locus_tag LOCUS_12610 gene topA 22233 19528 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390950.1 protein_id gnl|my_center|LOCUS_12610 23410 22274 gene locus_tag LOCUS_12620 gene dprA 23410 22274 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_12620 23997 23407 gene locus_tag LOCUS_12630 gene plsY 23997 23407 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256563.1 protein_id gnl|my_center|LOCUS_12630 25244 23994 gene locus_tag LOCUS_12640 25244 23994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 26560 25241 gene locus_tag LOCUS_12650 gene pyrC 26560 25241 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390939.1 protein_id gnl|my_center|LOCUS_12650 27250 26660 gene locus_tag LOCUS_12660 27250 26660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 28523 27615 gene locus_tag LOCUS_12670 28523 27615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 29159 28626 gene locus_tag LOCUS_12680 29159 28626 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_12680 30125 29316 gene locus_tag LOCUS_12690 30125 29316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 31045 30182 gene locus_tag LOCUS_12700 31045 30182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 32001 31216 gene locus_tag LOCUS_12710 32001 31216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 32209 34146 gene locus_tag LOCUS_12720 gene thrS 32209 34146 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_12720 34281 34802 gene locus_tag LOCUS_12730 gene infC 34281 34802 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_12730 34831 35763 gene locus_tag LOCUS_12740 gene pdxY 34831 35763 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_12740 35846 36166 gene locus_tag LOCUS_12750 35846 36166 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807389.1 protein_id gnl|my_center|LOCUS_12750 36924 36163 gene locus_tag LOCUS_12760 36924 36163 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_12760 37823 36921 gene locus_tag LOCUS_12770 37823 36921 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_12770 39024 37828 gene locus_tag LOCUS_12780 gene cbiE 39024 37828 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114023.1 protein_id gnl|my_center|LOCUS_12780 39128 39754 gene locus_tag LOCUS_12790 39128 39754 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521551.1 protein_id gnl|my_center|LOCUS_12790 39755 40540 gene locus_tag LOCUS_12800 gene cobJ 39755 40540 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390737.1 protein_id gnl|my_center|LOCUS_12800 41264 40635 gene locus_tag LOCUS_12810 gene phaR 41264 40635 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_12810 41409 41624 gene locus_tag LOCUS_12820 41409 41624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 41621 42874 gene locus_tag LOCUS_12830 41621 42874 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 protein_id gnl|my_center|LOCUS_12830 43253 42933 gene locus_tag LOCUS_12840 43253 42933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 43406 44704 gene locus_tag LOCUS_12850 43406 44704 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939425.1 protein_id gnl|my_center|LOCUS_12850 44973 46019 gene locus_tag LOCUS_12860 44973 46019 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083854.1 protein_id gnl|my_center|LOCUS_12860 46066 46332 gene locus_tag LOCUS_12870 46066 46332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 47107 46439 gene locus_tag LOCUS_12880 47107 46439 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 protein_id gnl|my_center|LOCUS_12880 47237 47926 gene locus_tag LOCUS_12890 47237 47926 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969082.1 protein_id gnl|my_center|LOCUS_12890 48552 47890 gene locus_tag LOCUS_12900 gene pcp 48552 47890 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027116.1 protein_id gnl|my_center|LOCUS_12900 48872 48552 gene locus_tag LOCUS_12910 48872 48552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 49279 48869 gene locus_tag LOCUS_12920 49279 48869 CDS product DUF2237 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923332.1 protein_id gnl|my_center|LOCUS_12920 49695 49369 gene locus_tag LOCUS_12930 49695 49369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 51342 49729 gene locus_tag LOCUS_12940 51342 49729 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921222.1 protein_id gnl|my_center|LOCUS_12940 51280 51465 gene locus_tag LOCUS_12950 51280 51465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 51478 51663 gene locus_tag LOCUS_12960 51478 51663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 51677 52585 gene locus_tag LOCUS_12970 51677 52585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 52671 55445 gene locus_tag LOCUS_12980 52671 55445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 55545 55895 gene locus_tag LOCUS_12990 55545 55895 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389363.1 protein_id gnl|my_center|LOCUS_12990 55895 57715 gene locus_tag LOCUS_13000 55895 57715 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_13000 57828 59030 gene locus_tag LOCUS_13010 gene ubiM 57828 59030 CDS product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 protein_id gnl|my_center|LOCUS_13010 59241 60221 gene locus_tag LOCUS_13020 gene cysK 59241 60221 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921452.1 protein_id gnl|my_center|LOCUS_13020 61490 60288 gene locus_tag LOCUS_13030 gene pcaF 61490 60288 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101891.1 protein_id gnl|my_center|LOCUS_13030 61798 62838 gene locus_tag LOCUS_13040 61798 62838 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018642187.1 protein_id gnl|my_center|LOCUS_13040 62954 63316 gene locus_tag LOCUS_13050 62954 63316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 63347 65644 gene locus_tag LOCUS_13060 63347 65644 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_13060 65743 66123 gene locus_tag LOCUS_13070 65743 66123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 66291 66959 gene locus_tag LOCUS_13080 66291 66959 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_13080 67837 66989 gene locus_tag LOCUS_13090 67837 66989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 67880 68737 gene locus_tag LOCUS_13100 67880 68737 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626584.1 protein_id gnl|my_center|LOCUS_13100 69618 68794 gene locus_tag LOCUS_13110 gene cobF 69618 68794 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390718.1 protein_id gnl|my_center|LOCUS_13110 70157 69615 gene locus_tag LOCUS_13120 gene cobC 70157 69615 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 protein_id gnl|my_center|LOCUS_13120 70912 70154 gene locus_tag LOCUS_13130 70912 70154 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191554.1 protein_id gnl|my_center|LOCUS_13130 72078 70909 gene locus_tag LOCUS_13140 gene cobT 72078 70909 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 protein_id gnl|my_center|LOCUS_13140 72152 72913 gene locus_tag LOCUS_13150 gene bluB 72152 72913 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992301.1 protein_id gnl|my_center|LOCUS_13150 73065 72910 gene locus_tag LOCUS_13160 73065 72910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 73113 73613 gene locus_tag LOCUS_13170 73113 73613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 73610 74161 gene locus_tag LOCUS_13180 73610 74161 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391245.1 protein_id gnl|my_center|LOCUS_13180 74802 74164 gene locus_tag LOCUS_13190 gene thiE 74802 74164 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921097.1 protein_id gnl|my_center|LOCUS_13190 75719 74799 gene locus_tag LOCUS_13200 75719 74799 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_13200 76175 75762 gene locus_tag LOCUS_13210 76175 75762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 76241 76444 gene locus_tag LOCUS_13220 76241 76444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 76509 76859 gene locus_tag LOCUS_13230 76509 76859 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921080.1 protein_id gnl|my_center|LOCUS_13230 76994 77590 gene locus_tag LOCUS_13240 76994 77590 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388839.1 protein_id gnl|my_center|LOCUS_13240 77591 78406 gene locus_tag LOCUS_13250 77591 78406 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_13250 78669 79418 gene locus_tag LOCUS_13260 78669 79418 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084350.1 protein_id gnl|my_center|LOCUS_13260 79430 79939 gene locus_tag LOCUS_13270 gene ruvC 79430 79939 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388842.1 protein_id gnl|my_center|LOCUS_13270 79936 80535 gene locus_tag LOCUS_13280 gene ruvA 79936 80535 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388843.1 protein_id gnl|my_center|LOCUS_13280 80998 80549 gene locus_tag LOCUS_13290 80998 80549 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337636.1 protein_id gnl|my_center|LOCUS_13290 81798 80995 gene locus_tag LOCUS_13300 gene thiD 81798 80995 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 protein_id gnl|my_center|LOCUS_13300 83224 81818 gene locus_tag LOCUS_13310 gene glmM 83224 81818 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388855.1 protein_id gnl|my_center|LOCUS_13310 84219 83239 gene locus_tag LOCUS_13320 gene folP 84219 83239 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337038.1 protein_id gnl|my_center|LOCUS_13320 84830 84267 gene locus_tag LOCUS_13330 gene hemG 84830 84267 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176268.1 protein_id gnl|my_center|LOCUS_13330 <86192 85077 gene locus_tag LOCUS_13340 <86192 85077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921059.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence012 908 3 gene locus_tag LOCUS_13350 908 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1251 2390 gene locus_tag LOCUS_13360 1251 2390 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535304.1 protein_id gnl|my_center|LOCUS_13360 3612 2371 gene locus_tag LOCUS_13370 3612 2371 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112233.1 protein_id gnl|my_center|LOCUS_13370 3947 3609 gene locus_tag LOCUS_13380 3947 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 3928 4542 gene locus_tag LOCUS_13390 3928 4542 CDS product HpnM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387817.1 protein_id gnl|my_center|LOCUS_13390 4601 7192 gene locus_tag LOCUS_13400 4601 7192 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 protein_id gnl|my_center|LOCUS_13400 9097 7265 gene locus_tag LOCUS_13410 gene typA 9097 7265 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_13410 9599 9312 gene locus_tag LOCUS_13420 9599 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 10804 9803 gene locus_tag LOCUS_13430 10804 9803 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968402.1 protein_id gnl|my_center|LOCUS_13430 10880 11605 gene locus_tag LOCUS_13440 10880 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 11714 12403 gene locus_tag LOCUS_13450 11714 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 12911 12456 gene locus_tag LOCUS_13460 12911 12456 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268700.1 protein_id gnl|my_center|LOCUS_13460 13537 12908 gene locus_tag LOCUS_13470 gene parA 13537 12908 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202825640.1 protein_id gnl|my_center|LOCUS_13470 13602 14975 gene locus_tag LOCUS_13480 13602 14975 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389422.1 protein_id gnl|my_center|LOCUS_13480 15030 15722 gene locus_tag LOCUS_13490 15030 15722 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_13490 15848 16162 gene locus_tag LOCUS_13500 15848 16162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 16186 16335 gene locus_tag LOCUS_13510 16186 16335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 16614 16540 gene locus_tag LOCUS_t00170 16614 16540 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16719 17591 gene locus_tag LOCUS_13520 16719 17591 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639858.1 protein_id gnl|my_center|LOCUS_13520 18412 17741 gene locus_tag LOCUS_13530 gene bioD 18412 17741 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919449.1 protein_id gnl|my_center|LOCUS_13530 19566 18409 gene locus_tag LOCUS_13540 gene bioF 19566 18409 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640275.1 protein_id gnl|my_center|LOCUS_13540 19703 20692 gene locus_tag LOCUS_13550 gene bioB 19703 20692 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_13550 20702 21976 gene locus_tag LOCUS_13560 20702 21976 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818556.1 protein_id gnl|my_center|LOCUS_13560 21973 22743 gene locus_tag LOCUS_13570 21973 22743 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_13570 22842 23186 gene locus_tag LOCUS_13580 22842 23186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 23191 24789 gene locus_tag LOCUS_13590 23191 24789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 24919 25896 gene locus_tag LOCUS_13600 24919 25896 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337355.1 protein_id gnl|my_center|LOCUS_13600 26022 26867 gene locus_tag LOCUS_13610 26022 26867 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703672.1 protein_id gnl|my_center|LOCUS_13610 26893 28380 gene locus_tag LOCUS_13620 26893 28380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 28456 29523 gene locus_tag LOCUS_13630 28456 29523 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184894.1 protein_id gnl|my_center|LOCUS_13630 29582 30661 gene locus_tag LOCUS_13640 29582 30661 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967441.1 protein_id gnl|my_center|LOCUS_13640 31447 30791 gene locus_tag LOCUS_13650 gene pncA 31447 30791 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327256.1 protein_id gnl|my_center|LOCUS_13650 32738 31464 gene locus_tag LOCUS_13660 gene serS 32738 31464 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389523.1 protein_id gnl|my_center|LOCUS_13660 33571 32741 gene locus_tag LOCUS_13670 gene tatC 33571 32741 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389524.1 protein_id gnl|my_center|LOCUS_13670 34177 33698 gene locus_tag LOCUS_13680 gene tatB 34177 33698 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389525.1 protein_id gnl|my_center|LOCUS_13680 34917 34267 gene locus_tag LOCUS_13690 34917 34267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 35686 34898 gene locus_tag LOCUS_13700 35686 34898 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129796.1 protein_id gnl|my_center|LOCUS_13700 36416 35673 gene locus_tag LOCUS_13710 36416 35673 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389529.1 protein_id gnl|my_center|LOCUS_13710 37462 36413 gene locus_tag LOCUS_13720 gene nagZ 37462 36413 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389530.1 protein_id gnl|my_center|LOCUS_13720 37614 37459 gene locus_tag LOCUS_13730 37614 37459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 41146 37862 gene locus_tag LOCUS_13740 41146 37862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 42395 41631 gene locus_tag LOCUS_13750 42395 41631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088592.1 protein_id gnl|my_center|LOCUS_13750 43110 42448 gene locus_tag LOCUS_13760 gene lipB 43110 42448 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389749.1 protein_id gnl|my_center|LOCUS_13760 43159 43244 gene locus_tag LOCUS_t00180 43159 43244 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44734 43319 gene locus_tag LOCUS_13770 gene gltX 44734 43319 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389476.1 protein_id gnl|my_center|LOCUS_13770 44791 46938 gene locus_tag LOCUS_13780 44791 46938 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_13780 47000 47206 gene locus_tag LOCUS_13790 47000 47206 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626541.1 protein_id gnl|my_center|LOCUS_13790 47203 47490 gene locus_tag LOCUS_13800 47203 47490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 47605 48078 gene locus_tag LOCUS_13810 47605 48078 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387828.1 protein_id gnl|my_center|LOCUS_13810 48066 48614 gene locus_tag LOCUS_13820 48066 48614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 48854 50464 gene locus_tag LOCUS_13830 48854 50464 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_13830 50464 54042 gene locus_tag LOCUS_13840 gene nifJ 50464 54042 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_13840 54372 54109 gene locus_tag LOCUS_13850 54372 54109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 55251 54505 gene locus_tag LOCUS_13860 55251 54505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 55595 56785 gene locus_tag LOCUS_13870 55595 56785 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040670.1 protein_id gnl|my_center|LOCUS_13870 56906 57325 gene locus_tag LOCUS_13880 56906 57325 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_13880 57759 57400 gene locus_tag LOCUS_13890 57759 57400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 58916 58149 gene locus_tag LOCUS_13900 58916 58149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 59947 58949 gene locus_tag LOCUS_13910 59947 58949 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537496.1 protein_id gnl|my_center|LOCUS_13910 60801 60046 gene locus_tag LOCUS_13920 60801 60046 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089765.1 protein_id gnl|my_center|LOCUS_13920 61559 60816 gene locus_tag LOCUS_13930 61559 60816 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194452.1 protein_id gnl|my_center|LOCUS_13930 63873 61648 gene locus_tag LOCUS_13940 63873 61648 CDS product DUF3141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983976.1 protein_id gnl|my_center|LOCUS_13940 64078 64296 gene locus_tag LOCUS_13950 64078 64296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 65641 64403 gene locus_tag LOCUS_13960 65641 64403 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087453.1 protein_id gnl|my_center|LOCUS_13960 65862 67412 gene locus_tag LOCUS_13970 65862 67412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 67424 68419 gene locus_tag LOCUS_13980 67424 68419 CDS product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086271.1 protein_id gnl|my_center|LOCUS_13980 69414 68479 gene locus_tag LOCUS_13990 69414 68479 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390938.1 protein_id gnl|my_center|LOCUS_13990 69612 70628 gene locus_tag LOCUS_14000 69612 70628 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389800.1 protein_id gnl|my_center|LOCUS_14000 70644 71105 gene locus_tag LOCUS_14010 70644 71105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 71105 72229 gene locus_tag LOCUS_14020 71105 72229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 72226 72981 gene locus_tag LOCUS_14030 72226 72981 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_14030 72978 73988 gene locus_tag LOCUS_14040 72978 73988 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454833.1 protein_id gnl|my_center|LOCUS_14040 74000 74575 gene locus_tag LOCUS_14050 74000 74575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 78187 74597 gene locus_tag LOCUS_14060 78187 74597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 78569 78381 gene locus_tag LOCUS_14070 78569 78381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 79139 78600 gene locus_tag LOCUS_14080 gene msrA 79139 78600 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421586.1 protein_id gnl|my_center|LOCUS_14080 79210 79983 gene locus_tag LOCUS_14090 79210 79983 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966886.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence013 210 76 gene locus_tag LOCUS_14100 210 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 891 625 gene locus_tag LOCUS_14110 891 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2862 1162 gene locus_tag LOCUS_14120 2862 1162 CDS product NADPH-dependent assimilatory sulfite reductase hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256582.1 protein_id gnl|my_center|LOCUS_14120 2957 3181 gene locus_tag LOCUS_14130 2957 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4247 3315 gene locus_tag LOCUS_14140 4247 3315 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103232.1 protein_id gnl|my_center|LOCUS_14140 4932 4531 gene locus_tag LOCUS_14150 4932 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 6288 4996 gene locus_tag LOCUS_14160 6288 4996 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389589.1 protein_id gnl|my_center|LOCUS_14160 6366 7112 gene locus_tag LOCUS_14170 6366 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_14170 7982 7410 gene locus_tag LOCUS_14180 7982 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 8287 8964 gene locus_tag LOCUS_14190 8287 8964 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396738.1 protein_id gnl|my_center|LOCUS_14190 9845 9030 gene locus_tag LOCUS_14200 9845 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 10567 9884 gene locus_tag LOCUS_14210 10567 9884 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_14210 10763 10689 gene locus_tag LOCUS_t00190 10763 10689 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10839 12308 gene locus_tag LOCUS_14220 10839 12308 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993961.1 protein_id gnl|my_center|LOCUS_14220 12293 13684 gene locus_tag LOCUS_14230 12293 13684 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_14230 13764 14495 gene locus_tag LOCUS_14240 13764 14495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 15434 14661 gene locus_tag LOCUS_14250 15434 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 15603 17954 gene locus_tag LOCUS_14260 15603 17954 CDS product Orn/Lys/Arg decarboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966057.1 protein_id gnl|my_center|LOCUS_14260 18341 18129 gene locus_tag LOCUS_14270 18341 18129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 18427 20058 gene locus_tag LOCUS_14280 18427 20058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 20110 20430 gene locus_tag LOCUS_14290 20110 20430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 20936 20505 gene locus_tag LOCUS_14300 gene arfB 20936 20505 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_14300 21124 21390 gene locus_tag LOCUS_14310 21124 21390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 21582 22958 gene locus_tag LOCUS_14320 21582 22958 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185398.1 protein_id gnl|my_center|LOCUS_14320 23566 24942 gene locus_tag LOCUS_14330 gene ppsR 23566 24942 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_14330 24961 27147 gene locus_tag LOCUS_14340 24961 27147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 27147 27743 gene locus_tag LOCUS_14350 27147 27743 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268476.1 protein_id gnl|my_center|LOCUS_14350 28983 27946 gene locus_tag LOCUS_14360 28983 27946 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071715.1 protein_id gnl|my_center|LOCUS_14360 30046 29114 gene locus_tag LOCUS_14370 30046 29114 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_14370 30932 30048 gene locus_tag LOCUS_14380 30932 30048 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 protein_id gnl|my_center|LOCUS_14380 32261 31044 gene locus_tag LOCUS_14390 32261 31044 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086815.1 protein_id gnl|my_center|LOCUS_14390 33012 32320 gene locus_tag LOCUS_14400 33012 32320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086814.1 protein_id gnl|my_center|LOCUS_14400 33757 33005 gene locus_tag LOCUS_14410 33757 33005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086813.1 protein_id gnl|my_center|LOCUS_14410 33857 34318 gene locus_tag LOCUS_14420 33857 34318 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_14420 34318 35220 gene locus_tag LOCUS_14430 34318 35220 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_14430 35382 36551 gene locus_tag LOCUS_14440 35382 36551 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_14440 37100 36546 gene locus_tag LOCUS_14450 37100 36546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 37676 39241 gene locus_tag LOCUS_14460 37676 39241 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494095.1 protein_id gnl|my_center|LOCUS_14460 39238 40536 gene locus_tag LOCUS_14470 39238 40536 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087228.1 protein_id gnl|my_center|LOCUS_14470 40547 43654 gene locus_tag LOCUS_14480 40547 43654 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087229.1 protein_id gnl|my_center|LOCUS_14480 43740 44177 gene locus_tag LOCUS_14490 43740 44177 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_14490 44315 47182 gene locus_tag LOCUS_14500 44315 47182 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 protein_id gnl|my_center|LOCUS_14500 47224 47742 gene locus_tag LOCUS_14510 47224 47742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 48120 47836 gene locus_tag LOCUS_14520 48120 47836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 48346 51441 gene locus_tag LOCUS_14530 48346 51441 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087230.1 protein_id gnl|my_center|LOCUS_14530 51522 51941 gene locus_tag LOCUS_14540 51522 51941 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844019.1 protein_id gnl|my_center|LOCUS_14540 52432 52178 gene locus_tag LOCUS_14550 52432 52178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 52751 52425 gene locus_tag LOCUS_14560 52751 52425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 53927 52995 gene locus_tag LOCUS_14570 gene thyX 53927 52995 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_14570 54324 54863 gene locus_tag LOCUS_14580 54324 54863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 54873 56519 gene locus_tag LOCUS_14590 54873 56519 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_14590 56525 56926 gene locus_tag LOCUS_14600 56525 56926 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080756.1 protein_id gnl|my_center|LOCUS_14600 57006 58034 gene locus_tag LOCUS_14610 gene queA 57006 58034 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388034.1 protein_id gnl|my_center|LOCUS_14610 58031 59152 gene locus_tag LOCUS_14620 gene tgt 58031 59152 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388033.1 protein_id gnl|my_center|LOCUS_14620 59149 59610 gene locus_tag LOCUS_14630 gene queF 59149 59610 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972191.1 protein_id gnl|my_center|LOCUS_14630 59610 60695 gene locus_tag LOCUS_14640 gene queG 59610 60695 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_14640 60756 60992 gene locus_tag LOCUS_14650 60756 60992 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719290.1 protein_id gnl|my_center|LOCUS_14650 61104 61277 gene locus_tag LOCUS_14660 61104 61277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 64245 61300 gene locus_tag LOCUS_14670 64245 61300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 67898 64245 gene locus_tag LOCUS_14680 67898 64245 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063869.1 protein_id gnl|my_center|LOCUS_14680 68038 68823 gene locus_tag LOCUS_14690 68038 68823 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_14690 68820 69554 gene locus_tag LOCUS_14700 68820 69554 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_14700 70348 70806 gene locus_tag LOCUS_14710 gene mraZ 70348 70806 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976221.1 protein_id gnl|my_center|LOCUS_14710 70803 71798 gene locus_tag LOCUS_14720 gene rsmH 70803 71798 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388713.1 protein_id gnl|my_center|LOCUS_14720 71795 72595 gene locus_tag LOCUS_14730 71795 72595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 72592 74586 gene locus_tag LOCUS_14740 72592 74586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 74591 76081 gene locus_tag LOCUS_14750 74591 76081 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920415.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence014 <1 1433 gene locus_tag LOCUS_14760 <1 1433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_188470974.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein 1553 1629 gene locus_tag LOCUS_t00200 1553 1629 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1662 1865 gene locus_tag LOCUS_14770 gene secE 1662 1865 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007611620.1 protein_id gnl|my_center|LOCUS_14770 1879 2409 gene locus_tag LOCUS_14780 gene nusG 1879 2409 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_14780 2516 2800 gene locus_tag LOCUS_14790 2516 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3279 2797 gene locus_tag LOCUS_14800 3279 2797 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 protein_id gnl|my_center|LOCUS_14800 4796 3291 gene locus_tag LOCUS_14810 4796 3291 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 protein_id gnl|my_center|LOCUS_14810 4911 5681 gene locus_tag LOCUS_14820 gene cysQ 4911 5681 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_14820 5678 6643 gene locus_tag LOCUS_14830 5678 6643 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_14830 6687 8138 gene locus_tag LOCUS_14840 6687 8138 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_14840 8230 9393 gene locus_tag LOCUS_14850 8230 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 9398 10510 gene locus_tag LOCUS_14860 gene lptG 9398 10510 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966780.1 protein_id gnl|my_center|LOCUS_14860 10534 12825 gene locus_tag LOCUS_14870 gene lptD 10534 12825 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_14870 12864 14222 gene locus_tag LOCUS_14880 gene surA 12864 14222 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780524.1 protein_id gnl|my_center|LOCUS_14880 14374 15039 gene locus_tag LOCUS_14890 gene rsmA 14374 15039 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388190.1 protein_id gnl|my_center|LOCUS_14890 15093 15995 gene locus_tag LOCUS_14900 15093 15995 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_14900 15992 17008 gene locus_tag LOCUS_14910 15992 17008 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133291485.1 protein_id gnl|my_center|LOCUS_14910 19106 17037 gene locus_tag LOCUS_14920 gene recG 19106 17037 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_14920 19148 19432 gene locus_tag LOCUS_14930 19148 19432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 19671 23120 gene locus_tag LOCUS_14940 gene mfd 19671 23120 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389416.1 protein_id gnl|my_center|LOCUS_14940 23213 23644 gene locus_tag LOCUS_14950 23213 23644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 23797 24999 gene locus_tag LOCUS_14960 23797 24999 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388890.1 protein_id gnl|my_center|LOCUS_14960 25004 26221 gene locus_tag LOCUS_14970 25004 26221 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086408.1 protein_id gnl|my_center|LOCUS_14970 26344 26802 gene locus_tag LOCUS_14980 26344 26802 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171431.1 protein_id gnl|my_center|LOCUS_14980 26923 28167 gene locus_tag LOCUS_14990 26923 28167 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085100.1 protein_id gnl|my_center|LOCUS_14990 28160 29029 gene locus_tag LOCUS_15000 gene fdhD 28160 29029 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966588.1 protein_id gnl|my_center|LOCUS_15000 30113 29100 gene locus_tag LOCUS_15010 30113 29100 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_15010 30199 31491 gene locus_tag LOCUS_15020 30199 31491 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 protein_id gnl|my_center|LOCUS_15020 32124 31525 gene locus_tag LOCUS_15030 32124 31525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 32462 32136 gene locus_tag LOCUS_15040 32462 32136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 32811 33368 gene locus_tag LOCUS_15050 32811 33368 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_15050 33421 33744 gene locus_tag LOCUS_15060 33421 33744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 33722 34216 gene locus_tag LOCUS_15070 33722 34216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 36572 34221 gene locus_tag LOCUS_15080 gene clpA 36572 34221 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_15080 37254 36874 gene locus_tag LOCUS_15090 gene clpS 37254 36874 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_15090 38152 37649 gene locus_tag LOCUS_15100 38152 37649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 38055 38354 gene locus_tag LOCUS_15110 38055 38354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 38538 39731 gene locus_tag LOCUS_15120 38538 39731 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974708.1 protein_id gnl|my_center|LOCUS_15120 40066 40872 gene locus_tag LOCUS_15130 gene map 40066 40872 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920527.1 protein_id gnl|my_center|LOCUS_15130 40884 41291 gene locus_tag LOCUS_15140 40884 41291 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704482.1 protein_id gnl|my_center|LOCUS_15140 41560 42309 gene locus_tag LOCUS_15150 gene radC 41560 42309 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385427.1 protein_id gnl|my_center|LOCUS_15150 42526 42954 gene locus_tag LOCUS_15160 42526 42954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 43024 43293 gene locus_tag LOCUS_15170 43024 43293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 44092 43316 gene locus_tag LOCUS_15180 44092 43316 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389598.1 protein_id gnl|my_center|LOCUS_15180 44661 44089 gene locus_tag LOCUS_15190 44661 44089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 47015 44658 gene locus_tag LOCUS_15200 47015 44658 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389593.1 protein_id gnl|my_center|LOCUS_15200 47178 47531 gene locus_tag LOCUS_15210 47178 47531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 48782 47553 gene locus_tag LOCUS_15220 48782 47553 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388692.1 protein_id gnl|my_center|LOCUS_15220 49931 49680 gene locus_tag LOCUS_15230 49931 49680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 51532 50003 gene locus_tag LOCUS_15240 51532 50003 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808822.1 protein_id gnl|my_center|LOCUS_15240 51608 52834 gene locus_tag LOCUS_15250 51608 52834 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204969.1 protein_id gnl|my_center|LOCUS_15250 53220 52945 gene locus_tag LOCUS_15260 53220 52945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15260 54002 53118 gene locus_tag LOCUS_15270 54002 53118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15270 54317 55567 gene locus_tag LOCUS_15280 54317 55567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 55949 55581 gene locus_tag LOCUS_15290 55949 55581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15290 56839 55868 gene locus_tag LOCUS_15300 56839 55868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15300 58484 56934 gene locus_tag LOCUS_15310 58484 56934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 59713 58643 gene locus_tag LOCUS_15320 59713 58643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 62445 59683 gene locus_tag LOCUS_15330 62445 59683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 62572 62949 gene locus_tag LOCUS_15340 62572 62949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15340 62886 63182 gene locus_tag LOCUS_15350 62886 63182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15350 64180 63410 gene locus_tag LOCUS_15360 64180 63410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 64755 66014 gene locus_tag LOCUS_15370 64755 66014 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565946.1 protein_id gnl|my_center|LOCUS_15370 66017 67165 gene locus_tag LOCUS_15380 66017 67165 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 protein_id gnl|my_center|LOCUS_15380 67191 68144 gene locus_tag LOCUS_15390 67191 68144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 68340 69362 gene locus_tag LOCUS_15400 68340 69362 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_15400 69374 70909 gene locus_tag LOCUS_15410 gene metG 69374 70909 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389391.1 protein_id gnl|my_center|LOCUS_15410 70917 71705 gene locus_tag LOCUS_15420 70917 71705 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_15420 71702 72517 gene locus_tag LOCUS_15430 71702 72517 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence015 546 1421 gene locus_tag LOCUS_15440 546 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2040 1588 gene locus_tag LOCUS_15450 2040 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2416 3741 gene locus_tag LOCUS_15460 2416 3741 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_15460 4628 4023 gene locus_tag LOCUS_15470 4628 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4781 6334 gene locus_tag LOCUS_15480 4781 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 6506 7762 gene locus_tag LOCUS_15490 gene aaxA 6506 7762 CDS product porin AaxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883666.1 protein_id gnl|my_center|LOCUS_15490 8165 9040 gene locus_tag LOCUS_15500 8165 9040 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_15500 10078 9161 gene locus_tag LOCUS_15510 10078 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 10702 10514 gene locus_tag LOCUS_15520 10702 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 11875 10751 gene locus_tag LOCUS_15530 11875 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 12644 11889 gene locus_tag LOCUS_15540 12644 11889 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 protein_id gnl|my_center|LOCUS_15540 13789 12641 gene locus_tag LOCUS_15550 13789 12641 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216554.1 protein_id gnl|my_center|LOCUS_15550 15264 13789 gene locus_tag LOCUS_15560 gene xrtA 15264 13789 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_15560 16568 15261 gene locus_tag LOCUS_15570 16568 15261 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_15570 17614 16565 gene locus_tag LOCUS_15580 17614 16565 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_15580 18040 17717 gene locus_tag LOCUS_15590 18040 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 18654 17947 gene locus_tag LOCUS_15600 18654 17947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 18931 20220 gene locus_tag LOCUS_15610 18931 20220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 21786 20362 gene locus_tag LOCUS_15620 21786 20362 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626578.1 protein_id gnl|my_center|LOCUS_15620 21885 22622 gene locus_tag LOCUS_15630 21885 22622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 23477 24451 gene locus_tag LOCUS_15640 23477 24451 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_15640 25316 24351 gene locus_tag LOCUS_15650 25316 24351 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_15650 26290 25328 gene locus_tag LOCUS_15660 26290 25328 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_15660 27998 26301 gene locus_tag LOCUS_15670 27998 26301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 29032 28076 gene locus_tag LOCUS_15680 29032 28076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 30660 29041 gene locus_tag LOCUS_15690 30660 29041 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_15690 31578 30673 gene locus_tag LOCUS_15700 31578 30673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 32075 33298 gene locus_tag LOCUS_15710 32075 33298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 33435 36227 gene locus_tag LOCUS_15720 33435 36227 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_15720 36230 37462 gene locus_tag LOCUS_15730 36230 37462 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_15730 38561 37494 gene locus_tag LOCUS_15740 38561 37494 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626518.1 protein_id gnl|my_center|LOCUS_15740 39595 38648 gene locus_tag LOCUS_15750 39595 38648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 39697 40836 gene locus_tag LOCUS_15760 39697 40836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 40833 41846 gene locus_tag LOCUS_15770 40833 41846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 41843 43570 gene locus_tag LOCUS_15780 41843 43570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 43628 44656 gene locus_tag LOCUS_15790 43628 44656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 45651 44638 gene locus_tag LOCUS_15800 45651 44638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 45908 45759 gene locus_tag LOCUS_15810 45908 45759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 47388 46039 gene locus_tag LOCUS_15820 47388 46039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 47779 49110 gene locus_tag LOCUS_15830 47779 49110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 49174 50661 gene locus_tag LOCUS_15840 49174 50661 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_15840 50934 52496 gene locus_tag LOCUS_15850 50934 52496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 54390 52852 gene locus_tag LOCUS_15860 54390 52852 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_15860 56258 54387 gene locus_tag LOCUS_15870 56258 54387 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_15870 59136 56704 gene locus_tag LOCUS_15880 59136 56704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 59499 59332 gene locus_tag LOCUS_15890 59499 59332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 59480 61546 gene locus_tag LOCUS_15900 gene prsK 59480 61546 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_15900 61623 62996 gene locus_tag LOCUS_15910 gene prsR 61623 62996 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_15910 63759 63124 gene locus_tag LOCUS_15920 63759 63124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 64180 64821 gene locus_tag LOCUS_15930 64180 64821 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083586.1 protein_id gnl|my_center|LOCUS_15930 64818 65177 gene locus_tag LOCUS_15940 64818 65177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 65541 66017 gene locus_tag LOCUS_15950 65541 66017 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_15950 68066 67809 gene locus_tag LOCUS_15960 68066 67809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 68724 70505 gene locus_tag LOCUS_15970 68724 70505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 71658 70492 gene locus_tag LOCUS_15980 71658 70492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence016 1702 2334 gene locus_tag LOCUS_15990 1702 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15990 2496 4082 gene locus_tag LOCUS_16000 2496 4082 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_16000 4094 5194 gene locus_tag LOCUS_16010 4094 5194 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_16010 5233 6807 gene locus_tag LOCUS_16020 gene purH 5233 6807 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391402.1 protein_id gnl|my_center|LOCUS_16020 6966 7268 gene locus_tag LOCUS_16030 6966 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 7249 7740 gene locus_tag LOCUS_16040 7249 7740 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806996.1 protein_id gnl|my_center|LOCUS_16040 7789 8106 gene locus_tag LOCUS_16050 7789 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 8522 8097 gene locus_tag LOCUS_16060 8522 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 9197 8739 gene locus_tag LOCUS_16070 9197 8739 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_16070 9956 9543 gene locus_tag LOCUS_16080 9956 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 10459 10232 gene locus_tag LOCUS_16090 10459 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 10451 12466 gene locus_tag LOCUS_16100 10451 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388856.1 protein_id gnl|my_center|LOCUS_16100 12474 13430 gene locus_tag LOCUS_16110 12474 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 14179 13436 gene locus_tag LOCUS_16120 14179 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 14702 14388 gene locus_tag LOCUS_16130 14702 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227996.1 protein_id gnl|my_center|LOCUS_16130 15612 17090 gene locus_tag LOCUS_16140 gene gabD 15612 17090 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_16140 17280 18635 gene locus_tag LOCUS_16150 gene gor 17280 18635 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189043.1 protein_id gnl|my_center|LOCUS_16150 18799 20187 gene locus_tag LOCUS_16160 18799 20187 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_16160 20194 21399 gene locus_tag LOCUS_16170 20194 21399 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440341.1 protein_id gnl|my_center|LOCUS_16170 21526 21801 gene locus_tag LOCUS_16180 21526 21801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 21912 22217 gene locus_tag LOCUS_16190 21912 22217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 22419 23336 gene locus_tag LOCUS_16200 22419 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 23430 23356 gene locus_tag LOCUS_t00210 23430 23356 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 23665 23447 gene locus_tag LOCUS_16210 23665 23447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 24320 23676 gene locus_tag LOCUS_16220 24320 23676 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_16220 24670 26001 gene locus_tag LOCUS_16230 24670 26001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 27116 25941 gene locus_tag LOCUS_16240 27116 25941 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703254.1 protein_id gnl|my_center|LOCUS_16240 27173 27631 gene locus_tag LOCUS_16250 gene nikR 27173 27631 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190057.1 protein_id gnl|my_center|LOCUS_16250 27719 28480 gene locus_tag LOCUS_16260 27719 28480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 28614 29978 gene locus_tag LOCUS_16270 28614 29978 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_16270 30077 30928 gene locus_tag LOCUS_16280 gene panC 30077 30928 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626566.1 protein_id gnl|my_center|LOCUS_16280 30925 31347 gene locus_tag LOCUS_16290 30925 31347 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_16290 31469 33151 gene locus_tag LOCUS_16300 31469 33151 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_16300 33170 33937 gene locus_tag LOCUS_16310 33170 33937 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399793.1 protein_id gnl|my_center|LOCUS_16310 34046 35236 gene locus_tag LOCUS_16320 34046 35236 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108823.1 protein_id gnl|my_center|LOCUS_16320 35247 36374 gene locus_tag LOCUS_16330 35247 36374 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973070.1 protein_id gnl|my_center|LOCUS_16330 36908 36387 gene locus_tag LOCUS_16340 36908 36387 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532478.1 protein_id gnl|my_center|LOCUS_16340 37192 36911 gene locus_tag LOCUS_16350 gene moaD 37192 36911 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 protein_id gnl|my_center|LOCUS_16350 37776 37213 gene locus_tag LOCUS_16360 37776 37213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 38392 37877 gene locus_tag LOCUS_16370 gene mobB 38392 37877 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_16370 39107 38412 gene locus_tag LOCUS_16380 gene pgsA 39107 38412 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_16380 40376 39273 gene locus_tag LOCUS_16390 40376 39273 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_16390 40857 40522 gene locus_tag LOCUS_16400 40857 40522 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_16400 41552 40857 gene locus_tag LOCUS_16410 41552 40857 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_16410 42277 41549 gene locus_tag LOCUS_16420 42277 41549 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536803.1 protein_id gnl|my_center|LOCUS_16420 42402 43394 gene locus_tag LOCUS_16430 42402 43394 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_16430 43509 44258 gene locus_tag LOCUS_16440 43509 44258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_16440 44255 45007 gene locus_tag LOCUS_16450 44255 45007 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384595.1 protein_id gnl|my_center|LOCUS_16450 45070 45279 gene locus_tag LOCUS_16460 45070 45279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 45922 45398 gene locus_tag LOCUS_16470 45922 45398 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969913.1 protein_id gnl|my_center|LOCUS_16470 45970 46944 gene locus_tag LOCUS_16480 45970 46944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 46973 48439 gene locus_tag LOCUS_16490 46973 48439 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_16490 48514 49212 gene locus_tag LOCUS_16500 48514 49212 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529987.1 protein_id gnl|my_center|LOCUS_16500 49315 49980 gene locus_tag LOCUS_16510 49315 49980 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_16510 50193 50648 gene locus_tag LOCUS_16520 50193 50648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 50732 52786 gene locus_tag LOCUS_16530 50732 52786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 52917 54605 gene locus_tag LOCUS_16540 52917 54605 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_16540 54602 55264 gene locus_tag LOCUS_16550 54602 55264 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971132.1 protein_id gnl|my_center|LOCUS_16550 56810 55680 gene locus_tag LOCUS_16560 56810 55680 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440409.1 protein_id gnl|my_center|LOCUS_16560 57882 57088 gene locus_tag LOCUS_16570 gene thiS 57882 57088 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16570 58137 57886 gene locus_tag LOCUS_16580 58137 57886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16580 58427 58825 gene locus_tag LOCUS_16590 58427 58825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 59179 60252 gene locus_tag LOCUS_16600 59179 60252 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967605.1 protein_id gnl|my_center|LOCUS_16600 60482 61261 gene locus_tag LOCUS_16610 60482 61261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 61393 61803 gene locus_tag LOCUS_16620 61393 61803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 61810 62055 gene locus_tag LOCUS_16630 61810 62055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 62221 63192 gene locus_tag LOCUS_16640 62221 63192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 63189 64142 gene locus_tag LOCUS_16650 63189 64142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 64575 65438 gene locus_tag LOCUS_16660 64575 65438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 66747 65608 gene locus_tag LOCUS_16670 gene cydB 66747 65608 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383172.1 protein_id gnl|my_center|LOCUS_16670 68314 66758 gene locus_tag LOCUS_16680 68314 66758 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037377.1 protein_id gnl|my_center|LOCUS_16680 68517 68320 gene locus_tag LOCUS_16690 68517 68320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 69078 68653 gene locus_tag LOCUS_16700 69078 68653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 69189 70043 gene locus_tag LOCUS_16710 69189 70043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 70189 70638 gene locus_tag LOCUS_16720 70189 70638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 70791 71126 gene locus_tag LOCUS_16730 70791 71126 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265860.1 protein_id gnl|my_center|LOCUS_16730 71502 71143 gene locus_tag LOCUS_16740 71502 71143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence017 605 952 gene locus_tag LOCUS_16750 605 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1100 2791 gene locus_tag LOCUS_16760 1100 2791 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940385.1 protein_id gnl|my_center|LOCUS_16760 2788 3372 gene locus_tag LOCUS_16770 2788 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 3559 3395 gene locus_tag LOCUS_16780 3559 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3524 4678 gene locus_tag LOCUS_16790 3524 4678 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064079.1 protein_id gnl|my_center|LOCUS_16790 5236 4739 gene locus_tag LOCUS_16800 5236 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6059 5268 gene locus_tag LOCUS_16810 6059 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 6415 6915 gene locus_tag LOCUS_16820 6415 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 7158 8108 gene locus_tag LOCUS_16830 7158 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 9304 8267 gene locus_tag LOCUS_16840 9304 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 9505 11172 gene locus_tag LOCUS_16850 9505 11172 CDS product molybdopterin-binding/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388726.1 protein_id gnl|my_center|LOCUS_16850 11188 13035 gene locus_tag LOCUS_16860 11188 13035 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389828.1 protein_id gnl|my_center|LOCUS_16860 13064 14164 gene locus_tag LOCUS_16870 13064 14164 CDS product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_16870 14161 14610 gene locus_tag LOCUS_16880 14161 14610 CDS product 1-methylthio-xylulose 5-phosphate sulfo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389753.1 protein_id gnl|my_center|LOCUS_16880 14612 16405 gene locus_tag LOCUS_16890 14612 16405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 20275 16487 gene locus_tag LOCUS_16900 20275 16487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 20795 20550 gene locus_tag LOCUS_16910 20795 20550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 23637 20809 gene locus_tag LOCUS_16920 23637 20809 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_16920 26222 23634 gene locus_tag LOCUS_16930 gene mutS 26222 23634 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_16930 28457 26496 gene locus_tag LOCUS_16940 28457 26496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 29335 28454 gene locus_tag LOCUS_16950 29335 28454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 29531 30091 gene locus_tag LOCUS_16960 29531 30091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 30197 30502 gene locus_tag LOCUS_16970 30197 30502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 31641 30415 gene locus_tag LOCUS_16980 31641 30415 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 protein_id gnl|my_center|LOCUS_16980 31902 33770 gene locus_tag LOCUS_16990 31902 33770 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992392.1 protein_id gnl|my_center|LOCUS_16990 34219 33848 gene locus_tag LOCUS_17000 34219 33848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 35154 34264 gene locus_tag LOCUS_17010 35154 34264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 36070 35576 gene locus_tag LOCUS_17020 36070 35576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 37763 36153 gene locus_tag LOCUS_17030 gene groL 37763 36153 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387923.1 protein_id gnl|my_center|LOCUS_17030 38190 37843 gene locus_tag LOCUS_17040 gene groES 38190 37843 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975443.1 protein_id gnl|my_center|LOCUS_17040 39109 38564 gene locus_tag LOCUS_17050 39109 38564 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971842.1 protein_id gnl|my_center|LOCUS_17050 39512 40390 gene locus_tag LOCUS_17060 39512 40390 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085045.1 protein_id gnl|my_center|LOCUS_17060 40419 41213 gene locus_tag LOCUS_17070 40419 41213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 41935 41234 gene locus_tag LOCUS_17080 41935 41234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 42022 42600 gene locus_tag LOCUS_17090 42022 42600 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_17090 42605 44176 gene locus_tag LOCUS_17100 42605 44176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17100 44311 44937 gene locus_tag LOCUS_17110 44311 44937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 45120 46430 gene locus_tag LOCUS_17120 gene gltA 45120 46430 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_17120 46853 47476 gene locus_tag LOCUS_17130 46853 47476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 48508 47615 gene locus_tag LOCUS_17140 48508 47615 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921532.1 protein_id gnl|my_center|LOCUS_17140 48940 48707 gene locus_tag LOCUS_17150 48940 48707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 50100 49054 gene locus_tag LOCUS_17160 50100 49054 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_17160 50158 50901 gene locus_tag LOCUS_17170 50158 50901 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390260.1 protein_id gnl|my_center|LOCUS_17170 52464 51283 gene locus_tag LOCUS_17180 52464 51283 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331464.1 protein_id gnl|my_center|LOCUS_17180 52697 53458 gene locus_tag LOCUS_17190 52697 53458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 53462 54193 gene locus_tag LOCUS_17200 53462 54193 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_17200 54195 56111 gene locus_tag LOCUS_17210 54195 56111 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_17210 56125 57261 gene locus_tag LOCUS_17220 56125 57261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 57352 57717 gene locus_tag LOCUS_17230 57352 57717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 57786 58745 gene locus_tag LOCUS_17240 57786 58745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 58742 59686 gene locus_tag LOCUS_17250 58742 59686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 <63171 59945 gene locus_tag LOCUS_17260 <63171 59945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140137.1:peptidoglycan -binding protein >Feature sequence018 1178 969 gene locus_tag LOCUS_17270 1178 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1332 1649 gene locus_tag LOCUS_17280 1332 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3105 1888 gene locus_tag LOCUS_17290 3105 1888 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 protein_id gnl|my_center|LOCUS_17290 4182 3190 gene locus_tag LOCUS_17300 4182 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 7130 4242 gene locus_tag LOCUS_17310 7130 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 8965 7154 gene locus_tag LOCUS_17320 8965 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 10460 9051 gene locus_tag LOCUS_17330 10460 9051 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_17330 12627 10474 gene locus_tag LOCUS_17340 12627 10474 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_17340 12968 13489 gene locus_tag LOCUS_17350 12968 13489 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095190.1 protein_id gnl|my_center|LOCUS_17350 14458 13523 gene locus_tag LOCUS_17360 14458 13523 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080854800.1 protein_id gnl|my_center|LOCUS_17360 15462 14449 gene locus_tag LOCUS_17370 15462 14449 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967329.1 protein_id gnl|my_center|LOCUS_17370 16154 15459 gene locus_tag LOCUS_17380 16154 15459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 16283 17245 gene locus_tag LOCUS_17390 16283 17245 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338243.1 protein_id gnl|my_center|LOCUS_17390 17229 17975 gene locus_tag LOCUS_17400 17229 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 17992 18552 gene locus_tag LOCUS_17410 17992 18552 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_17410 18707 19438 gene locus_tag LOCUS_17420 18707 19438 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086187.1 protein_id gnl|my_center|LOCUS_17420 19441 20154 gene locus_tag LOCUS_17430 gene pgmB 19441 20154 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257887.1 protein_id gnl|my_center|LOCUS_17430 20170 22488 gene locus_tag LOCUS_17440 20170 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 22850 22521 gene locus_tag LOCUS_17450 22850 22521 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087423.1 protein_id gnl|my_center|LOCUS_17450 23803 22847 gene locus_tag LOCUS_17460 23803 22847 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967060.1 protein_id gnl|my_center|LOCUS_17460 24653 24027 gene locus_tag LOCUS_17470 24653 24027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 25227 25421 gene locus_tag LOCUS_17480 25227 25421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 25414 26067 gene locus_tag LOCUS_17490 25414 26067 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390364.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17490 26423 26094 gene locus_tag LOCUS_17500 26423 26094 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384063.1 protein_id gnl|my_center|LOCUS_17500 26926 26585 gene locus_tag LOCUS_17510 26926 26585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 27304 29289 gene locus_tag LOCUS_17520 gene parE 27304 29289 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390520.1 protein_id gnl|my_center|LOCUS_17520 29644 29375 gene locus_tag LOCUS_17530 29644 29375 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_17530 29871 30788 gene locus_tag LOCUS_17540 gene murQ 29871 30788 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 protein_id gnl|my_center|LOCUS_17540 30785 31921 gene locus_tag LOCUS_17550 gene nagA 30785 31921 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038508.1 protein_id gnl|my_center|LOCUS_17550 33355 31922 gene locus_tag LOCUS_17560 33355 31922 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_17560 34626 34955 gene locus_tag LOCUS_17570 34626 34955 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228510.1 protein_id gnl|my_center|LOCUS_17570 34961 35320 gene locus_tag LOCUS_17580 34961 35320 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888442.1 protein_id gnl|my_center|LOCUS_17580 35597 36745 gene locus_tag LOCUS_17590 35597 36745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 37236 37529 gene locus_tag LOCUS_17600 37236 37529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 38054 37713 gene locus_tag LOCUS_17610 38054 37713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 38283 38047 gene locus_tag LOCUS_17620 38283 38047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 38934 38395 gene locus_tag LOCUS_17630 38934 38395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 39440 39081 gene locus_tag LOCUS_17640 39440 39081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 40100 39501 gene locus_tag LOCUS_17650 40100 39501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 40845 40243 gene locus_tag LOCUS_17660 40845 40243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 43462 41360 gene locus_tag LOCUS_17670 gene brxL 43462 41360 CDS product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 protein_id gnl|my_center|LOCUS_17670 45416 43452 gene locus_tag LOCUS_17680 45416 43452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 45981 45640 gene locus_tag LOCUS_17690 45981 45640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 47786 45978 gene locus_tag LOCUS_17700 47786 45978 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140819.1 protein_id gnl|my_center|LOCUS_17700 48823 47783 gene locus_tag LOCUS_17710 48823 47783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 51603 49699 gene locus_tag LOCUS_17720 51603 49699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17720 55222 51608 gene locus_tag LOCUS_17730 gene brxC 55222 51608 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942753.1 protein_id gnl|my_center|LOCUS_17730 55824 55249 gene locus_tag LOCUS_17740 55824 55249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 56593 55805 gene locus_tag LOCUS_17750 56593 55805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 57075 56590 gene locus_tag LOCUS_17760 57075 56590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 57968 57282 gene locus_tag LOCUS_17770 57968 57282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 58518 59513 gene locus_tag LOCUS_17780 58518 59513 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974282.1 protein_id gnl|my_center|LOCUS_17780 61613 60267 gene locus_tag LOCUS_17790 61613 60267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 62313 61708 gene locus_tag LOCUS_17800 62313 61708 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275291.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence019 191 1003 gene locus_tag LOCUS_17810 191 1003 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229054.1 protein_id gnl|my_center|LOCUS_17810 1000 5724 gene locus_tag LOCUS_17820 1000 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 5734 9486 gene locus_tag LOCUS_17830 5734 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 9486 9899 gene locus_tag LOCUS_17840 9486 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 9997 10353 gene locus_tag LOCUS_17850 9997 10353 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807759.1 protein_id gnl|my_center|LOCUS_17850 11311 10616 gene locus_tag LOCUS_17860 11311 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 11448 12509 gene locus_tag LOCUS_17870 11448 12509 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_17870 13318 12539 gene locus_tag LOCUS_17880 13318 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 14448 13315 gene locus_tag LOCUS_17890 14448 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 14738 15787 gene locus_tag LOCUS_17900 14738 15787 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966058.1 protein_id gnl|my_center|LOCUS_17900 15853 16908 gene locus_tag LOCUS_17910 15853 16908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 17986 17057 gene locus_tag LOCUS_17920 17986 17057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 18411 19532 gene locus_tag LOCUS_17930 18411 19532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 19681 20919 gene locus_tag LOCUS_17940 gene trpB 19681 20919 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067442.1 protein_id gnl|my_center|LOCUS_17940 20916 21746 gene locus_tag LOCUS_17950 gene trpA 20916 21746 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083570.1 protein_id gnl|my_center|LOCUS_17950 21816 22682 gene locus_tag LOCUS_17960 gene accD 21816 22682 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626593.1 protein_id gnl|my_center|LOCUS_17960 22710 23999 gene locus_tag LOCUS_17970 22710 23999 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_17970 24110 24283 gene locus_tag LOCUS_17980 24110 24283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 24676 24347 gene locus_tag LOCUS_17990 gene trxA 24676 24347 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_17990 28168 24728 gene locus_tag LOCUS_18000 gene addA 28168 24728 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_18000 31095 28165 gene locus_tag LOCUS_18010 gene addB 31095 28165 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_18010 31823 31092 gene locus_tag LOCUS_18020 31823 31092 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_18020 32362 31820 gene locus_tag LOCUS_18030 32362 31820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 32361 33395 gene locus_tag LOCUS_18040 32361 33395 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391186.1 protein_id gnl|my_center|LOCUS_18040 33545 33790 gene locus_tag LOCUS_18050 33545 33790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 33796 35427 gene locus_tag LOCUS_18060 33796 35427 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764923.1 protein_id gnl|my_center|LOCUS_18060 35660 35463 gene locus_tag LOCUS_18070 35660 35463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 36615 37616 gene locus_tag LOCUS_18080 36615 37616 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992236.1 protein_id gnl|my_center|LOCUS_18080 37991 37704 gene locus_tag LOCUS_18090 37991 37704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 38209 37967 gene locus_tag LOCUS_18100 38209 37967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 38493 39749 gene locus_tag LOCUS_18110 38493 39749 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085770.1 protein_id gnl|my_center|LOCUS_18110 39761 42637 gene locus_tag LOCUS_18120 39761 42637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 42634 44775 gene locus_tag LOCUS_18130 42634 44775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 45066 46130 gene locus_tag LOCUS_18140 45066 46130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 47658 47467 gene locus_tag LOCUS_18150 47658 47467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 47692 49752 gene locus_tag LOCUS_18160 47692 49752 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_18160 49752 49979 gene locus_tag LOCUS_18170 49752 49979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 49976 52636 gene locus_tag LOCUS_18180 49976 52636 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 protein_id gnl|my_center|LOCUS_18180 52875 54452 gene locus_tag LOCUS_18190 52875 54452 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_18190 55163 54465 gene locus_tag LOCUS_18200 55163 54465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 55299 56858 gene locus_tag LOCUS_18210 55299 56858 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_18210 59009 57156 gene locus_tag LOCUS_18220 gene ilvD 59009 57156 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087307.1 protein_id gnl|my_center|LOCUS_18220 59345 59689 gene locus_tag LOCUS_18230 59345 59689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18230 60488 60871 gene locus_tag LOCUS_18240 60488 60871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence020 861 154 gene locus_tag LOCUS_18250 861 154 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971379.1 protein_id gnl|my_center|LOCUS_18250 2373 862 gene locus_tag LOCUS_18260 gene purF 2373 862 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388163.1 protein_id gnl|my_center|LOCUS_18260 2960 2394 gene locus_tag LOCUS_18270 2960 2394 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188369.1 protein_id gnl|my_center|LOCUS_18270 4418 3021 gene locus_tag LOCUS_18280 gene radA 4418 3021 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_18280 4856 5413 gene locus_tag LOCUS_18290 4856 5413 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 protein_id gnl|my_center|LOCUS_18290 5413 6516 gene locus_tag LOCUS_18300 5413 6516 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528501.1 protein_id gnl|my_center|LOCUS_18300 6563 8155 gene locus_tag LOCUS_18310 6563 8155 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 protein_id gnl|my_center|LOCUS_18310 8336 9022 gene locus_tag LOCUS_18320 8336 9022 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_18320 9013 10290 gene locus_tag LOCUS_18330 9013 10290 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 protein_id gnl|my_center|LOCUS_18330 10277 11242 gene locus_tag LOCUS_18340 gene lpxK 10277 11242 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 protein_id gnl|my_center|LOCUS_18340 11239 12183 gene locus_tag LOCUS_18350 11239 12183 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_18350 12691 12410 gene locus_tag LOCUS_18360 12691 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 13135 12776 gene locus_tag LOCUS_18370 gene queD 13135 12776 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008576903.1 protein_id gnl|my_center|LOCUS_18370 13764 13132 gene locus_tag LOCUS_18380 gene queE 13764 13132 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931061.1 protein_id gnl|my_center|LOCUS_18380 14286 15275 gene locus_tag LOCUS_18390 14286 15275 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_18390 15272 16216 gene locus_tag LOCUS_18400 15272 16216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_18400 16213 17151 gene locus_tag LOCUS_18410 16213 17151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_18410 17148 18284 gene locus_tag LOCUS_18420 17148 18284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_18420 18289 19419 gene locus_tag LOCUS_18430 18289 19419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_18430 21267 19408 gene locus_tag LOCUS_18440 21267 19408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 22601 21282 gene locus_tag LOCUS_18450 22601 21282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 23027 24199 gene locus_tag LOCUS_18460 23027 24199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 24499 24257 gene locus_tag LOCUS_18470 24499 24257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 25236 24496 gene locus_tag LOCUS_18480 25236 24496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 25495 26253 gene locus_tag LOCUS_18490 25495 26253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 26870 26373 gene locus_tag LOCUS_18500 26870 26373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 27936 26887 gene locus_tag LOCUS_18510 27936 26887 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938929.1 protein_id gnl|my_center|LOCUS_18510 28214 28735 gene locus_tag LOCUS_18520 28214 28735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 28806 29966 gene locus_tag LOCUS_18530 28806 29966 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388860.1 protein_id gnl|my_center|LOCUS_18530 29974 31263 gene locus_tag LOCUS_18540 29974 31263 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_18540 31387 31869 gene locus_tag LOCUS_18550 31387 31869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 34036 31937 gene locus_tag LOCUS_18560 34036 31937 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389571.1 protein_id gnl|my_center|LOCUS_18560 34230 34036 gene locus_tag LOCUS_18570 34230 34036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 34238 34311 gene locus_tag LOCUS_t00220 34238 34311 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 34536 36215 gene locus_tag LOCUS_18580 gene ettA 34536 36215 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_18580 36455 36967 gene locus_tag LOCUS_18590 36455 36967 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918102.1 protein_id gnl|my_center|LOCUS_18590 36967 37374 gene locus_tag LOCUS_18600 36967 37374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 37559 37996 gene locus_tag LOCUS_18610 37559 37996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 39056 38088 gene locus_tag LOCUS_18620 gene metF 39056 38088 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 protein_id gnl|my_center|LOCUS_18620 39291 40094 gene locus_tag LOCUS_18630 39291 40094 CDS product MlaA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921519.1 protein_id gnl|my_center|LOCUS_18630 40126 40737 gene locus_tag LOCUS_18640 40126 40737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 40863 42941 gene locus_tag LOCUS_18650 gene ligA 40863 42941 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 protein_id gnl|my_center|LOCUS_18650 43056 43823 gene locus_tag LOCUS_18660 43056 43823 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015530.1 protein_id gnl|my_center|LOCUS_18660 49322 43860 gene locus_tag LOCUS_18670 49322 43860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 50092 49391 gene locus_tag LOCUS_18680 50092 49391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 50929 50108 gene locus_tag LOCUS_18690 50929 50108 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_18690 51141 51554 gene locus_tag LOCUS_18700 51141 51554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 51558 52742 gene locus_tag LOCUS_18710 51558 52742 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626572.1 protein_id gnl|my_center|LOCUS_18710 53191 52853 gene locus_tag LOCUS_18720 53191 52853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 53362 54276 gene locus_tag LOCUS_18730 53362 54276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258637.1 protein_id gnl|my_center|LOCUS_18730 55087 54425 gene locus_tag LOCUS_18740 55087 54425 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_18740 55717 55376 gene locus_tag LOCUS_18750 55717 55376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 56453 55737 gene locus_tag LOCUS_18760 56453 55737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 57515 56562 gene locus_tag LOCUS_18770 57515 56562 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310684.1 protein_id gnl|my_center|LOCUS_18770 58117 57548 gene locus_tag LOCUS_18780 58117 57548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 58413 58255 gene locus_tag LOCUS_18790 58413 58255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 58699 58418 gene locus_tag LOCUS_18800 58699 58418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence021 2476 1196 gene locus_tag LOCUS_18810 2476 1196 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205401.1 protein_id gnl|my_center|LOCUS_18810 3604 2654 gene locus_tag LOCUS_18820 gene pip 3604 2654 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_18820 3679 4041 gene locus_tag LOCUS_18830 3679 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 4038 4937 gene locus_tag LOCUS_18840 4038 4937 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_18840 5760 4978 gene locus_tag LOCUS_18850 5760 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 6935 5757 gene locus_tag LOCUS_18860 6935 5757 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083921.1 protein_id gnl|my_center|LOCUS_18860 8253 7003 gene locus_tag LOCUS_18870 8253 7003 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_18870 10265 8403 gene locus_tag LOCUS_18880 10265 8403 CDS product DUF3857 and transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037137.1 protein_id gnl|my_center|LOCUS_18880 10722 10423 gene locus_tag LOCUS_18890 gene rpmB 10722 10423 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387963.1 protein_id gnl|my_center|LOCUS_18890 11130 10822 gene locus_tag LOCUS_18900 11130 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 13876 11213 gene locus_tag LOCUS_18910 13876 11213 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_18910 13997 14950 gene locus_tag LOCUS_18920 13997 14950 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929723.1 protein_id gnl|my_center|LOCUS_18920 15069 16274 gene locus_tag LOCUS_18930 15069 16274 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388321.1 protein_id gnl|my_center|LOCUS_18930 16308 18134 gene locus_tag LOCUS_18940 16308 18134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930654.1 protein_id gnl|my_center|LOCUS_18940 18131 18871 gene locus_tag LOCUS_18950 18131 18871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086608.1 protein_id gnl|my_center|LOCUS_18950 18871 19572 gene locus_tag LOCUS_18960 18871 19572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086609.1 protein_id gnl|my_center|LOCUS_18960 19853 19620 gene locus_tag LOCUS_18970 19853 19620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 20874 20074 gene locus_tag LOCUS_18980 20874 20074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 21358 21795 gene locus_tag LOCUS_18990 21358 21795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 22484 21825 gene locus_tag LOCUS_19000 22484 21825 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114100.1 protein_id gnl|my_center|LOCUS_19000 26036 22572 gene locus_tag LOCUS_19010 26036 22572 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_19010 26291 26533 gene locus_tag LOCUS_19020 26291 26533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 26908 26618 gene locus_tag LOCUS_19030 26908 26618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 26799 27020 gene locus_tag LOCUS_19040 26799 27020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 28766 27081 gene locus_tag LOCUS_19050 28766 27081 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388393.1 protein_id gnl|my_center|LOCUS_19050 28981 28763 gene locus_tag LOCUS_19060 28981 28763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 29589 31493 gene locus_tag LOCUS_19070 29589 31493 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084127.1 protein_id gnl|my_center|LOCUS_19070 32333 31857 gene locus_tag LOCUS_19080 32333 31857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 33682 32333 gene locus_tag LOCUS_19090 33682 32333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 36694 33686 gene locus_tag LOCUS_19100 36694 33686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 37168 36698 gene locus_tag LOCUS_19110 37168 36698 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689064.1 protein_id gnl|my_center|LOCUS_19110 38109 37165 gene locus_tag LOCUS_19120 38109 37165 CDS product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951065.1 protein_id gnl|my_center|LOCUS_19120 38699 38106 gene locus_tag LOCUS_19130 38699 38106 CDS product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692874.1 protein_id gnl|my_center|LOCUS_19130 41644 38696 gene locus_tag LOCUS_19140 41644 38696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 41870 41670 gene locus_tag LOCUS_19150 41870 41670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 42268 41912 gene locus_tag LOCUS_19160 42268 41912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 43007 42273 gene locus_tag LOCUS_19170 43007 42273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 43210 43010 gene locus_tag LOCUS_19180 43210 43010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 43653 43222 gene locus_tag LOCUS_19190 43653 43222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 44135 43650 gene locus_tag LOCUS_19200 44135 43650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552548.1 protein_id gnl|my_center|LOCUS_19200 44662 44102 gene locus_tag LOCUS_19210 44662 44102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 44910 44662 gene locus_tag LOCUS_19220 44910 44662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 46426 44912 gene locus_tag LOCUS_19230 46426 44912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951063.1 protein_id gnl|my_center|LOCUS_19230 47912 46440 gene locus_tag LOCUS_19240 47912 46440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 48594 48184 gene locus_tag LOCUS_19250 48594 48184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 49324 48686 gene locus_tag LOCUS_19260 49324 48686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 49539 49321 gene locus_tag LOCUS_19270 49539 49321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 50094 49807 gene locus_tag LOCUS_19280 50094 49807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 52544 50091 gene locus_tag LOCUS_19290 52544 50091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 52840 52541 gene locus_tag LOCUS_19300 52840 52541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 54171 52837 gene locus_tag LOCUS_19310 54171 52837 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889353.1 protein_id gnl|my_center|LOCUS_19310 54691 54173 gene locus_tag LOCUS_19320 54691 54173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 55014 54718 gene locus_tag LOCUS_19330 55014 54718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 protein_id gnl|my_center|LOCUS_19330 55361 55014 gene locus_tag LOCUS_19340 55361 55014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 55570 55358 gene locus_tag LOCUS_19350 55570 55358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 56184 55570 gene locus_tag LOCUS_19360 56184 55570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 56630 56181 gene locus_tag LOCUS_19370 56630 56181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 57101 56646 gene locus_tag LOCUS_19380 57101 56646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence022 <1 2622 gene locus_tag LOCUS_19390 <1 2622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004536696.1:ESPR-type extended signal peptide-containing protein 2624 5635 gene locus_tag LOCUS_19400 2624 5635 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918488.1 protein_id gnl|my_center|LOCUS_19400 5680 7578 gene locus_tag LOCUS_19410 5680 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 7884 8537 gene locus_tag LOCUS_19420 7884 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 9104 8538 gene locus_tag LOCUS_19430 9104 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 9874 9248 gene locus_tag LOCUS_19440 9874 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 10740 10096 gene locus_tag LOCUS_19450 10740 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 11429 10740 gene locus_tag LOCUS_19460 11429 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 12917 11445 gene locus_tag LOCUS_19470 gene tssC 12917 11445 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 protein_id gnl|my_center|LOCUS_19470 14773 12923 gene locus_tag LOCUS_19480 gene vgrG1b 14773 12923 CDS product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 protein_id gnl|my_center|LOCUS_19480 18448 14804 gene locus_tag LOCUS_19490 gene tssM 18448 14804 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 protein_id gnl|my_center|LOCUS_19490 19853 18459 gene locus_tag LOCUS_19500 gene tssL 19853 18459 CDS product type VI secretion system protein TssL, long form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973756.1 protein_id gnl|my_center|LOCUS_19500 21187 19826 gene locus_tag LOCUS_19510 gene tssK 21187 19826 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973757.1 protein_id gnl|my_center|LOCUS_19510 21717 21190 gene locus_tag LOCUS_19520 21717 21190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 23561 21906 gene locus_tag LOCUS_19530 gene tagH 23561 21906 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 protein_id gnl|my_center|LOCUS_19530 23526 24059 gene locus_tag LOCUS_19540 23526 24059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 25832 24072 gene locus_tag LOCUS_19550 25832 24072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 26373 25882 gene locus_tag LOCUS_19560 26373 25882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 26329 26532 gene locus_tag LOCUS_19570 26329 26532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 27301 26798 gene locus_tag LOCUS_19580 27301 26798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 28011 27331 gene locus_tag LOCUS_19590 28011 27331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 29979 28021 gene locus_tag LOCUS_19600 29979 28021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 31202 30075 gene locus_tag LOCUS_19610 31202 30075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 33912 31297 gene locus_tag LOCUS_19620 gene tssH 33912 31297 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 protein_id gnl|my_center|LOCUS_19620 35090 33984 gene locus_tag LOCUS_19630 gene tssG 35090 33984 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 protein_id gnl|my_center|LOCUS_19630 36981 35098 gene locus_tag LOCUS_19640 gene tssF 36981 35098 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 protein_id gnl|my_center|LOCUS_19640 37490 36981 gene locus_tag LOCUS_19650 gene tssE 37490 36981 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104971.1 protein_id gnl|my_center|LOCUS_19650 38336 37494 gene locus_tag LOCUS_19660 gene tagJ 38336 37494 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_19660 38980 38369 gene locus_tag LOCUS_19670 38980 38369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 40503 39025 gene locus_tag LOCUS_19680 gene tssC 40503 39025 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 protein_id gnl|my_center|LOCUS_19680 41031 40507 gene locus_tag LOCUS_19690 gene tssB 41031 40507 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 protein_id gnl|my_center|LOCUS_19690 42180 41122 gene locus_tag LOCUS_19700 gene tssA 42180 41122 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115054.1 protein_id gnl|my_center|LOCUS_19700 45851 42336 gene locus_tag LOCUS_19710 gene tssM 45851 42336 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 protein_id gnl|my_center|LOCUS_19710 47269 45866 gene locus_tag LOCUS_19720 47269 45866 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115051.1 protein_id gnl|my_center|LOCUS_19720 47525 48274 gene locus_tag LOCUS_19730 47525 48274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 48360 48725 gene locus_tag LOCUS_19740 48360 48725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 49941 48832 gene locus_tag LOCUS_19750 49941 48832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 50082 50402 gene locus_tag LOCUS_19760 50082 50402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 50405 50992 gene locus_tag LOCUS_19770 50405 50992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 50989 51723 gene locus_tag LOCUS_19780 gene pppA 50989 51723 CDS product serine/threonine phosphatase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_19780 51845 52849 gene locus_tag LOCUS_19790 51845 52849 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939726.1 protein_id gnl|my_center|LOCUS_19790 53160 54359 gene locus_tag LOCUS_19800 53160 54359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence023 604 98 gene locus_tag LOCUS_19810 604 98 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_19810 1836 607 gene locus_tag LOCUS_19820 1836 607 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330161.1 protein_id gnl|my_center|LOCUS_19820 1955 3100 gene locus_tag LOCUS_19830 1955 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3339 3157 gene locus_tag LOCUS_19840 3339 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 3733 3269 gene locus_tag LOCUS_19850 3733 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3763 4743 gene locus_tag LOCUS_19860 3763 4743 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 protein_id gnl|my_center|LOCUS_19860 4740 8225 gene locus_tag LOCUS_19870 gene metH 4740 8225 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389284.1 protein_id gnl|my_center|LOCUS_19870 9030 8359 gene locus_tag LOCUS_19880 9030 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 9152 10816 gene locus_tag LOCUS_19890 9152 10816 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_19890 10842 11207 gene locus_tag LOCUS_19900 10842 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 11204 12538 gene locus_tag LOCUS_19910 gene gltX 11204 12538 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388446.1 protein_id gnl|my_center|LOCUS_19910 12661 15000 gene locus_tag LOCUS_19920 gene bamA 12661 15000 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 protein_id gnl|my_center|LOCUS_19920 15004 15855 gene locus_tag LOCUS_19930 15004 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 15858 16988 gene locus_tag LOCUS_19940 gene lpxD 15858 16988 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969259.1 protein_id gnl|my_center|LOCUS_19940 16994 17503 gene locus_tag LOCUS_19950 gene fabZ 16994 17503 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_19950 17505 18317 gene locus_tag LOCUS_19960 gene lpxA 17505 18317 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_19960 18629 18372 gene locus_tag LOCUS_19970 18629 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 18831 19676 gene locus_tag LOCUS_19980 gene lpxI 18831 19676 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 protein_id gnl|my_center|LOCUS_19980 19676 20074 gene locus_tag LOCUS_19990 gene gloA 19676 20074 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210948.1 protein_id gnl|my_center|LOCUS_19990 20087 21433 gene locus_tag LOCUS_20000 20087 21433 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338326.1 protein_id gnl|my_center|LOCUS_20000 21430 22290 gene locus_tag LOCUS_20010 21430 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 22401 22838 gene locus_tag LOCUS_20020 22401 22838 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965897.1 protein_id gnl|my_center|LOCUS_20020 23686 23877 gene locus_tag LOCUS_20030 23686 23877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 23877 24827 gene locus_tag LOCUS_20040 23877 24827 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_20040 24827 25972 gene locus_tag LOCUS_20050 24827 25972 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_20050 26983 26150 gene locus_tag LOCUS_20060 26983 26150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 27149 29788 gene locus_tag LOCUS_20070 gene alaS 27149 29788 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390445.1 protein_id gnl|my_center|LOCUS_20070 30485 29853 gene locus_tag LOCUS_20080 30485 29853 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809129.1 protein_id gnl|my_center|LOCUS_20080 30478 30681 gene locus_tag LOCUS_20090 30478 30681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 30766 31458 gene locus_tag LOCUS_20100 30766 31458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 31505 31969 gene locus_tag LOCUS_20110 31505 31969 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388632.1 protein_id gnl|my_center|LOCUS_20110 32141 33343 gene locus_tag LOCUS_20120 32141 33343 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_20120 34986 33376 gene locus_tag LOCUS_20130 34986 33376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 35740 35165 gene locus_tag LOCUS_20140 35740 35165 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389412.1 protein_id gnl|my_center|LOCUS_20140 36262 37779 gene locus_tag LOCUS_20150 36262 37779 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_20150 38097 37804 gene locus_tag LOCUS_20160 38097 37804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 38188 38673 gene locus_tag LOCUS_20170 38188 38673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 39788 40081 gene locus_tag LOCUS_20180 39788 40081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 41967 40303 gene locus_tag LOCUS_20190 41967 40303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 42061 42207 gene locus_tag LOCUS_20200 42061 42207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 42218 43108 gene locus_tag LOCUS_20210 gene xerD 42218 43108 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970125.1 protein_id gnl|my_center|LOCUS_20210 43140 44096 gene locus_tag LOCUS_20220 43140 44096 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625895.1 protein_id gnl|my_center|LOCUS_20220 44243 45667 gene locus_tag LOCUS_20230 44243 45667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 45745 46863 gene locus_tag LOCUS_20240 45745 46863 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_20240 46904 47785 gene locus_tag LOCUS_20250 46904 47785 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_20250 47795 48637 gene locus_tag LOCUS_20260 47795 48637 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944004.1 protein_id gnl|my_center|LOCUS_20260 48634 49437 gene locus_tag LOCUS_20270 48634 49437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_20270 49434 50168 gene locus_tag LOCUS_20280 49434 50168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_20280 51374 50328 gene locus_tag LOCUS_20290 51374 50328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 51651 52964 gene locus_tag LOCUS_20300 51651 52964 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085208.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence024 5145 5525 gene locus_tag LOCUS_20310 5145 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 5607 5924 gene locus_tag LOCUS_20320 5607 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 6884 5949 gene locus_tag LOCUS_20330 6884 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 7071 7262 gene locus_tag LOCUS_20340 7071 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 7574 8107 gene locus_tag LOCUS_20350 7574 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 8114 9013 gene locus_tag LOCUS_20360 gene cpaB 8114 9013 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205080.1 protein_id gnl|my_center|LOCUS_20360 9021 10460 gene locus_tag LOCUS_20370 9021 10460 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647881.1 protein_id gnl|my_center|LOCUS_20370 10457 10837 gene locus_tag LOCUS_20380 10457 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 10834 12036 gene locus_tag LOCUS_20390 10834 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 12039 13418 gene locus_tag LOCUS_20400 12039 13418 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086278.1 protein_id gnl|my_center|LOCUS_20400 13428 14399 gene locus_tag LOCUS_20410 13428 14399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 14418 15356 gene locus_tag LOCUS_20420 14418 15356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 15712 16386 gene locus_tag LOCUS_20430 15712 16386 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312933.1 protein_id gnl|my_center|LOCUS_20430 16638 16429 gene locus_tag LOCUS_20440 16638 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 16805 18085 gene locus_tag LOCUS_20450 16805 18085 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531999.1 protein_id gnl|my_center|LOCUS_20450 18085 18582 gene locus_tag LOCUS_20460 18085 18582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 18587 18982 gene locus_tag LOCUS_20470 18587 18982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 20474 19005 gene locus_tag LOCUS_20480 gene rfaE1 20474 19005 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_20480 20933 21307 gene locus_tag LOCUS_20490 20933 21307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 22771 21506 gene locus_tag LOCUS_20500 22771 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 23276 22833 gene locus_tag LOCUS_20510 23276 22833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 24825 23287 gene locus_tag LOCUS_20520 24825 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 25679 24822 gene locus_tag LOCUS_20530 25679 24822 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230355.1 protein_id gnl|my_center|LOCUS_20530 27075 25660 gene locus_tag LOCUS_20540 gene zraR 27075 25660 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 protein_id gnl|my_center|LOCUS_20540 29998 27833 gene locus_tag LOCUS_20550 29998 27833 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_20550 30596 30036 gene locus_tag LOCUS_20560 30596 30036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 31234 30734 gene locus_tag LOCUS_20570 31234 30734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 31569 31231 gene locus_tag LOCUS_20580 31569 31231 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564244.1 protein_id gnl|my_center|LOCUS_20580 32216 31590 gene locus_tag LOCUS_20590 32216 31590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 32523 32263 gene locus_tag LOCUS_20600 32523 32263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 33300 32566 gene locus_tag LOCUS_20610 33300 32566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 33723 33358 gene locus_tag LOCUS_20620 33723 33358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 34102 33791 gene locus_tag LOCUS_20630 34102 33791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 35145 34099 gene locus_tag LOCUS_20640 35145 34099 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339432.1 protein_id gnl|my_center|LOCUS_20640 35972 35142 gene locus_tag LOCUS_20650 35972 35142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 36291 36073 gene locus_tag LOCUS_20660 36291 36073 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_20660 36753 38501 gene locus_tag LOCUS_20670 gene kaiC 36753 38501 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_20670 38498 38866 gene locus_tag LOCUS_20680 38498 38866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 38863 41796 gene locus_tag LOCUS_20690 38863 41796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 41789 42250 gene locus_tag LOCUS_20700 41789 42250 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_20700 42264 44414 gene locus_tag LOCUS_20710 42264 44414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 44414 46198 gene locus_tag LOCUS_20720 44414 46198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 46347 46919 gene locus_tag LOCUS_20730 46347 46919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 51534 47515 gene locus_tag LOCUS_20740 51534 47515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 51433 51948 gene locus_tag LOCUS_20750 51433 51948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence025 3191 2145 gene locus_tag LOCUS_20760 gene cobW 3191 2145 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388429.1 protein_id gnl|my_center|LOCUS_20760 3484 3188 gene locus_tag LOCUS_20770 3484 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 3727 4335 gene locus_tag LOCUS_20780 gene cobO 3727 4335 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531120.1 protein_id gnl|my_center|LOCUS_20780 5177 4380 gene locus_tag LOCUS_20790 gene cobA 5177 4380 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932082.1 protein_id gnl|my_center|LOCUS_20790 5692 5174 gene locus_tag LOCUS_20800 gene cobU 5692 5174 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552342.1 protein_id gnl|my_center|LOCUS_20800 6481 5696 gene locus_tag LOCUS_20810 6481 5696 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060749.1 protein_id gnl|my_center|LOCUS_20810 7230 6478 gene locus_tag LOCUS_20820 gene cbiQ 7230 6478 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030565.1 protein_id gnl|my_center|LOCUS_20820 7525 7214 gene locus_tag LOCUS_20830 7525 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 8196 7522 gene locus_tag LOCUS_20840 8196 7522 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030567.1 protein_id gnl|my_center|LOCUS_20840 9673 8222 gene locus_tag LOCUS_20850 9673 8222 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392614.1 protein_id gnl|my_center|LOCUS_20850 10644 9670 gene locus_tag LOCUS_20860 10644 9670 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926108.1 protein_id gnl|my_center|LOCUS_20860 11545 10649 gene locus_tag LOCUS_20870 gene cbiB 11545 10649 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174539.1 protein_id gnl|my_center|LOCUS_20870 11988 11542 gene locus_tag LOCUS_20880 11988 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 12188 12003 gene locus_tag LOCUS_20890 12188 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 12371 13747 gene locus_tag LOCUS_20900 gene tcuA 12371 13747 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_20900 13734 14516 gene locus_tag LOCUS_20910 13734 14516 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390736.1 protein_id gnl|my_center|LOCUS_20910 15123 14587 gene locus_tag LOCUS_20920 15123 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 15437 15120 gene locus_tag LOCUS_20930 15437 15120 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389358.1 protein_id gnl|my_center|LOCUS_20930 16485 15532 gene locus_tag LOCUS_20940 16485 15532 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389357.1 protein_id gnl|my_center|LOCUS_20940 17686 16547 gene locus_tag LOCUS_20950 gene plsX 17686 16547 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389356.1 protein_id gnl|my_center|LOCUS_20950 17996 17793 gene locus_tag LOCUS_20960 gene rpmF 17996 17793 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_20960 18666 18157 gene locus_tag LOCUS_20970 18666 18157 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087783.1 protein_id gnl|my_center|LOCUS_20970 19202 18663 gene locus_tag LOCUS_20980 19202 18663 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 protein_id gnl|my_center|LOCUS_20980 19396 19917 gene locus_tag LOCUS_20990 19396 19917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 20951 19989 gene locus_tag LOCUS_21000 gene thiL 20951 19989 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 protein_id gnl|my_center|LOCUS_21000 21483 20965 gene locus_tag LOCUS_21010 gene nusB 21483 20965 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841646.1 protein_id gnl|my_center|LOCUS_21010 21965 21483 gene locus_tag LOCUS_21020 21965 21483 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720942.1 protein_id gnl|my_center|LOCUS_21020 23083 21962 gene locus_tag LOCUS_21030 gene ribB 23083 21962 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_21030 23679 23080 gene locus_tag LOCUS_21040 23679 23080 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_21040 24755 23679 gene locus_tag LOCUS_21050 gene ribD 24755 23679 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_21050 25236 24781 gene locus_tag LOCUS_21060 gene nrdR 25236 24781 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389579.1 protein_id gnl|my_center|LOCUS_21060 26611 25304 gene locus_tag LOCUS_21070 26611 25304 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338519.1 protein_id gnl|my_center|LOCUS_21070 27075 26623 gene locus_tag LOCUS_21080 gene rpiB 27075 26623 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_21080 27766 27329 gene locus_tag LOCUS_21090 27766 27329 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085738.1 protein_id gnl|my_center|LOCUS_21090 28030 28398 gene locus_tag LOCUS_21100 28030 28398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 30415 28358 gene locus_tag LOCUS_21110 30415 28358 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_21110 31656 30502 gene locus_tag LOCUS_21120 31656 30502 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626386.1 protein_id gnl|my_center|LOCUS_21120 32151 31684 gene locus_tag LOCUS_21130 32151 31684 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_21130 33657 32167 gene locus_tag LOCUS_21140 33657 32167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 33852 34208 gene locus_tag LOCUS_21150 33852 34208 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390193.1 protein_id gnl|my_center|LOCUS_21150 34225 34734 gene locus_tag LOCUS_21160 gene mlaD 34225 34734 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 protein_id gnl|my_center|LOCUS_21160 34731 34952 gene locus_tag LOCUS_21170 34731 34952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214913.1 protein_id gnl|my_center|LOCUS_21170 34949 35443 gene locus_tag LOCUS_21180 34949 35443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 35693 37060 gene locus_tag LOCUS_21190 35693 37060 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 protein_id gnl|my_center|LOCUS_21190 37089 40193 gene locus_tag LOCUS_21200 37089 40193 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204974.1 protein_id gnl|my_center|LOCUS_21200 40190 43456 gene locus_tag LOCUS_21210 40190 43456 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521877.1 protein_id gnl|my_center|LOCUS_21210 43453 44895 gene locus_tag LOCUS_21220 43453 44895 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21220 46514 44970 gene locus_tag LOCUS_21230 46514 44970 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_21230 49690 46520 gene locus_tag LOCUS_21240 49690 46520 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085816.1 protein_id gnl|my_center|LOCUS_21240 51084 49867 gene locus_tag LOCUS_21250 51084 49867 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085815.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence026 <1 2325 gene locus_tag LOCUS_21260 <1 2325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388124.1:DUF4159 domain-containing protein 2367 4466 gene locus_tag LOCUS_21270 2367 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388125.1 protein_id gnl|my_center|LOCUS_21270 4565 5014 gene locus_tag LOCUS_21280 4565 5014 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403782.1 protein_id gnl|my_center|LOCUS_21280 5029 5670 gene locus_tag LOCUS_21290 5029 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 6542 5757 gene locus_tag LOCUS_21300 6542 5757 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991722.1 protein_id gnl|my_center|LOCUS_21300 7481 6561 gene locus_tag LOCUS_21310 7481 6561 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_21310 8660 7485 gene locus_tag LOCUS_21320 gene chrA 8660 7485 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555966.1 protein_id gnl|my_center|LOCUS_21320 8997 8665 gene locus_tag LOCUS_21330 8997 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 9200 9009 gene locus_tag LOCUS_21340 9200 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 9111 9416 gene locus_tag LOCUS_21350 9111 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 11355 9436 gene locus_tag LOCUS_21360 11355 9436 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357009.1 protein_id gnl|my_center|LOCUS_21360 11513 12448 gene locus_tag LOCUS_21370 11513 12448 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390856.1 protein_id gnl|my_center|LOCUS_21370 12571 13665 gene locus_tag LOCUS_21380 12571 13665 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234837588.1 protein_id gnl|my_center|LOCUS_21380 13655 15673 gene locus_tag LOCUS_21390 13655 15673 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085096.1 protein_id gnl|my_center|LOCUS_21390 18863 15705 gene locus_tag LOCUS_21400 18863 15705 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140808.1 protein_id gnl|my_center|LOCUS_21400 20041 18875 gene locus_tag LOCUS_21410 20041 18875 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928611.1 protein_id gnl|my_center|LOCUS_21410 20269 21198 gene locus_tag LOCUS_21420 20269 21198 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084071.1 protein_id gnl|my_center|LOCUS_21420 21795 21274 gene locus_tag LOCUS_21430 21795 21274 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087466.1 protein_id gnl|my_center|LOCUS_21430 22038 24896 gene locus_tag LOCUS_21440 gene uvrA 22038 24896 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_21440 25729 25100 gene locus_tag LOCUS_21450 25729 25100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 27083 25980 gene locus_tag LOCUS_21460 27083 25980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 27679 27209 gene locus_tag LOCUS_21470 27679 27209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 28104 28766 gene locus_tag LOCUS_21480 28104 28766 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_21480 29385 28906 gene locus_tag LOCUS_21490 29385 28906 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094773.1 protein_id gnl|my_center|LOCUS_21490 29568 30032 gene locus_tag LOCUS_21500 gene rplM 29568 30032 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532205.1 protein_id gnl|my_center|LOCUS_21500 30037 30528 gene locus_tag LOCUS_21510 gene rpsI 30037 30528 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384467.1 protein_id gnl|my_center|LOCUS_21510 30656 31591 gene locus_tag LOCUS_21520 gene argC 30656 31591 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_21520 31584 32120 gene locus_tag LOCUS_21530 31584 32120 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_21530 33991 32189 gene locus_tag LOCUS_21540 gene phaC 33991 32189 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_21540 34162 35100 gene locus_tag LOCUS_21550 34162 35100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 35194 36423 gene locus_tag LOCUS_21560 35194 36423 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390164.1 protein_id gnl|my_center|LOCUS_21560 36423 37712 gene locus_tag LOCUS_21570 36423 37712 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390163.1 protein_id gnl|my_center|LOCUS_21570 37738 38736 gene locus_tag LOCUS_21580 gene glpX 37738 38736 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442341.1 protein_id gnl|my_center|LOCUS_21580 38758 40551 gene locus_tag LOCUS_21590 gene recJ 38758 40551 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_21590 40863 41081 gene locus_tag LOCUS_21600 40863 41081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 43176 41203 gene locus_tag LOCUS_21610 43176 41203 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389829.1 protein_id gnl|my_center|LOCUS_21610 44248 43256 gene locus_tag LOCUS_21620 gene epmA 44248 43256 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918606.1 protein_id gnl|my_center|LOCUS_21620 44249 45316 gene locus_tag LOCUS_21630 44249 45316 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918602.1 protein_id gnl|my_center|LOCUS_21630 45313 46140 gene locus_tag LOCUS_21640 45313 46140 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_21640 46865 46164 gene locus_tag LOCUS_21650 46865 46164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 47663 47025 gene locus_tag LOCUS_21660 47663 47025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 48092 47778 gene locus_tag LOCUS_21670 48092 47778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 47983 48195 gene locus_tag LOCUS_21680 47983 48195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 48255 48803 gene locus_tag LOCUS_21690 gene efp 48255 48803 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388832.1 protein_id gnl|my_center|LOCUS_21690 48828 49667 gene locus_tag LOCUS_21700 48828 49667 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence027 <1 1823 gene locus_tag LOCUS_21710 <1 1823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050983976.1:DUF3141 domain-containing protein 1816 2781 gene locus_tag LOCUS_21720 1816 2781 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061604.1 protein_id gnl|my_center|LOCUS_21720 2792 3982 gene locus_tag LOCUS_21730 2792 3982 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_21730 4010 5272 gene locus_tag LOCUS_21740 4010 5272 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031025.1 protein_id gnl|my_center|LOCUS_21740 6695 5460 gene locus_tag LOCUS_21750 6695 5460 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210864.1 protein_id gnl|my_center|LOCUS_21750 7200 8534 gene locus_tag LOCUS_21760 7200 8534 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_21760 8542 9624 gene locus_tag LOCUS_21770 8542 9624 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_21770 9763 10476 gene locus_tag LOCUS_21780 9763 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 11593 10520 gene locus_tag LOCUS_21790 11593 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 11814 11635 gene locus_tag LOCUS_21800 11814 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 12349 11816 gene locus_tag LOCUS_21810 12349 11816 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_21810 13123 12641 gene locus_tag LOCUS_21820 gene rnhA 13123 12641 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036192.1 protein_id gnl|my_center|LOCUS_21820 14072 13113 gene locus_tag LOCUS_21830 14072 13113 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390801.1 protein_id gnl|my_center|LOCUS_21830 15065 14112 gene locus_tag LOCUS_21840 gene ispH 15065 14112 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084132.1 protein_id gnl|my_center|LOCUS_21840 15094 15777 gene locus_tag LOCUS_21850 15094 15777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 16179 17267 gene locus_tag LOCUS_21860 gene gcvT 16179 17267 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390799.1 protein_id gnl|my_center|LOCUS_21860 17281 17655 gene locus_tag LOCUS_21870 gene gcvH 17281 17655 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531953.1 protein_id gnl|my_center|LOCUS_21870 17652 20510 gene locus_tag LOCUS_21880 gene gcvP 17652 20510 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195877.1 protein_id gnl|my_center|LOCUS_21880 20515 21126 gene locus_tag LOCUS_21890 20515 21126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 21774 21226 gene locus_tag LOCUS_21900 21774 21226 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480501.1 protein_id gnl|my_center|LOCUS_21900 22412 21903 gene locus_tag LOCUS_21910 22412 21903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 22992 22423 gene locus_tag LOCUS_21920 22992 22423 CDS product ATP synthase F0 subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918255.1 protein_id gnl|my_center|LOCUS_21920 23293 23069 gene locus_tag LOCUS_21930 23293 23069 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390993.1 protein_id gnl|my_center|LOCUS_21930 24128 23373 gene locus_tag LOCUS_21940 24128 23373 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_21940 24518 24171 gene locus_tag LOCUS_21950 24518 24171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 24726 25541 gene locus_tag LOCUS_21960 24726 25541 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_21960 26348 25560 gene locus_tag LOCUS_21970 26348 25560 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329369.1 protein_id gnl|my_center|LOCUS_21970 27056 26445 gene locus_tag LOCUS_21980 27056 26445 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391361.1 protein_id gnl|my_center|LOCUS_21980 27976 27056 gene locus_tag LOCUS_21990 27976 27056 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528729.1 protein_id gnl|my_center|LOCUS_21990 28249 29271 gene locus_tag LOCUS_22000 gene hemE 28249 29271 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 protein_id gnl|my_center|LOCUS_22000 29293 30393 gene locus_tag LOCUS_22010 gene hemH 29293 30393 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391364.1 protein_id gnl|my_center|LOCUS_22010 30408 31088 gene locus_tag LOCUS_22020 30408 31088 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448378.1 protein_id gnl|my_center|LOCUS_22020 31085 31543 gene locus_tag LOCUS_22030 gene hemJ 31085 31543 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338807.1 protein_id gnl|my_center|LOCUS_22030 31918 33192 gene locus_tag LOCUS_22040 gene rho 31918 33192 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391366.1 protein_id gnl|my_center|LOCUS_22040 33939 33676 gene locus_tag LOCUS_22050 33939 33676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 34145 35458 gene locus_tag LOCUS_22060 gene ahcY 34145 35458 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_22060 35609 35932 gene locus_tag LOCUS_22070 35609 35932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 36098 36811 gene locus_tag LOCUS_22080 36098 36811 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089830.1 protein_id gnl|my_center|LOCUS_22080 36824 37474 gene locus_tag LOCUS_22090 36824 37474 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 protein_id gnl|my_center|LOCUS_22090 37805 37440 gene locus_tag LOCUS_22100 37805 37440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 37973 38048 gene locus_tag LOCUS_t00230 37973 38048 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 38430 38774 gene locus_tag LOCUS_22110 38430 38774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 40790 39390 gene locus_tag LOCUS_22120 40790 39390 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_22120 43012 41396 gene locus_tag LOCUS_22130 43012 41396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 43677 43114 gene locus_tag LOCUS_22140 43677 43114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 44491 43733 gene locus_tag LOCUS_22150 44491 43733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 44721 45152 gene locus_tag LOCUS_22160 44721 45152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 47751 45280 gene locus_tag LOCUS_22170 47751 45280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence028 914 576 gene locus_tag LOCUS_22180 914 576 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005386570.1 protein_id gnl|my_center|LOCUS_22180 1546 3255 gene locus_tag LOCUS_22190 gene kdpA 1546 3255 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529643.1 protein_id gnl|my_center|LOCUS_22190 3263 5362 gene locus_tag LOCUS_22200 gene kdpB 3263 5362 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391516.1 protein_id gnl|my_center|LOCUS_22200 5388 5987 gene locus_tag LOCUS_22210 5388 5987 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089516.1 protein_id gnl|my_center|LOCUS_22210 6000 8750 gene locus_tag LOCUS_22220 6000 8750 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529647.1 protein_id gnl|my_center|LOCUS_22220 8747 9607 gene locus_tag LOCUS_22230 8747 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 9610 9783 gene locus_tag LOCUS_22240 9610 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 9986 11293 gene locus_tag LOCUS_22250 9986 11293 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_22250 11375 12598 gene locus_tag LOCUS_22260 11375 12598 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_22260 13430 12915 gene locus_tag LOCUS_22270 13430 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 13740 14483 gene locus_tag LOCUS_22280 13740 14483 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809144.1 protein_id gnl|my_center|LOCUS_22280 14489 15436 gene locus_tag LOCUS_22290 14489 15436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 15439 17379 gene locus_tag LOCUS_22300 15439 17379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 17554 17841 gene locus_tag LOCUS_22310 17554 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 18319 17861 gene locus_tag LOCUS_22320 18319 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 18538 18759 gene locus_tag LOCUS_22330 18538 18759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 19206 21785 gene locus_tag LOCUS_22340 19206 21785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 22962 21907 gene locus_tag LOCUS_22350 gene dctP 22962 21907 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087202.1 protein_id gnl|my_center|LOCUS_22350 23826 23452 gene locus_tag LOCUS_22360 23826 23452 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532440.1 protein_id gnl|my_center|LOCUS_22360 24769 23861 gene locus_tag LOCUS_22370 24769 23861 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970180.1 protein_id gnl|my_center|LOCUS_22370 25610 24792 gene locus_tag LOCUS_22380 25610 24792 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971164.1 protein_id gnl|my_center|LOCUS_22380 25717 26715 gene locus_tag LOCUS_22390 25717 26715 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972405.1 protein_id gnl|my_center|LOCUS_22390 27773 26724 gene locus_tag LOCUS_22400 27773 26724 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966058.1 protein_id gnl|my_center|LOCUS_22400 29359 29622 gene locus_tag LOCUS_22410 29359 29622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 29855 31156 gene locus_tag LOCUS_22420 29855 31156 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097074.1 protein_id gnl|my_center|LOCUS_22420 31449 31216 gene locus_tag LOCUS_22430 31449 31216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 32664 31555 gene locus_tag LOCUS_22440 32664 31555 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_22440 35500 33005 gene locus_tag LOCUS_22450 35500 33005 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171190.1 protein_id gnl|my_center|LOCUS_22450 35572 36321 gene locus_tag LOCUS_22460 35572 36321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 37732 36644 gene locus_tag LOCUS_22470 gene mutY 37732 36644 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_22470 37743 38264 gene locus_tag LOCUS_22480 37743 38264 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390998.1 protein_id gnl|my_center|LOCUS_22480 38319 38936 gene locus_tag LOCUS_22490 38319 38936 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967973.1 protein_id gnl|my_center|LOCUS_22490 38967 42824 gene locus_tag LOCUS_22500 38967 42824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 43045 43266 gene locus_tag LOCUS_22510 43045 43266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 43269 43529 gene locus_tag LOCUS_22520 43269 43529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 43526 43840 gene locus_tag LOCUS_22530 43526 43840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 43953 45080 gene locus_tag LOCUS_22540 43953 45080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence029 189 2096 gene locus_tag LOCUS_22550 189 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2768 2148 gene locus_tag LOCUS_22560 2768 2148 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_22560 2992 3144 gene locus_tag LOCUS_22570 2992 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3453 3378 gene locus_tag LOCUS_t00240 3453 3378 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4121 3531 gene locus_tag LOCUS_22580 4121 3531 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389495.1 protein_id gnl|my_center|LOCUS_22580 4651 4118 gene locus_tag LOCUS_22590 gene coaD 4651 4118 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389496.1 protein_id gnl|my_center|LOCUS_22590 7451 4644 gene locus_tag LOCUS_22600 gene gyrA 7451 4644 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087464.1 protein_id gnl|my_center|LOCUS_22600 8685 7630 gene locus_tag LOCUS_22610 8685 7630 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864506.1 protein_id gnl|my_center|LOCUS_22610 9520 8771 gene locus_tag LOCUS_22620 9520 8771 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_22620 9567 10736 gene locus_tag LOCUS_22630 9567 10736 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211860579.1 protein_id gnl|my_center|LOCUS_22630 10736 11752 gene locus_tag LOCUS_22640 10736 11752 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_22640 12544 11777 gene locus_tag LOCUS_22650 12544 11777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815979.1 protein_id gnl|my_center|LOCUS_22650 13562 12627 gene locus_tag LOCUS_22660 13562 12627 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 protein_id gnl|my_center|LOCUS_22660 13773 14465 gene locus_tag LOCUS_22670 13773 14465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 14462 15151 gene locus_tag LOCUS_22680 14462 15151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 16123 16335 gene locus_tag LOCUS_22690 16123 16335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 17988 16381 gene locus_tag LOCUS_22700 17988 16381 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811087.1 protein_id gnl|my_center|LOCUS_22700 18191 18988 gene locus_tag LOCUS_22710 18191 18988 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_22710 18988 19788 gene locus_tag LOCUS_22720 18988 19788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089645.1 protein_id gnl|my_center|LOCUS_22720 20881 19913 gene locus_tag LOCUS_22730 20881 19913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 21106 21564 gene locus_tag LOCUS_22740 21106 21564 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083047.1 protein_id gnl|my_center|LOCUS_22740 22383 21565 gene locus_tag LOCUS_22750 22383 21565 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_22750 22434 23192 gene locus_tag LOCUS_22760 22434 23192 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085024.1 protein_id gnl|my_center|LOCUS_22760 23853 23314 gene locus_tag LOCUS_22770 23853 23314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 24888 24376 gene locus_tag LOCUS_22780 24888 24376 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_22780 26683 25028 gene locus_tag LOCUS_22790 26683 25028 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387881.1 protein_id gnl|my_center|LOCUS_22790 26881 28485 gene locus_tag LOCUS_22800 gene dppA 26881 28485 CDS product dipeptide ABC transporter substrate-binding protein DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222871.1 protein_id gnl|my_center|LOCUS_22800 28485 29489 gene locus_tag LOCUS_22810 28485 29489 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525885.1 protein_id gnl|my_center|LOCUS_22810 29486 30400 gene locus_tag LOCUS_22820 gene dppC 29486 30400 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209563.1 protein_id gnl|my_center|LOCUS_22820 30400 31368 gene locus_tag LOCUS_22830 30400 31368 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390112.1 protein_id gnl|my_center|LOCUS_22830 31365 32330 gene locus_tag LOCUS_22840 31365 32330 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 protein_id gnl|my_center|LOCUS_22840 32375 32905 gene locus_tag LOCUS_22850 gene ppa 32375 32905 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330115.1 protein_id gnl|my_center|LOCUS_22850 32989 33204 gene locus_tag LOCUS_22860 32989 33204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 33982 33197 gene locus_tag LOCUS_22870 33982 33197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 35130 33979 gene locus_tag LOCUS_22880 35130 33979 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_22880 35687 35127 gene locus_tag LOCUS_22890 35687 35127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169971.1 protein_id gnl|my_center|LOCUS_22890 35837 37624 gene locus_tag LOCUS_22900 35837 37624 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 protein_id gnl|my_center|LOCUS_22900 37658 38929 gene locus_tag LOCUS_22910 37658 38929 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_22910 39021 39338 gene locus_tag LOCUS_22920 39021 39338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 40530 39385 gene locus_tag LOCUS_22930 40530 39385 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965168.1 protein_id gnl|my_center|LOCUS_22930 41233 40553 gene locus_tag LOCUS_22940 41233 40553 CDS product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528376.1 protein_id gnl|my_center|LOCUS_22940 42363 41233 gene locus_tag LOCUS_22950 42363 41233 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113124.1 protein_id gnl|my_center|LOCUS_22950 42590 42360 gene locus_tag LOCUS_22960 42590 42360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 42583 43104 gene locus_tag LOCUS_22970 42583 43104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 44358 43123 gene locus_tag LOCUS_22980 44358 43123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 45357 44539 gene locus_tag LOCUS_22990 gene panB 45357 44539 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391068.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence030 3919 4827 gene locus_tag LOCUS_23000 3919 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 6316 5180 gene locus_tag LOCUS_23010 6316 5180 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_23010 7200 6316 gene locus_tag LOCUS_23020 7200 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 8211 7234 gene locus_tag LOCUS_23030 8211 7234 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_23030 8638 8477 gene locus_tag LOCUS_23040 8638 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 9142 8942 gene locus_tag LOCUS_23050 9142 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 9134 9724 gene locus_tag LOCUS_23060 9134 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 9978 9751 gene locus_tag LOCUS_23070 9978 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 10074 10544 gene locus_tag LOCUS_23080 10074 10544 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_23080 10863 11627 gene locus_tag LOCUS_23090 10863 11627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 14583 11716 gene locus_tag LOCUS_23100 14583 11716 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105372141.1 protein_id gnl|my_center|LOCUS_23100 16915 16019 gene locus_tag LOCUS_23110 16915 16019 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106663661.1 protein_id gnl|my_center|LOCUS_23110 19200 16915 gene locus_tag LOCUS_23120 19200 16915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 19282 20280 gene locus_tag LOCUS_23130 19282 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 26571 20506 gene locus_tag LOCUS_23140 26571 20506 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220355262.1 protein_id gnl|my_center|LOCUS_23140 29802 26584 gene locus_tag LOCUS_23150 29802 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 31118 29799 gene locus_tag LOCUS_23160 31118 29799 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123229.1 protein_id gnl|my_center|LOCUS_23160 32575 31115 gene locus_tag LOCUS_23170 32575 31115 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_23170 35961 32572 gene locus_tag LOCUS_23180 gene hsdR 35961 32572 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147180764.1 protein_id gnl|my_center|LOCUS_23180 37199 36195 gene locus_tag LOCUS_23190 37199 36195 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010044806.1 protein_id gnl|my_center|LOCUS_23190 37261 37515 gene locus_tag LOCUS_23200 37261 37515 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331446.1 protein_id gnl|my_center|LOCUS_23200 37505 37906 gene locus_tag LOCUS_23210 37505 37906 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331447.1 protein_id gnl|my_center|LOCUS_23210 39100 38534 gene locus_tag LOCUS_23220 39100 38534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 39347 39739 gene locus_tag LOCUS_23230 39347 39739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 40802 40014 gene locus_tag LOCUS_23240 40802 40014 CDS product DUF2092 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967308.1 protein_id gnl|my_center|LOCUS_23240 41897 41328 gene locus_tag LOCUS_23250 41897 41328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 43437 42013 gene locus_tag LOCUS_23260 43437 42013 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085449.1 protein_id gnl|my_center|LOCUS_23260 44383 43595 gene locus_tag LOCUS_23270 44383 43595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022305.1 protein_id gnl|my_center|LOCUS_23270 44966 44619 gene locus_tag LOCUS_23280 44966 44619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 >Feature sequence031 179 388 gene locus_tag LOCUS_23290 179 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 568 1191 gene locus_tag LOCUS_23300 568 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 1415 2443 gene locus_tag LOCUS_23310 1415 2443 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388951.1 protein_id gnl|my_center|LOCUS_23310 2448 2762 gene locus_tag LOCUS_23320 gene sugE 2448 2762 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171053.1 protein_id gnl|my_center|LOCUS_23320 2919 3341 gene locus_tag LOCUS_23330 2919 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 3361 3768 gene locus_tag LOCUS_23340 gene sdhD 3361 3768 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_23340 3860 5671 gene locus_tag LOCUS_23350 gene sdhA 3860 5671 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388959.1 protein_id gnl|my_center|LOCUS_23350 5688 6488 gene locus_tag LOCUS_23360 5688 6488 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388960.1 protein_id gnl|my_center|LOCUS_23360 6545 7132 gene locus_tag LOCUS_23370 6545 7132 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384959.1 protein_id gnl|my_center|LOCUS_23370 7332 9398 gene locus_tag LOCUS_23380 7332 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 9486 10274 gene locus_tag LOCUS_23390 9486 10274 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975597.1 protein_id gnl|my_center|LOCUS_23390 10295 11278 gene locus_tag LOCUS_23400 gene gnd 10295 11278 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089498.1 protein_id gnl|my_center|LOCUS_23400 12306 11416 gene locus_tag LOCUS_23410 gene speB 12306 11416 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337839.1 protein_id gnl|my_center|LOCUS_23410 14193 12589 gene locus_tag LOCUS_23420 14193 12589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338426.1 protein_id gnl|my_center|LOCUS_23420 15212 14190 gene locus_tag LOCUS_23430 15212 14190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390916.1 protein_id gnl|my_center|LOCUS_23430 16332 15250 gene locus_tag LOCUS_23440 16332 15250 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_23440 18146 16332 gene locus_tag LOCUS_23450 18146 16332 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267221.1 protein_id gnl|my_center|LOCUS_23450 19023 18148 gene locus_tag LOCUS_23460 gene hisN 19023 18148 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_23460 19000 19839 gene locus_tag LOCUS_23470 19000 19839 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626528.1 protein_id gnl|my_center|LOCUS_23470 19836 20687 gene locus_tag LOCUS_23480 19836 20687 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_23480 22066 21017 gene locus_tag LOCUS_23490 22066 21017 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 protein_id gnl|my_center|LOCUS_23490 22280 22086 gene locus_tag LOCUS_23500 22280 22086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 22478 22867 gene locus_tag LOCUS_23510 22478 22867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 24442 23186 gene locus_tag LOCUS_23520 24442 23186 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_23520 24482 25189 gene locus_tag LOCUS_23530 24482 25189 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_23530 25198 25746 gene locus_tag LOCUS_23540 25198 25746 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923209.1 protein_id gnl|my_center|LOCUS_23540 26192 26953 gene locus_tag LOCUS_23550 26192 26953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 28970 27048 gene locus_tag LOCUS_23560 28970 27048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 29224 29421 gene locus_tag LOCUS_23570 29224 29421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 30583 29741 gene locus_tag LOCUS_23580 30583 29741 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_23580 31884 30595 gene locus_tag LOCUS_23590 31884 30595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 33158 31902 gene locus_tag LOCUS_23600 33158 31902 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460239.1 protein_id gnl|my_center|LOCUS_23600 34366 33197 gene locus_tag LOCUS_23610 34366 33197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 34670 34598 gene locus_tag LOCUS_t00250 34670 34598 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 35204 34896 gene locus_tag LOCUS_23620 35204 34896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 35495 37489 gene locus_tag LOCUS_23630 gene hyfB 35495 37489 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_23630 37480 38436 gene locus_tag LOCUS_23640 37480 38436 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_23640 38453 39121 gene locus_tag LOCUS_23650 38453 39121 CDS product hydrogenase-4 component E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548289.1 protein_id gnl|my_center|LOCUS_23650 39118 40560 gene locus_tag LOCUS_23660 39118 40560 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089082.1 protein_id gnl|my_center|LOCUS_23660 40571 42097 gene locus_tag LOCUS_23670 40571 42097 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089083.1 protein_id gnl|my_center|LOCUS_23670 42097 42606 gene locus_tag LOCUS_23680 42097 42606 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_23680 43737 42607 gene locus_tag LOCUS_23690 43737 42607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 43666 43992 gene locus_tag LOCUS_23700 43666 43992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence032 1624 299 gene locus_tag LOCUS_23710 1624 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 1839 3956 gene locus_tag LOCUS_23720 1839 3956 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_23720 3953 6151 gene locus_tag LOCUS_23730 gene scpA 3953 6151 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_23730 6148 7146 gene locus_tag LOCUS_23740 gene meaB 6148 7146 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_23740 9203 8073 gene locus_tag LOCUS_23750 9203 8073 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391420.1 protein_id gnl|my_center|LOCUS_23750 9365 9207 gene locus_tag LOCUS_23760 9365 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 9764 9393 gene locus_tag LOCUS_23770 9764 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 10115 9807 gene locus_tag LOCUS_23780 10115 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 11688 10141 gene locus_tag LOCUS_23790 11688 10141 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_23790 12254 11850 gene locus_tag LOCUS_23800 gene mce 12254 11850 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_23800 14243 12396 gene locus_tag LOCUS_23810 14243 12396 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_23810 14644 15180 gene locus_tag LOCUS_23820 14644 15180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 15474 15283 gene locus_tag LOCUS_23830 15474 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 15880 16413 gene locus_tag LOCUS_23840 15880 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 17095 16463 gene locus_tag LOCUS_23850 17095 16463 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_23850 17787 17215 gene locus_tag LOCUS_23860 17787 17215 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529007.1 protein_id gnl|my_center|LOCUS_23860 19115 17799 gene locus_tag LOCUS_23870 19115 17799 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192968.1 protein_id gnl|my_center|LOCUS_23870 20852 19128 gene locus_tag LOCUS_23880 20852 19128 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192556.1 protein_id gnl|my_center|LOCUS_23880 22867 21242 gene locus_tag LOCUS_23890 22867 21242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 23238 22882 gene locus_tag LOCUS_23900 23238 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 24433 23828 gene locus_tag LOCUS_23910 24433 23828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 24529 27030 gene locus_tag LOCUS_23920 24529 27030 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100816.1 protein_id gnl|my_center|LOCUS_23920 27044 29224 gene locus_tag LOCUS_23930 gene glgB 27044 29224 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532700.1 protein_id gnl|my_center|LOCUS_23930 29397 30653 gene locus_tag LOCUS_23940 gene glgC 29397 30653 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313778.1 protein_id gnl|my_center|LOCUS_23940 30650 32101 gene locus_tag LOCUS_23950 gene glgA 30650 32101 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089199.1 protein_id gnl|my_center|LOCUS_23950 32098 36186 gene locus_tag LOCUS_23960 32098 36186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 37450 36200 gene locus_tag LOCUS_23970 gene coaBC 37450 36200 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391543.1 protein_id gnl|my_center|LOCUS_23970 38222 37461 gene locus_tag LOCUS_23980 gene ubiE 38222 37461 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626664.1 protein_id gnl|my_center|LOCUS_23980 38252 39091 gene locus_tag LOCUS_23990 gene mutM 38252 39091 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338891.1 protein_id gnl|my_center|LOCUS_23990 39150 39905 gene locus_tag LOCUS_24000 39150 39905 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815367.1 protein_id gnl|my_center|LOCUS_24000 40079 40348 gene locus_tag LOCUS_24010 gene rpsT 40079 40348 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241581.1 protein_id gnl|my_center|LOCUS_24010 40616 42241 gene locus_tag LOCUS_24020 gene dnaA 40616 42241 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_24020 42485 43609 gene locus_tag LOCUS_24030 gene dnaN 42485 43609 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence033 <1 945 gene locus_tag LOCUS_24040 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626639.1:penicillin-binding protein activator 958 2322 gene locus_tag LOCUS_24050 958 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2399 5038 gene locus_tag LOCUS_24060 gene pepN 2399 5038 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940973.1 protein_id gnl|my_center|LOCUS_24060 5227 5433 gene locus_tag LOCUS_24070 5227 5433 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859522.1 protein_id gnl|my_center|LOCUS_24070 5523 5759 gene locus_tag LOCUS_24080 5523 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 6233 6895 gene locus_tag LOCUS_24090 6233 6895 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388419.1 protein_id gnl|my_center|LOCUS_24090 7040 8461 gene locus_tag LOCUS_24100 7040 8461 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038979.1 protein_id gnl|my_center|LOCUS_24100 8617 9015 gene locus_tag LOCUS_24110 8617 9015 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_24110 9673 9071 gene locus_tag LOCUS_24120 9673 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 10776 9721 gene locus_tag LOCUS_24130 10776 9721 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_24130 10873 12807 gene locus_tag LOCUS_24140 10873 12807 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_24140 12833 13963 gene locus_tag LOCUS_24150 12833 13963 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967037.1 protein_id gnl|my_center|LOCUS_24150 14064 15815 gene locus_tag LOCUS_24160 14064 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 15893 18409 gene locus_tag LOCUS_24170 15893 18409 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387835.1 protein_id gnl|my_center|LOCUS_24170 18409 18816 gene locus_tag LOCUS_24180 18409 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 18813 19145 gene locus_tag LOCUS_24190 18813 19145 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387838.1 protein_id gnl|my_center|LOCUS_24190 19606 20694 gene locus_tag LOCUS_24200 19606 20694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 21558 20776 gene locus_tag LOCUS_24210 21558 20776 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391305.1 protein_id gnl|my_center|LOCUS_24210 24150 21652 gene locus_tag LOCUS_24220 24150 21652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_24220 24286 26199 gene locus_tag LOCUS_24230 24286 26199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085303.1 protein_id gnl|my_center|LOCUS_24230 26304 27884 gene locus_tag LOCUS_24240 26304 27884 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085302.1 protein_id gnl|my_center|LOCUS_24240 27946 28923 gene locus_tag LOCUS_24250 gene hlyD 27946 28923 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158910.1 protein_id gnl|my_center|LOCUS_24250 28924 30639 gene locus_tag LOCUS_24260 28924 30639 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061627.1 protein_id gnl|my_center|LOCUS_24260 30651 31763 gene locus_tag LOCUS_24270 30651 31763 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529050.1 protein_id gnl|my_center|LOCUS_24270 31895 32995 gene locus_tag LOCUS_24280 31895 32995 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529052.1 protein_id gnl|my_center|LOCUS_24280 33935 33030 gene locus_tag LOCUS_24290 33935 33030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 34176 35093 gene locus_tag LOCUS_24300 34176 35093 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970855.1 protein_id gnl|my_center|LOCUS_24300 35152 35727 gene locus_tag LOCUS_24310 35152 35727 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810481.1 protein_id gnl|my_center|LOCUS_24310 36651 35833 gene locus_tag LOCUS_24320 36651 35833 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389891.1 protein_id gnl|my_center|LOCUS_24320 37676 37071 gene locus_tag LOCUS_24330 37676 37071 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942944.1 protein_id gnl|my_center|LOCUS_24330 37975 37772 gene locus_tag LOCUS_24340 gene rpsU 37975 37772 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388798.1 protein_id gnl|my_center|LOCUS_24340 38148 38696 gene locus_tag LOCUS_24350 gene def 38148 38696 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 protein_id gnl|my_center|LOCUS_24350 38693 39322 gene locus_tag LOCUS_24360 38693 39322 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_24360 39413 40339 gene locus_tag LOCUS_24370 39413 40339 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_24370 42160 40586 gene locus_tag LOCUS_24380 42160 40586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 42582 42283 gene locus_tag LOCUS_24390 42582 42283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 42932 42591 gene locus_tag LOCUS_24400 42932 42591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence034 1069 623 gene locus_tag LOCUS_24410 1069 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 1623 994 gene locus_tag LOCUS_24420 1623 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2035 1613 gene locus_tag LOCUS_24430 2035 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4008 2545 gene locus_tag LOCUS_24440 4008 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 4308 4150 gene locus_tag LOCUS_24450 4308 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 5739 4333 gene locus_tag LOCUS_24460 5739 4333 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_24460 6525 5833 gene locus_tag LOCUS_24470 6525 5833 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640290.1 protein_id gnl|my_center|LOCUS_24470 7652 6528 gene locus_tag LOCUS_24480 7652 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 8153 7779 gene locus_tag LOCUS_24490 8153 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 8156 8713 gene locus_tag LOCUS_24500 8156 8713 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390006.1 protein_id gnl|my_center|LOCUS_24500 8849 9091 gene locus_tag LOCUS_24510 8849 9091 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389526.1 protein_id gnl|my_center|LOCUS_24510 9167 9865 gene locus_tag LOCUS_24520 gene mtnC 9167 9865 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267285.1 protein_id gnl|my_center|LOCUS_24520 9904 11331 gene locus_tag LOCUS_24530 9904 11331 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_24530 11331 12032 gene locus_tag LOCUS_24540 11331 12032 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_24540 12153 12698 gene locus_tag LOCUS_24550 12153 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 15707 12879 gene locus_tag LOCUS_24560 15707 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 17296 15908 gene locus_tag LOCUS_24570 17296 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 17681 18271 gene locus_tag LOCUS_24580 17681 18271 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035433.1 protein_id gnl|my_center|LOCUS_24580 18249 18815 gene locus_tag LOCUS_24590 18249 18815 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_24590 19852 19028 gene locus_tag LOCUS_24600 19852 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 20395 20000 gene locus_tag LOCUS_24610 20395 20000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 21230 20385 gene locus_tag LOCUS_24620 gene moeB 21230 20385 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_24620 21267 21974 gene locus_tag LOCUS_24630 gene queC 21267 21974 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174058.1 protein_id gnl|my_center|LOCUS_24630 21971 23209 gene locus_tag LOCUS_24640 21971 23209 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_24640 23210 26641 gene locus_tag LOCUS_24650 23210 26641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 26638 28011 gene locus_tag LOCUS_24660 26638 28011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 29347 28052 gene locus_tag LOCUS_24670 29347 28052 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817389.1 protein_id gnl|my_center|LOCUS_24670 29484 30170 gene locus_tag LOCUS_24680 29484 30170 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 protein_id gnl|my_center|LOCUS_24680 30173 30982 gene locus_tag LOCUS_24690 30173 30982 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393770.1 protein_id gnl|my_center|LOCUS_24690 31729 31007 gene locus_tag LOCUS_24700 31729 31007 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_24700 32096 33229 gene locus_tag LOCUS_24710 32096 33229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 33254 33751 gene locus_tag LOCUS_24720 33254 33751 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 protein_id gnl|my_center|LOCUS_24720 34143 33790 gene locus_tag LOCUS_24730 34143 33790 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_24730 34375 34157 gene locus_tag LOCUS_24740 34375 34157 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917997.1 protein_id gnl|my_center|LOCUS_24740 35077 34403 gene locus_tag LOCUS_24750 35077 34403 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_24750 36031 35090 gene locus_tag LOCUS_24760 gene trxA 36031 35090 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 protein_id gnl|my_center|LOCUS_24760 36245 36319 gene locus_tag LOCUS_t00260 36245 36319 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37473 36256 gene locus_tag LOCUS_24770 37473 36256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 38211 37654 gene locus_tag LOCUS_24780 38211 37654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 39465 38251 gene locus_tag LOCUS_24790 39465 38251 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 protein_id gnl|my_center|LOCUS_24790 40007 39462 gene locus_tag LOCUS_24800 40007 39462 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504050.1 protein_id gnl|my_center|LOCUS_24800 41305 40004 gene locus_tag LOCUS_24810 41305 40004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 41575 41730 gene locus_tag LOCUS_24820 41575 41730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 41685 41861 gene locus_tag LOCUS_24830 41685 41861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 42282 41863 gene locus_tag LOCUS_24840 42282 41863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 42711 42529 gene locus_tag LOCUS_24850 42711 42529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence035 856 305 gene locus_tag LOCUS_24860 856 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1973 990 gene locus_tag LOCUS_24870 1973 990 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_24870 3903 2026 gene locus_tag LOCUS_24880 gene recQ 3903 2026 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245677.1 protein_id gnl|my_center|LOCUS_24880 4290 3904 gene locus_tag LOCUS_24890 4290 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 5572 4439 gene locus_tag LOCUS_24900 5572 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 6919 5786 gene locus_tag LOCUS_24910 6919 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 9369 7408 gene locus_tag LOCUS_24920 9369 7408 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388895.1 protein_id gnl|my_center|LOCUS_24920 11204 9552 gene locus_tag LOCUS_24930 gene cydC 11204 9552 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941873.1 protein_id gnl|my_center|LOCUS_24930 11376 11807 gene locus_tag LOCUS_24940 11376 11807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 12233 11907 gene locus_tag LOCUS_24950 12233 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 12433 12245 gene locus_tag LOCUS_24960 12433 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 12478 12702 gene locus_tag LOCUS_24970 12478 12702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 14762 12801 gene locus_tag LOCUS_24980 gene dxs 14762 12801 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175335.1 protein_id gnl|my_center|LOCUS_24980 15793 14885 gene locus_tag LOCUS_24990 15793 14885 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_24990 16103 15810 gene locus_tag LOCUS_25000 16103 15810 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919931.1 protein_id gnl|my_center|LOCUS_25000 17128 16196 gene locus_tag LOCUS_25010 17128 16196 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_25010 17375 17145 gene locus_tag LOCUS_25020 17375 17145 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222784.1 protein_id gnl|my_center|LOCUS_25020 17810 17445 gene locus_tag LOCUS_25030 17810 17445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 17694 18803 gene locus_tag LOCUS_25040 17694 18803 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_25040 18808 19659 gene locus_tag LOCUS_25050 18808 19659 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388273.1 protein_id gnl|my_center|LOCUS_25050 19775 20914 gene locus_tag LOCUS_25060 gene zapE 19775 20914 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083288.1 protein_id gnl|my_center|LOCUS_25060 21075 22028 gene locus_tag LOCUS_25070 gene mdh 21075 22028 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530257.1 protein_id gnl|my_center|LOCUS_25070 22033 23229 gene locus_tag LOCUS_25080 gene sucC 22033 23229 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_25080 23229 24104 gene locus_tag LOCUS_25090 gene sucD 23229 24104 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_25090 24201 27110 gene locus_tag LOCUS_25100 24201 27110 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_25100 27300 28568 gene locus_tag LOCUS_25110 gene odhB 27300 28568 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_25110 28573 29964 gene locus_tag LOCUS_25120 gene lpdA 28573 29964 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_25120 29961 31025 gene locus_tag LOCUS_25130 gene pdxA 29961 31025 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388191.1 protein_id gnl|my_center|LOCUS_25130 31022 31750 gene locus_tag LOCUS_25140 31022 31750 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389607.1 protein_id gnl|my_center|LOCUS_25140 31918 32760 gene locus_tag LOCUS_25150 31918 32760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161491309.1 protein_id gnl|my_center|LOCUS_25150 32814 33665 gene locus_tag LOCUS_25160 32814 33665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 33628 34593 gene locus_tag LOCUS_25170 33628 34593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 34590 35822 gene locus_tag LOCUS_25180 34590 35822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 37167 35887 gene locus_tag LOCUS_25190 37167 35887 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543324.1 protein_id gnl|my_center|LOCUS_25190 37344 37871 gene locus_tag LOCUS_25200 37344 37871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 38112 38363 gene locus_tag LOCUS_25210 38112 38363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 38544 38311 gene locus_tag LOCUS_25220 38544 38311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 38759 38541 gene locus_tag LOCUS_25230 38759 38541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 39046 41325 gene locus_tag LOCUS_25240 39046 41325 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence036 1227 514 gene locus_tag LOCUS_25250 1227 514 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454821.1 protein_id gnl|my_center|LOCUS_25250 3439 1295 gene locus_tag LOCUS_25260 3439 1295 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263831.1 protein_id gnl|my_center|LOCUS_25260 3894 3439 gene locus_tag LOCUS_25270 3894 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 4299 4006 gene locus_tag LOCUS_25280 4299 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 4592 4825 gene locus_tag LOCUS_25290 4592 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 4828 5595 gene locus_tag LOCUS_25300 4828 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 6091 7098 gene locus_tag LOCUS_25310 6091 7098 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263836.1 protein_id gnl|my_center|LOCUS_25310 7976 7062 gene locus_tag LOCUS_25320 7976 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 8132 9310 gene locus_tag LOCUS_25330 8132 9310 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_25330 9298 10680 gene locus_tag LOCUS_25340 9298 10680 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263839.1 protein_id gnl|my_center|LOCUS_25340 10682 11749 gene locus_tag LOCUS_25350 10682 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 11844 13229 gene locus_tag LOCUS_25360 11844 13229 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263840.1 protein_id gnl|my_center|LOCUS_25360 13382 14293 gene locus_tag LOCUS_25370 13382 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 14553 17477 gene locus_tag LOCUS_25380 14553 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 17591 18289 gene locus_tag LOCUS_25390 17591 18289 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_25390 18319 19578 gene locus_tag LOCUS_25400 18319 19578 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083559.1 protein_id gnl|my_center|LOCUS_25400 21977 19644 gene locus_tag LOCUS_25410 21977 19644 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100176370.1 protein_id gnl|my_center|LOCUS_25410 27304 22175 gene locus_tag LOCUS_25420 27304 22175 CDS product DUF4011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090812.1 protein_id gnl|my_center|LOCUS_25420 27482 28330 gene locus_tag LOCUS_25430 27482 28330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 28497 29534 gene locus_tag LOCUS_25440 28497 29534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 29634 30821 gene locus_tag LOCUS_25450 gene metK 29634 30821 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_25450 30920 31537 gene locus_tag LOCUS_25460 gene trmB 30920 31537 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_25460 32316 33881 gene locus_tag LOCUS_25470 32316 33881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 35119 33977 gene locus_tag LOCUS_25480 35119 33977 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_25480 35257 37773 gene locus_tag LOCUS_25490 35257 37773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 37871 38407 gene locus_tag LOCUS_25500 37871 38407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 38431 39996 gene locus_tag LOCUS_25510 gene nusA 38431 39996 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_25510 40049 40732 gene locus_tag LOCUS_25520 40049 40732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence037 <1 598 gene locus_tag LOCUS_25530 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390377.1:pyridoxamine 5'-phosphate oxidase 601 2097 gene locus_tag LOCUS_25540 601 2097 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338248.1 protein_id gnl|my_center|LOCUS_25540 2097 2963 gene locus_tag LOCUS_25550 2097 2963 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_25550 2965 3489 gene locus_tag LOCUS_25560 2965 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3722 4027 gene locus_tag LOCUS_25570 3722 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 6110 4086 gene locus_tag LOCUS_25580 6110 4086 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244273.1 protein_id gnl|my_center|LOCUS_25580 7730 6333 gene locus_tag LOCUS_25590 7730 6333 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_25590 8595 7840 gene locus_tag LOCUS_25600 8595 7840 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388329.1 protein_id gnl|my_center|LOCUS_25600 8594 9535 gene locus_tag LOCUS_25610 gene ubiA 8594 9535 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388330.1 protein_id gnl|my_center|LOCUS_25610 9529 10179 gene locus_tag LOCUS_25620 9529 10179 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388331.1 protein_id gnl|my_center|LOCUS_25620 10263 10610 gene locus_tag LOCUS_25630 10263 10610 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857681.1 protein_id gnl|my_center|LOCUS_25630 10833 11138 gene locus_tag LOCUS_25640 10833 11138 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_25640 11135 11434 gene locus_tag LOCUS_25650 11135 11434 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_25650 11441 11884 gene locus_tag LOCUS_25660 11441 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 12283 13110 gene locus_tag LOCUS_25670 12283 13110 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164689163.1 protein_id gnl|my_center|LOCUS_25670 14304 13948 gene locus_tag LOCUS_25680 14304 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 15767 14862 gene locus_tag LOCUS_25690 15767 14862 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057545.1 protein_id gnl|my_center|LOCUS_25690 16519 15764 gene locus_tag LOCUS_25700 gene ydfG 16519 15764 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185593.1 protein_id gnl|my_center|LOCUS_25700 17424 16609 gene locus_tag LOCUS_25710 17424 16609 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479310.1 protein_id gnl|my_center|LOCUS_25710 17742 17521 gene locus_tag LOCUS_25720 17742 17521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 20002 17840 gene locus_tag LOCUS_25730 20002 17840 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083347.1 protein_id gnl|my_center|LOCUS_25730 20422 20159 gene locus_tag LOCUS_25740 20422 20159 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389736.1 protein_id gnl|my_center|LOCUS_25740 20733 22820 gene locus_tag LOCUS_25750 gene fusA 20733 22820 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599757.1 protein_id gnl|my_center|LOCUS_25750 23027 23329 gene locus_tag LOCUS_25760 23027 23329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 24623 23445 gene locus_tag LOCUS_25770 24623 23445 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_25770 25019 24849 gene locus_tag LOCUS_25780 25019 24849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 25199 26422 gene locus_tag LOCUS_25790 gene phaZ 25199 26422 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536442.1 protein_id gnl|my_center|LOCUS_25790 27482 26571 gene locus_tag LOCUS_25800 27482 26571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 28568 27504 gene locus_tag LOCUS_25810 gene arsB 28568 27504 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085869.1 protein_id gnl|my_center|LOCUS_25810 29017 28565 gene locus_tag LOCUS_25820 gene arsC 29017 28565 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459395.1 protein_id gnl|my_center|LOCUS_25820 29358 29014 gene locus_tag LOCUS_25830 29358 29014 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_25830 30714 29428 gene locus_tag LOCUS_25840 30714 29428 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085015.1 protein_id gnl|my_center|LOCUS_25840 31196 31645 gene locus_tag LOCUS_25850 31196 31645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 31878 32948 gene locus_tag LOCUS_25860 31878 32948 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089680.1 protein_id gnl|my_center|LOCUS_25860 32962 34752 gene locus_tag LOCUS_25870 32962 34752 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089679.1 protein_id gnl|my_center|LOCUS_25870 34867 35613 gene locus_tag LOCUS_25880 gene cybH 34867 35613 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089678.1 protein_id gnl|my_center|LOCUS_25880 35606 36190 gene locus_tag LOCUS_25890 35606 36190 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089677.1 protein_id gnl|my_center|LOCUS_25890 36183 36509 gene locus_tag LOCUS_25900 36183 36509 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089676.1 protein_id gnl|my_center|LOCUS_25900 36513 37376 gene locus_tag LOCUS_25910 gene modD 36513 37376 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836200.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence038 300 5294 gene locus_tag LOCUS_25920 300 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 5291 8128 gene locus_tag LOCUS_25930 5291 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 8295 12944 gene locus_tag LOCUS_25940 gene gltB 8295 12944 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 protein_id gnl|my_center|LOCUS_25940 12961 14412 gene locus_tag LOCUS_25950 12961 14412 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_25950 15466 14597 gene locus_tag LOCUS_25960 15466 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 16470 15496 gene locus_tag LOCUS_25970 gene galE 16470 15496 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_25970 17384 16539 gene locus_tag LOCUS_25980 17384 16539 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_25980 18052 17645 gene locus_tag LOCUS_25990 18052 17645 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_25990 19506 18076 gene locus_tag LOCUS_26000 gene atpD 19506 18076 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388981.1 protein_id gnl|my_center|LOCUS_26000 20419 19535 gene locus_tag LOCUS_26010 20419 19535 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388980.1 protein_id gnl|my_center|LOCUS_26010 21978 20446 gene locus_tag LOCUS_26020 gene atpA 21978 20446 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388979.1 protein_id gnl|my_center|LOCUS_26020 22435 21980 gene locus_tag LOCUS_26030 22435 21980 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_26030 25135 22910 gene locus_tag LOCUS_26040 25135 22910 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563538.1 protein_id gnl|my_center|LOCUS_26040 25195 25866 gene locus_tag LOCUS_26050 gene fsa 25195 25866 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709604.1 protein_id gnl|my_center|LOCUS_26050 25866 26507 gene locus_tag LOCUS_26060 25866 26507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 26679 27590 gene locus_tag LOCUS_26070 26679 27590 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338319.1 protein_id gnl|my_center|LOCUS_26070 28699 29094 gene locus_tag LOCUS_26080 28699 29094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 29327 30211 gene locus_tag LOCUS_26090 29327 30211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 30444 30289 gene locus_tag LOCUS_26100 30444 30289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 31739 30537 gene locus_tag LOCUS_26110 31739 30537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 33011 31908 gene locus_tag LOCUS_26120 gene aroC 33011 31908 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_26120 33869 33027 gene locus_tag LOCUS_26130 gene fabI 33869 33027 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085415.1 protein_id gnl|my_center|LOCUS_26130 35251 34133 gene locus_tag LOCUS_26140 35251 34133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence039 447 1577 gene locus_tag LOCUS_26150 447 1577 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_26150 2266 1676 gene locus_tag LOCUS_26160 2266 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2451 3929 gene locus_tag LOCUS_26170 2451 3929 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_26170 3926 4933 gene locus_tag LOCUS_26180 3926 4933 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_26180 6569 4995 gene locus_tag LOCUS_26190 6569 4995 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919415.1 protein_id gnl|my_center|LOCUS_26190 7100 7303 gene locus_tag LOCUS_26200 7100 7303 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084262.1 protein_id gnl|my_center|LOCUS_26200 8162 7614 gene locus_tag LOCUS_26210 gene moaB 8162 7614 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 protein_id gnl|my_center|LOCUS_26210 10105 8192 gene locus_tag LOCUS_26220 10105 8192 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_26220 11111 10221 gene locus_tag LOCUS_26230 11111 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 11207 12838 gene locus_tag LOCUS_26240 11207 12838 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_26240 12935 14635 gene locus_tag LOCUS_26250 12935 14635 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 protein_id gnl|my_center|LOCUS_26250 14641 15483 gene locus_tag LOCUS_26260 14641 15483 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388016.1 protein_id gnl|my_center|LOCUS_26260 15516 15590 gene locus_tag LOCUS_t00270 15516 15590 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15725 17731 gene locus_tag LOCUS_26270 15725 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 17745 18197 gene locus_tag LOCUS_26280 17745 18197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 18665 18357 gene locus_tag LOCUS_26290 18665 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 18885 21059 gene locus_tag LOCUS_26300 18885 21059 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389289.1 protein_id gnl|my_center|LOCUS_26300 21056 21586 gene locus_tag LOCUS_26310 gene greB 21056 21586 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_26310 21744 22655 gene locus_tag LOCUS_26320 gene panE 21744 22655 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391265.1 protein_id gnl|my_center|LOCUS_26320 23748 22699 gene locus_tag LOCUS_26330 23748 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_26330 23638 23988 gene locus_tag LOCUS_26340 23638 23988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 24020 25420 gene locus_tag LOCUS_26350 24020 25420 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090487.1 protein_id gnl|my_center|LOCUS_26350 25675 26436 gene locus_tag LOCUS_26360 25675 26436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 28077 26623 gene locus_tag LOCUS_26370 28077 26623 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258419.1 protein_id gnl|my_center|LOCUS_26370 28247 28747 gene locus_tag LOCUS_26380 28247 28747 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090555.1 protein_id gnl|my_center|LOCUS_26380 28938 29399 gene locus_tag LOCUS_26390 28938 29399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 29837 29436 gene locus_tag LOCUS_26400 gene crcB 29837 29436 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_26400 32293 29834 gene locus_tag LOCUS_26410 32293 29834 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720592.1 protein_id gnl|my_center|LOCUS_26410 32408 33856 gene locus_tag LOCUS_26420 32408 33856 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence040 27 779 gene locus_tag LOCUS_26430 27 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2447 996 gene locus_tag LOCUS_26440 gene gatB 2447 996 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390923.1 protein_id gnl|my_center|LOCUS_26440 3924 2452 gene locus_tag LOCUS_26450 gene gatA 3924 2452 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087849.1 protein_id gnl|my_center|LOCUS_26450 4211 3924 gene locus_tag LOCUS_26460 gene gatC 4211 3924 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719430.1 protein_id gnl|my_center|LOCUS_26460 4272 4724 gene locus_tag LOCUS_26470 gene ruvX 4272 4724 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390926.1 protein_id gnl|my_center|LOCUS_26470 5658 4744 gene locus_tag LOCUS_26480 5658 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 6194 5901 gene locus_tag LOCUS_26490 6194 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 6331 6486 gene locus_tag LOCUS_26500 6331 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 7313 6630 gene locus_tag LOCUS_26510 7313 6630 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483433.1 protein_id gnl|my_center|LOCUS_26510 8511 7339 gene locus_tag LOCUS_26520 8511 7339 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483424.1 protein_id gnl|my_center|LOCUS_26520 9596 8508 gene locus_tag LOCUS_26530 9596 8508 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483418.1 protein_id gnl|my_center|LOCUS_26530 9774 12911 gene locus_tag LOCUS_26540 9774 12911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 14057 12933 gene locus_tag LOCUS_26550 14057 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 15389 14181 gene locus_tag LOCUS_26560 15389 14181 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086738.1 protein_id gnl|my_center|LOCUS_26560 16665 15553 gene locus_tag LOCUS_26570 16665 15553 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966531.1 protein_id gnl|my_center|LOCUS_26570 18180 16690 gene locus_tag LOCUS_26580 18180 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 18900 18184 gene locus_tag LOCUS_26590 18900 18184 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087416.1 protein_id gnl|my_center|LOCUS_26590 19058 19924 gene locus_tag LOCUS_26600 19058 19924 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_26600 19949 21775 gene locus_tag LOCUS_26610 gene ftsH 19949 21775 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143134.1 protein_id gnl|my_center|LOCUS_26610 22363 21794 gene locus_tag LOCUS_26620 22363 21794 CDS product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349807.1 protein_id gnl|my_center|LOCUS_26620 23240 22482 gene locus_tag LOCUS_26630 23240 22482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 23554 24342 gene locus_tag LOCUS_26640 23554 24342 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_26640 24349 24807 gene locus_tag LOCUS_26650 24349 24807 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_26650 25116 27014 gene locus_tag LOCUS_26660 gene uvrC 25116 27014 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_26660 29165 27036 gene locus_tag LOCUS_26670 29165 27036 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_26670 31483 29231 gene locus_tag LOCUS_26680 gene hypF 31483 29231 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388061.1 protein_id gnl|my_center|LOCUS_26680 31682 32665 gene locus_tag LOCUS_26690 31682 32665 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241170.1 protein_id gnl|my_center|LOCUS_26690 33045 32674 gene locus_tag LOCUS_26700 33045 32674 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930690.1 protein_id gnl|my_center|LOCUS_26700 33617 33174 gene locus_tag LOCUS_26710 33617 33174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 33720 34793 gene locus_tag LOCUS_26720 gene hemW 33720 34793 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399647.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence041 1390 644 gene locus_tag LOCUS_26730 1390 644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089634.1 protein_id gnl|my_center|LOCUS_26730 3377 1383 gene locus_tag LOCUS_26740 3377 1383 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090557.1 protein_id gnl|my_center|LOCUS_26740 4317 3388 gene locus_tag LOCUS_26750 4317 3388 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820410.1 protein_id gnl|my_center|LOCUS_26750 5548 4325 gene locus_tag LOCUS_26760 5548 4325 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227931.1 protein_id gnl|my_center|LOCUS_26760 5581 5889 gene locus_tag LOCUS_26770 5581 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 7502 5790 gene locus_tag LOCUS_26780 gene ggt 7502 5790 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670404.1 protein_id gnl|my_center|LOCUS_26780 7585 7983 gene locus_tag LOCUS_26790 7585 7983 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391439.1 protein_id gnl|my_center|LOCUS_26790 8043 8546 gene locus_tag LOCUS_26800 8043 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 8595 8918 gene locus_tag LOCUS_26810 8595 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 9459 8881 gene locus_tag LOCUS_26820 9459 8881 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_26820 10304 9471 gene locus_tag LOCUS_26830 10304 9471 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_26830 11442 10291 gene locus_tag LOCUS_26840 11442 10291 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869713.1 protein_id gnl|my_center|LOCUS_26840 12424 11540 gene locus_tag LOCUS_26850 12424 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 14276 12444 gene locus_tag LOCUS_26860 gene iorA 14276 12444 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_26860 15764 14442 gene locus_tag LOCUS_26870 gene paaF 15764 14442 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931072.1 protein_id gnl|my_center|LOCUS_26870 16194 16556 gene locus_tag LOCUS_26880 16194 16556 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530010.1 protein_id gnl|my_center|LOCUS_26880 16556 17053 gene locus_tag LOCUS_26890 gene gpt 16556 17053 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_26890 18104 17130 gene locus_tag LOCUS_26900 18104 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 19873 18350 gene locus_tag LOCUS_26910 19873 18350 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086915.1 protein_id gnl|my_center|LOCUS_26910 20471 21475 gene locus_tag LOCUS_26920 gene hemB 20471 21475 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_26920 21805 21482 gene locus_tag LOCUS_26930 21805 21482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 23351 21960 gene locus_tag LOCUS_26940 23351 21960 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_26940 23744 23514 gene locus_tag LOCUS_26950 23744 23514 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085116.1 protein_id gnl|my_center|LOCUS_26950 25378 23741 gene locus_tag LOCUS_26960 25378 23741 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205212.1 protein_id gnl|my_center|LOCUS_26960 25487 26152 gene locus_tag LOCUS_26970 25487 26152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 26695 26276 gene locus_tag LOCUS_26980 26695 26276 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_26980 26792 27529 gene locus_tag LOCUS_26990 26792 27529 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096148.1 protein_id gnl|my_center|LOCUS_26990 27603 28493 gene locus_tag LOCUS_27000 27603 28493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 30810 28516 gene locus_tag LOCUS_27010 30810 28516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 32172 30970 gene locus_tag LOCUS_27020 32172 30970 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 protein_id gnl|my_center|LOCUS_27020 34001 32289 gene locus_tag LOCUS_27030 34001 32289 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538142.1 protein_id gnl|my_center|LOCUS_27030 34151 34969 gene locus_tag LOCUS_27040 gene mazG 34151 34969 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence042 1071 250 gene locus_tag LOCUS_27050 1071 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1649 1068 gene locus_tag LOCUS_27060 1649 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2080 1646 gene locus_tag LOCUS_27070 2080 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2293 3234 gene locus_tag LOCUS_27080 2293 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3343 5697 gene locus_tag LOCUS_27090 3343 5697 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372678.1 protein_id gnl|my_center|LOCUS_27090 5950 8994 gene locus_tag LOCUS_27100 5950 8994 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038744192.1 protein_id gnl|my_center|LOCUS_27100 10707 9709 gene locus_tag LOCUS_27110 10707 9709 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975279.1 protein_id gnl|my_center|LOCUS_27110 13066 10811 gene locus_tag LOCUS_27120 13066 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 13401 13829 gene locus_tag LOCUS_27130 gene gspG 13401 13829 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533582.1 protein_id gnl|my_center|LOCUS_27130 13836 14270 gene locus_tag LOCUS_27140 13836 14270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 15028 14249 gene locus_tag LOCUS_27150 15028 14249 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639900.1 protein_id gnl|my_center|LOCUS_27150 15848 15036 gene locus_tag LOCUS_27160 15848 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 18122 15852 gene locus_tag LOCUS_27170 18122 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 18610 18119 gene locus_tag LOCUS_27180 18610 18119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 19221 18607 gene locus_tag LOCUS_27190 19221 18607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 20261 19224 gene locus_tag LOCUS_27200 20261 19224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 20941 20267 gene locus_tag LOCUS_27210 20941 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 21369 20938 gene locus_tag LOCUS_27220 21369 20938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 21793 21359 gene locus_tag LOCUS_27230 21793 21359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 23000 21774 gene locus_tag LOCUS_27240 gene gspF 23000 21774 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767347.1 protein_id gnl|my_center|LOCUS_27240 24703 23000 gene locus_tag LOCUS_27250 gene gspE 24703 23000 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_27250 24790 25089 gene locus_tag LOCUS_27260 24790 25089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 26551 25103 gene locus_tag LOCUS_27270 gene phnY 26551 25103 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194628.1 protein_id gnl|my_center|LOCUS_27270 27405 26572 gene locus_tag LOCUS_27280 gene phnE 27405 26572 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808587.1 protein_id gnl|my_center|LOCUS_27280 28222 27410 gene locus_tag LOCUS_27290 gene phnE 28222 27410 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_27290 28976 28224 gene locus_tag LOCUS_27300 gene phnC 28976 28224 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_27300 29886 28984 gene locus_tag LOCUS_27310 29886 28984 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119656.1 protein_id gnl|my_center|LOCUS_27310 31003 29909 gene locus_tag LOCUS_27320 31003 29909 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728652.1 protein_id gnl|my_center|LOCUS_27320 32253 31015 gene locus_tag LOCUS_27330 gene phnA 32253 31015 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040446.1 protein_id gnl|my_center|LOCUS_27330 32581 33480 gene locus_tag LOCUS_27340 32581 33480 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926018.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence043 476 1564 gene locus_tag LOCUS_27350 gene mraY 476 1564 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_27350 1564 2952 gene locus_tag LOCUS_27360 gene murD 1564 2952 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920413.1 protein_id gnl|my_center|LOCUS_27360 2953 4125 gene locus_tag LOCUS_27370 2953 4125 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_27370 4134 5270 gene locus_tag LOCUS_27380 gene murG 4134 5270 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530957.1 protein_id gnl|my_center|LOCUS_27380 5267 6700 gene locus_tag LOCUS_27390 gene murC 5267 6700 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388704.1 protein_id gnl|my_center|LOCUS_27390 5722 5640 gene locus_tag LOCUS_t00280 5722 5640 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 6697 7668 gene locus_tag LOCUS_27400 gene murB 6697 7668 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388703.1 protein_id gnl|my_center|LOCUS_27400 7665 8582 gene locus_tag LOCUS_27410 7665 8582 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337244.1 protein_id gnl|my_center|LOCUS_27410 8570 9601 gene locus_tag LOCUS_27420 8570 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 9612 10913 gene locus_tag LOCUS_27430 gene ftsA 9612 10913 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388700.1 protein_id gnl|my_center|LOCUS_27430 10971 12617 gene locus_tag LOCUS_27440 gene ftsZ 10971 12617 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530963.1 protein_id gnl|my_center|LOCUS_27440 12883 13896 gene locus_tag LOCUS_27450 gene lpxC 12883 13896 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388698.1 protein_id gnl|my_center|LOCUS_27450 14180 14992 gene locus_tag LOCUS_27460 14180 14992 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_27460 15015 16715 gene locus_tag LOCUS_27470 gene recN 15015 16715 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388695.1 protein_id gnl|my_center|LOCUS_27470 16957 17421 gene locus_tag LOCUS_27480 16957 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 17495 18367 gene locus_tag LOCUS_27490 gene speE 17495 18367 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389381.1 protein_id gnl|my_center|LOCUS_27490 18920 18381 gene locus_tag LOCUS_27500 18920 18381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 19114 20298 gene locus_tag LOCUS_27510 19114 20298 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_27510 20304 21890 gene locus_tag LOCUS_27520 gene serA 20304 21890 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921048.1 protein_id gnl|my_center|LOCUS_27520 22409 21981 gene locus_tag LOCUS_27530 22409 21981 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337528.1 protein_id gnl|my_center|LOCUS_27530 23135 22413 gene locus_tag LOCUS_27540 gene gloB 23135 22413 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337385.1 protein_id gnl|my_center|LOCUS_27540 23232 23945 gene locus_tag LOCUS_27550 23232 23945 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391017.1 protein_id gnl|my_center|LOCUS_27550 27285 24451 gene locus_tag LOCUS_27560 27285 24451 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 protein_id gnl|my_center|LOCUS_27560 29134 27299 gene locus_tag LOCUS_27570 29134 27299 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_27570 29867 29208 gene locus_tag LOCUS_27580 29867 29208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 30119 31015 gene locus_tag LOCUS_27590 30119 31015 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086433.1 protein_id gnl|my_center|LOCUS_27590 31023 31820 gene locus_tag LOCUS_27600 31023 31820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086432.1 protein_id gnl|my_center|LOCUS_27600 33314 31923 gene locus_tag LOCUS_27610 33314 31923 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121818.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence044 2701 377 gene locus_tag LOCUS_27620 2701 377 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385014.1 protein_id gnl|my_center|LOCUS_27620 3112 2708 gene locus_tag LOCUS_27630 gene rpoZ 3112 2708 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974878.1 protein_id gnl|my_center|LOCUS_27630 3698 3210 gene locus_tag LOCUS_27640 gene folK 3698 3210 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_27640 3809 4447 gene locus_tag LOCUS_27650 3809 4447 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_27650 4455 5114 gene locus_tag LOCUS_27660 4455 5114 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389613.1 protein_id gnl|my_center|LOCUS_27660 6168 5341 gene locus_tag LOCUS_27670 6168 5341 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446872.1 protein_id gnl|my_center|LOCUS_27670 7316 6165 gene locus_tag LOCUS_27680 gene hflX 7316 6165 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389375.1 protein_id gnl|my_center|LOCUS_27680 7857 7459 gene locus_tag LOCUS_27690 7857 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 8127 8972 gene locus_tag LOCUS_27700 8127 8972 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_27700 9750 9076 gene locus_tag LOCUS_27710 9750 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 10263 9937 gene locus_tag LOCUS_27720 10263 9937 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087569.1 protein_id gnl|my_center|LOCUS_27720 10398 11771 gene locus_tag LOCUS_27730 10398 11771 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_27730 12507 11830 gene locus_tag LOCUS_27740 12507 11830 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973806.1 protein_id gnl|my_center|LOCUS_27740 12827 12624 gene locus_tag LOCUS_27750 12827 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 13215 15158 gene locus_tag LOCUS_27760 13215 15158 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089495.1 protein_id gnl|my_center|LOCUS_27760 15191 16480 gene locus_tag LOCUS_27770 15191 16480 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975205.1 protein_id gnl|my_center|LOCUS_27770 16477 17985 gene locus_tag LOCUS_27780 16477 17985 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089493.1 protein_id gnl|my_center|LOCUS_27780 18705 18085 gene locus_tag LOCUS_27790 18705 18085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 22744 18995 gene locus_tag LOCUS_27800 22744 18995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 27416 22746 gene locus_tag LOCUS_27810 27416 22746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 27715 27912 gene locus_tag LOCUS_27820 27715 27912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 27899 28315 gene locus_tag LOCUS_27830 27899 28315 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 protein_id gnl|my_center|LOCUS_27830 28858 28343 gene locus_tag LOCUS_27840 28858 28343 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561457.1 protein_id gnl|my_center|LOCUS_27840 30071 29484 gene locus_tag LOCUS_27850 30071 29484 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_27850 30214 30699 gene locus_tag LOCUS_27860 30214 30699 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_27860 32052 30781 gene locus_tag LOCUS_27870 32052 30781 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087884.1 protein_id gnl|my_center|LOCUS_27870 30897 30991 gene locus_tag LOCUS_t00290 30897 30991 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 32945 32031 gene locus_tag LOCUS_27880 32945 32031 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_27880 33392 33105 gene locus_tag LOCUS_27890 33392 33105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence045 <1 1100 gene locus_tag LOCUS_27900 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089399.1:phosphomethylpyrimidine synthase ThiC 1200 2189 gene locus_tag LOCUS_27910 gene gshB 1200 2189 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_27910 2221 2673 gene locus_tag LOCUS_27920 2221 2673 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 protein_id gnl|my_center|LOCUS_27920 3517 2915 gene locus_tag LOCUS_27930 3517 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 4389 3625 gene locus_tag LOCUS_27940 4389 3625 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836202.1 protein_id gnl|my_center|LOCUS_27940 4563 5039 gene locus_tag LOCUS_27950 gene paaI 4563 5039 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577719.1 protein_id gnl|my_center|LOCUS_27950 5618 5070 gene locus_tag LOCUS_27960 5618 5070 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_27960 6622 5747 gene locus_tag LOCUS_27970 6622 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 7275 6637 gene locus_tag LOCUS_27980 7275 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 7922 7272 gene locus_tag LOCUS_27990 7922 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 8598 7912 gene locus_tag LOCUS_28000 gene aat 8598 7912 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259206.1 protein_id gnl|my_center|LOCUS_28000 10005 8665 gene locus_tag LOCUS_28010 gene accC 10005 8665 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390188.1 protein_id gnl|my_center|LOCUS_28010 10501 10022 gene locus_tag LOCUS_28020 gene accB 10501 10022 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720335.1 protein_id gnl|my_center|LOCUS_28020 10977 10498 gene locus_tag LOCUS_28030 gene aroQ 10977 10498 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_28030 11914 11132 gene locus_tag LOCUS_28040 11914 11132 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_28040 12035 12301 gene locus_tag LOCUS_28050 12035 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 12886 12230 gene locus_tag LOCUS_28060 12886 12230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 14237 13023 gene locus_tag LOCUS_28070 14237 13023 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_28070 14941 14237 gene locus_tag LOCUS_28080 14941 14237 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_28080 15015 15629 gene locus_tag LOCUS_28090 15015 15629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 15706 16248 gene locus_tag LOCUS_28100 gene secB 15706 16248 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391357.1 protein_id gnl|my_center|LOCUS_28100 17112 16453 gene locus_tag LOCUS_28110 gene agmR 17112 16453 CDS product response regulator AgmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107754.1 protein_id gnl|my_center|LOCUS_28110 17350 19062 gene locus_tag LOCUS_28120 17350 19062 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_28120 19084 20355 gene locus_tag LOCUS_28130 19084 20355 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967450.1 protein_id gnl|my_center|LOCUS_28130 20446 21966 gene locus_tag LOCUS_28140 20446 21966 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_28140 22026 22427 gene locus_tag LOCUS_28150 22026 22427 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_28150 22571 24019 gene locus_tag LOCUS_28160 22571 24019 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 protein_id gnl|my_center|LOCUS_28160 24159 25325 gene locus_tag LOCUS_28170 24159 25325 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088928.1 protein_id gnl|my_center|LOCUS_28170 25337 26305 gene locus_tag LOCUS_28180 25337 26305 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532045.1 protein_id gnl|my_center|LOCUS_28180 26302 27060 gene locus_tag LOCUS_28190 26302 27060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088930.1 protein_id gnl|my_center|LOCUS_28190 27057 27887 gene locus_tag LOCUS_28200 27057 27887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088931.1 protein_id gnl|my_center|LOCUS_28200 27934 28245 gene locus_tag LOCUS_28210 27934 28245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 29055 28303 gene locus_tag LOCUS_28220 29055 28303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010203323.1 protein_id gnl|my_center|LOCUS_28220 29872 29048 gene locus_tag LOCUS_28230 29872 29048 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088940.1 protein_id gnl|my_center|LOCUS_28230 30876 29869 gene locus_tag LOCUS_28240 30876 29869 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532064.1 protein_id gnl|my_center|LOCUS_28240 31032 31499 gene locus_tag LOCUS_28250 31032 31499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 32298 32684 gene locus_tag LOCUS_28260 32298 32684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence046 689 1531 gene locus_tag LOCUS_28270 689 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2637 1525 gene locus_tag LOCUS_28280 2637 1525 CDS product DUF4424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967721.1 protein_id gnl|my_center|LOCUS_28280 3056 2646 gene locus_tag LOCUS_28290 3056 2646 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_28290 3139 4152 gene locus_tag LOCUS_28300 3139 4152 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389306.1 protein_id gnl|my_center|LOCUS_28300 4208 4984 gene locus_tag LOCUS_28310 4208 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 8215 5078 gene locus_tag LOCUS_28320 8215 5078 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087840.1 protein_id gnl|my_center|LOCUS_28320 9304 8219 gene locus_tag LOCUS_28330 9304 8219 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087841.1 protein_id gnl|my_center|LOCUS_28330 10212 9421 gene locus_tag LOCUS_28340 10212 9421 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071741117.1 protein_id gnl|my_center|LOCUS_28340 10093 10365 gene locus_tag LOCUS_28350 10093 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 10874 10338 gene locus_tag LOCUS_28360 gene rfbC 10874 10338 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_28360 12106 10871 gene locus_tag LOCUS_28370 12106 10871 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435778.1 protein_id gnl|my_center|LOCUS_28370 13194 12103 gene locus_tag LOCUS_28380 gene rfbG 13194 12103 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_28380 13964 13191 gene locus_tag LOCUS_28390 gene rfbF 13964 13191 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037178.1 protein_id gnl|my_center|LOCUS_28390 14474 14082 gene locus_tag LOCUS_28400 14474 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 15100 14471 gene locus_tag LOCUS_28410 15100 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 16068 15103 gene locus_tag LOCUS_28420 16068 15103 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013600.1 protein_id gnl|my_center|LOCUS_28420 17657 16065 gene locus_tag LOCUS_28430 17657 16065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 19054 17816 gene locus_tag LOCUS_28440 19054 17816 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_28440 21641 19197 gene locus_tag LOCUS_28450 21641 19197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 24137 21756 gene locus_tag LOCUS_28460 24137 21756 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085599.1 protein_id gnl|my_center|LOCUS_28460 24629 24970 gene locus_tag LOCUS_28470 24629 24970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 25408 26289 gene locus_tag LOCUS_28480 25408 26289 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_28480 26309 27796 gene locus_tag LOCUS_28490 gene gltA 26309 27796 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082125.1 protein_id gnl|my_center|LOCUS_28490 27814 29718 gene locus_tag LOCUS_28500 27814 29718 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791976.1 protein_id gnl|my_center|LOCUS_28500 29787 30704 gene locus_tag LOCUS_28510 29787 30704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 30830 32923 gene locus_tag LOCUS_28520 30830 32923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence047 <1 2447 gene locus_tag LOCUS_28530 <1 2447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626661.1:translation initiation factor IF-2 2444 2857 gene locus_tag LOCUS_28540 2444 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 2861 3163 gene locus_tag LOCUS_28550 2861 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3163 3627 gene locus_tag LOCUS_28560 3163 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 3689 4615 gene locus_tag LOCUS_28570 gene truB 3689 4615 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391530.1 protein_id gnl|my_center|LOCUS_28570 4660 4929 gene locus_tag LOCUS_28580 gene rpsO 4660 4929 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_28580 5313 7547 gene locus_tag LOCUS_28590 gene pnp 5313 7547 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391532.1 protein_id gnl|my_center|LOCUS_28590 7656 9068 gene locus_tag LOCUS_28600 7656 9068 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_28600 10084 9224 gene locus_tag LOCUS_28610 gene pssA 10084 9224 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_28610 10728 10084 gene locus_tag LOCUS_28620 10728 10084 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 protein_id gnl|my_center|LOCUS_28620 10801 11319 gene locus_tag LOCUS_28630 10801 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 12170 11331 gene locus_tag LOCUS_28640 12170 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 12229 12921 gene locus_tag LOCUS_28650 12229 12921 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263283.1 protein_id gnl|my_center|LOCUS_28650 13570 13034 gene locus_tag LOCUS_28660 13570 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 13569 14150 gene locus_tag LOCUS_28670 13569 14150 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 protein_id gnl|my_center|LOCUS_28670 14268 14344 gene locus_tag LOCUS_t00300 14268 14344 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14411 14650 gene locus_tag LOCUS_28680 14411 14650 CDS product DUF6489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391370.1 protein_id gnl|my_center|LOCUS_28680 18329 14769 gene locus_tag LOCUS_28690 18329 14769 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111930220.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28690 18783 19508 gene locus_tag LOCUS_28700 gene minC 18783 19508 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086984.1 protein_id gnl|my_center|LOCUS_28700 19624 20448 gene locus_tag LOCUS_28710 gene minD 19624 20448 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976171.1 protein_id gnl|my_center|LOCUS_28710 20445 20708 gene locus_tag LOCUS_28720 gene minE 20445 20708 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530672.1 protein_id gnl|my_center|LOCUS_28720 21016 20717 gene locus_tag LOCUS_28730 21016 20717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 21235 22509 gene locus_tag LOCUS_28740 21235 22509 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257427.1 protein_id gnl|my_center|LOCUS_28740 22535 23968 gene locus_tag LOCUS_28750 gene pyk 22535 23968 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 protein_id gnl|my_center|LOCUS_28750 24173 23976 gene locus_tag LOCUS_28760 24173 23976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 24770 25285 gene locus_tag LOCUS_28770 24770 25285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 26048 25302 gene locus_tag LOCUS_28780 26048 25302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 26655 26059 gene locus_tag LOCUS_28790 26655 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 27790 26939 gene locus_tag LOCUS_28800 27790 26939 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535735.1 protein_id gnl|my_center|LOCUS_28800 28038 28904 gene locus_tag LOCUS_28810 28038 28904 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850619.1 protein_id gnl|my_center|LOCUS_28810 28901 30028 gene locus_tag LOCUS_28820 28901 30028 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028005617.1 protein_id gnl|my_center|LOCUS_28820 30152 31048 gene locus_tag LOCUS_28830 30152 31048 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920427.1 protein_id gnl|my_center|LOCUS_28830 31582 31088 gene locus_tag LOCUS_28840 31582 31088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 31848 31645 gene locus_tag LOCUS_28850 31848 31645 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence048 635 444 gene locus_tag LOCUS_28860 635 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 1028 666 gene locus_tag LOCUS_28870 1028 666 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_28870 1554 2138 gene locus_tag LOCUS_28880 1554 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 2370 2885 gene locus_tag LOCUS_28890 2370 2885 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_28890 2900 3478 gene locus_tag LOCUS_28900 2900 3478 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942948.1 protein_id gnl|my_center|LOCUS_28900 3657 4862 gene locus_tag LOCUS_28910 3657 4862 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_28910 4877 5164 gene locus_tag LOCUS_28920 4877 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 5261 6052 gene locus_tag LOCUS_28930 5261 6052 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_28930 6672 6049 gene locus_tag LOCUS_28940 6672 6049 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_28940 6792 7151 gene locus_tag LOCUS_28950 6792 7151 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390365.1 protein_id gnl|my_center|LOCUS_28950 7707 7165 gene locus_tag LOCUS_28960 7707 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 8861 7722 gene locus_tag LOCUS_28970 8861 7722 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_28970 9134 8904 gene locus_tag LOCUS_28980 9134 8904 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_28980 10537 9080 gene locus_tag LOCUS_28990 gene cobB 10537 9080 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_28990 11532 10546 gene locus_tag LOCUS_29000 11532 10546 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108776.1 protein_id gnl|my_center|LOCUS_29000 12701 11529 gene locus_tag LOCUS_29010 gene hmeB 12701 11529 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_29010 13421 12717 gene locus_tag LOCUS_29020 13421 12717 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393110.1 protein_id gnl|my_center|LOCUS_29020 13744 13418 gene locus_tag LOCUS_29030 13744 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 15680 13746 gene locus_tag LOCUS_29040 15680 13746 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_29040 17192 15702 gene locus_tag LOCUS_29050 17192 15702 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_29050 17917 17189 gene locus_tag LOCUS_29060 gene dsrM 17917 17189 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_29060 18280 17942 gene locus_tag LOCUS_29070 18280 17942 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_29070 18595 18293 gene locus_tag LOCUS_29080 gene tusB 18595 18293 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_29080 18993 18607 gene locus_tag LOCUS_29090 gene tusC 18993 18607 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_29090 19363 19004 gene locus_tag LOCUS_29100 gene tusD 19363 19004 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_29100 20446 19376 gene locus_tag LOCUS_29110 gene dsrB 20446 19376 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_29110 21733 20477 gene locus_tag LOCUS_29120 gene dsrA 21733 20477 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_29120 21993 22226 gene locus_tag LOCUS_29130 21993 22226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 22999 22208 gene locus_tag LOCUS_29140 22999 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 24142 23300 gene locus_tag LOCUS_29150 24142 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 25022 24153 gene locus_tag LOCUS_29160 gene modD 25022 24153 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000265.1 protein_id gnl|my_center|LOCUS_29160 25976 25248 gene locus_tag LOCUS_29170 25976 25248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 26503 26078 gene locus_tag LOCUS_29180 26503 26078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389789.1 protein_id gnl|my_center|LOCUS_29180 26682 27038 gene locus_tag LOCUS_29190 26682 27038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 27109 27651 gene locus_tag LOCUS_29200 27109 27651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 27668 28228 gene locus_tag LOCUS_29210 gene petA 27668 28228 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597339.1 protein_id gnl|my_center|LOCUS_29210 28412 28861 gene locus_tag LOCUS_29220 28412 28861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 28941 29273 gene locus_tag LOCUS_29230 28941 29273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 29650 30351 gene locus_tag LOCUS_29240 29650 30351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence049 1891 1004 gene locus_tag LOCUS_29250 1891 1004 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_29250 2996 1884 gene locus_tag LOCUS_29260 gene hisC 2996 1884 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391012.1 protein_id gnl|my_center|LOCUS_29260 3889 2993 gene locus_tag LOCUS_29270 3889 2993 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_29270 4003 5148 gene locus_tag LOCUS_29280 4003 5148 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_29280 5381 6028 gene locus_tag LOCUS_29290 gene metW 5381 6028 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_29290 7469 6255 gene locus_tag LOCUS_29300 7469 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 7912 8271 gene locus_tag LOCUS_29310 7912 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 8977 8288 gene locus_tag LOCUS_29320 8977 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29320 10950 8974 gene locus_tag LOCUS_29330 10950 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 12277 10961 gene locus_tag LOCUS_29340 gene lysA 12277 10961 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388155.1 protein_id gnl|my_center|LOCUS_29340 12444 12665 gene locus_tag LOCUS_29350 12444 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 14344 12935 gene locus_tag LOCUS_29360 gene argH 14344 12935 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338440.1 protein_id gnl|my_center|LOCUS_29360 14372 14965 gene locus_tag LOCUS_29370 14372 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 16563 15067 gene locus_tag LOCUS_29380 16563 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 16861 16526 gene locus_tag LOCUS_29390 16861 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 17723 16962 gene locus_tag LOCUS_29400 17723 16962 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532723.1 protein_id gnl|my_center|LOCUS_29400 18930 17731 gene locus_tag LOCUS_29410 18930 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 19787 18846 gene locus_tag LOCUS_29420 19787 18846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 20815 19886 gene locus_tag LOCUS_29430 20815 19886 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_29430 21751 20816 gene locus_tag LOCUS_29440 21751 20816 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_29440 22504 21755 gene locus_tag LOCUS_29450 22504 21755 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_29450 23210 22665 gene locus_tag LOCUS_29460 23210 22665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 24325 25251 gene locus_tag LOCUS_29470 24325 25251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29470 26037 25396 gene locus_tag LOCUS_29480 gene folE 26037 25396 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388024.1 protein_id gnl|my_center|LOCUS_29480 26619 26215 gene locus_tag LOCUS_29490 gene apaG 26619 26215 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388023.1 protein_id gnl|my_center|LOCUS_29490 27894 26692 gene locus_tag LOCUS_29500 27894 26692 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974345.1 protein_id gnl|my_center|LOCUS_29500 28184 28257 gene locus_tag LOCUS_t00310 28184 28257 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 28655 28281 gene locus_tag LOCUS_29510 28655 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 28789 29448 gene locus_tag LOCUS_29520 gene ftsE 28789 29448 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 protein_id gnl|my_center|LOCUS_29520 >Feature sequence050 928 575 gene locus_tag LOCUS_29530 928 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 1338 1090 gene locus_tag LOCUS_29540 1338 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 1664 1362 gene locus_tag LOCUS_29550 1664 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2062 1643 gene locus_tag LOCUS_29560 2062 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2570 3562 gene locus_tag LOCUS_29570 2570 3562 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_29570 3635 4084 gene locus_tag LOCUS_29580 3635 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 4214 8095 gene locus_tag LOCUS_29590 4214 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 9405 8110 gene locus_tag LOCUS_29600 9405 8110 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035843.1 protein_id gnl|my_center|LOCUS_29600 12366 9568 gene locus_tag LOCUS_29610 12366 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 12571 13638 gene locus_tag LOCUS_29620 gene rfbB 12571 13638 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387761.1 protein_id gnl|my_center|LOCUS_29620 13635 14528 gene locus_tag LOCUS_29630 gene rfbA 13635 14528 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815331.1 protein_id gnl|my_center|LOCUS_29630 14534 15091 gene locus_tag LOCUS_29640 gene rfbC 14534 15091 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387749.1 protein_id gnl|my_center|LOCUS_29640 15121 16044 gene locus_tag LOCUS_29650 gene rfbD 15121 16044 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 protein_id gnl|my_center|LOCUS_29650 16692 16039 gene locus_tag LOCUS_29660 16692 16039 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_29660 16691 17425 gene locus_tag LOCUS_29670 16691 17425 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957298.1 protein_id gnl|my_center|LOCUS_29670 17934 17485 gene locus_tag LOCUS_29680 17934 17485 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_29680 18581 18135 gene locus_tag LOCUS_29690 18581 18135 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971842.1 protein_id gnl|my_center|LOCUS_29690 18869 19402 gene locus_tag LOCUS_29700 18869 19402 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241465.1 protein_id gnl|my_center|LOCUS_29700 21463 19418 gene locus_tag LOCUS_29710 21463 19418 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_29710 21825 21622 gene locus_tag LOCUS_29720 21825 21622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 21713 24109 gene locus_tag LOCUS_29730 gene hrpB 21713 24109 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440436.1 protein_id gnl|my_center|LOCUS_29730 24197 25246 gene locus_tag LOCUS_29740 24197 25246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 25252 25929 gene locus_tag LOCUS_29750 25252 25929 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_29750 25934 27412 gene locus_tag LOCUS_29760 25934 27412 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_29760 27471 27806 gene locus_tag LOCUS_29770 27471 27806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 28273 27878 gene locus_tag LOCUS_29780 28273 27878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 28535 28254 gene locus_tag LOCUS_29790 28535 28254 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965479.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence051 290 508 gene locus_tag LOCUS_29800 290 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 549 1919 gene locus_tag LOCUS_29810 gene atpD 549 1919 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045606127.1 protein_id gnl|my_center|LOCUS_29810 1916 2335 gene locus_tag LOCUS_29820 1916 2335 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836235.1 protein_id gnl|my_center|LOCUS_29820 2332 2628 gene locus_tag LOCUS_29830 2332 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 2625 2894 gene locus_tag LOCUS_29840 2625 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 2939 3589 gene locus_tag LOCUS_29850 2939 3589 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724766.1 protein_id gnl|my_center|LOCUS_29850 3586 3834 gene locus_tag LOCUS_29860 3586 3834 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187193.1 protein_id gnl|my_center|LOCUS_29860 3847 4572 gene locus_tag LOCUS_29870 3847 4572 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188739.1 protein_id gnl|my_center|LOCUS_29870 4786 6300 gene locus_tag LOCUS_29880 4786 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 6297 7223 gene locus_tag LOCUS_29890 6297 7223 CDS product FoF1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009972311.1 protein_id gnl|my_center|LOCUS_29890 6470 6554 gene locus_tag LOCUS_t00320 6470 6554 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7633 7241 gene locus_tag LOCUS_29900 7633 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 7924 9639 gene locus_tag LOCUS_29910 gene kaiC 7924 9639 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_29910 9636 9980 gene locus_tag LOCUS_29920 gene kaiB 9636 9980 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125575.1 protein_id gnl|my_center|LOCUS_29920 9982 10296 gene locus_tag LOCUS_29930 9982 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 10293 12062 gene locus_tag LOCUS_29940 10293 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 12219 15119 gene locus_tag LOCUS_29950 12219 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 15094 15480 gene locus_tag LOCUS_29960 15094 15480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 16881 15880 gene locus_tag LOCUS_29970 16881 15880 CDS product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086271.1 protein_id gnl|my_center|LOCUS_29970 18533 16878 gene locus_tag LOCUS_29980 18533 16878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 18986 18606 gene locus_tag LOCUS_29990 18986 18606 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083682.1 protein_id gnl|my_center|LOCUS_29990 19602 19261 gene locus_tag LOCUS_30000 19602 19261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 20306 20025 gene locus_tag LOCUS_30010 20306 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30010 20376 20582 gene locus_tag LOCUS_30020 20376 20582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 21191 20955 gene locus_tag LOCUS_30030 21191 20955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 21376 22701 gene locus_tag LOCUS_30040 21376 22701 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_30040 23280 25058 gene locus_tag LOCUS_30050 23280 25058 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525224.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence052 703 23 gene locus_tag LOCUS_30060 gene dnaQ 703 23 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_30060 1428 700 gene locus_tag LOCUS_30070 1428 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 1629 2210 gene locus_tag LOCUS_30080 1629 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 2259 6494 gene locus_tag LOCUS_30090 2259 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 6569 8179 gene locus_tag LOCUS_30100 6569 8179 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085806.1 protein_id gnl|my_center|LOCUS_30100 8983 8231 gene locus_tag LOCUS_30110 8983 8231 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722560.1 protein_id gnl|my_center|LOCUS_30110 10131 9010 gene locus_tag LOCUS_30120 10131 9010 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085697.1 protein_id gnl|my_center|LOCUS_30120 11314 10133 gene locus_tag LOCUS_30130 11314 10133 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_30130 12405 11380 gene locus_tag LOCUS_30140 12405 11380 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 protein_id gnl|my_center|LOCUS_30140 12501 12992 gene locus_tag LOCUS_30150 12501 12992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 13085 13282 gene locus_tag LOCUS_30160 13085 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 13362 14648 gene locus_tag LOCUS_30170 13362 14648 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 protein_id gnl|my_center|LOCUS_30170 14946 16589 gene locus_tag LOCUS_30180 14946 16589 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_30180 17425 16664 gene locus_tag LOCUS_30190 gene rquA 17425 16664 CDS product rhodoquinone biosynthesis methyltransferase RquA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390975.1 protein_id gnl|my_center|LOCUS_30190 17731 18288 gene locus_tag LOCUS_30200 17731 18288 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_30200 18469 19053 gene locus_tag LOCUS_30210 18469 19053 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972362.1 protein_id gnl|my_center|LOCUS_30210 19097 19762 gene locus_tag LOCUS_30220 19097 19762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 19767 20231 gene locus_tag LOCUS_30230 19767 20231 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337316.1 protein_id gnl|my_center|LOCUS_30230 20594 20322 gene locus_tag LOCUS_30240 20594 20322 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391512.1 protein_id gnl|my_center|LOCUS_30240 20775 21083 gene locus_tag LOCUS_30250 20775 21083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 21344 21832 gene locus_tag LOCUS_30260 21344 21832 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_30260 21871 22695 gene locus_tag LOCUS_30270 21871 22695 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_30270 22679 24184 gene locus_tag LOCUS_30280 gene lnt 22679 24184 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_30280 24497 24255 gene locus_tag LOCUS_30290 24497 24255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 24423 24740 gene locus_tag LOCUS_30300 24423 24740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 24912 25466 gene locus_tag LOCUS_30310 24912 25466 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391522.1 protein_id gnl|my_center|LOCUS_30310 25494 26168 gene locus_tag LOCUS_30320 gene nth 25494 26168 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence053 1124 261 gene locus_tag LOCUS_30330 1124 261 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_30330 3199 1328 gene locus_tag LOCUS_30340 3199 1328 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_30340 3507 3157 gene locus_tag LOCUS_30350 3507 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 3786 5633 gene locus_tag LOCUS_30360 3786 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 5736 6947 gene locus_tag LOCUS_30370 5736 6947 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_30370 6995 8251 gene locus_tag LOCUS_30380 6995 8251 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338785.1 protein_id gnl|my_center|LOCUS_30380 9057 8497 gene locus_tag LOCUS_30390 9057 8497 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_30390 9232 10428 gene locus_tag LOCUS_30400 9232 10428 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337152.1 protein_id gnl|my_center|LOCUS_30400 10425 11411 gene locus_tag LOCUS_30410 gene argF 10425 11411 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470667.1 protein_id gnl|my_center|LOCUS_30410 11712 12473 gene locus_tag LOCUS_30420 11712 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 12739 13152 gene locus_tag LOCUS_30430 12739 13152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 13893 13168 gene locus_tag LOCUS_30440 13893 13168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813864.1 protein_id gnl|my_center|LOCUS_30440 15653 13890 gene locus_tag LOCUS_30450 15653 13890 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971602.1 protein_id gnl|my_center|LOCUS_30450 16687 15650 gene locus_tag LOCUS_30460 16687 15650 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195812.1 protein_id gnl|my_center|LOCUS_30460 17930 16773 gene locus_tag LOCUS_30470 17930 16773 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813867.1 protein_id gnl|my_center|LOCUS_30470 19181 18024 gene locus_tag LOCUS_30480 19181 18024 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_30480 19313 20959 gene locus_tag LOCUS_30490 19313 20959 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085749.1 protein_id gnl|my_center|LOCUS_30490 22467 21034 gene locus_tag LOCUS_30500 22467 21034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 22894 22589 gene locus_tag LOCUS_30510 22894 22589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 23225 23437 gene locus_tag LOCUS_30520 gene pufB 23225 23437 CDS product light-harvesting antenna LH1, beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390725.1 protein_id gnl|my_center|LOCUS_30520 23447 23653 gene locus_tag LOCUS_30530 23447 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 23957 26545 gene locus_tag LOCUS_30540 23957 26545 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence054 <1 2160 gene locus_tag LOCUS_30550 <1 2160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388279.1:chemotaxis protein CheW 2176 2655 gene locus_tag LOCUS_30560 2176 2655 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 protein_id gnl|my_center|LOCUS_30560 2660 3043 gene locus_tag LOCUS_30570 2660 3043 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923289.1 protein_id gnl|my_center|LOCUS_30570 3040 4161 gene locus_tag LOCUS_30580 3040 4161 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918484.1 protein_id gnl|my_center|LOCUS_30580 4158 5006 gene locus_tag LOCUS_30590 4158 5006 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_30590 5237 6604 gene locus_tag LOCUS_30600 5237 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 7900 6770 gene locus_tag LOCUS_30610 7900 6770 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388688.1 protein_id gnl|my_center|LOCUS_30610 8882 7911 gene locus_tag LOCUS_30620 8882 7911 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626066.1 protein_id gnl|my_center|LOCUS_30620 9911 8946 gene locus_tag LOCUS_30630 9911 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 10391 10158 gene locus_tag LOCUS_30640 10391 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390514.1 protein_id gnl|my_center|LOCUS_30640 11318 10464 gene locus_tag LOCUS_30650 11318 10464 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376994.1 protein_id gnl|my_center|LOCUS_30650 12069 11326 gene locus_tag LOCUS_30660 gene aztA 12069 11326 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267626.1 protein_id gnl|my_center|LOCUS_30660 12320 12066 gene locus_tag LOCUS_30670 12320 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 12239 13525 gene locus_tag LOCUS_30680 12239 13525 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259113.1 protein_id gnl|my_center|LOCUS_30680 13836 13543 gene locus_tag LOCUS_30690 13836 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 14664 13918 gene locus_tag LOCUS_30700 14664 13918 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115022.1 protein_id gnl|my_center|LOCUS_30700 15407 14661 gene locus_tag LOCUS_30710 15407 14661 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965276.1 protein_id gnl|my_center|LOCUS_30710 15623 15877 gene locus_tag LOCUS_30720 15623 15877 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626599.1 protein_id gnl|my_center|LOCUS_30720 16020 18947 gene locus_tag LOCUS_30730 16020 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 19093 19437 gene locus_tag LOCUS_30740 19093 19437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 19434 19643 gene locus_tag LOCUS_30750 19434 19643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 19725 20483 gene locus_tag LOCUS_30760 19725 20483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 22413 20620 gene locus_tag LOCUS_30770 22413 20620 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_30770 22886 22425 gene locus_tag LOCUS_30780 22886 22425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 23224 22886 gene locus_tag LOCUS_30790 23224 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 24130 23267 gene locus_tag LOCUS_30800 24130 23267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 24297 25361 gene locus_tag LOCUS_30810 24297 25361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 25429 26367 gene locus_tag LOCUS_30820 25429 26367 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064007.1 protein_id gnl|my_center|LOCUS_30820 >Feature sequence055 512 1114 gene locus_tag LOCUS_30830 512 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 1117 1359 gene locus_tag LOCUS_30840 1117 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 1340 1519 gene locus_tag LOCUS_30850 1340 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 1516 1710 gene locus_tag LOCUS_30860 1516 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 2179 2397 gene locus_tag LOCUS_30870 2179 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 2600 2524 gene locus_tag LOCUS_t00330 2600 2524 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5550 2668 gene locus_tag LOCUS_30880 5550 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 6903 5770 gene locus_tag LOCUS_30890 gene ppk2 6903 5770 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338472.1 protein_id gnl|my_center|LOCUS_30890 7354 7046 gene locus_tag LOCUS_30900 7354 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 7790 8032 gene locus_tag LOCUS_30910 7790 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 8105 8512 gene locus_tag LOCUS_30920 8105 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 8861 8484 gene locus_tag LOCUS_30930 8861 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 9475 8894 gene locus_tag LOCUS_30940 9475 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 9758 11440 gene locus_tag LOCUS_30950 gene cydD 9758 11440 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040597.1 protein_id gnl|my_center|LOCUS_30950 12601 11684 gene locus_tag LOCUS_30960 12601 11684 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_30960 13071 12628 gene locus_tag LOCUS_30970 13071 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 13968 13162 gene locus_tag LOCUS_30980 13968 13162 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195415.1 protein_id gnl|my_center|LOCUS_30980 14693 13998 gene locus_tag LOCUS_30990 gene tpiA 14693 13998 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389642.1 protein_id gnl|my_center|LOCUS_30990 14836 16752 gene locus_tag LOCUS_31000 14836 16752 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389643.1 protein_id gnl|my_center|LOCUS_31000 16800 18314 gene locus_tag LOCUS_31010 gene trpE 16800 18314 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_31010 18524 19495 gene locus_tag LOCUS_31020 18524 19495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 19577 20155 gene locus_tag LOCUS_31030 19577 20155 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_31030 20273 21427 gene locus_tag LOCUS_31040 20273 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 22272 21529 gene locus_tag LOCUS_31050 22272 21529 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086938.1 protein_id gnl|my_center|LOCUS_31050 22718 24364 gene locus_tag LOCUS_31060 22718 24364 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389640.1 protein_id gnl|my_center|LOCUS_31060 24377 25198 gene locus_tag LOCUS_31070 gene kdsA 24377 25198 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382951.1 protein_id gnl|my_center|LOCUS_31070 25200 25637 gene locus_tag LOCUS_31080 25200 25637 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507823.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence056 501 956 gene locus_tag LOCUS_31090 501 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 2213 1098 gene locus_tag LOCUS_31100 gene proB 2213 1098 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970464.1 protein_id gnl|my_center|LOCUS_31100 3229 2210 gene locus_tag LOCUS_31110 gene obgE 3229 2210 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083257.1 protein_id gnl|my_center|LOCUS_31110 3586 3302 gene locus_tag LOCUS_31120 gene rpmA 3586 3302 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067214.1 protein_id gnl|my_center|LOCUS_31120 3914 3600 gene locus_tag LOCUS_31130 gene rplU 3914 3600 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067213.1 protein_id gnl|my_center|LOCUS_31130 4341 4060 gene locus_tag LOCUS_31140 4341 4060 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_31140 4644 5474 gene locus_tag LOCUS_31150 gene dapF 4644 5474 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 protein_id gnl|my_center|LOCUS_31150 5483 6700 gene locus_tag LOCUS_31160 gene mtaB 5483 6700 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_31160 6700 7620 gene locus_tag LOCUS_31170 6700 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31170 8773 7754 gene locus_tag LOCUS_31180 gene ilvC 8773 7754 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089237.1 protein_id gnl|my_center|LOCUS_31180 9394 8861 gene locus_tag LOCUS_31190 gene ilvN 9394 8861 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_31190 11248 9440 gene locus_tag LOCUS_31200 11248 9440 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388226.1 protein_id gnl|my_center|LOCUS_31200 12242 11283 gene locus_tag LOCUS_31210 gene miaA 12242 11283 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388225.1 protein_id gnl|my_center|LOCUS_31210 12298 13176 gene locus_tag LOCUS_31220 gene serB 12298 13176 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388224.1 protein_id gnl|my_center|LOCUS_31220 13350 13913 gene locus_tag LOCUS_31230 13350 13913 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705937.1 protein_id gnl|my_center|LOCUS_31230 14874 13984 gene locus_tag LOCUS_31240 14874 13984 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967882.1 protein_id gnl|my_center|LOCUS_31240 14987 15412 gene locus_tag LOCUS_31250 14987 15412 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089292.1 protein_id gnl|my_center|LOCUS_31250 15428 16222 gene locus_tag LOCUS_31260 15428 16222 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_31260 16870 16244 gene locus_tag LOCUS_31270 16870 16244 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090855.1 protein_id gnl|my_center|LOCUS_31270 17774 16956 gene locus_tag LOCUS_31280 17774 16956 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265631.1 protein_id gnl|my_center|LOCUS_31280 18799 17831 gene locus_tag LOCUS_31290 gene prfB 18799 17831 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148265477.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31290 21621 18994 gene locus_tag LOCUS_31300 21621 18994 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_31300 22514 21669 gene locus_tag LOCUS_31310 22514 21669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 >Feature sequence057 689 1768 gene locus_tag LOCUS_31320 689 1768 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965440.1 protein_id gnl|my_center|LOCUS_31320 1768 4842 gene locus_tag LOCUS_31330 1768 4842 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090047.1 protein_id gnl|my_center|LOCUS_31330 4889 5413 gene locus_tag LOCUS_31340 4889 5413 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090050.1 protein_id gnl|my_center|LOCUS_31340 5406 5693 gene locus_tag LOCUS_31350 5406 5693 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090051.1 protein_id gnl|my_center|LOCUS_31350 5690 5983 gene locus_tag LOCUS_31360 5690 5983 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_31360 5980 6945 gene locus_tag LOCUS_31370 5980 6945 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090053.1 protein_id gnl|my_center|LOCUS_31370 6942 7289 gene locus_tag LOCUS_31380 6942 7289 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090054.1 protein_id gnl|my_center|LOCUS_31380 7289 8818 gene locus_tag LOCUS_31390 7289 8818 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090055.1 protein_id gnl|my_center|LOCUS_31390 8815 10446 gene locus_tag LOCUS_31400 8815 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 11561 10530 gene locus_tag LOCUS_31410 11561 10530 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095519074.1 protein_id gnl|my_center|LOCUS_31410 12016 12495 gene locus_tag LOCUS_31420 12016 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 13092 12568 gene locus_tag LOCUS_31430 13092 12568 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649445.1 protein_id gnl|my_center|LOCUS_31430 14300 13251 gene locus_tag LOCUS_31440 14300 13251 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966094.1 protein_id gnl|my_center|LOCUS_31440 16369 14672 gene locus_tag LOCUS_31450 16369 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 16369 16572 gene locus_tag LOCUS_31460 16369 16572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 16657 16986 gene locus_tag LOCUS_31470 16657 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31470 18722 17523 gene locus_tag LOCUS_31480 18722 17523 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970121.1 protein_id gnl|my_center|LOCUS_31480 20284 18770 gene locus_tag LOCUS_31490 20284 18770 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970122.1 protein_id gnl|my_center|LOCUS_31490 20877 22556 gene locus_tag LOCUS_31500 20877 22556 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206542.1 protein_id gnl|my_center|LOCUS_31500 24444 22606 gene locus_tag LOCUS_31510 24444 22606 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970120.1 protein_id gnl|my_center|LOCUS_31510 25293 24844 gene locus_tag LOCUS_31520 25293 24844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence058 298 600 gene locus_tag LOCUS_31530 298 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 597 2069 gene locus_tag LOCUS_31540 gene zwf 597 2069 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971003.1 protein_id gnl|my_center|LOCUS_31540 2880 2128 gene locus_tag LOCUS_31550 2880 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 4541 2880 gene locus_tag LOCUS_31560 4541 2880 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495579.1 protein_id gnl|my_center|LOCUS_31560 5594 4734 gene locus_tag LOCUS_31570 gene purU 5594 4734 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921457.1 protein_id gnl|my_center|LOCUS_31570 6181 5777 gene locus_tag LOCUS_31580 6181 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 7746 6178 gene locus_tag LOCUS_31590 7746 6178 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525090.1 protein_id gnl|my_center|LOCUS_31590 9421 7736 gene locus_tag LOCUS_31600 9421 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965716.1 protein_id gnl|my_center|LOCUS_31600 10889 10002 gene locus_tag LOCUS_31610 10889 10002 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_31610 11944 10976 gene locus_tag LOCUS_31620 gene trxB 11944 10976 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_31620 12130 12606 gene locus_tag LOCUS_31630 12130 12606 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_31630 12705 14120 gene locus_tag LOCUS_31640 12705 14120 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_31640 14149 15123 gene locus_tag LOCUS_31650 14149 15123 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528653.1 protein_id gnl|my_center|LOCUS_31650 15511 15137 gene locus_tag LOCUS_31660 15511 15137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 15640 16212 gene locus_tag LOCUS_31670 15640 16212 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389277.1 protein_id gnl|my_center|LOCUS_31670 17365 16223 gene locus_tag LOCUS_31680 17365 16223 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388806.1 protein_id gnl|my_center|LOCUS_31680 17871 17362 gene locus_tag LOCUS_31690 gene purE 17871 17362 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529209.1 protein_id gnl|my_center|LOCUS_31690 18184 17981 gene locus_tag LOCUS_31700 18184 17981 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_31700 18396 18566 gene locus_tag LOCUS_31710 18396 18566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 19368 18787 gene locus_tag LOCUS_31720 19368 18787 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_31720 19603 19794 gene locus_tag LOCUS_31730 19603 19794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 20344 19871 gene locus_tag LOCUS_31740 20344 19871 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173863.1 protein_id gnl|my_center|LOCUS_31740 21597 20725 gene locus_tag LOCUS_31750 21597 20725 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966160.1 protein_id gnl|my_center|LOCUS_31750 21688 22683 gene locus_tag LOCUS_31760 21688 22683 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_31760 22680 23105 gene locus_tag LOCUS_31770 22680 23105 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_31770 23102 23536 gene locus_tag LOCUS_31780 23102 23536 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_31780 24617 24000 gene locus_tag LOCUS_31790 24617 24000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence059 110 1387 gene locus_tag LOCUS_31800 gene eno 110 1387 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389638.1 protein_id gnl|my_center|LOCUS_31800 1864 1445 gene locus_tag LOCUS_31810 1864 1445 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971842.1 protein_id gnl|my_center|LOCUS_31810 3907 2024 gene locus_tag LOCUS_31820 gene cysC 3907 2024 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_31820 4701 3907 gene locus_tag LOCUS_31830 4701 3907 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084292.1 protein_id gnl|my_center|LOCUS_31830 5441 4704 gene locus_tag LOCUS_31840 5441 4704 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084297.1 protein_id gnl|my_center|LOCUS_31840 5735 7219 gene locus_tag LOCUS_31850 5735 7219 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459002.1 protein_id gnl|my_center|LOCUS_31850 7236 7391 gene locus_tag LOCUS_31860 7236 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 7726 7454 gene locus_tag LOCUS_31870 7726 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 8185 7922 gene locus_tag LOCUS_31880 8185 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 8806 8393 gene locus_tag LOCUS_31890 8806 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 10413 8803 gene locus_tag LOCUS_31900 10413 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 11141 10410 gene locus_tag LOCUS_31910 11141 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 12003 11152 gene locus_tag LOCUS_31920 12003 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204824.1 protein_id gnl|my_center|LOCUS_31920 12207 12899 gene locus_tag LOCUS_31930 12207 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 14472 12967 gene locus_tag LOCUS_31940 14472 12967 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_31940 14585 15838 gene locus_tag LOCUS_31950 14585 15838 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 protein_id gnl|my_center|LOCUS_31950 15852 17414 gene locus_tag LOCUS_31960 15852 17414 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521735.1 protein_id gnl|my_center|LOCUS_31960 17633 19438 gene locus_tag LOCUS_31970 17633 19438 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_31970 19891 19553 gene locus_tag LOCUS_31980 gene grxD 19891 19553 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388463.1 protein_id gnl|my_center|LOCUS_31980 20136 19888 gene locus_tag LOCUS_31990 20136 19888 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088461.1 protein_id gnl|my_center|LOCUS_31990 22344 20161 gene locus_tag LOCUS_32000 gene purL 22344 20161 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_32000 23096 22404 gene locus_tag LOCUS_32010 gene purQ 23096 22404 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088468.1 protein_id gnl|my_center|LOCUS_32010 23350 23093 gene locus_tag LOCUS_32020 gene purS 23350 23093 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_32020 23972 23424 gene locus_tag LOCUS_32030 23972 23424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 24903 24139 gene locus_tag LOCUS_32040 24903 24139 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388469.1 protein_id gnl|my_center|LOCUS_32040 >Feature sequence060 164 523 gene locus_tag LOCUS_32050 164 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 661 586 gene locus_tag LOCUS_t00340 661 586 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 825 1142 gene locus_tag LOCUS_32060 825 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 1139 1441 gene locus_tag LOCUS_32070 1139 1441 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528978.1 protein_id gnl|my_center|LOCUS_32070 1468 2280 gene locus_tag LOCUS_32080 1468 2280 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228455.1 protein_id gnl|my_center|LOCUS_32080 2525 2364 gene locus_tag LOCUS_32090 2525 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 2592 3356 gene locus_tag LOCUS_32100 2592 3356 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087332.1 protein_id gnl|my_center|LOCUS_32100 3526 4182 gene locus_tag LOCUS_32110 3526 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 4772 4266 gene locus_tag LOCUS_32120 gene ccmE 4772 4266 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085910.1 protein_id gnl|my_center|LOCUS_32120 4925 4788 gene locus_tag LOCUS_32130 4925 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 5692 4922 gene locus_tag LOCUS_32140 5692 4922 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_32140 5791 6084 gene locus_tag LOCUS_32150 5791 6084 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528905.1 protein_id gnl|my_center|LOCUS_32150 6084 6512 gene locus_tag LOCUS_32160 6084 6512 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_32160 6509 6994 gene locus_tag LOCUS_32170 6509 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 6991 7353 gene locus_tag LOCUS_32180 6991 7353 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_32180 7423 9354 gene locus_tag LOCUS_32190 gene acs 7423 9354 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_32190 9822 9430 gene locus_tag LOCUS_32200 9822 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 10446 9877 gene locus_tag LOCUS_32210 10446 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32210 10399 11268 gene locus_tag LOCUS_32220 10399 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 11247 11332 gene locus_tag LOCUS_t00350 11247 11332 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 11504 12721 gene locus_tag LOCUS_32230 11504 12721 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209929.1 protein_id gnl|my_center|LOCUS_32230 15145 12830 gene locus_tag LOCUS_32240 15145 12830 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126619406.1 protein_id gnl|my_center|LOCUS_32240 15290 17527 gene locus_tag LOCUS_32250 15290 17527 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_32250 20114 17832 gene locus_tag LOCUS_32260 20114 17832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 21612 20698 gene locus_tag LOCUS_32270 21612 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 21947 21609 gene locus_tag LOCUS_32280 21947 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 22712 22071 gene locus_tag LOCUS_32290 22712 22071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 23222 24808 gene locus_tag LOCUS_32300 23222 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence061 273 956 gene locus_tag LOCUS_32310 273 956 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 protein_id gnl|my_center|LOCUS_32310 1199 3079 gene locus_tag LOCUS_32320 1199 3079 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086584.1 protein_id gnl|my_center|LOCUS_32320 3366 3094 gene locus_tag LOCUS_32330 3366 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 3463 3984 gene locus_tag LOCUS_32340 3463 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 4036 4551 gene locus_tag LOCUS_32350 4036 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 5906 4632 gene locus_tag LOCUS_32360 5906 4632 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528911.1 protein_id gnl|my_center|LOCUS_32360 7054 5906 gene locus_tag LOCUS_32370 7054 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 7734 7051 gene locus_tag LOCUS_32380 7734 7051 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528909.1 protein_id gnl|my_center|LOCUS_32380 8719 7775 gene locus_tag LOCUS_32390 gene hemC 8719 7775 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391315.1 protein_id gnl|my_center|LOCUS_32390 8860 9948 gene locus_tag LOCUS_32400 gene tsaD 8860 9948 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 protein_id gnl|my_center|LOCUS_32400 9959 10780 gene locus_tag LOCUS_32410 gene rlmJ 9959 10780 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389691.1 protein_id gnl|my_center|LOCUS_32410 10773 11723 gene locus_tag LOCUS_32420 10773 11723 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639871.1 protein_id gnl|my_center|LOCUS_32420 11850 13670 gene locus_tag LOCUS_32430 11850 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 13743 15323 gene locus_tag LOCUS_32440 gene murJ 13743 15323 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_32440 15348 15986 gene locus_tag LOCUS_32450 15348 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 15983 17095 gene locus_tag LOCUS_32460 gene trpS 15983 17095 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391282.1 protein_id gnl|my_center|LOCUS_32460 17102 18175 gene locus_tag LOCUS_32470 17102 18175 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705134.1 protein_id gnl|my_center|LOCUS_32470 19933 18185 gene locus_tag LOCUS_32480 19933 18185 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_32480 20633 20046 gene locus_tag LOCUS_32490 20633 20046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 21120 21542 gene locus_tag LOCUS_32500 21120 21542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 21784 23211 gene locus_tag LOCUS_32510 21784 23211 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_32510 23679 23338 gene locus_tag LOCUS_32520 23679 23338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 >Feature sequence062 131 616 gene locus_tag LOCUS_32530 131 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 680 1483 gene locus_tag LOCUS_32540 gene menB 680 1483 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_32540 1511 2692 gene locus_tag LOCUS_32550 gene pimC 1511 2692 CDS product pimeloyl-CoA dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090542.1 protein_id gnl|my_center|LOCUS_32550 2695 3846 gene locus_tag LOCUS_32560 gene pimD 2695 3846 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_32560 4333 3860 gene locus_tag LOCUS_32570 4333 3860 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815617.1 protein_id gnl|my_center|LOCUS_32570 4470 5237 gene locus_tag LOCUS_32580 4470 5237 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_32580 5310 6356 gene locus_tag LOCUS_32590 5310 6356 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_32590 8116 6422 gene locus_tag LOCUS_32600 8116 6422 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 protein_id gnl|my_center|LOCUS_32600 9971 8643 gene locus_tag LOCUS_32610 9971 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 10134 11783 gene locus_tag LOCUS_32620 10134 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 11793 12275 gene locus_tag LOCUS_32630 11793 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 12741 12280 gene locus_tag LOCUS_32640 12741 12280 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524657.1 protein_id gnl|my_center|LOCUS_32640 13683 12772 gene locus_tag LOCUS_32650 gene benC 13683 12772 CDS product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705526.1 protein_id gnl|my_center|LOCUS_32650 15524 13866 gene locus_tag LOCUS_32660 gene hcp 15524 13866 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390569.1 protein_id gnl|my_center|LOCUS_32660 15709 16149 gene locus_tag LOCUS_32670 15709 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 protein_id gnl|my_center|LOCUS_32670 16231 17583 gene locus_tag LOCUS_32680 gene hemN 16231 17583 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089823.1 protein_id gnl|my_center|LOCUS_32680 17586 18215 gene locus_tag LOCUS_32690 17586 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 18710 18228 gene locus_tag LOCUS_32700 18710 18228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 18886 19638 gene locus_tag LOCUS_32710 18886 19638 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 protein_id gnl|my_center|LOCUS_32710 19758 20384 gene locus_tag LOCUS_32720 19758 20384 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390957.1 protein_id gnl|my_center|LOCUS_32720 20487 21560 gene locus_tag LOCUS_32730 20487 21560 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385525.1 protein_id gnl|my_center|LOCUS_32730 21898 24081 gene locus_tag LOCUS_32740 gene uvrB 21898 24081 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470604.1 protein_id gnl|my_center|LOCUS_32740 >Feature sequence063 177 410 gene locus_tag LOCUS_32750 177 410 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_32750 403 720 gene locus_tag LOCUS_32760 403 720 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_32760 826 1395 gene locus_tag LOCUS_32770 826 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 1677 1435 gene locus_tag LOCUS_32780 gene rpmE 1677 1435 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388827.1 protein_id gnl|my_center|LOCUS_32780 1877 3103 gene locus_tag LOCUS_32790 1877 3103 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_32790 3282 3938 gene locus_tag LOCUS_32800 3282 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 4018 4533 gene locus_tag LOCUS_32810 4018 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 4530 5471 gene locus_tag LOCUS_32820 4530 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 5606 6088 gene locus_tag LOCUS_32830 5606 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 6612 6181 gene locus_tag LOCUS_32840 6612 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 7542 6820 gene locus_tag LOCUS_32850 gene phbB 7542 6820 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_32850 7722 8186 gene locus_tag LOCUS_32860 7722 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 8939 8199 gene locus_tag LOCUS_32870 8939 8199 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085797.1 protein_id gnl|my_center|LOCUS_32870 9463 8936 gene locus_tag LOCUS_32880 9463 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32880 9820 9491 gene locus_tag LOCUS_32890 9820 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 10751 9831 gene locus_tag LOCUS_32900 10751 9831 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085800.1 protein_id gnl|my_center|LOCUS_32900 11534 10917 gene locus_tag LOCUS_32910 11534 10917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 11780 12310 gene locus_tag LOCUS_32920 11780 12310 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939756.1 protein_id gnl|my_center|LOCUS_32920 12310 13389 gene locus_tag LOCUS_32930 12310 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 13816 13421 gene locus_tag LOCUS_32940 13816 13421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 14861 13920 gene locus_tag LOCUS_32950 14861 13920 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524705.1 protein_id gnl|my_center|LOCUS_32950 15837 14866 gene locus_tag LOCUS_32960 15837 14866 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192001.1 protein_id gnl|my_center|LOCUS_32960 16907 16059 gene locus_tag LOCUS_32970 16907 16059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 17071 20034 gene locus_tag LOCUS_32980 17071 20034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 20111 20545 gene locus_tag LOCUS_32990 20111 20545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 21050 20673 gene locus_tag LOCUS_33000 21050 20673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 22261 21143 gene locus_tag LOCUS_33010 22261 21143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 22779 22372 gene locus_tag LOCUS_33020 22779 22372 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388365.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33020 >Feature sequence064 2311 1127 gene locus_tag LOCUS_33030 2311 1127 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187603.1 protein_id gnl|my_center|LOCUS_33030 2786 2397 gene locus_tag LOCUS_33040 2786 2397 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_33040 3470 2973 gene locus_tag LOCUS_33050 3470 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 4259 3480 gene locus_tag LOCUS_33060 gene hisF 4259 3480 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 protein_id gnl|my_center|LOCUS_33060 5119 4376 gene locus_tag LOCUS_33070 gene hisA 5119 4376 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_33070 5678 5109 gene locus_tag LOCUS_33080 5678 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 6352 5714 gene locus_tag LOCUS_33090 gene hisH 6352 5714 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391343.1 protein_id gnl|my_center|LOCUS_33090 6711 6349 gene locus_tag LOCUS_33100 6711 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 7375 6785 gene locus_tag LOCUS_33110 gene hisB 7375 6785 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_33110 7790 7413 gene locus_tag LOCUS_33120 7790 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 7902 8498 gene locus_tag LOCUS_33130 gene hslV 7902 8498 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531980.1 protein_id gnl|my_center|LOCUS_33130 8505 9824 gene locus_tag LOCUS_33140 gene hslU 8505 9824 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391347.1 protein_id gnl|my_center|LOCUS_33140 10393 9920 gene locus_tag LOCUS_33150 10393 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 11012 10575 gene locus_tag LOCUS_33160 11012 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 22149 11005 gene locus_tag LOCUS_33170 22149 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 22697 22621 gene locus_tag LOCUS_t00360 22697 22621 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence065 1306 107 gene locus_tag LOCUS_33180 1306 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 2520 1339 gene locus_tag LOCUS_33190 2520 1339 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_33190 2848 4005 gene locus_tag LOCUS_33200 2848 4005 CDS product FIST signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106998.1 protein_id gnl|my_center|LOCUS_33200 4002 5411 gene locus_tag LOCUS_33210 4002 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33210 5045 5136 gene locus_tag LOCUS_t00370 5045 5136 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6799 5546 gene locus_tag LOCUS_33220 6799 5546 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_33220 7501 6935 gene locus_tag LOCUS_33230 gene rplI 7501 6935 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532521.1 protein_id gnl|my_center|LOCUS_33230 7790 7515 gene locus_tag LOCUS_33240 gene rpsR 7790 7515 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 protein_id gnl|my_center|LOCUS_33240 8327 7797 gene locus_tag LOCUS_33250 gene rpsF 8327 7797 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388173.1 protein_id gnl|my_center|LOCUS_33250 8585 9541 gene locus_tag LOCUS_33260 gene fabD 8585 9541 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_33260 9555 10292 gene locus_tag LOCUS_33270 gene fabG 9555 10292 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_33270 10512 10751 gene locus_tag LOCUS_33280 10512 10751 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_33280 10792 12054 gene locus_tag LOCUS_33290 gene fabF 10792 12054 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086859.1 protein_id gnl|my_center|LOCUS_33290 12083 13069 gene locus_tag LOCUS_33300 12083 13069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 14059 13130 gene locus_tag LOCUS_33310 gene cysK 14059 13130 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921452.1 protein_id gnl|my_center|LOCUS_33310 14226 14678 gene locus_tag LOCUS_33320 14226 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 14878 16446 gene locus_tag LOCUS_33330 14878 16446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 16652 17653 gene locus_tag LOCUS_33340 16652 17653 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266412.1 protein_id gnl|my_center|LOCUS_33340 17664 18494 gene locus_tag LOCUS_33350 gene cysT 17664 18494 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975580.1 protein_id gnl|my_center|LOCUS_33350 18491 19324 gene locus_tag LOCUS_33360 gene cysW 18491 19324 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 protein_id gnl|my_center|LOCUS_33360 19321 20346 gene locus_tag LOCUS_33370 19321 20346 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084301.1 protein_id gnl|my_center|LOCUS_33370 20886 20596 gene locus_tag LOCUS_33380 20886 20596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 21135 21296 gene locus_tag LOCUS_33390 21135 21296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 21289 21747 gene locus_tag LOCUS_33400 21289 21747 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213269.1 protein_id gnl|my_center|LOCUS_33400 >Feature sequence066 788 1657 gene locus_tag LOCUS_33410 gene ppk2 788 1657 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705517.1 protein_id gnl|my_center|LOCUS_33410 2628 1693 gene locus_tag LOCUS_33420 2628 1693 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_33420 4467 2701 gene locus_tag LOCUS_33430 4467 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 5136 4498 gene locus_tag LOCUS_33440 5136 4498 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966025.1 protein_id gnl|my_center|LOCUS_33440 5948 5133 gene locus_tag LOCUS_33450 5948 5133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_33450 6673 5945 gene locus_tag LOCUS_33460 6673 5945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_33460 7948 6749 gene locus_tag LOCUS_33470 7948 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 9417 7945 gene locus_tag LOCUS_33480 9417 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 9509 10231 gene locus_tag LOCUS_33490 9509 10231 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390859.1 protein_id gnl|my_center|LOCUS_33490 10286 11785 gene locus_tag LOCUS_33500 gene rfaE1 10286 11785 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_33500 12736 11897 gene locus_tag LOCUS_33510 12736 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 12848 13759 gene locus_tag LOCUS_33520 12848 13759 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085702.1 protein_id gnl|my_center|LOCUS_33520 13773 13854 gene locus_tag LOCUS_t00380 13773 13854 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14964 15191 gene locus_tag LOCUS_33530 14964 15191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 15412 17247 gene locus_tag LOCUS_33540 15412 17247 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204925.1 protein_id gnl|my_center|LOCUS_33540 17244 17537 gene locus_tag LOCUS_33550 17244 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 17534 18907 gene locus_tag LOCUS_33560 17534 18907 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554539.1 protein_id gnl|my_center|LOCUS_33560 18904 22098 gene locus_tag LOCUS_33570 18904 22098 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554541.1 protein_id gnl|my_center|LOCUS_33570 >Feature sequence067 45 1049 gene locus_tag LOCUS_33580 45 1049 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010044806.1 protein_id gnl|my_center|LOCUS_33580 7626 1282 gene locus_tag LOCUS_33590 7626 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 7970 7626 gene locus_tag LOCUS_33600 7970 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 11578 8171 gene locus_tag LOCUS_33610 11578 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 14812 11603 gene locus_tag LOCUS_33620 14812 11603 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228378.1 protein_id gnl|my_center|LOCUS_33620 18332 14820 gene locus_tag LOCUS_33630 18332 14820 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968627.1 protein_id gnl|my_center|LOCUS_33630 18591 20084 gene locus_tag LOCUS_33640 18591 20084 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_33640 20210 20479 gene locus_tag LOCUS_33650 20210 20479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33650 20543 20773 gene locus_tag LOCUS_33660 20543 20773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 21020 21166 gene locus_tag LOCUS_33670 21020 21166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 21163 21531 gene locus_tag LOCUS_33680 21163 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 22097 21636 gene locus_tag LOCUS_33690 22097 21636 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence068 738 887 gene locus_tag LOCUS_33700 738 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 888 2216 gene locus_tag LOCUS_33710 gene ltrA 888 2216 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_33710 2437 3780 gene locus_tag LOCUS_33720 2437 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 4106 4999 gene locus_tag LOCUS_33730 4106 4999 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_33730 7555 5330 gene locus_tag LOCUS_33740 7555 5330 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083633.1 protein_id gnl|my_center|LOCUS_33740 9548 9363 gene locus_tag LOCUS_33750 9548 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 10119 10751 gene locus_tag LOCUS_33760 10119 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 10858 11295 gene locus_tag LOCUS_33770 10858 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 11690 11436 gene locus_tag LOCUS_33780 11690 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 12072 12686 gene locus_tag LOCUS_33790 12072 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 13309 12593 gene locus_tag LOCUS_33800 13309 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 14046 13726 gene locus_tag LOCUS_33810 14046 13726 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035952.1 protein_id gnl|my_center|LOCUS_33810 14546 14046 gene locus_tag LOCUS_33820 14546 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 14562 14774 gene locus_tag LOCUS_33830 14562 14774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 15230 14820 gene locus_tag LOCUS_33840 15230 14820 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984158.1 protein_id gnl|my_center|LOCUS_33840 15469 15230 gene locus_tag LOCUS_33850 15469 15230 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002631.1 protein_id gnl|my_center|LOCUS_33850 16003 17055 gene locus_tag LOCUS_33860 16003 17055 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_33860 17544 17179 gene locus_tag LOCUS_33870 17544 17179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 18729 17974 gene locus_tag LOCUS_33880 18729 17974 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088682.1 protein_id gnl|my_center|LOCUS_33880 18871 19023 gene locus_tag LOCUS_33890 18871 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 19503 19093 gene locus_tag LOCUS_33900 19503 19093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 19708 19466 gene locus_tag LOCUS_33910 19708 19466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 19905 20129 gene locus_tag LOCUS_33920 19905 20129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 >Feature sequence069 541 302 gene locus_tag LOCUS_33930 541 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 1351 605 gene locus_tag LOCUS_33940 1351 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 1755 2714 gene locus_tag LOCUS_33950 1755 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 4132 2870 gene locus_tag LOCUS_33960 gene murA 4132 2870 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390681.1 protein_id gnl|my_center|LOCUS_33960 4676 4152 gene locus_tag LOCUS_33970 gene dcd 4676 4152 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554836.1 protein_id gnl|my_center|LOCUS_33970 4795 6051 gene locus_tag LOCUS_33980 4795 6051 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104899.1 protein_id gnl|my_center|LOCUS_33980 6023 5937 gene locus_tag LOCUS_t00390 6023 5937 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7521 6190 gene locus_tag LOCUS_33990 gene purB 7521 6190 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532121.1 protein_id gnl|my_center|LOCUS_33990 7592 8209 gene locus_tag LOCUS_34000 7592 8209 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531644.1 protein_id gnl|my_center|LOCUS_34000 8312 9703 gene locus_tag LOCUS_34010 8312 9703 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190513.1 protein_id gnl|my_center|LOCUS_34010 9834 11834 gene locus_tag LOCUS_34020 9834 11834 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_34020 11885 12229 gene locus_tag LOCUS_34030 11885 12229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 12229 12636 gene locus_tag LOCUS_34040 12229 12636 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_34040 13187 12672 gene locus_tag LOCUS_34050 13187 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 14054 13191 gene locus_tag LOCUS_34060 14054 13191 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088022.1 protein_id gnl|my_center|LOCUS_34060 14186 14560 gene locus_tag LOCUS_34070 14186 14560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 15151 14699 gene locus_tag LOCUS_34080 15151 14699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 15480 15803 gene locus_tag LOCUS_34090 15480 15803 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461077.1 protein_id gnl|my_center|LOCUS_34090 17359 15872 gene locus_tag LOCUS_34100 gene rfaE1 17359 15872 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_34100 17828 18613 gene locus_tag LOCUS_34110 17828 18613 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388812.1 protein_id gnl|my_center|LOCUS_34110 18627 19613 gene locus_tag LOCUS_34120 18627 19613 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141070.1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence070 <1 1270 gene locus_tag LOCUS_34130 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391113.1:cobaltochelatase subunit CobN 1267 2046 gene locus_tag LOCUS_34140 gene cobM 1267 2046 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970288.1 protein_id gnl|my_center|LOCUS_34140 2043 2789 gene locus_tag LOCUS_34150 2043 2789 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390738.1 protein_id gnl|my_center|LOCUS_34150 6045 2926 gene locus_tag LOCUS_34160 6045 2926 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090065.1 protein_id gnl|my_center|LOCUS_34160 7239 6049 gene locus_tag LOCUS_34170 7239 6049 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090064.1 protein_id gnl|my_center|LOCUS_34170 7448 8359 gene locus_tag LOCUS_34180 7448 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 8944 10500 gene locus_tag LOCUS_34190 8944 10500 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071251.1 protein_id gnl|my_center|LOCUS_34190 10511 11683 gene locus_tag LOCUS_34200 10511 11683 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967657.1 protein_id gnl|my_center|LOCUS_34200 11694 14879 gene locus_tag LOCUS_34210 11694 14879 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089465.1 protein_id gnl|my_center|LOCUS_34210 15108 15611 gene locus_tag LOCUS_34220 15108 15611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34220 15569 17059 gene locus_tag LOCUS_34230 15569 17059 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087076.1 protein_id gnl|my_center|LOCUS_34230 18095 17094 gene locus_tag LOCUS_34240 18095 17094 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084169.1 protein_id gnl|my_center|LOCUS_34240 18177 18635 gene locus_tag LOCUS_34250 18177 18635 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387847.1 protein_id gnl|my_center|LOCUS_34250 19747 18644 gene locus_tag LOCUS_34260 19747 18644 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729107.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence071 490 1056 gene locus_tag LOCUS_34270 490 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 4203 1174 gene locus_tag LOCUS_34280 4203 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 5054 4404 gene locus_tag LOCUS_34290 5054 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 5433 5047 gene locus_tag LOCUS_34300 5433 5047 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_34300 6113 5430 gene locus_tag LOCUS_34310 6113 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 6630 6115 gene locus_tag LOCUS_34320 6630 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 7755 6679 gene locus_tag LOCUS_34330 gene fliM 7755 6679 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390467.1 protein_id gnl|my_center|LOCUS_34330 8261 7752 gene locus_tag LOCUS_34340 8261 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 8360 9265 gene locus_tag LOCUS_34350 gene flgF 8360 9265 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 protein_id gnl|my_center|LOCUS_34350 9286 10071 gene locus_tag LOCUS_34360 gene flgG 9286 10071 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390470.1 protein_id gnl|my_center|LOCUS_34360 10080 11048 gene locus_tag LOCUS_34370 gene flgA 10080 11048 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390471.1 protein_id gnl|my_center|LOCUS_34370 11060 11794 gene locus_tag LOCUS_34380 gene flgH 11060 11794 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088573.1 protein_id gnl|my_center|LOCUS_34380 13730 11892 gene locus_tag LOCUS_34390 13730 11892 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852913.1 protein_id gnl|my_center|LOCUS_34390 13811 14593 gene locus_tag LOCUS_34400 13811 14593 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_34400 15263 14658 gene locus_tag LOCUS_34410 15263 14658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 16253 15438 gene locus_tag LOCUS_34420 gene prmC 16253 15438 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_34420 17305 16250 gene locus_tag LOCUS_34430 gene prfA 17305 16250 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597801.1 protein_id gnl|my_center|LOCUS_34430 18537 17302 gene locus_tag LOCUS_34440 gene hisS 18537 17302 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388506.1 protein_id gnl|my_center|LOCUS_34440 19663 18539 gene locus_tag LOCUS_34450 gene ispG 19663 18539 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388505.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence072 311 592 gene locus_tag LOCUS_34460 311 592 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_34460 612 914 gene locus_tag LOCUS_34470 612 914 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_34470 1176 964 gene locus_tag LOCUS_34480 1176 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 1459 3354 gene locus_tag LOCUS_34490 1459 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 3941 3627 gene locus_tag LOCUS_34500 3941 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 4317 3946 gene locus_tag LOCUS_34510 4317 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 13852 4370 gene locus_tag LOCUS_34520 13852 4370 CDS product autotransporter-associated beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104543246.1 protein_id gnl|my_center|LOCUS_34520 13919 14131 gene locus_tag LOCUS_34530 13919 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 14880 15173 gene locus_tag LOCUS_34540 14880 15173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 15232 15621 gene locus_tag LOCUS_34550 15232 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 16109 15618 gene locus_tag LOCUS_34560 16109 15618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 16421 16224 gene locus_tag LOCUS_34570 16421 16224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 17864 16548 gene locus_tag LOCUS_34580 gene paaF 17864 16548 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329391.1 protein_id gnl|my_center|LOCUS_34580 >Feature sequence073 5216 192 gene locus_tag LOCUS_34590 5216 192 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390274.1 protein_id gnl|my_center|LOCUS_34590 8043 5515 gene locus_tag LOCUS_34600 8043 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 8407 8045 gene locus_tag LOCUS_34610 8407 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 11010 8419 gene locus_tag LOCUS_34620 11010 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 13434 11545 gene locus_tag LOCUS_34630 13434 11545 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083689.1 protein_id gnl|my_center|LOCUS_34630 14489 13434 gene locus_tag LOCUS_34640 14489 13434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34640 16888 14486 gene locus_tag LOCUS_34650 16888 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34650 >Feature sequence074 1136 756 gene locus_tag LOCUS_34660 1136 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 1743 1363 gene locus_tag LOCUS_34670 1743 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 2016 2633 gene locus_tag LOCUS_34680 2016 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 3287 2814 gene locus_tag LOCUS_34690 3287 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 3785 3453 gene locus_tag LOCUS_34700 3785 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 4033 4590 gene locus_tag LOCUS_34710 4033 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 5796 5224 gene locus_tag LOCUS_34720 5796 5224 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088057164.1 protein_id gnl|my_center|LOCUS_34720 7428 6175 gene locus_tag LOCUS_34730 7428 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 7680 7605 gene locus_tag LOCUS_t00400 7680 7605 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7940 8920 gene locus_tag LOCUS_34740 7940 8920 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088417.1 protein_id gnl|my_center|LOCUS_34740 8923 10200 gene locus_tag LOCUS_34750 gene livM 8923 10200 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088418.1 protein_id gnl|my_center|LOCUS_34750 10200 11051 gene locus_tag LOCUS_34760 10200 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 11048 11767 gene locus_tag LOCUS_34770 11048 11767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088420.1 protein_id gnl|my_center|LOCUS_34770 12781 11834 gene locus_tag LOCUS_34780 12781 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 14199 12868 gene locus_tag LOCUS_34790 14199 12868 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_34790 15512 14211 gene locus_tag LOCUS_34800 15512 14211 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_34800 16909 15509 gene locus_tag LOCUS_34810 gene thrC 16909 15509 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_34810 17914 17030 gene locus_tag LOCUS_34820 17914 17030 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967985.1 protein_id gnl|my_center|LOCUS_34820 >Feature sequence075 491 1909 gene locus_tag LOCUS_34830 491 1909 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085925.1 protein_id gnl|my_center|LOCUS_34830 1959 2549 gene locus_tag LOCUS_34840 1959 2549 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705445.1 protein_id gnl|my_center|LOCUS_34840 2677 2955 gene locus_tag LOCUS_34850 2677 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 2966 3559 gene locus_tag LOCUS_34860 2966 3559 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970806.1 protein_id gnl|my_center|LOCUS_34860 4911 3553 gene locus_tag LOCUS_34870 4911 3553 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339373.1 protein_id gnl|my_center|LOCUS_34870 5576 4908 gene locus_tag LOCUS_34880 5576 4908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339372.1 protein_id gnl|my_center|LOCUS_34880 5923 5576 gene locus_tag LOCUS_34890 5923 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 6085 6792 gene locus_tag LOCUS_34900 6085 6792 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388998.1 protein_id gnl|my_center|LOCUS_34900 6965 7366 gene locus_tag LOCUS_34910 6965 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 7527 8228 gene locus_tag LOCUS_34920 7527 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 10607 8331 gene locus_tag LOCUS_34930 10607 8331 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445450.1 protein_id gnl|my_center|LOCUS_34930 11143 10715 gene locus_tag LOCUS_34940 11143 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 11658 11155 gene locus_tag LOCUS_34950 11658 11155 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088836.1 protein_id gnl|my_center|LOCUS_34950 12092 11670 gene locus_tag LOCUS_34960 12092 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 12606 12094 gene locus_tag LOCUS_34970 12606 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34970 12769 12632 gene locus_tag LOCUS_34980 12769 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 13651 14493 gene locus_tag LOCUS_34990 13651 14493 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331465.1 protein_id gnl|my_center|LOCUS_34990 14493 15533 gene locus_tag LOCUS_35000 14493 15533 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_35000 15533 16774 gene locus_tag LOCUS_35010 gene arsJ 15533 16774 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255925.1 protein_id gnl|my_center|LOCUS_35010 16825 17238 gene locus_tag LOCUS_35020 16825 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 >Feature sequence076 294 731 gene locus_tag LOCUS_35030 294 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 656 1255 gene locus_tag LOCUS_35040 656 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35040 1275 2141 gene locus_tag LOCUS_35050 1275 2141 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_35050 2288 3265 gene locus_tag LOCUS_35060 2288 3265 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391782.1 protein_id gnl|my_center|LOCUS_35060 5264 3540 gene locus_tag LOCUS_35070 5264 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 7327 5264 gene locus_tag LOCUS_35080 7327 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 7718 7341 gene locus_tag LOCUS_35090 7718 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 8450 7734 gene locus_tag LOCUS_35100 8450 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 8850 8554 gene locus_tag LOCUS_35110 8850 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 10058 9435 gene locus_tag LOCUS_35120 10058 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 10512 10129 gene locus_tag LOCUS_35130 10512 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 10985 10509 gene locus_tag LOCUS_35140 10985 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 11481 10885 gene locus_tag LOCUS_35150 11481 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 11719 11471 gene locus_tag LOCUS_35160 11719 11471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 12459 11716 gene locus_tag LOCUS_35170 12459 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 14567 12528 gene locus_tag LOCUS_35180 14567 12528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 14908 14687 gene locus_tag LOCUS_35190 14908 14687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 15236 15556 gene locus_tag LOCUS_35200 15236 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 17065 15788 gene locus_tag LOCUS_35210 17065 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 >Feature sequence077 333 1496 gene locus_tag LOCUS_35220 333 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 3684 1636 gene locus_tag LOCUS_35230 gene brxL 3684 1636 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_35230 5988 3688 gene locus_tag LOCUS_35240 gene pglZ 5988 3688 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_35240 6075 6308 gene locus_tag LOCUS_35250 6075 6308 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140251.1 protein_id gnl|my_center|LOCUS_35250 6341 6775 gene locus_tag LOCUS_35260 6341 6775 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140252.1 protein_id gnl|my_center|LOCUS_35260 7083 6751 gene locus_tag LOCUS_35270 7083 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 7339 7070 gene locus_tag LOCUS_35280 7339 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 10736 7413 gene locus_tag LOCUS_35290 10736 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 11412 10855 gene locus_tag LOCUS_35300 11412 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390698.1 protein_id gnl|my_center|LOCUS_35300 11710 11402 gene locus_tag LOCUS_35310 11710 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 15312 11884 gene locus_tag LOCUS_35320 gene brxC 15312 11884 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_35320 15881 15348 gene locus_tag LOCUS_35330 15881 15348 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_35330 16716 15868 gene locus_tag LOCUS_35340 16716 15868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_35340 >Feature sequence078 723 589 gene locus_tag LOCUS_35350 723 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 2768 984 gene locus_tag LOCUS_35360 2768 984 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 protein_id gnl|my_center|LOCUS_35360 2933 3226 gene locus_tag LOCUS_35370 2933 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 3438 4484 gene locus_tag LOCUS_35380 3438 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 5237 4551 gene locus_tag LOCUS_35390 5237 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 5530 5246 gene locus_tag LOCUS_35400 5530 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 6771 5752 gene locus_tag LOCUS_35410 6771 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 7464 6787 gene locus_tag LOCUS_35420 gene parA 7464 6787 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_35420 7846 7553 gene locus_tag LOCUS_35430 7846 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 8184 7843 gene locus_tag LOCUS_35440 8184 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 8978 8181 gene locus_tag LOCUS_35450 8978 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 10653 9043 gene locus_tag LOCUS_35460 10653 9043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119278.1 protein_id gnl|my_center|LOCUS_35460 11815 10643 gene locus_tag LOCUS_35470 11815 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 12252 12725 gene locus_tag LOCUS_35480 12252 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 12772 13452 gene locus_tag LOCUS_35490 12772 13452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 14318 13677 gene locus_tag LOCUS_35500 14318 13677 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722215.1 protein_id gnl|my_center|LOCUS_35500 16154 14391 gene locus_tag LOCUS_35510 16154 14391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390692.1 protein_id gnl|my_center|LOCUS_35510 >Feature sequence079 2202 178 gene locus_tag LOCUS_35520 2202 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 6274 2276 gene locus_tag LOCUS_35530 6274 2276 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 protein_id gnl|my_center|LOCUS_35530 8166 6274 gene locus_tag LOCUS_35540 8166 6274 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530880.1 protein_id gnl|my_center|LOCUS_35540 8305 9276 gene locus_tag LOCUS_35550 8305 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 9369 10751 gene locus_tag LOCUS_35560 gene miaB 9369 10751 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391517.1 protein_id gnl|my_center|LOCUS_35560 10748 11800 gene locus_tag LOCUS_35570 10748 11800 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527906.1 protein_id gnl|my_center|LOCUS_35570 11804 12262 gene locus_tag LOCUS_35580 gene ybeY 11804 12262 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974257.1 protein_id gnl|my_center|LOCUS_35580 12259 13146 gene locus_tag LOCUS_35590 12259 13146 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_35590 13225 13347 gene locus_tag LOCUS_35600 13225 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 13492 13977 gene locus_tag LOCUS_35610 13492 13977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 15463 14225 gene locus_tag LOCUS_35620 15463 14225 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_35620 15651 15989 gene locus_tag LOCUS_35630 15651 15989 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388313.1 protein_id gnl|my_center|LOCUS_35630 >Feature sequence080 2037 1069 gene locus_tag LOCUS_35640 2037 1069 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039189.1 protein_id gnl|my_center|LOCUS_35640 2257 2883 gene locus_tag LOCUS_35650 gene azoR2 2257 2883 CDS product FMN-dependent NADH-azoreductase AzoR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113473.1 protein_id gnl|my_center|LOCUS_35650 2965 3675 gene locus_tag LOCUS_35660 2965 3675 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086661.1 protein_id gnl|my_center|LOCUS_35660 3771 4748 gene locus_tag LOCUS_35670 3771 4748 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_35670 5181 5768 gene locus_tag LOCUS_35680 5181 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 6121 7521 gene locus_tag LOCUS_35690 6121 7521 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_35690 7580 8029 gene locus_tag LOCUS_35700 7580 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 8809 8321 gene locus_tag LOCUS_35710 8809 8321 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_35710 9632 9177 gene locus_tag LOCUS_35720 9632 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 10074 10391 gene locus_tag LOCUS_35730 10074 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 11094 10459 gene locus_tag LOCUS_35740 11094 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 11271 12188 gene locus_tag LOCUS_35750 11271 12188 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_35750 13295 12285 gene locus_tag LOCUS_35760 13295 12285 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227004.1 protein_id gnl|my_center|LOCUS_35760 13560 13348 gene locus_tag LOCUS_35770 13560 13348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 13499 14389 gene locus_tag LOCUS_35780 13499 14389 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_35780 14686 14417 gene locus_tag LOCUS_35790 14686 14417 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015647.1 protein_id gnl|my_center|LOCUS_35790 14934 14602 gene locus_tag LOCUS_35800 14934 14602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 16119 14998 gene locus_tag LOCUS_35810 16119 14998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 >Feature sequence081 1947 775 gene locus_tag LOCUS_35820 1947 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 2408 1944 gene locus_tag LOCUS_35830 2408 1944 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731060.1 protein_id gnl|my_center|LOCUS_35830 4739 2412 gene locus_tag LOCUS_35840 4739 2412 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_35840 7033 4736 gene locus_tag LOCUS_35850 7033 4736 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_35850 7523 8566 gene locus_tag LOCUS_35860 7523 8566 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529026.1 protein_id gnl|my_center|LOCUS_35860 8602 9531 gene locus_tag LOCUS_35870 8602 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 9741 11171 gene locus_tag LOCUS_35880 9741 11171 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530546.1 protein_id gnl|my_center|LOCUS_35880 12113 11316 gene locus_tag LOCUS_35890 12113 11316 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190826.1 protein_id gnl|my_center|LOCUS_35890 12677 12255 gene locus_tag LOCUS_35900 12677 12255 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390519.1 protein_id gnl|my_center|LOCUS_35900 12857 12705 gene locus_tag LOCUS_35910 12857 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 12924 13088 gene locus_tag LOCUS_35920 12924 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 13122 14174 gene locus_tag LOCUS_35930 gene ruvB 13122 14174 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388844.1 protein_id gnl|my_center|LOCUS_35930 14171 14611 gene locus_tag LOCUS_35940 gene ybgC 14171 14611 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_35940 14690 15406 gene locus_tag LOCUS_35950 14690 15406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 15410 15952 gene locus_tag LOCUS_35960 gene tolR 15410 15952 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 protein_id gnl|my_center|LOCUS_35960 >Feature sequence082 1156 848 gene locus_tag LOCUS_35970 1156 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 1797 1153 gene locus_tag LOCUS_35980 gene parA 1797 1153 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_35980 2279 1905 gene locus_tag LOCUS_35990 2279 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 2316 2486 gene locus_tag LOCUS_36000 2316 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 2935 2471 gene locus_tag LOCUS_36010 2935 2471 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633552.1 protein_id gnl|my_center|LOCUS_36010 3299 4264 gene locus_tag LOCUS_36020 3299 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 4270 4623 gene locus_tag LOCUS_36030 4270 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 5301 4822 gene locus_tag LOCUS_36040 5301 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 6112 5402 gene locus_tag LOCUS_36050 6112 5402 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_36050 6253 7149 gene locus_tag LOCUS_36060 6253 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 10076 7176 gene locus_tag LOCUS_36070 10076 7176 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 protein_id gnl|my_center|LOCUS_36070 10811 10095 gene locus_tag LOCUS_36080 10811 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 13826 10815 gene locus_tag LOCUS_36090 gene traA 13826 10815 CDS product Ti-type conjugative transfer relaxase TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106726897.1 protein_id gnl|my_center|LOCUS_36090 14006 14335 gene locus_tag LOCUS_36100 14006 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 14669 14478 gene locus_tag LOCUS_36110 14669 14478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 14751 15218 gene locus_tag LOCUS_36120 14751 15218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 15675 15373 gene locus_tag LOCUS_36130 15675 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 >Feature sequence083 927 151 gene locus_tag LOCUS_36140 927 151 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 protein_id gnl|my_center|LOCUS_36140 960 2603 gene locus_tag LOCUS_36150 960 2603 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064231.1 protein_id gnl|my_center|LOCUS_36150 2600 3364 gene locus_tag LOCUS_36160 2600 3364 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099097343.1 protein_id gnl|my_center|LOCUS_36160 3420 3674 gene locus_tag LOCUS_36170 gene grxC 3420 3674 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315748.1 protein_id gnl|my_center|LOCUS_36170 3760 4266 gene locus_tag LOCUS_36180 3760 4266 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 protein_id gnl|my_center|LOCUS_36180 5317 4268 gene locus_tag LOCUS_36190 5317 4268 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084020.1 protein_id gnl|my_center|LOCUS_36190 6154 5432 gene locus_tag LOCUS_36200 6154 5432 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_36200 6260 7495 gene locus_tag LOCUS_36210 6260 7495 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388501.1 protein_id gnl|my_center|LOCUS_36210 7488 8555 gene locus_tag LOCUS_36220 7488 8555 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_36220 8569 10815 gene locus_tag LOCUS_36230 gene ptsP 8569 10815 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388503.1 protein_id gnl|my_center|LOCUS_36230 11191 12222 gene locus_tag LOCUS_36240 11191 12222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 13008 12289 gene locus_tag LOCUS_36250 13008 12289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 14182 13154 gene locus_tag LOCUS_36260 gene moaA 14182 13154 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086533.1 protein_id gnl|my_center|LOCUS_36260 14518 15300 gene locus_tag LOCUS_36270 14518 15300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 >Feature sequence084 230 439 gene locus_tag LOCUS_36280 230 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 443 871 gene locus_tag LOCUS_36290 gene hicB 443 871 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_36290 1993 1049 gene locus_tag LOCUS_36300 1993 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 2532 2011 gene locus_tag LOCUS_36310 2532 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 2446 2757 gene locus_tag LOCUS_36320 2446 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 2918 3160 gene locus_tag LOCUS_36330 2918 3160 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_36330 3160 3561 gene locus_tag LOCUS_36340 3160 3561 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_36340 3678 3890 gene locus_tag LOCUS_36350 3678 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 4258 3935 gene locus_tag LOCUS_36360 4258 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 4718 4368 gene locus_tag LOCUS_36370 4718 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 6796 4715 gene locus_tag LOCUS_36380 6796 4715 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 protein_id gnl|my_center|LOCUS_36380 7197 6796 gene locus_tag LOCUS_36390 7197 6796 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969926.1 protein_id gnl|my_center|LOCUS_36390 7454 7194 gene locus_tag LOCUS_36400 7454 7194 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_36400 10437 7483 gene locus_tag LOCUS_36410 10437 7483 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387994.1 protein_id gnl|my_center|LOCUS_36410 13477 10451 gene locus_tag LOCUS_36420 13477 10451 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387995.1 protein_id gnl|my_center|LOCUS_36420 14028 13600 gene locus_tag LOCUS_36430 14028 13600 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_36430 14273 14025 gene locus_tag LOCUS_36440 14273 14025 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141676.1 protein_id gnl|my_center|LOCUS_36440 14623 14763 gene locus_tag LOCUS_36450 14623 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 14760 15128 gene locus_tag LOCUS_36460 14760 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 15694 15233 gene locus_tag LOCUS_36470 15694 15233 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_36470 >Feature sequence085 469 308 gene locus_tag LOCUS_36480 469 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 1601 1212 gene locus_tag LOCUS_36490 1601 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 3149 2130 gene locus_tag LOCUS_36500 3149 2130 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243759.1 protein_id gnl|my_center|LOCUS_36500 3400 4128 gene locus_tag LOCUS_36510 gene tauC 3400 4128 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704532.1 protein_id gnl|my_center|LOCUS_36510 4116 4910 gene locus_tag LOCUS_36520 gene tauC 4116 4910 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114575.1 protein_id gnl|my_center|LOCUS_36520 4907 5701 gene locus_tag LOCUS_36530 4907 5701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031738.1 protein_id gnl|my_center|LOCUS_36530 5756 6787 gene locus_tag LOCUS_36540 5756 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 6837 8150 gene locus_tag LOCUS_36550 gene hisD 6837 8150 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012931617.1 protein_id gnl|my_center|LOCUS_36550 8161 8922 gene locus_tag LOCUS_36560 8161 8922 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973552.1 protein_id gnl|my_center|LOCUS_36560 8919 9899 gene locus_tag LOCUS_36570 8919 9899 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075125.1 protein_id gnl|my_center|LOCUS_36570 9896 10918 gene locus_tag LOCUS_36580 9896 10918 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229212.1 protein_id gnl|my_center|LOCUS_36580 10908 11705 gene locus_tag LOCUS_36590 10908 11705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191944.1 protein_id gnl|my_center|LOCUS_36590 11705 12445 gene locus_tag LOCUS_36600 11705 12445 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723682.1 protein_id gnl|my_center|LOCUS_36600 12442 12759 gene locus_tag LOCUS_36610 12442 12759 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723680.1 protein_id gnl|my_center|LOCUS_36610 12759 13025 gene locus_tag LOCUS_36620 12759 13025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 13019 14752 gene locus_tag LOCUS_36630 13019 14752 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339081.1 protein_id gnl|my_center|LOCUS_36630 >Feature sequence086 278 997 gene locus_tag LOCUS_36640 278 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 2535 1474 gene locus_tag LOCUS_36650 gene rlmN 2535 1474 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_36650 2455 2676 gene locus_tag LOCUS_36660 2455 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 3173 2640 gene locus_tag LOCUS_36670 3173 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 3801 3220 gene locus_tag LOCUS_36680 3801 3220 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_36680 3800 5068 gene locus_tag LOCUS_36690 3800 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 5065 5589 gene locus_tag LOCUS_36700 5065 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 6110 5586 gene locus_tag LOCUS_36710 6110 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 6021 7361 gene locus_tag LOCUS_36720 gene aroA 6021 7361 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339439.1 protein_id gnl|my_center|LOCUS_36720 7358 7978 gene locus_tag LOCUS_36730 7358 7978 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339438.1 protein_id gnl|my_center|LOCUS_36730 9356 8175 gene locus_tag LOCUS_36740 9356 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 11709 9367 gene locus_tag LOCUS_36750 11709 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 11934 12542 gene locus_tag LOCUS_36760 11934 12542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 12797 13735 gene locus_tag LOCUS_36770 12797 13735 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922721.1 protein_id gnl|my_center|LOCUS_36770 >Feature sequence087 978 223 gene locus_tag LOCUS_36780 978 223 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083922.1 protein_id gnl|my_center|LOCUS_36780 1808 1023 gene locus_tag LOCUS_36790 1808 1023 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440322.1 protein_id gnl|my_center|LOCUS_36790 2782 1805 gene locus_tag LOCUS_36800 2782 1805 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440034.1 protein_id gnl|my_center|LOCUS_36800 4892 2805 gene locus_tag LOCUS_36810 gene flhA 4892 2805 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 protein_id gnl|my_center|LOCUS_36810 6269 4899 gene locus_tag LOCUS_36820 6269 4899 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388298.1 protein_id gnl|my_center|LOCUS_36820 6609 6283 gene locus_tag LOCUS_36830 gene fliN 6609 6283 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388300.1 protein_id gnl|my_center|LOCUS_36830 7405 6626 gene locus_tag LOCUS_36840 7405 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 8423 7407 gene locus_tag LOCUS_36850 gene fliG 8423 7407 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388302.1 protein_id gnl|my_center|LOCUS_36850 10045 8423 gene locus_tag LOCUS_36860 gene fliF 10045 8423 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388303.1 protein_id gnl|my_center|LOCUS_36860 10472 11203 gene locus_tag LOCUS_36870 10472 11203 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 protein_id gnl|my_center|LOCUS_36870 11317 12546 gene locus_tag LOCUS_36880 11317 12546 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085640.1 protein_id gnl|my_center|LOCUS_36880 12737 14044 gene locus_tag LOCUS_36890 gene fahA 12737 14044 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100400.1 protein_id gnl|my_center|LOCUS_36890 >Feature sequence088 1022 177 gene locus_tag LOCUS_36900 1022 177 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_36900 1295 1095 gene locus_tag LOCUS_36910 1295 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 1494 1925 gene locus_tag LOCUS_36920 1494 1925 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_36920 2540 2091 gene locus_tag LOCUS_36930 2540 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 3481 2540 gene locus_tag LOCUS_36940 3481 2540 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090475.1 protein_id gnl|my_center|LOCUS_36940 3855 4013 gene locus_tag LOCUS_36950 3855 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 4059 4682 gene locus_tag LOCUS_36960 4059 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 4745 5434 gene locus_tag LOCUS_36970 4745 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36970 5485 5919 gene locus_tag LOCUS_36980 5485 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 5993 6502 gene locus_tag LOCUS_36990 5993 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 6946 6749 gene locus_tag LOCUS_37000 6946 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37000 7452 7219 gene locus_tag LOCUS_37010 7452 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 8362 7529 gene locus_tag LOCUS_37020 8362 7529 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038652.1 protein_id gnl|my_center|LOCUS_37020 8991 8362 gene locus_tag LOCUS_37030 gene mobA 8991 8362 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970348.1 protein_id gnl|my_center|LOCUS_37030 9104 10114 gene locus_tag LOCUS_37040 9104 10114 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087282.1 protein_id gnl|my_center|LOCUS_37040 10114 11985 gene locus_tag LOCUS_37050 10114 11985 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087283.1 protein_id gnl|my_center|LOCUS_37050 12248 12964 gene locus_tag LOCUS_37060 12248 12964 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_37060 13087 13992 gene locus_tag LOCUS_37070 13087 13992 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724106.1 protein_id gnl|my_center|LOCUS_37070 >Feature sequence089 337 1380 gene locus_tag LOCUS_37080 337 1380 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_37080 1505 2371 gene locus_tag LOCUS_37090 gene mreC 1505 2371 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_37090 2371 2919 gene locus_tag LOCUS_37100 2371 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 2916 4817 gene locus_tag LOCUS_37110 gene mrdA 2916 4817 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_37110 4814 5965 gene locus_tag LOCUS_37120 gene rodA 4814 5965 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391426.1 protein_id gnl|my_center|LOCUS_37120 7519 6659 gene locus_tag LOCUS_37130 7519 6659 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267863.1 protein_id gnl|my_center|LOCUS_37130 7739 7921 gene locus_tag LOCUS_37140 7739 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 8504 9697 gene locus_tag LOCUS_37150 8504 9697 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089195.1 protein_id gnl|my_center|LOCUS_37150 9711 10718 gene locus_tag LOCUS_37160 9711 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 10712 11503 gene locus_tag LOCUS_37170 10712 11503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089193.1 protein_id gnl|my_center|LOCUS_37170 11514 12113 gene locus_tag LOCUS_37180 11514 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 12324 12046 gene locus_tag LOCUS_37190 12324 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37190 13052 12321 gene locus_tag LOCUS_37200 13052 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37200 <14130 13072 gene locus_tag LOCUS_37210 <14130 13072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814041.1:UxaA family hydrolase >Feature sequence090 <1 1856 gene locus_tag LOCUS_37220 <1 1856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106726897.1:Ti-type conjugative transfer relaxase TraA 1969 2238 gene locus_tag LOCUS_37230 1969 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 2235 2609 gene locus_tag LOCUS_37240 2235 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 3004 2819 gene locus_tag LOCUS_37250 3004 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 4869 3037 gene locus_tag LOCUS_37260 4869 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 5916 4876 gene locus_tag LOCUS_37270 gene virB11 5916 4876 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970871.1 protein_id gnl|my_center|LOCUS_37270 7024 5906 gene locus_tag LOCUS_37280 gene virB10 7024 5906 CDS product type IV secretion system protein VirB10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891494.1 protein_id gnl|my_center|LOCUS_37280 7914 7021 gene locus_tag LOCUS_37290 gene virB9 7914 7021 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970873.1 protein_id gnl|my_center|LOCUS_37290 8603 7911 gene locus_tag LOCUS_37300 8603 7911 CDS product type IV secretion system protein VirB8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533337.1 protein_id gnl|my_center|LOCUS_37300 8761 8600 gene locus_tag LOCUS_37310 8761 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 9731 8814 gene locus_tag LOCUS_37320 9731 8814 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974917.1 protein_id gnl|my_center|LOCUS_37320 10115 9735 gene locus_tag LOCUS_37330 10115 9735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 10810 10112 gene locus_tag LOCUS_37340 10810 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 13203 10831 gene locus_tag LOCUS_37350 gene virB4 13203 10831 CDS product type IV secretion/conjugal transfer ATPase VirB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974916.1 protein_id gnl|my_center|LOCUS_37350 13472 13203 gene locus_tag LOCUS_37360 13472 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 >Feature sequence091 865 305 gene locus_tag LOCUS_37370 865 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 2986 1031 gene locus_tag LOCUS_37380 2986 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 4905 3085 gene locus_tag LOCUS_37390 gene dnaG 4905 3085 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390633.1 protein_id gnl|my_center|LOCUS_37390 5380 4925 gene locus_tag LOCUS_37400 5380 4925 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_37400 5507 6889 gene locus_tag LOCUS_37410 gene carA 5507 6889 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_37410 6945 7205 gene locus_tag LOCUS_37420 6945 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 7219 10461 gene locus_tag LOCUS_37430 gene carB 7219 10461 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390636.1 protein_id gnl|my_center|LOCUS_37430 10627 11100 gene locus_tag LOCUS_37440 gene greA 10627 11100 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_37440 11139 12335 gene locus_tag LOCUS_37450 11139 12335 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_37450 12442 13281 gene locus_tag LOCUS_37460 12442 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 >Feature sequence092 303 473 gene locus_tag LOCUS_37470 303 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 606 2642 gene locus_tag LOCUS_37480 gene tkt 606 2642 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388353.1 protein_id gnl|my_center|LOCUS_37480 2672 3685 gene locus_tag LOCUS_37490 gene gap 2672 3685 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387975.1 protein_id gnl|my_center|LOCUS_37490 3699 4889 gene locus_tag LOCUS_37500 3699 4889 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393616.1 protein_id gnl|my_center|LOCUS_37500 4935 5165 gene locus_tag LOCUS_37510 4935 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 5304 5870 gene locus_tag LOCUS_37520 5304 5870 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_37520 5867 6256 gene locus_tag LOCUS_37530 5867 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 6388 6975 gene locus_tag LOCUS_37540 6388 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 7554 6991 gene locus_tag LOCUS_37550 7554 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 8421 7687 gene locus_tag LOCUS_37560 8421 7687 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958530.1 protein_id gnl|my_center|LOCUS_37560 8845 8513 gene locus_tag LOCUS_37570 8845 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 8748 10349 gene locus_tag LOCUS_37580 8748 10349 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390177.1 protein_id gnl|my_center|LOCUS_37580 10442 11602 gene locus_tag LOCUS_37590 10442 11602 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626375.1 protein_id gnl|my_center|LOCUS_37590 11763 12032 gene locus_tag LOCUS_37600 11763 12032 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932148.1 protein_id gnl|my_center|LOCUS_37600 11995 12327 gene locus_tag LOCUS_37610 11995 12327 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932149.1 protein_id gnl|my_center|LOCUS_37610 >Feature sequence093 315 109 gene locus_tag LOCUS_37620 315 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 811 503 gene locus_tag LOCUS_37630 811 503 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 protein_id gnl|my_center|LOCUS_37630 1035 811 gene locus_tag LOCUS_37640 1035 811 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626617.1 protein_id gnl|my_center|LOCUS_37640 1208 1594 gene locus_tag LOCUS_37650 1208 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 1814 2056 gene locus_tag LOCUS_37660 1814 2056 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_37660 2060 2449 gene locus_tag LOCUS_37670 2060 2449 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_37670 3359 4285 gene locus_tag LOCUS_37680 3359 4285 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_37680 5040 4327 gene locus_tag LOCUS_37690 5040 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 5504 5037 gene locus_tag LOCUS_37700 5504 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 6316 6098 gene locus_tag LOCUS_37710 6316 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 6484 6954 gene locus_tag LOCUS_37720 6484 6954 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 protein_id gnl|my_center|LOCUS_37720 6951 7391 gene locus_tag LOCUS_37730 6951 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128261979.1 protein_id gnl|my_center|LOCUS_37730 7600 8199 gene locus_tag LOCUS_37740 7600 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 8742 8314 gene locus_tag LOCUS_37750 8742 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 8778 8927 gene locus_tag LOCUS_37760 8778 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 9142 9525 gene locus_tag LOCUS_37770 9142 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 10199 9576 gene locus_tag LOCUS_37780 10199 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 10825 10196 gene locus_tag LOCUS_37790 10825 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 11463 11873 gene locus_tag LOCUS_37800 11463 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 11917 12648 gene locus_tag LOCUS_37810 11917 12648 CDS product type IV secretion system lytic transglycosylase VirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970881.1 protein_id gnl|my_center|LOCUS_37810 12652 13032 gene locus_tag LOCUS_37820 12652 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 >Feature sequence094 <1 2331 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcgcctgcggggaacac 2747 2403 gene locus_tag LOCUS_37830 gene cas2e 2747 2403 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 protein_id gnl|my_center|LOCUS_37830 3693 2728 gene locus_tag LOCUS_37840 gene cas1e 3693 2728 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942041.1 protein_id gnl|my_center|LOCUS_37840 4379 3687 gene locus_tag LOCUS_37850 gene cas6e 4379 3687 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387929.1 protein_id gnl|my_center|LOCUS_37850 5110 4376 gene locus_tag LOCUS_37860 gene cas5e 5110 4376 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387930.1 protein_id gnl|my_center|LOCUS_37860 6157 5117 gene locus_tag LOCUS_37870 gene cas7e 6157 5117 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 protein_id gnl|my_center|LOCUS_37870 6696 6154 gene locus_tag LOCUS_37880 6696 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 8306 6693 gene locus_tag LOCUS_37890 gene casA 8306 6693 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387933.1 protein_id gnl|my_center|LOCUS_37890 11015 8373 gene locus_tag LOCUS_37900 11015 8373 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387934.1 protein_id gnl|my_center|LOCUS_37900 11776 11312 gene locus_tag LOCUS_37910 11776 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 >Feature sequence095 407 66 gene locus_tag LOCUS_37920 407 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 1005 544 gene locus_tag LOCUS_37930 1005 544 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_37930 1970 1008 gene locus_tag LOCUS_37940 gene lipA 1970 1008 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919603.1 protein_id gnl|my_center|LOCUS_37940 3394 1997 gene locus_tag LOCUS_37950 gene lpdA 3394 1997 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389631.1 protein_id gnl|my_center|LOCUS_37950 3837 3406 gene locus_tag LOCUS_37960 3837 3406 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918290.1 protein_id gnl|my_center|LOCUS_37960 5159 3885 gene locus_tag LOCUS_37970 5159 3885 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_37970 6502 5180 gene locus_tag LOCUS_37980 6502 5180 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389633.1 protein_id gnl|my_center|LOCUS_37980 7532 6507 gene locus_tag LOCUS_37990 gene pdhA 7532 6507 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535472.1 protein_id gnl|my_center|LOCUS_37990 8017 7688 gene locus_tag LOCUS_38000 8017 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 8153 8380 gene locus_tag LOCUS_38010 8153 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 10063 8483 gene locus_tag LOCUS_38020 10063 8483 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112648.1 protein_id gnl|my_center|LOCUS_38020 11565 10075 gene locus_tag LOCUS_38030 11565 10075 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112648.1 protein_id gnl|my_center|LOCUS_38030 >Feature sequence096 <1 688 gene locus_tag LOCUS_38040 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974797.1:ParB N-terminal domain-containing protein 758 1135 gene locus_tag LOCUS_38050 758 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 1248 1664 gene locus_tag LOCUS_38060 1248 1664 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391482.1 protein_id gnl|my_center|LOCUS_38060 1661 2098 gene locus_tag LOCUS_38070 1661 2098 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770938.1 protein_id gnl|my_center|LOCUS_38070 2727 3527 gene locus_tag LOCUS_38080 2727 3527 CDS product ImuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972865.1 protein_id gnl|my_center|LOCUS_38080 3565 4965 gene locus_tag LOCUS_38090 3565 4965 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257431.1 protein_id gnl|my_center|LOCUS_38090 4981 5232 gene locus_tag LOCUS_38100 4981 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 5229 8489 gene locus_tag LOCUS_38110 5229 8489 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972863.1 protein_id gnl|my_center|LOCUS_38110 8762 9031 gene locus_tag LOCUS_38120 8762 9031 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_38120 9173 9667 gene locus_tag LOCUS_38130 9173 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 9755 10150 gene locus_tag LOCUS_38140 9755 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 10186 10413 gene locus_tag LOCUS_38150 10186 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 11161 10541 gene locus_tag LOCUS_38160 11161 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 11484 11206 gene locus_tag LOCUS_38170 11484 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 11880 11599 gene locus_tag LOCUS_38180 11880 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 >Feature sequence097 2363 1095 gene locus_tag LOCUS_38190 2363 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 3223 2360 gene locus_tag LOCUS_38200 3223 2360 CDS product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966857.1 protein_id gnl|my_center|LOCUS_38200 3393 3770 gene locus_tag LOCUS_38210 3393 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 3767 4480 gene locus_tag LOCUS_38220 3767 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 4484 4864 gene locus_tag LOCUS_38230 4484 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 4864 5190 gene locus_tag LOCUS_38240 4864 5190 CDS product type IV secretion system protein VirB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891501.1 protein_id gnl|my_center|LOCUS_38240 5190 7538 gene locus_tag LOCUS_38250 gene virB4 5190 7538 CDS product type IV secretion/conjugal transfer ATPase VirB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974916.1 protein_id gnl|my_center|LOCUS_38250 7557 8255 gene locus_tag LOCUS_38260 7557 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 8252 8629 gene locus_tag LOCUS_38270 8252 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 8633 9550 gene locus_tag LOCUS_38280 8633 9550 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974917.1 protein_id gnl|my_center|LOCUS_38280 9604 9765 gene locus_tag LOCUS_38290 9604 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 9762 10454 gene locus_tag LOCUS_38300 9762 10454 CDS product type IV secretion system protein VirB8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533337.1 protein_id gnl|my_center|LOCUS_38300 10451 11344 gene locus_tag LOCUS_38310 gene virB9 10451 11344 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891495.1 protein_id gnl|my_center|LOCUS_38310 >Feature sequence098 141 584 gene locus_tag LOCUS_38320 141 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 591 1433 gene locus_tag LOCUS_38330 591 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 1461 1715 gene locus_tag LOCUS_38340 1461 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 1768 2016 gene locus_tag LOCUS_38350 1768 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 2767 2180 gene locus_tag LOCUS_38360 2767 2180 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_38360 3801 2836 gene locus_tag LOCUS_38370 3801 2836 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_38370 3921 4907 gene locus_tag LOCUS_38380 3921 4907 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_38380 4987 5742 gene locus_tag LOCUS_38390 4987 5742 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020462.1 protein_id gnl|my_center|LOCUS_38390 5815 6555 gene locus_tag LOCUS_38400 5815 6555 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_38400 7171 6992 gene locus_tag LOCUS_38410 7171 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 8424 7690 gene locus_tag LOCUS_38420 8424 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974887.1 protein_id gnl|my_center|LOCUS_38420 8402 8764 gene locus_tag LOCUS_38430 8402 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 9204 10157 gene locus_tag LOCUS_38440 9204 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 10485 10186 gene locus_tag LOCUS_38450 10485 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 11005 10544 gene locus_tag LOCUS_38460 11005 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 >Feature sequence099 1541 708 gene locus_tag LOCUS_38470 1541 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 2708 1554 gene locus_tag LOCUS_38480 2708 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 3297 2827 gene locus_tag LOCUS_38490 3297 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 5779 3317 gene locus_tag LOCUS_38500 5779 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 9135 5794 gene locus_tag LOCUS_38510 9135 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 10799 9204 gene locus_tag LOCUS_38520 10799 9204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 >Feature sequence100 660 1871 gene locus_tag LOCUS_38530 660 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 2375 3451 gene locus_tag LOCUS_38540 2375 3451 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_38540 3438 4460 gene locus_tag LOCUS_38550 3438 4460 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966893.1 protein_id gnl|my_center|LOCUS_38550 4457 4999 gene locus_tag LOCUS_38560 4457 4999 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_38560 6571 5042 gene locus_tag LOCUS_38570 gene otsA 6571 5042 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338617.1 protein_id gnl|my_center|LOCUS_38570 6846 6568 gene locus_tag LOCUS_38580 6846 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 6978 8114 gene locus_tag LOCUS_38590 6978 8114 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965860.1 protein_id gnl|my_center|LOCUS_38590 8319 9140 gene locus_tag LOCUS_38600 8319 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 9140 9760 gene locus_tag LOCUS_38610 9140 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 >Feature sequence101 997 305 gene locus_tag LOCUS_38620 gene tmk 997 305 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720716.1 protein_id gnl|my_center|LOCUS_38620 2245 1001 gene locus_tag LOCUS_38630 2245 1001 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_38630 3406 2474 gene locus_tag LOCUS_38640 3406 2474 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 protein_id gnl|my_center|LOCUS_38640 4440 3403 gene locus_tag LOCUS_38650 4440 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 4723 6111 gene locus_tag LOCUS_38660 4723 6111 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_38660 7188 6154 gene locus_tag LOCUS_38670 7188 6154 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_38670 7715 9154 gene locus_tag LOCUS_38680 7715 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 9470 9643 gene locus_tag LOCUS_38690 9470 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 9975 10067 gene locus_tag LOCUS_t00410 9975 10067 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10455 10186 gene locus_tag LOCUS_38700 10455 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 10816 10409 gene locus_tag LOCUS_38710 10816 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 >Feature sequence102 2220 754 gene locus_tag LOCUS_38720 2220 754 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731434.1 protein_id gnl|my_center|LOCUS_38720 3147 2404 gene locus_tag LOCUS_38730 3147 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 3217 3777 gene locus_tag LOCUS_38740 3217 3777 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082866.1 protein_id gnl|my_center|LOCUS_38740 3774 3935 gene locus_tag LOCUS_38750 3774 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 4611 3946 gene locus_tag LOCUS_38760 4611 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 4998 5489 gene locus_tag LOCUS_38770 4998 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38770 5889 7142 gene locus_tag LOCUS_38780 5889 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 7139 8077 gene locus_tag LOCUS_38790 7139 8077 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_38790 8070 9065 gene locus_tag LOCUS_38800 8070 9065 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108412.1 protein_id gnl|my_center|LOCUS_38800 10508 9180 gene locus_tag LOCUS_38810 gene ltrA 10508 9180 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090914.1 protein_id gnl|my_center|LOCUS_38810 >Feature sequence103 3 524 gene locus_tag LOCUS_38820 3 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 1220 507 gene locus_tag LOCUS_38830 1220 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 1909 1217 gene locus_tag LOCUS_38840 1909 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 2160 1924 gene locus_tag LOCUS_38850 2160 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 3038 2514 gene locus_tag LOCUS_38860 3038 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 3537 4163 gene locus_tag LOCUS_38870 3537 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 4183 5055 gene locus_tag LOCUS_38880 4183 5055 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850619.1 protein_id gnl|my_center|LOCUS_38880 5082 6212 gene locus_tag LOCUS_38890 5082 6212 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970701.1 protein_id gnl|my_center|LOCUS_38890 6393 6938 gene locus_tag LOCUS_38900 6393 6938 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_38900 7527 7000 gene locus_tag LOCUS_38910 7527 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 8673 7684 gene locus_tag LOCUS_38920 8673 7684 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_38920 8894 8661 gene locus_tag LOCUS_38930 8894 8661 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070876.1 protein_id gnl|my_center|LOCUS_38930 9931 8909 gene locus_tag LOCUS_38940 9931 8909 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331459.1 protein_id gnl|my_center|LOCUS_38940 10272 10069 gene locus_tag LOCUS_38950 10272 10069 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720756.1 protein_id gnl|my_center|LOCUS_38950 10730 10269 gene locus_tag LOCUS_38960 gene trxC 10730 10269 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_38960 >Feature sequence104 722 60 gene locus_tag LOCUS_38970 722 60 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_38970 1449 991 gene locus_tag LOCUS_38980 1449 991 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_38980 1704 1522 gene locus_tag LOCUS_38990 1704 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 2057 3856 gene locus_tag LOCUS_39000 2057 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39000 3853 5079 gene locus_tag LOCUS_39010 3853 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39010 6034 5120 gene locus_tag LOCUS_39020 6034 5120 CDS product DUF4238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921407.1 protein_id gnl|my_center|LOCUS_39020 6600 6031 gene locus_tag LOCUS_39030 6600 6031 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112313490.1 protein_id gnl|my_center|LOCUS_39030 6854 7303 gene locus_tag LOCUS_39040 6854 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 10071 8635 gene locus_tag LOCUS_39050 10071 8635 CDS product IS1182-like element ISPa22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112390.1 protein_id gnl|my_center|LOCUS_39050 >Feature sequence105 197 556 gene locus_tag LOCUS_39060 197 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 4020 499 gene locus_tag LOCUS_39070 4020 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 5222 4017 gene locus_tag LOCUS_39080 5222 4017 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257960.1 protein_id gnl|my_center|LOCUS_39080 6206 5631 gene locus_tag LOCUS_39090 6206 5631 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086823.1 protein_id gnl|my_center|LOCUS_39090 6097 6312 gene locus_tag LOCUS_39100 6097 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 6929 6393 gene locus_tag LOCUS_39110 6929 6393 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815273.1 protein_id gnl|my_center|LOCUS_39110 7828 7097 gene locus_tag LOCUS_39120 7828 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 8550 7720 gene locus_tag LOCUS_39130 8550 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 9331 8435 gene locus_tag LOCUS_39140 9331 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 9818 9651 gene locus_tag LOCUS_39150 9818 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 <10602 9952 gene locus_tag LOCUS_39160 <10602 9952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459240.1:IS1634 family transposase >Feature sequence106 2140 731 gene locus_tag LOCUS_39170 2140 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 3616 2486 gene locus_tag LOCUS_39180 3616 2486 CDS product IS4-like element IS1481A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035386.1 protein_id gnl|my_center|LOCUS_39180 4281 3931 gene locus_tag LOCUS_39190 4281 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 4177 4512 gene locus_tag LOCUS_39200 4177 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 5687 4722 gene locus_tag LOCUS_39210 5687 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 6954 5818 gene locus_tag LOCUS_39220 6954 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 7799 6951 gene locus_tag LOCUS_39230 7799 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 8614 7796 gene locus_tag LOCUS_39240 8614 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 8567 8872 gene locus_tag LOCUS_39250 8567 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 9900 9082 gene locus_tag LOCUS_39260 9900 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 >Feature sequence107 1138 341 gene locus_tag LOCUS_39270 1138 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 1635 1135 gene locus_tag LOCUS_39280 1635 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 3624 1717 gene locus_tag LOCUS_39290 3624 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 4655 3621 gene locus_tag LOCUS_39300 4655 3621 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368630.1 protein_id gnl|my_center|LOCUS_39300 4852 4652 gene locus_tag LOCUS_39310 4852 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 5716 4979 gene locus_tag LOCUS_39320 5716 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 6104 5826 gene locus_tag LOCUS_39330 6104 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 7267 6218 gene locus_tag LOCUS_39340 7267 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 7968 7423 gene locus_tag LOCUS_39350 7968 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 8671 8087 gene locus_tag LOCUS_39360 8671 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 9060 9287 gene locus_tag LOCUS_39370 9060 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 >Feature sequence108 678 352 gene locus_tag LOCUS_39380 678 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 934 698 gene locus_tag LOCUS_39390 934 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 1622 1047 gene locus_tag LOCUS_39400 1622 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 2059 1730 gene locus_tag LOCUS_39410 2059 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 2751 2152 gene locus_tag LOCUS_39420 2751 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 3213 6314 gene locus_tag LOCUS_39430 gene drmD 3213 6314 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083686.1 protein_id gnl|my_center|LOCUS_39430 6318 9953 gene locus_tag LOCUS_39440 6318 9953 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083687.1 protein_id gnl|my_center|LOCUS_39440 >Feature sequence109 1159 425 gene locus_tag LOCUS_39450 gene fliP 1159 425 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088559.1 protein_id gnl|my_center|LOCUS_39450 1440 1156 gene locus_tag LOCUS_39460 1440 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 1592 1978 gene locus_tag LOCUS_39470 gene flgB 1592 1978 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626458.1 protein_id gnl|my_center|LOCUS_39470 2110 2517 gene locus_tag LOCUS_39480 gene flgC 2110 2517 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974466.1 protein_id gnl|my_center|LOCUS_39480 2527 2838 gene locus_tag LOCUS_39490 2527 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 2905 3174 gene locus_tag LOCUS_39500 gene fliQ 2905 3174 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_39500 3174 3947 gene locus_tag LOCUS_39510 gene fliR 3174 3947 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088554.1 protein_id gnl|my_center|LOCUS_39510 3951 5018 gene locus_tag LOCUS_39520 gene flhB 3951 5018 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 protein_id gnl|my_center|LOCUS_39520 5015 6235 gene locus_tag LOCUS_39530 5015 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 6414 6683 gene locus_tag LOCUS_39540 6414 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 6733 7800 gene locus_tag LOCUS_39550 6733 7800 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202342.1 protein_id gnl|my_center|LOCUS_39550 8264 9301 gene locus_tag LOCUS_39560 gene recA 8264 9301 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_39560 >Feature sequence110 281 823 gene locus_tag LOCUS_39570 281 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 1025 8227 gene locus_tag LOCUS_39580 1025 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 8637 9422 gene locus_tag LOCUS_39590 8637 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 >Feature sequence111 709 1680 gene locus_tag LOCUS_39600 709 1680 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_39600 3886 2606 gene locus_tag LOCUS_39610 3886 2606 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210864.1 protein_id gnl|my_center|LOCUS_39610 4423 5277 gene locus_tag LOCUS_39620 4423 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 5318 6286 gene locus_tag LOCUS_39630 5318 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 6602 6883 gene locus_tag LOCUS_39640 6602 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 6996 7751 gene locus_tag LOCUS_39650 6996 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 7862 8443 gene locus_tag LOCUS_39660 7862 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 8452 9651 gene locus_tag LOCUS_39670 8452 9651 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112138.1 protein_id gnl|my_center|LOCUS_39670 >Feature sequence112 1252 326 gene locus_tag LOCUS_39680 1252 326 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_39680 2304 1249 gene locus_tag LOCUS_39690 2304 1249 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625927.1 protein_id gnl|my_center|LOCUS_39690 2431 3081 gene locus_tag LOCUS_39700 2431 3081 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440306.1 protein_id gnl|my_center|LOCUS_39700 3106 3747 gene locus_tag LOCUS_39710 3106 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 3747 3980 gene locus_tag LOCUS_39720 3747 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4198 5997 gene locus_tag LOCUS_39730 4198 5997 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390241.1 protein_id gnl|my_center|LOCUS_39730 5997 7085 gene locus_tag LOCUS_39740 5997 7085 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390240.1 protein_id gnl|my_center|LOCUS_39740 7389 7820 gene locus_tag LOCUS_39750 7389 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 >Feature sequence113 601 416 gene locus_tag LOCUS_39760 601 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 616 4203 gene locus_tag LOCUS_39770 616 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 5158 4367 gene locus_tag LOCUS_39780 5158 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 5724 5155 gene locus_tag LOCUS_39790 5724 5155 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112313490.1 protein_id gnl|my_center|LOCUS_39790 7357 6338 gene locus_tag LOCUS_39800 7357 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 8041 7361 gene locus_tag LOCUS_39810 8041 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 >Feature sequence114 1133 324 gene locus_tag LOCUS_39820 1133 324 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_39820 3329 1149 gene locus_tag LOCUS_39830 gene copA1 3329 1149 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_39830 3652 3933 gene locus_tag LOCUS_39840 3652 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 4009 5124 gene locus_tag LOCUS_39850 gene ald 4009 5124 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_39850 7260 5872 gene locus_tag LOCUS_39860 gene ccmI 7260 5872 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532636.1 protein_id gnl|my_center|LOCUS_39860 7712 7257 gene locus_tag LOCUS_39870 7712 7257 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387794.1 protein_id gnl|my_center|LOCUS_39870 8245 7709 gene locus_tag LOCUS_39880 8245 7709 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 protein_id gnl|my_center|LOCUS_39880 >Feature sequence115 308 631 gene locus_tag LOCUS_39890 308 631 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390817.1 protein_id gnl|my_center|LOCUS_39890 652 954 gene locus_tag LOCUS_39900 652 954 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958263.1 protein_id gnl|my_center|LOCUS_39900 4473 1159 gene locus_tag LOCUS_39910 4473 1159 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387961.1 protein_id gnl|my_center|LOCUS_39910 4987 4757 gene locus_tag LOCUS_39920 4987 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 5527 5147 gene locus_tag LOCUS_39930 5527 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 5677 6771 gene locus_tag LOCUS_39940 5677 6771 CDS product IS1595-like element ISRsp21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076611897.1 protein_id gnl|my_center|LOCUS_39940 7333 7998 gene locus_tag LOCUS_39950 7333 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 >Feature sequence116 1567 2763 gene locus_tag LOCUS_39960 1567 2763 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_39960 3839 3063 gene locus_tag LOCUS_39970 3839 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 5647 3836 gene locus_tag LOCUS_39980 5647 3836 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083689.1 protein_id gnl|my_center|LOCUS_39980 6426 5644 gene locus_tag LOCUS_39990 6426 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39990 7864 6401 gene locus_tag LOCUS_40000 7864 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40000 >Feature sequence117 1715 1215 gene locus_tag LOCUS_40010 1715 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 2155 2517 gene locus_tag LOCUS_40020 2155 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 2969 2673 gene locus_tag LOCUS_40030 2969 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 2969 3364 gene locus_tag LOCUS_40040 2969 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 3898 3674 gene locus_tag LOCUS_40050 3898 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 4486 3908 gene locus_tag LOCUS_40060 4486 3908 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100847.1 protein_id gnl|my_center|LOCUS_40060 5089 4490 gene locus_tag LOCUS_40070 5089 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 5282 5076 gene locus_tag LOCUS_40080 5282 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 6102 5485 gene locus_tag LOCUS_40090 6102 5485 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_40090 6667 7902 gene locus_tag LOCUS_40100 gene ltrA 6667 7902 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024495.1 protein_id gnl|my_center|LOCUS_40100 >Feature sequence118 531 1874 gene locus_tag LOCUS_40110 531 1874 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920834.1 protein_id gnl|my_center|LOCUS_40110 2999 2658 gene locus_tag LOCUS_40120 2999 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966402.1 protein_id gnl|my_center|LOCUS_40120 3547 3206 gene locus_tag LOCUS_40130 3547 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 4982 3630 gene locus_tag LOCUS_40140 gene hflX 4982 3630 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261607.1 protein_id gnl|my_center|LOCUS_40140 4908 5141 gene locus_tag LOCUS_40150 4908 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 7290 6004 gene locus_tag LOCUS_40160 7290 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 7585 7295 gene locus_tag LOCUS_40170 7585 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 >Feature sequence119 780 172 gene locus_tag LOCUS_40180 780 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 1747 785 gene locus_tag LOCUS_40190 1747 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 2893 2321 gene locus_tag LOCUS_40200 2893 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 3182 2904 gene locus_tag LOCUS_40210 3182 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 4822 3422 gene locus_tag LOCUS_40220 4822 3422 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_40220 5059 5235 gene locus_tag LOCUS_40230 5059 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 5222 5770 gene locus_tag LOCUS_40240 5222 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 6213 6518 gene locus_tag LOCUS_40250 6213 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 6606 6971 gene locus_tag LOCUS_40260 6606 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 >Feature sequence120 1158 799 gene locus_tag LOCUS_40270 1158 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 1570 1370 gene locus_tag LOCUS_40280 1570 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 2598 1573 gene locus_tag LOCUS_40290 2598 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 3116 2739 gene locus_tag LOCUS_40300 3116 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 3656 3186 gene locus_tag LOCUS_40310 3656 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 3919 5163 gene locus_tag LOCUS_40320 3919 5163 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_40320 5178 6122 gene locus_tag LOCUS_40330 5178 6122 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_40330 6115 7125 gene locus_tag LOCUS_40340 6115 7125 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence121 840 1766 gene locus_tag LOCUS_40350 840 1766 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_40350 2266 1862 gene locus_tag LOCUS_40360 2266 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042063.1 protein_id gnl|my_center|LOCUS_40360 2895 2263 gene locus_tag LOCUS_40370 2895 2263 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042062.1 protein_id gnl|my_center|LOCUS_40370 3447 3145 gene locus_tag LOCUS_40380 3447 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 3672 3460 gene locus_tag LOCUS_40390 3672 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 4026 3805 gene locus_tag LOCUS_40400 4026 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 4387 4812 gene locus_tag LOCUS_40410 4387 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 6166 5210 gene locus_tag LOCUS_40420 6166 5210 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024927297.1 protein_id gnl|my_center|LOCUS_40420 >Feature sequence122 2155 1364 gene locus_tag LOCUS_40430 2155 1364 CDS product quinoprotein dehydrogenase-associated SoxYZ-like carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966743.1 protein_id gnl|my_center|LOCUS_40430 2766 2209 gene locus_tag LOCUS_40440 2766 2209 CDS product PQQ-dependent catabolism-associated CXXCW motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969572.1 protein_id gnl|my_center|LOCUS_40440 3707 2769 gene locus_tag LOCUS_40450 3707 2769 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966742.1 protein_id gnl|my_center|LOCUS_40450 4335 3877 gene locus_tag LOCUS_40460 4335 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 5052 4453 gene locus_tag LOCUS_40470 5052 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 5644 5237 gene locus_tag LOCUS_40480 5644 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 6182 5943 gene locus_tag LOCUS_40490 6182 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 6297 6608 gene locus_tag LOCUS_40500 6297 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 6605 6943 gene locus_tag LOCUS_40510 6605 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40510 >Feature sequence123 111 509 gene locus_tag LOCUS_40520 111 509 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_40520 1004 1321 gene locus_tag LOCUS_40530 1004 1321 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084751.1 protein_id gnl|my_center|LOCUS_40530 1592 2728 gene locus_tag LOCUS_40540 1592 2728 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_40540 3457 2795 gene locus_tag LOCUS_40550 3457 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 4374 3454 gene locus_tag LOCUS_40560 4374 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 4903 4397 gene locus_tag LOCUS_40570 4903 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 5197 5556 gene locus_tag LOCUS_40580 5197 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 5558 6355 gene locus_tag LOCUS_40590 5558 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 >Feature sequence124 7 83 gene locus_tag LOCUS_t00420 7 83 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 270 3089 gene locus_tag LOCUS_40600 270 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 5585 3153 gene locus_tag LOCUS_40610 gene gyrB 5585 3153 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387765.1 protein_id gnl|my_center|LOCUS_40610 6808 5660 gene locus_tag LOCUS_40620 gene recF 6808 5660 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 protein_id gnl|my_center|LOCUS_40620 >Feature sequence125 664 1551 gene locus_tag LOCUS_40630 664 1551 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_40630 1544 2341 gene locus_tag LOCUS_40640 1544 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 2338 2751 gene locus_tag LOCUS_40650 2338 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 2748 3329 gene locus_tag LOCUS_40660 2748 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40660 3347 3898 gene locus_tag LOCUS_40670 3347 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40670 3900 4745 gene locus_tag LOCUS_40680 3900 4745 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114948346.1 protein_id gnl|my_center|LOCUS_40680 6312 4735 gene locus_tag LOCUS_40690 6312 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965716.1 protein_id gnl|my_center|LOCUS_40690 >Feature sequence126 <1 538 gene locus_tag LOCUS_40700 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:tandem-95 repeat protein 1351 581 gene locus_tag LOCUS_40710 1351 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 1971 1348 gene locus_tag LOCUS_40720 1971 1348 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391172.1 protein_id gnl|my_center|LOCUS_40720 2676 1987 gene locus_tag LOCUS_40730 gene pyrF 2676 1987 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_40730 2986 2678 gene locus_tag LOCUS_40740 2986 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 3449 3036 gene locus_tag LOCUS_40750 3449 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 4332 3403 gene locus_tag LOCUS_40760 gene sppA 4332 3403 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327051.1 protein_id gnl|my_center|LOCUS_40760 6137 4389 gene locus_tag LOCUS_40770 gene rpsA 6137 4389 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388046.1 protein_id gnl|my_center|LOCUS_40770 6190 6393 gene locus_tag LOCUS_40780 6190 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 >Feature sequence127 611 703 gene locus_tag LOCUS_t00430 611 703 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1309 773 gene locus_tag LOCUS_40790 1309 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 1868 2443 gene locus_tag LOCUS_40800 1868 2443 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_40800 2646 2987 gene locus_tag LOCUS_40810 2646 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 3316 3498 gene locus_tag LOCUS_40820 3316 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 3840 5615 gene locus_tag LOCUS_40830 3840 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 6066 6608 gene locus_tag LOCUS_40840 6066 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 >Feature sequence128 4276 5976 gene locus_tag LOCUS_40850 4276 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 >Feature sequence129 300 467 gene locus_tag LOCUS_40860 300 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 630 1256 gene locus_tag LOCUS_40870 630 1256 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_40870 1290 1604 gene locus_tag LOCUS_40880 1290 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 2473 1754 gene locus_tag LOCUS_40890 2473 1754 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338460.1 protein_id gnl|my_center|LOCUS_40890 2679 2473 gene locus_tag LOCUS_40900 2679 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 2867 3904 gene locus_tag LOCUS_40910 2867 3904 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_40910 4508 4017 gene locus_tag LOCUS_40920 4508 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 6241 4841 gene locus_tag LOCUS_40930 6241 4841 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_40930 6366 6548 gene locus_tag LOCUS_40940 6366 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 >Feature sequence130 206 463 gene locus_tag LOCUS_40950 206 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 1101 487 gene locus_tag LOCUS_40960 1101 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 1608 1318 gene locus_tag LOCUS_40970 1608 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 2128 1778 gene locus_tag LOCUS_40980 2128 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 2928 2503 gene locus_tag LOCUS_40990 2928 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 3756 4985 gene locus_tag LOCUS_41000 gene repA 3756 4985 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331263.1 protein_id gnl|my_center|LOCUS_41000 4985 6040 gene locus_tag LOCUS_41010 gene repB 4985 6040 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243826.1 protein_id gnl|my_center|LOCUS_41010 >Feature sequence131 330 944 gene locus_tag LOCUS_41020 330 944 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_41020 971 2167 gene locus_tag LOCUS_41030 971 2167 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412926.1 protein_id gnl|my_center|LOCUS_41030 2167 2646 gene locus_tag LOCUS_41040 2167 2646 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899362.1 protein_id gnl|my_center|LOCUS_41040 2853 3896 gene locus_tag LOCUS_41050 2853 3896 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_41050 4359 4036 gene locus_tag LOCUS_41060 4359 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 5051 4356 gene locus_tag LOCUS_41070 5051 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 5420 5145 gene locus_tag LOCUS_41080 5420 5145 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 protein_id gnl|my_center|LOCUS_41080 5603 5424 gene locus_tag LOCUS_41090 5603 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 5956 5699 gene locus_tag LOCUS_41100 5956 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 >Feature sequence132 1438 146 gene locus_tag LOCUS_41110 1438 146 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705677.1 protein_id gnl|my_center|LOCUS_41110 2004 1447 gene locus_tag LOCUS_41120 gene umuD 2004 1447 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946963.1 protein_id gnl|my_center|LOCUS_41120 2619 5105 gene locus_tag LOCUS_41130 2619 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 5470 6132 gene locus_tag LOCUS_41140 5470 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 >Feature sequence133 1253 135 gene locus_tag LOCUS_41150 gene virB10 1253 135 CDS product type IV secretion system protein VirB10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891494.1 protein_id gnl|my_center|LOCUS_41150 2143 1250 gene locus_tag LOCUS_41160 gene virB9 2143 1250 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970873.1 protein_id gnl|my_center|LOCUS_41160 2832 2140 gene locus_tag LOCUS_41170 2832 2140 CDS product type IV secretion system protein VirB8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533337.1 protein_id gnl|my_center|LOCUS_41170 3949 3044 gene locus_tag LOCUS_41180 3949 3044 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974917.1 protein_id gnl|my_center|LOCUS_41180 4330 3953 gene locus_tag LOCUS_41190 4330 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 5025 4327 gene locus_tag LOCUS_41200 5025 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 <5977 5043 gene locus_tag LOCUS_41210 <5977 5043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974916.1:type IV secretion/conjugal transfer ATPase VirB4 >Feature sequence134 59 502 gene locus_tag LOCUS_41220 59 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 1226 597 gene locus_tag LOCUS_41230 1226 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 1570 1758 gene locus_tag LOCUS_41240 1570 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 2271 2023 gene locus_tag LOCUS_41250 2271 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 2528 2334 gene locus_tag LOCUS_41260 2528 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 3655 2771 gene locus_tag LOCUS_41270 3655 2771 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_41270 4497 4021 gene locus_tag LOCUS_41280 4497 4021 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_41280 4648 5019 gene locus_tag LOCUS_41290 4648 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 5029 5595 gene locus_tag LOCUS_41300 5029 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390698.1 protein_id gnl|my_center|LOCUS_41300 5640 5885 gene locus_tag LOCUS_41310 5640 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 >Feature sequence135 468 250 gene locus_tag LOCUS_41320 468 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 409 819 gene locus_tag LOCUS_41330 409 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 1448 1155 gene locus_tag LOCUS_41340 1448 1155 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_41340 1696 1445 gene locus_tag LOCUS_41350 1696 1445 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_41350 2467 1766 gene locus_tag LOCUS_41360 2467 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 3578 4486 gene locus_tag LOCUS_41370 3578 4486 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932075.1 protein_id gnl|my_center|LOCUS_41370 4516 5448 gene locus_tag LOCUS_41380 4516 5448 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084071.1 protein_id gnl|my_center|LOCUS_41380 5802 5461 gene locus_tag LOCUS_41390 5802 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 >Feature sequence136 1821 1495 gene locus_tag LOCUS_41400 1821 1495 CDS product type IV secretion system protein VirB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891501.1 protein_id gnl|my_center|LOCUS_41400 2201 1821 gene locus_tag LOCUS_41410 2201 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 2990 2205 gene locus_tag LOCUS_41420 2990 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 3347 3559 gene locus_tag LOCUS_41430 3347 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 4196 4633 gene locus_tag LOCUS_41440 4196 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 <5936 4712 gene locus_tag LOCUS_41450 <5936 4712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933069.1:ATP-dependent RecD-like DNA helicase >Feature sequence137 1839 244 gene locus_tag LOCUS_41460 1839 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 2326 3924 gene locus_tag LOCUS_41470 2326 3924 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528485.1 protein_id gnl|my_center|LOCUS_41470 3921 4310 gene locus_tag LOCUS_41480 3921 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 4307 4585 gene locus_tag LOCUS_41490 4307 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 5682 4714 gene locus_tag LOCUS_41500 5682 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 >Feature sequence138 1706 63 gene locus_tag LOCUS_41510 1706 63 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727486.1 protein_id gnl|my_center|LOCUS_41510 2402 2659 gene locus_tag LOCUS_41520 2402 2659 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970293.1 protein_id gnl|my_center|LOCUS_41520 3105 2743 gene locus_tag LOCUS_41530 3105 2743 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869618.1 protein_id gnl|my_center|LOCUS_41530 3548 3105 gene locus_tag LOCUS_41540 3548 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 4494 4943 gene locus_tag LOCUS_41550 4494 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 >Feature sequence139 2212 941 gene locus_tag LOCUS_41560 2212 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 3128 2250 gene locus_tag LOCUS_41570 3128 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 3606 3145 gene locus_tag LOCUS_41580 gene pal 3606 3145 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527588.1 protein_id gnl|my_center|LOCUS_41580 5221 3848 gene locus_tag LOCUS_41590 gene tolB 5221 3848 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388849.1 protein_id gnl|my_center|LOCUS_41590 5804 5304 gene locus_tag LOCUS_41600 5804 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 >Feature sequence140 161 1702 gene locus_tag LOCUS_41610 161 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 2999 1827 gene locus_tag LOCUS_41620 2999 1827 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202174.1 protein_id gnl|my_center|LOCUS_41620 3564 4682 gene locus_tag LOCUS_41630 3564 4682 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_41630 >Feature sequence141 1391 1272 gene locus_tag LOCUS_41640 1391 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 1865 1940 gene locus_tag LOCUS_t00440 1865 1940 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2349 1978 gene locus_tag LOCUS_41650 2349 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 3295 2420 gene locus_tag LOCUS_41660 3295 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 3612 3283 gene locus_tag LOCUS_41670 3612 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 4310 3609 gene locus_tag LOCUS_41680 4310 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 5117 4323 gene locus_tag LOCUS_41690 5117 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 5514 5287 gene locus_tag LOCUS_41700 5514 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 >Feature sequence142 726 1220 gene locus_tag LOCUS_41710 726 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 1901 1494 gene locus_tag LOCUS_41720 1901 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 1842 2048 gene locus_tag LOCUS_41730 1842 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 2711 3133 gene locus_tag LOCUS_41740 2711 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 3555 3106 gene locus_tag LOCUS_41750 3555 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 3651 4640 gene locus_tag LOCUS_41760 3651 4640 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_41760 5364 4582 gene locus_tag LOCUS_41770 5364 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 >Feature sequence143 <1 2548 gene locus_tag LOCUS_41780 <1 2548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106726897.1:Ti-type conjugative transfer relaxase TraA 3930 2665 gene locus_tag LOCUS_41790 3930 2665 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_41790 4112 4669 gene locus_tag LOCUS_41800 4112 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 4691 5173 gene locus_tag LOCUS_41810 4691 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 5384 5199 gene locus_tag LOCUS_41820 5384 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 >Feature sequence144 <1 2454 gene locus_tag LOCUS_41830 <1 2454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974882.1:lactate dehydrogenase 2981 2565 gene locus_tag LOCUS_41840 2981 2565 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975642.1 protein_id gnl|my_center|LOCUS_41840 3216 2968 gene locus_tag LOCUS_41850 3216 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 3524 4168 gene locus_tag LOCUS_41860 3524 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 4165 4413 gene locus_tag LOCUS_41870 4165 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 4410 4802 gene locus_tag LOCUS_41880 4410 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 4799 5479 gene locus_tag LOCUS_41890 4799 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 >Feature sequence145 602 378 gene locus_tag LOCUS_41900 602 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 872 1927 gene locus_tag LOCUS_41910 872 1927 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530538.1 protein_id gnl|my_center|LOCUS_41910 1935 2825 gene locus_tag LOCUS_41920 1935 2825 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388364.1 protein_id gnl|my_center|LOCUS_41920 3159 3500 gene locus_tag LOCUS_41930 3159 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 4036 3590 gene locus_tag LOCUS_41940 4036 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 4524 4859 gene locus_tag LOCUS_41950 4524 4859 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461077.1 protein_id gnl|my_center|LOCUS_41950 5298 4915 gene locus_tag LOCUS_41960 5298 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 >Feature sequence146 1096 2460 gene locus_tag LOCUS_41970 gene gtrII 1096 2460 CDS product glucosyltransferase GtrII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590793.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41970 3645 2596 gene locus_tag LOCUS_41980 3645 2596 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057335.1 protein_id gnl|my_center|LOCUS_41980 4358 3642 gene locus_tag LOCUS_41990 4358 3642 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_41990 >Feature sequence147 161 562 gene locus_tag LOCUS_42000 161 562 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_42000 581 1045 gene locus_tag LOCUS_42010 581 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 1173 979 gene locus_tag LOCUS_42020 1173 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 1244 1819 gene locus_tag LOCUS_42030 1244 1819 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028006006.1 protein_id gnl|my_center|LOCUS_42030 2314 2075 gene locus_tag LOCUS_42040 2314 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 2369 3787 gene locus_tag LOCUS_42050 2369 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42050 >Feature sequence148 384 698 gene locus_tag LOCUS_42060 384 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 1041 1958 gene locus_tag LOCUS_42070 1041 1958 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_42070 2277 2035 gene locus_tag LOCUS_42080 2277 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 2902 2270 gene locus_tag LOCUS_42090 2902 2270 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083586.1 protein_id gnl|my_center|LOCUS_42090 3422 3114 gene locus_tag LOCUS_42100 3422 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 3650 3438 gene locus_tag LOCUS_42110 3650 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 4019 3798 gene locus_tag LOCUS_42120 4019 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 4306 4503 gene locus_tag LOCUS_42130 4306 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 >Feature sequence149 678 289 gene locus_tag LOCUS_42140 678 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 1287 2384 gene locus_tag LOCUS_42150 1287 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 2381 3814 gene locus_tag LOCUS_42160 2381 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 4076 4489 gene locus_tag LOCUS_42170 4076 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 >Feature sequence150 92 1105 gene locus_tag LOCUS_42180 92 1105 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_42180 1109 1888 gene locus_tag LOCUS_42190 1109 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 3116 1944 gene locus_tag LOCUS_42200 3116 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 3852 3118 gene locus_tag LOCUS_42210 3852 3118 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465065.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42210 4019 3825 gene locus_tag LOCUS_42220 4019 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 4524 4021 gene locus_tag LOCUS_42230 4524 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 >Feature sequence151 290 550 gene locus_tag LOCUS_42240 290 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 693 1721 gene locus_tag LOCUS_42250 693 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 1735 2481 gene locus_tag LOCUS_42260 1735 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 2478 2717 gene locus_tag LOCUS_42270 2478 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 2720 4330 gene locus_tag LOCUS_42280 2720 4330 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_42280 >Feature sequence152 488 1000 gene locus_tag LOCUS_42290 488 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 997 1146 gene locus_tag LOCUS_42300 997 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 1168 2787 gene locus_tag LOCUS_42310 1168 2787 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974229.1 protein_id gnl|my_center|LOCUS_42310 3431 3006 gene locus_tag LOCUS_42320 3431 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 3764 3985 gene locus_tag LOCUS_42330 3764 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 >Feature sequence153 <1 1234 gene locus_tag LOCUS_42340 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933069.1:ATP-dependent RecD-like DNA helicase 1713 1303 gene locus_tag LOCUS_42350 1713 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 2019 1837 gene locus_tag LOCUS_42360 2019 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 2480 2319 gene locus_tag LOCUS_42370 2480 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 2602 3540 gene locus_tag LOCUS_42380 2602 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 4161 3694 gene locus_tag LOCUS_42390 4161 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 4415 4155 gene locus_tag LOCUS_42400 4415 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 >Feature sequence154 734 441 gene locus_tag LOCUS_42410 734 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 1387 737 gene locus_tag LOCUS_42420 1387 737 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090916.1 protein_id gnl|my_center|LOCUS_42420 1822 1535 gene locus_tag LOCUS_42430 1822 1535 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811141.1 protein_id gnl|my_center|LOCUS_42430 2192 1827 gene locus_tag LOCUS_42440 2192 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897305.1 protein_id gnl|my_center|LOCUS_42440 3862 2564 gene locus_tag LOCUS_42450 gene repC 3862 2564 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525330.1 protein_id gnl|my_center|LOCUS_42450 >Feature sequence155 857 498 gene locus_tag LOCUS_42460 857 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 1137 1310 gene locus_tag LOCUS_42470 1137 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 1286 1648 gene locus_tag LOCUS_42480 1286 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 1673 2590 gene locus_tag LOCUS_42490 1673 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 2587 3249 gene locus_tag LOCUS_42500 2587 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 3622 3443 gene locus_tag LOCUS_42510 3622 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 3967 4143 gene locus_tag LOCUS_42520 3967 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 >Feature sequence156 391 41 gene locus_tag LOCUS_42530 391 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 615 388 gene locus_tag LOCUS_42540 615 388 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_42540 1633 689 gene locus_tag LOCUS_42550 1633 689 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967479.1 protein_id gnl|my_center|LOCUS_42550 3011 1974 gene locus_tag LOCUS_42560 3011 1974 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084736.1 protein_id gnl|my_center|LOCUS_42560 <4319 3098 gene locus_tag LOCUS_42570 <4319 3098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014490278.1:ParB/RepB/Spo0J family partition protein >Feature sequence157 1120 227 gene locus_tag LOCUS_42580 gene virB9 1120 227 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891495.1 protein_id gnl|my_center|LOCUS_42580 1809 1117 gene locus_tag LOCUS_42590 1809 1117 CDS product type IV secretion system protein VirB8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533337.1 protein_id gnl|my_center|LOCUS_42590 1967 1806 gene locus_tag LOCUS_42600 1967 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 2938 2021 gene locus_tag LOCUS_42610 2938 2021 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974917.1 protein_id gnl|my_center|LOCUS_42610 3319 2942 gene locus_tag LOCUS_42620 3319 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 4014 3316 gene locus_tag LOCUS_42630 4014 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 >Feature sequence158 434 75 gene locus_tag LOCUS_42640 434 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 1674 877 gene locus_tag LOCUS_42650 1674 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 2224 2811 gene locus_tag LOCUS_42660 2224 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 >Feature sequence159 1135 1479 gene locus_tag LOCUS_42670 1135 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 1825 2466 gene locus_tag LOCUS_42680 1825 2466 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085558.1 protein_id gnl|my_center|LOCUS_42680 2543 3409 gene locus_tag LOCUS_42690 2543 3409 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399088.1 protein_id gnl|my_center|LOCUS_42690 >Feature sequence160 3102 520 gene locus_tag LOCUS_42700 gene clpB 3102 520 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388511.1 protein_id gnl|my_center|LOCUS_42700 >Feature sequence161 <1 626 gene locus_tag LOCUS_42710 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990809.1:IS630-like element ISMac18 family transposase 1290 730 gene locus_tag LOCUS_42720 1290 730 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974767.1 protein_id gnl|my_center|LOCUS_42720 2260 1346 gene locus_tag LOCUS_42730 2260 1346 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 protein_id gnl|my_center|LOCUS_42730 2388 3284 gene locus_tag LOCUS_42740 2388 3284 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970386.1 protein_id gnl|my_center|LOCUS_42740 >Feature sequence162 302 937 gene locus_tag LOCUS_42750 302 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 >Feature sequence163 633 1829 gene locus_tag LOCUS_42760 633 1829 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338075.1 protein_id gnl|my_center|LOCUS_42760 1930 2382 gene locus_tag LOCUS_42770 1930 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 2379 2765 gene locus_tag LOCUS_42780 2379 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 2729 3379 gene locus_tag LOCUS_42790 2729 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 3479 3784 gene locus_tag LOCUS_42800 3479 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 >Feature sequence164 222 134 gene locus_tag LOCUS_t00450 222 134 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1076 729 gene locus_tag LOCUS_42810 1076 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42810 1327 1079 gene locus_tag LOCUS_42820 1327 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42820 2257 2724 gene locus_tag LOCUS_42830 2257 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 3094 3462 gene locus_tag LOCUS_42840 3094 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42840 >Feature sequence165 426 208 gene locus_tag LOCUS_42850 426 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 801 535 gene locus_tag LOCUS_42860 801 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 2915 1644 gene locus_tag LOCUS_42870 2915 1644 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095144.1 protein_id gnl|my_center|LOCUS_42870 >Feature sequence166 186 716 gene locus_tag LOCUS_42880 186 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42880 >Feature sequence167 539 1120 gene locus_tag LOCUS_42890 539 1120 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552315.1 protein_id gnl|my_center|LOCUS_42890 1328 1861 gene locus_tag LOCUS_42900 1328 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 1858 2328 gene locus_tag LOCUS_42910 1858 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 2307 3374 gene locus_tag LOCUS_42920 2307 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 >Feature sequence168 376 1128 gene locus_tag LOCUS_42930 gene lepB 376 1128 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389606.1 protein_id gnl|my_center|LOCUS_42930 1080 1904 gene locus_tag LOCUS_42940 gene rnc 1080 1904 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389605.1 protein_id gnl|my_center|LOCUS_42940 1901 2809 gene locus_tag LOCUS_42950 gene era 1901 2809 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389604.1 protein_id gnl|my_center|LOCUS_42950 3180 2941 gene locus_tag LOCUS_42960 3180 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 >Feature sequence169 585 376 gene locus_tag LOCUS_42970 585 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 1500 688 gene locus_tag LOCUS_42980 1500 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 2958 1741 gene locus_tag LOCUS_42990 2958 1741 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954590.1 protein_id gnl|my_center|LOCUS_42990 >Feature sequence170 2603 1563 gene locus_tag LOCUS_43000 gene virB11 2603 1563 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970871.1 protein_id gnl|my_center|LOCUS_43000 <3314 2593 gene locus_tag LOCUS_43010 <3314 2593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891494.1:type IV secretion system protein VirB10 >Feature sequence171 2689 425 gene locus_tag LOCUS_43020 2689 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 >Feature sequence172 320 396 gene locus_tag LOCUS_t00460 320 396 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 852 484 gene locus_tag LOCUS_43030 852 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 1514 747 gene locus_tag LOCUS_43040 1514 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 1951 1601 gene locus_tag LOCUS_43050 1951 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 2542 2087 gene locus_tag LOCUS_43060 2542 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 >Feature sequence173 363 100 gene locus_tag LOCUS_43070 363 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 1430 360 gene locus_tag LOCUS_43080 1430 360 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368630.1 protein_id gnl|my_center|LOCUS_43080 1887 1456 gene locus_tag LOCUS_43090 1887 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 1958 2194 gene locus_tag LOCUS_43100 1958 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 3033 2635 gene locus_tag LOCUS_43110 3033 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 >Feature sequence174 599 333 gene locus_tag LOCUS_43120 599 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 781 1101 gene locus_tag LOCUS_43130 781 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 2308 2739 gene locus_tag LOCUS_43140 2308 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 >Feature sequence175 258 626 gene locus_tag LOCUS_43150 258 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 1090 641 gene locus_tag LOCUS_43160 1090 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 1480 2847 gene locus_tag LOCUS_43170 1480 2847 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024749659.1 protein_id gnl|my_center|LOCUS_43170 >Feature sequence176 567 1697 gene locus_tag LOCUS_43180 567 1697 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_43180 >Feature sequence177 645 1886 gene locus_tag LOCUS_43190 645 1886 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_43190 1883 2680 gene locus_tag LOCUS_43200 1883 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 >Feature sequence178 2 391 gene locus_tag LOCUS_43210 2 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 1866 340 gene locus_tag LOCUS_43220 1866 340 CDS product IS66-like element ISBj7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084592.1 protein_id gnl|my_center|LOCUS_43220 2303 1944 gene locus_tag LOCUS_43230 gene tnpB 2303 1944 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612591.1 protein_id gnl|my_center|LOCUS_43230 2646 2305 gene locus_tag LOCUS_43240 2646 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 >Feature sequence179 1061 1309 gene locus_tag LOCUS_43250 1061 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 1312 1809 gene locus_tag LOCUS_43260 1312 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 >Feature sequence180 60 1097 gene locus_tag LOCUS_43270 60 1097 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368630.1 protein_id gnl|my_center|LOCUS_43270 1429 2373 gene locus_tag LOCUS_43280 1429 2373 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967479.1 protein_id gnl|my_center|LOCUS_43280 >Feature sequence181 427 1092 gene locus_tag LOCUS_43290 427 1092 CDS product fumarate hydratase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339079.1 protein_id gnl|my_center|LOCUS_43290 1214 2077 gene locus_tag LOCUS_43300 1214 2077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339085.1 protein_id gnl|my_center|LOCUS_43300 2074 2361 gene locus_tag LOCUS_43310 2074 2361 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_43310 >Feature sequence182 427 1092 gene locus_tag LOCUS_43320 427 1092 CDS product fumarate hydratase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339079.1 protein_id gnl|my_center|LOCUS_43320 1213 2076 gene locus_tag LOCUS_43330 1213 2076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083211.1 protein_id gnl|my_center|LOCUS_43330 2073 2348 gene locus_tag LOCUS_43340 2073 2348 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_43340 >Feature sequence183 1119 460 gene locus_tag LOCUS_43350 1119 460 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388104.1 protein_id gnl|my_center|LOCUS_43350 1336 1124 gene locus_tag LOCUS_43360 1336 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 1791 1378 gene locus_tag LOCUS_43370 1791 1378 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_43370 2036 1788 gene locus_tag LOCUS_43380 2036 1788 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141679.1 protein_id gnl|my_center|LOCUS_43380 >Feature sequence184 713 1987 gene locus_tag LOCUS_43390 713 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 2009 2239 gene locus_tag LOCUS_43400 2009 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 2236 2403 gene locus_tag LOCUS_43410 2236 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence185 720 136 gene locus_tag LOCUS_43420 720 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 957 727 gene locus_tag LOCUS_43430 957 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 1157 957 gene locus_tag LOCUS_43440 1157 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 1420 1154 gene locus_tag LOCUS_43450 1420 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 2196 1420 gene locus_tag LOCUS_43460 2196 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 >Feature sequence186 323 1732 gene locus_tag LOCUS_43470 323 1732 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_43470 >Feature sequence187 780 1718 gene locus_tag LOCUS_43480 780 1718 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974798.1 protein_id gnl|my_center|LOCUS_43480 1946 2170 gene locus_tag LOCUS_43490 1946 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 >Feature sequence188 122 553 gene locus_tag LOCUS_43500 122 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 550 1923 gene locus_tag LOCUS_43510 550 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 >Feature sequence189 187 429 gene locus_tag LOCUS_43520 187 429 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110750833.1 protein_id gnl|my_center|LOCUS_43520 831 1937 gene locus_tag LOCUS_43530 831 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 2138 1965 gene locus_tag LOCUS_43540 2138 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 >Feature sequence190 <1 1856 gene locus_tag LOCUS_43550 <1 1856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106726897.1:Ti-type conjugative transfer relaxase TraA 2100 1915 gene locus_tag LOCUS_43560 2100 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 >Feature sequence191 586 425 gene locus_tag LOCUS_43570 586 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 1090 1680 gene locus_tag LOCUS_43580 1090 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 1886 1707 gene locus_tag LOCUS_43590 1886 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 >Feature sequence192 >Feature sequence193 1474 842 gene locus_tag LOCUS_43600 1474 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43600 >Feature sequence194 >Feature sequence195 716 531 gene locus_tag LOCUS_43610 716 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 1285 878 gene locus_tag LOCUS_43620 1285 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43620 2015 1341 gene locus_tag LOCUS_43630 2015 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43630 >Feature sequence196 359 757 gene locus_tag LOCUS_43640 359 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 754 2070 gene locus_tag LOCUS_43650 754 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 >Feature sequence197 1822 356 gene locus_tag LOCUS_43660 1822 356 CDS product DUF3631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091506663.1 protein_id gnl|my_center|LOCUS_43660 2016 1810 gene locus_tag LOCUS_43670 2016 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 >Feature sequence198 1760 183 gene locus_tag LOCUS_43680 1760 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 >Feature sequence199 111 536 gene locus_tag LOCUS_43690 111 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 547 744 gene locus_tag LOCUS_43700 547 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 734 1024 gene locus_tag LOCUS_43710 734 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 1746 1048 gene locus_tag LOCUS_43720 1746 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 >Feature sequence200 <1 933 gene locus_tag LOCUS_43730 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967177.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence201 1311 1475 gene locus_tag LOCUS_43740 1311 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 >Feature sequence202 142 306 gene locus_tag LOCUS_43750 142 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 921 301 gene locus_tag LOCUS_43760 921 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 >Feature sequence203 1294 185 gene locus_tag LOCUS_43770 1294 185 CDS product IS4-like element IS421 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300563.1 protein_id gnl|my_center|LOCUS_43770 1809 1447 gene locus_tag LOCUS_43780 1809 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 >Feature sequence204 220 537 gene locus_tag LOCUS_43790 220 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 534 977 gene locus_tag LOCUS_43800 534 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 974 1291 gene locus_tag LOCUS_43810 974 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 1239 1415 gene locus_tag LOCUS_43820 1239 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 >Feature sequence205 93 539 gene locus_tag LOCUS_43830 93 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 1469 558 gene locus_tag LOCUS_43840 gene rsmI 1469 558 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083497.1 protein_id gnl|my_center|LOCUS_43840 >Feature sequence206 373 1551 gene locus_tag LOCUS_43850 373 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 >Feature sequence207 >Feature sequence208 629 189 gene locus_tag LOCUS_43860 629 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 1024 845 gene locus_tag LOCUS_43870 1024 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 >Feature sequence209 355 1599 gene locus_tag LOCUS_43880 355 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 >Feature sequence210 >Feature sequence211 277 1716 gene locus_tag LOCUS_43890 277 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 >Feature sequence212 195 10 gene locus_tag LOCUS_43900 195 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 <1716 228 gene locus_tag LOCUS_43910 <1716 228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066871162.1:Ti-type conjugative transfer system protein TraG >Feature sequence213 1201 224 gene locus_tag LOCUS_43920 1201 224 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391782.1 protein_id gnl|my_center|LOCUS_43920 >Feature sequence214 1499 1269 gene locus_tag LOCUS_43930 1499 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 >Feature sequence215 47 202 gene locus_tag LOCUS_43940 47 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 199 426 gene locus_tag LOCUS_43950 199 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 423 638 gene locus_tag LOCUS_43960 423 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 735 1070 gene locus_tag LOCUS_43970 735 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 1067 1261 gene locus_tag LOCUS_43980 1067 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 1258 1488 gene locus_tag LOCUS_43990 1258 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 >Feature sequence216 >Feature sequence217 382 41 gene locus_tag LOCUS_44000 382 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 1461 1090 gene locus_tag LOCUS_44010 1461 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 >Feature sequence218 960 1544 gene locus_tag LOCUS_44020 960 1544 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044436927.1 protein_id gnl|my_center|LOCUS_44020 >Feature sequence219 902 1213 gene locus_tag LOCUS_44030 902 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 1478 1299 gene locus_tag LOCUS_44040 1478 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 >Feature sequence220 <1573 33 gene locus_tag LOCUS_44050 <1573 33 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974894.1:Ti-type conjugative transfer system protein TraG >Feature sequence221 569 258 gene locus_tag LOCUS_44060 569 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 826 590 gene locus_tag LOCUS_44070 826 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070