>Feature sequence001 2339 273 gene locus_tag LOCUS_00010 2339 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2491 2877 gene locus_tag LOCUS_00020 2491 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4131 3112 gene locus_tag LOCUS_00030 4131 3112 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970599.1 protein_id gnl|my_center|LOCUS_00030 5441 4176 gene locus_tag LOCUS_00040 gene murA 5441 4176 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_00040 6270 5434 gene locus_tag LOCUS_00050 gene prmC 6270 5434 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_00050 7404 6319 gene locus_tag LOCUS_00060 gene prfA 7404 6319 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173949.1 protein_id gnl|my_center|LOCUS_00060 7766 7542 gene locus_tag LOCUS_00070 gene rpmE 7766 7542 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_00070 7929 8381 gene locus_tag LOCUS_00080 7929 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9008 8421 gene locus_tag LOCUS_00090 9008 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9680 9099 gene locus_tag LOCUS_00100 9680 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10676 9750 gene locus_tag LOCUS_00110 10676 9750 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120550.1 protein_id gnl|my_center|LOCUS_00110 11905 10826 gene locus_tag LOCUS_00120 gene dinB 11905 10826 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404287.1 protein_id gnl|my_center|LOCUS_00120 13542 12199 gene locus_tag LOCUS_00130 13542 12199 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_00130 15170 13599 gene locus_tag LOCUS_00140 15170 13599 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_00140 16884 15508 gene locus_tag LOCUS_00150 16884 15508 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_00150 >Feature sequence002 <1 2649 gene locus_tag LOCUS_00160 <1 2649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113821.1:phosphoribosylformylglycinamidine synthase 2753 3583 gene locus_tag LOCUS_00170 2753 3583 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333289.1 protein_id gnl|my_center|LOCUS_00170 4011 5198 gene locus_tag LOCUS_00180 4011 5198 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_00180 5185 6372 gene locus_tag LOCUS_00190 5185 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_00190 6369 7439 gene locus_tag LOCUS_00200 6369 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119567.1 protein_id gnl|my_center|LOCUS_00200 8322 7555 gene locus_tag LOCUS_00210 8322 7555 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263747.1 protein_id gnl|my_center|LOCUS_00210 9929 8349 gene locus_tag LOCUS_00220 9929 8349 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401279.1 protein_id gnl|my_center|LOCUS_00220 10140 11333 gene locus_tag LOCUS_00230 gene purT 10140 11333 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036337.1 protein_id gnl|my_center|LOCUS_00230 12170 11442 gene locus_tag LOCUS_00240 12170 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 13610 12228 gene locus_tag LOCUS_00250 13610 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 13798 14943 gene locus_tag LOCUS_00260 13798 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 14961 16205 gene locus_tag LOCUS_00270 14961 16205 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120898.1 protein_id gnl|my_center|LOCUS_00270 >Feature sequence003 <1 928 gene locus_tag LOCUS_00280 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046033636.1:glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase 2064 1210 gene locus_tag LOCUS_00290 gene purU 2064 1210 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406331.1 protein_id gnl|my_center|LOCUS_00290 2179 2778 gene locus_tag LOCUS_00300 2179 2778 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_00300 2791 3333 gene locus_tag LOCUS_00310 2791 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 3713 4339 gene locus_tag LOCUS_00320 gene infC 3713 4339 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_00320 4561 5817 gene locus_tag LOCUS_00330 4561 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 5874 6482 gene locus_tag LOCUS_00340 5874 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 6496 7500 gene locus_tag LOCUS_00350 6496 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 10350 7531 gene locus_tag LOCUS_00360 gene gcvP 10350 7531 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_00360 10627 10869 gene locus_tag LOCUS_00370 10627 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 11539 11186 gene locus_tag LOCUS_00380 11539 11186 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_00380 12715 11543 gene locus_tag LOCUS_00390 gene mnmA 12715 11543 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948825.1 protein_id gnl|my_center|LOCUS_00390 13177 12743 gene locus_tag LOCUS_00400 13177 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 13800 13174 gene locus_tag LOCUS_00410 13800 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 14717 13797 gene locus_tag LOCUS_00420 gene cyoE 14717 13797 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_00420 15823 14714 gene locus_tag LOCUS_00430 15823 14714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 <16444 15915 gene locus_tag LOCUS_00440 <16444 15915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036891713.1:cytochrome c oxidase subunit II >Feature sequence004 1358 525 gene locus_tag LOCUS_00450 gene folP 1358 525 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225731.1 protein_id gnl|my_center|LOCUS_00450 2188 1355 gene locus_tag LOCUS_00460 2188 1355 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_00460 2336 3310 gene locus_tag LOCUS_00470 gene trpS 2336 3310 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_00470 3446 3643 gene locus_tag LOCUS_00480 3446 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 4666 4208 gene locus_tag LOCUS_00490 gene gcvH 4666 4208 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895104.1 protein_id gnl|my_center|LOCUS_00490 6706 4709 gene locus_tag LOCUS_00500 6706 4709 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530640.1 protein_id gnl|my_center|LOCUS_00500 7745 6714 gene locus_tag LOCUS_00510 7745 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 8674 7742 gene locus_tag LOCUS_00520 8674 7742 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222926.1 protein_id gnl|my_center|LOCUS_00520 11009 9018 gene locus_tag LOCUS_00530 11009 9018 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_00530 11150 12298 gene locus_tag LOCUS_00540 11150 12298 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055867.1 protein_id gnl|my_center|LOCUS_00540 12376 13662 gene locus_tag LOCUS_00550 12376 13662 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266835.1 protein_id gnl|my_center|LOCUS_00550 13901 14938 gene locus_tag LOCUS_00560 gene recA 13901 14938 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_00560 >Feature sequence005 1849 185 gene locus_tag LOCUS_00570 1849 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 2185 4371 gene locus_tag LOCUS_00580 2185 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 4747 4346 gene locus_tag LOCUS_00590 4747 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 4951 5820 gene locus_tag LOCUS_00600 4951 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 9538 6155 gene locus_tag LOCUS_00610 9538 6155 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_00610 9726 11075 gene locus_tag LOCUS_00620 9726 11075 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_00620 14231 11133 gene locus_tag LOCUS_00630 14231 11133 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967470.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence006 <1 2791 gene locus_tag LOCUS_00640 <1 2791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123065.1:exo-alpha-sialidase 2796 3728 gene locus_tag LOCUS_00650 2796 3728 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798219.1 protein_id gnl|my_center|LOCUS_00650 3725 4783 gene locus_tag LOCUS_00660 3725 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 4780 5505 gene locus_tag LOCUS_00670 gene hpaI 4780 5505 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384097.1 protein_id gnl|my_center|LOCUS_00670 8128 5576 gene locus_tag LOCUS_00680 8128 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 <13683 8132 gene locus_tag LOCUS_00690 <13683 8132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169313288.1:Calx-beta domain-containing protein >Feature sequence007 <1 1442 gene locus_tag LOCUS_00700 <1 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118167.1:PQQ-binding-like beta-propeller repeat protein 1461 2192 gene locus_tag LOCUS_00710 1461 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 2295 2369 gene locus_tag LOCUS_t00010 2295 2369 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2401 2703 gene locus_tag LOCUS_00720 2401 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 5349 2779 gene locus_tag LOCUS_00730 5349 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 7740 5383 gene locus_tag LOCUS_00740 7740 5383 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922898.1 protein_id gnl|my_center|LOCUS_00740 9212 7788 gene locus_tag LOCUS_00750 9212 7788 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_00750 9452 10024 gene locus_tag LOCUS_00760 9452 10024 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_00760 10586 10053 gene locus_tag LOCUS_00770 10586 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 10710 11519 gene locus_tag LOCUS_00780 10710 11519 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_00780 12672 11695 gene locus_tag LOCUS_00790 12672 11695 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036484.1 protein_id gnl|my_center|LOCUS_00790 >Feature sequence008 728 507 gene locus_tag LOCUS_00800 728 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 1415 780 gene locus_tag LOCUS_00810 1415 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 4542 1429 gene locus_tag LOCUS_00820 4542 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 5836 4961 gene locus_tag LOCUS_00830 5836 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 6610 6068 gene locus_tag LOCUS_00840 6610 6068 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_00840 7411 6719 gene locus_tag LOCUS_00850 7411 6719 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_00850 7427 8179 gene locus_tag LOCUS_00860 7427 8179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193988.1 protein_id gnl|my_center|LOCUS_00860 8163 10778 gene locus_tag LOCUS_00870 8163 10778 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_00870 12676 10850 gene locus_tag LOCUS_00880 12676 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 <13342 12779 gene locus_tag LOCUS_00890 <13342 12779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390013.1:AI-2E family transporter >Feature sequence009 934 251 gene locus_tag LOCUS_00900 934 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 1778 966 gene locus_tag LOCUS_00910 1778 966 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902785.1 protein_id gnl|my_center|LOCUS_00910 3102 1834 gene locus_tag LOCUS_00920 gene fabF 3102 1834 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_00920 4517 3213 gene locus_tag LOCUS_00930 4517 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 5125 4517 gene locus_tag LOCUS_00940 gene ruvA 5125 4517 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694351.1 protein_id gnl|my_center|LOCUS_00940 5240 5746 gene locus_tag LOCUS_00950 5240 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 5957 7390 gene locus_tag LOCUS_00960 5957 7390 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_00960 7503 8825 gene locus_tag LOCUS_00970 7503 8825 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_00970 8861 9457 gene locus_tag LOCUS_00980 8861 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 9513 10760 gene locus_tag LOCUS_00990 9513 10760 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_00990 10873 11997 gene locus_tag LOCUS_01000 10873 11997 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_01000 12108 12485 gene locus_tag LOCUS_01010 12108 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 12562 13098 gene locus_tag LOCUS_01020 gene sufT 12562 13098 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence010 577 1683 gene locus_tag LOCUS_01030 577 1683 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388654.1 protein_id gnl|my_center|LOCUS_01030 1738 2766 gene locus_tag LOCUS_01040 1738 2766 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388653.1 protein_id gnl|my_center|LOCUS_01040 2859 4283 gene locus_tag LOCUS_01050 2859 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 5002 4427 gene locus_tag LOCUS_01060 5002 4427 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388648.1 protein_id gnl|my_center|LOCUS_01060 5661 5086 gene locus_tag LOCUS_01070 5661 5086 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388649.1 protein_id gnl|my_center|LOCUS_01070 6237 5782 gene locus_tag LOCUS_01080 6237 5782 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975175.1 protein_id gnl|my_center|LOCUS_01080 7220 6330 gene locus_tag LOCUS_01090 7220 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 7406 8287 gene locus_tag LOCUS_01100 7406 8287 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259407.1 protein_id gnl|my_center|LOCUS_01100 8287 9468 gene locus_tag LOCUS_01110 8287 9468 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_01110 9495 10787 gene locus_tag LOCUS_01120 9495 10787 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986831.1 protein_id gnl|my_center|LOCUS_01120 11095 12678 gene locus_tag LOCUS_01130 11095 12678 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_01130 >Feature sequence011 397 1119 gene locus_tag LOCUS_01140 397 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 1220 2242 gene locus_tag LOCUS_01150 1220 2242 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_01150 2291 3730 gene locus_tag LOCUS_01160 2291 3730 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_01160 3727 5805 gene locus_tag LOCUS_01170 3727 5805 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_01170 6140 6403 gene locus_tag LOCUS_01180 6140 6403 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769718.1 protein_id gnl|my_center|LOCUS_01180 7913 6621 gene locus_tag LOCUS_01190 7913 6621 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_01190 8832 7945 gene locus_tag LOCUS_01200 8832 7945 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_01200 9048 10364 gene locus_tag LOCUS_01210 9048 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 10885 11877 gene locus_tag LOCUS_01220 10885 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 11953 12744 gene locus_tag LOCUS_01230 11953 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 >Feature sequence012 445 122 gene locus_tag LOCUS_01240 445 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 668 435 gene locus_tag LOCUS_01250 668 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 805 1374 gene locus_tag LOCUS_01260 805 1374 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 protein_id gnl|my_center|LOCUS_01260 5247 1501 gene locus_tag LOCUS_01270 5247 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 5309 5782 gene locus_tag LOCUS_01280 gene ruvX 5309 5782 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_01280 5779 6561 gene locus_tag LOCUS_01290 gene truA 5779 6561 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888918.1 protein_id gnl|my_center|LOCUS_01290 7341 6640 gene locus_tag LOCUS_01300 7341 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 8860 7475 gene locus_tag LOCUS_01310 8860 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 9759 8947 gene locus_tag LOCUS_01320 9759 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 9819 10658 gene locus_tag LOCUS_01330 gene folP 9819 10658 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_01330 10655 11437 gene locus_tag LOCUS_01340 gene cdaA 10655 11437 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_01340 11430 11567 gene locus_tag LOCUS_01350 11430 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 >Feature sequence013 <1 978 gene locus_tag LOCUS_01360 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616105.1:DUF1080 domain-containing protein 1047 2381 gene locus_tag LOCUS_01370 1047 2381 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_01370 2545 3639 gene locus_tag LOCUS_01380 2545 3639 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_01380 4400 3690 gene locus_tag LOCUS_01390 4400 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 4692 5834 gene locus_tag LOCUS_01400 4692 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 7185 6022 gene locus_tag LOCUS_01410 7185 6022 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_01410 8481 7318 gene locus_tag LOCUS_01420 8481 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 8795 10309 gene locus_tag LOCUS_01430 8795 10309 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence014 >Feature sequence015 519 3122 gene locus_tag LOCUS_01440 519 3122 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_01440 3130 4431 gene locus_tag LOCUS_01450 3130 4431 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_01450 4484 5791 gene locus_tag LOCUS_01460 4484 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5788 6372 gene locus_tag LOCUS_01470 5788 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 8696 6447 gene locus_tag LOCUS_01480 8696 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 11265 8680 gene locus_tag LOCUS_01490 11265 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence016 550 1752 gene locus_tag LOCUS_01500 gene eboE 550 1752 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_01500 1832 3235 gene locus_tag LOCUS_01510 1832 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 4774 3341 gene locus_tag LOCUS_01520 4774 3341 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_01520 4947 5804 gene locus_tag LOCUS_01530 4947 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 6042 7067 gene locus_tag LOCUS_01540 6042 7067 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_01540 8291 7104 gene locus_tag LOCUS_01550 8291 7104 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_01550 8653 8288 gene locus_tag LOCUS_01560 8653 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 9285 8737 gene locus_tag LOCUS_01570 9285 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 9419 9682 gene locus_tag LOCUS_01580 9419 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 9976 9809 gene locus_tag LOCUS_01590 9976 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 >Feature sequence017 1773 772 gene locus_tag LOCUS_01600 1773 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 2519 2214 gene locus_tag LOCUS_01610 2519 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 4104 2749 gene locus_tag LOCUS_01620 4104 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 5472 4240 gene locus_tag LOCUS_01630 5472 4240 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_01630 6147 5533 gene locus_tag LOCUS_01640 6147 5533 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067253.1 protein_id gnl|my_center|LOCUS_01640 7353 6232 gene locus_tag LOCUS_01650 7353 6232 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_01650 7259 7456 gene locus_tag LOCUS_01660 7259 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 7669 8130 gene locus_tag LOCUS_01670 7669 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 8370 9341 gene locus_tag LOCUS_01680 8370 9341 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_01680 9338 9910 gene locus_tag LOCUS_01690 9338 9910 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_01690 <10873 9957 gene locus_tag LOCUS_01700 <10873 9957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403695.1:bacillithiol biosynthesis deacetylase BshB1 >Feature sequence018 931 791 gene locus_tag LOCUS_01710 931 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 1422 2381 gene locus_tag LOCUS_01720 1422 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 2873 2517 gene locus_tag LOCUS_01730 2873 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 2835 3620 gene locus_tag LOCUS_01740 2835 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3734 6277 gene locus_tag LOCUS_01750 3734 6277 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_01750 6348 7766 gene locus_tag LOCUS_01760 6348 7766 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_01760 8392 8036 gene locus_tag LOCUS_01770 8392 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 9012 8389 gene locus_tag LOCUS_01780 9012 8389 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_01780 9443 10168 gene locus_tag LOCUS_01790 9443 10168 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence019 1655 1119 gene locus_tag LOCUS_01800 1655 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 3421 1985 gene locus_tag LOCUS_01810 gene pyk 3421 1985 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122699.1 protein_id gnl|my_center|LOCUS_01810 4038 3703 gene locus_tag LOCUS_01820 4038 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4244 5089 gene locus_tag LOCUS_01830 4244 5089 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529258.1 protein_id gnl|my_center|LOCUS_01830 6221 5781 gene locus_tag LOCUS_01840 6221 5781 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 protein_id gnl|my_center|LOCUS_01840 6357 7652 gene locus_tag LOCUS_01850 gene purB 6357 7652 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_01850 7896 9290 gene locus_tag LOCUS_01860 7896 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 >Feature sequence020 1594 3249 gene locus_tag LOCUS_01870 1594 3249 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_01870 4297 3296 gene locus_tag LOCUS_01880 gene galE 4297 3296 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404514.1 protein_id gnl|my_center|LOCUS_01880 4425 4985 gene locus_tag LOCUS_01890 4425 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 5389 7146 gene locus_tag LOCUS_01900 5389 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 7143 8105 gene locus_tag LOCUS_01910 7143 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 8129 9547 gene locus_tag LOCUS_01920 8129 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 <10476 9619 gene locus_tag LOCUS_01930 <10476 9619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002285916.1:leucine--tRNA ligase >Feature sequence021 <1 3262 gene locus_tag LOCUS_01940 <1 3262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121181.1:L-sorbosone dehydrogenase 5034 3331 gene locus_tag LOCUS_01950 gene rfbH 5034 3331 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_01950 6224 5109 gene locus_tag LOCUS_01960 gene rfbG 6224 5109 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_01960 6952 6239 gene locus_tag LOCUS_01970 gene rfbF 6952 6239 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_01970 7746 7213 gene locus_tag LOCUS_01980 7746 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 10108 7901 gene locus_tag LOCUS_01990 10108 7901 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104510.1 protein_id gnl|my_center|LOCUS_01990 >Feature sequence022 117 971 gene locus_tag LOCUS_02000 117 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 985 1497 gene locus_tag LOCUS_02010 985 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 2329 1535 gene locus_tag LOCUS_02020 2329 1535 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_02020 3373 2342 gene locus_tag LOCUS_02030 3373 2342 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_02030 3655 4620 gene locus_tag LOCUS_02040 gene manA 3655 4620 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_02040 4659 5651 gene locus_tag LOCUS_02050 4659 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 5942 6934 gene locus_tag LOCUS_02060 5942 6934 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_02060 6980 7375 gene locus_tag LOCUS_02070 gene rplQ 6980 7375 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258259.1 protein_id gnl|my_center|LOCUS_02070 7650 9566 gene locus_tag LOCUS_02080 7650 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence023 576 1715 gene locus_tag LOCUS_02090 576 1715 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022331.1 protein_id gnl|my_center|LOCUS_02090 1940 4069 gene locus_tag LOCUS_02100 1940 4069 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_02100 4419 4652 gene locus_tag LOCUS_02110 4419 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402859.1 protein_id gnl|my_center|LOCUS_02110 5325 5401 gene locus_tag LOCUS_t00020 5325 5401 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5693 6379 gene locus_tag LOCUS_02120 gene lexA 5693 6379 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719150.1 protein_id gnl|my_center|LOCUS_02120 6404 7093 gene locus_tag LOCUS_02130 6404 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 7210 8742 gene locus_tag LOCUS_02140 7210 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 >Feature sequence024 <1 567 gene locus_tag LOCUS_02150 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005894436.1:MotA/TolQ/ExbB proton channel family protein 592 1005 gene locus_tag LOCUS_02160 592 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 1002 1550 gene locus_tag LOCUS_02170 gene def 1002 1550 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528469.1 protein_id gnl|my_center|LOCUS_02170 1722 2906 gene locus_tag LOCUS_02180 1722 2906 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_02180 3033 4352 gene locus_tag LOCUS_02190 3033 4352 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973141.1 protein_id gnl|my_center|LOCUS_02190 4349 5542 gene locus_tag LOCUS_02200 4349 5542 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189296.1 protein_id gnl|my_center|LOCUS_02200 5686 7224 gene locus_tag LOCUS_02210 5686 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 8972 7374 gene locus_tag LOCUS_02220 8972 7374 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_02220 <10119 9161 gene locus_tag LOCUS_02230 <10119 9161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368549.1:3-dehydroquinate synthase >Feature sequence025 400 170 gene locus_tag LOCUS_02240 400 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 519 1484 gene locus_tag LOCUS_02250 519 1484 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_02250 1529 2065 gene locus_tag LOCUS_02260 1529 2065 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_02260 2356 3549 gene locus_tag LOCUS_02270 2356 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 3577 4761 gene locus_tag LOCUS_02280 3577 4761 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_02280 5024 6985 gene locus_tag LOCUS_02290 gene acs 5024 6985 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_02290 7060 7488 gene locus_tag LOCUS_02300 7060 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 8360 7629 gene locus_tag LOCUS_02310 8360 7629 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943290.1 protein_id gnl|my_center|LOCUS_02310 9156 8350 gene locus_tag LOCUS_02320 9156 8350 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943289.1 protein_id gnl|my_center|LOCUS_02320 <10023 9169 gene locus_tag LOCUS_02330 <10023 9169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943288.1:transporter substrate-binding domain-containing protein >Feature sequence026 380 667 gene locus_tag LOCUS_02340 380 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 825 1331 gene locus_tag LOCUS_02350 825 1331 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_02350 1385 2557 gene locus_tag LOCUS_02360 1385 2557 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050828.1 protein_id gnl|my_center|LOCUS_02360 2692 4110 gene locus_tag LOCUS_02370 2692 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 4230 4727 gene locus_tag LOCUS_02380 4230 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6362 4845 gene locus_tag LOCUS_02390 6362 4845 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402000.1 protein_id gnl|my_center|LOCUS_02390 6716 9511 gene locus_tag LOCUS_02400 6716 9511 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119753.1 protein_id gnl|my_center|LOCUS_02400 >Feature sequence027 1955 2554 gene locus_tag LOCUS_02410 gene yihX 1955 2554 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209011.1 protein_id gnl|my_center|LOCUS_02410 2977 3363 gene locus_tag LOCUS_02420 2977 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 3729 3316 gene locus_tag LOCUS_02430 3729 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 5194 3806 gene locus_tag LOCUS_02440 5194 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 5760 5461 gene locus_tag LOCUS_02450 5760 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 6031 5792 gene locus_tag LOCUS_02460 6031 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 6233 5970 gene locus_tag LOCUS_02470 6233 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 6651 6271 gene locus_tag LOCUS_02480 6651 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 7834 6680 gene locus_tag LOCUS_02490 7834 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 7882 8115 gene locus_tag LOCUS_02500 7882 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 9995 8217 gene locus_tag LOCUS_02510 9995 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence028 831 97 gene locus_tag LOCUS_02520 831 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 2253 883 gene locus_tag LOCUS_02530 gene murD 2253 883 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_02530 3377 2250 gene locus_tag LOCUS_02540 gene mraY 3377 2250 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_02540 4738 3377 gene locus_tag LOCUS_02550 4738 3377 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_02550 6246 4753 gene locus_tag LOCUS_02560 6246 4753 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_02560 6683 6243 gene locus_tag LOCUS_02570 6683 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02570 8002 6671 gene locus_tag LOCUS_02580 8002 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02580 8413 8036 gene locus_tag LOCUS_02590 8413 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 9450 8452 gene locus_tag LOCUS_02600 gene rsmH 9450 8452 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence029 <1 5026 gene locus_tag LOCUS_02610 <1 5026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein 5194 8403 gene locus_tag LOCUS_02620 5194 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence030 46 591 gene locus_tag LOCUS_02630 gene rpsE 46 591 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_02630 605 1054 gene locus_tag LOCUS_02640 gene rplO 605 1054 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869910.1 protein_id gnl|my_center|LOCUS_02640 1136 2635 gene locus_tag LOCUS_02650 gene secY 1136 2635 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_02650 2636 3412 gene locus_tag LOCUS_02660 gene map 2636 3412 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_02660 3924 4301 gene locus_tag LOCUS_02670 gene rpsM 3924 4301 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_02670 4328 4945 gene locus_tag LOCUS_02680 4328 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 4981 5592 gene locus_tag LOCUS_02690 gene rpsD 4981 5592 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_02690 5651 7429 gene locus_tag LOCUS_02700 5651 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 7544 8359 gene locus_tag LOCUS_02710 gene hpnD 7544 8359 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_02710 8666 8887 gene locus_tag LOCUS_02720 8666 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 >Feature sequence031 788 1375 gene locus_tag LOCUS_02730 788 1375 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_02730 1381 2334 gene locus_tag LOCUS_02740 gene fmt 1381 2334 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_02740 2367 3191 gene locus_tag LOCUS_02750 2367 3191 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333051.1 protein_id gnl|my_center|LOCUS_02750 3202 4026 gene locus_tag LOCUS_02760 gene larE 3202 4026 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_02760 7613 4074 gene locus_tag LOCUS_02770 7613 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 9004 7730 gene locus_tag LOCUS_02780 gene hflX 9004 7730 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413984.1 protein_id gnl|my_center|LOCUS_02780 <9576 9001 gene locus_tag LOCUS_02790 <9576 9001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000261262.1:peptide-methionine (R)-S-oxide reductase MsrB >Feature sequence032 2499 370 gene locus_tag LOCUS_02800 2499 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 3259 2702 gene locus_tag LOCUS_02810 3259 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 3485 4729 gene locus_tag LOCUS_02820 3485 4729 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_02820 4944 5576 gene locus_tag LOCUS_02830 4944 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 6265 5594 gene locus_tag LOCUS_02840 6265 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 6607 6344 gene locus_tag LOCUS_02850 6607 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 6695 7912 gene locus_tag LOCUS_02860 6695 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 9573 8347 gene locus_tag LOCUS_02870 9573 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence033 1418 2704 gene locus_tag LOCUS_02880 1418 2704 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120796.1 protein_id gnl|my_center|LOCUS_02880 2816 5965 gene locus_tag LOCUS_02890 2816 5965 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_02890 5970 7442 gene locus_tag LOCUS_02900 5970 7442 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_02900 7505 7690 gene locus_tag LOCUS_02910 7505 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 7722 8996 gene locus_tag LOCUS_02920 7722 8996 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence034 4749 5129 gene locus_tag LOCUS_02930 4749 5129 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_02930 5392 6600 gene locus_tag LOCUS_02940 5392 6600 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_02940 6849 8465 gene locus_tag LOCUS_02950 6849 8465 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_02950 >Feature sequence035 516 677 gene locus_tag LOCUS_02960 516 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 1003 764 gene locus_tag LOCUS_02970 1003 764 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_02970 3702 1090 gene locus_tag LOCUS_02980 3702 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 3971 5755 gene locus_tag LOCUS_02990 3971 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 5870 6361 gene locus_tag LOCUS_03000 gene nrdR 5870 6361 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_03000 6358 6918 gene locus_tag LOCUS_03010 6358 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 7030 7368 gene locus_tag LOCUS_03020 7030 7368 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_03020 7798 7280 gene locus_tag LOCUS_03030 7798 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 8483 7860 gene locus_tag LOCUS_03040 8483 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 8869 8516 gene locus_tag LOCUS_03050 gene rplS 8869 8516 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence036 <1 679 gene locus_tag LOCUS_03060 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921574.1:PSD1 and planctomycete cytochrome C domain-containing protein 689 2083 gene locus_tag LOCUS_03070 689 2083 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_03070 2137 4947 gene locus_tag LOCUS_03080 2137 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 4954 6342 gene locus_tag LOCUS_03090 4954 6342 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_03090 6371 7390 gene locus_tag LOCUS_03100 gene doeB 6371 7390 CDS product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014530717.1 protein_id gnl|my_center|LOCUS_03100 7387 8646 gene locus_tag LOCUS_03110 7387 8646 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822181.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence037 1369 2550 gene locus_tag LOCUS_03120 1369 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5154 2614 gene locus_tag LOCUS_03130 5154 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 5960 5208 gene locus_tag LOCUS_03140 5960 5208 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126006.1 protein_id gnl|my_center|LOCUS_03140 6990 6031 gene locus_tag LOCUS_03150 6990 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 7064 8413 gene locus_tag LOCUS_03160 7064 8413 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_03160 8507 8980 gene locus_tag LOCUS_03170 8507 8980 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_03170 >Feature sequence038 1638 2564 gene locus_tag LOCUS_03180 1638 2564 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888469.1 protein_id gnl|my_center|LOCUS_03180 3034 2609 gene locus_tag LOCUS_03190 3034 2609 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_03190 3400 4203 gene locus_tag LOCUS_03200 3400 4203 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_03200 4322 6481 gene locus_tag LOCUS_03210 4322 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 7906 6527 gene locus_tag LOCUS_03220 7906 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 8330 7827 gene locus_tag LOCUS_03230 8330 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 9023 8523 gene locus_tag LOCUS_03240 gene blc 9023 8523 CDS product outer membrane lipoprotein Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175561.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence039 <1 756 gene locus_tag LOCUS_03250 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121153.1:DUF1552 domain-containing protein 1037 3553 gene locus_tag LOCUS_03260 1037 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 3734 3522 gene locus_tag LOCUS_03270 3734 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 5167 3779 gene locus_tag LOCUS_03280 5167 3779 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_03280 5828 5391 gene locus_tag LOCUS_03290 5828 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03290 8718 5719 gene locus_tag LOCUS_03300 8718 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03300 >Feature sequence040 293 6118 gene locus_tag LOCUS_03310 293 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 6204 6944 gene locus_tag LOCUS_03320 6204 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 7066 8868 gene locus_tag LOCUS_03330 7066 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence041 112 3135 gene locus_tag LOCUS_03340 112 3135 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_03340 4038 3241 gene locus_tag LOCUS_03350 4038 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03350 4355 4020 gene locus_tag LOCUS_03360 4355 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03360 5971 4496 gene locus_tag LOCUS_03370 5971 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 6151 7209 gene locus_tag LOCUS_03380 6151 7209 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_03380 7332 7802 gene locus_tag LOCUS_03390 gene accB 7332 7802 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence042 242 577 gene locus_tag LOCUS_03400 242 577 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216764.1 protein_id gnl|my_center|LOCUS_03400 675 2711 gene locus_tag LOCUS_03410 675 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 2594 3487 gene locus_tag LOCUS_03420 2594 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 3477 4928 gene locus_tag LOCUS_03430 3477 4928 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_03430 4947 5885 gene locus_tag LOCUS_03440 4947 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812972.1 protein_id gnl|my_center|LOCUS_03440 6489 6052 gene locus_tag LOCUS_03450 6489 6052 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_03450 7025 6498 gene locus_tag LOCUS_03460 7025 6498 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_03460 7355 7032 gene locus_tag LOCUS_03470 7355 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 8629 7454 gene locus_tag LOCUS_03480 8629 7454 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence043 837 439 gene locus_tag LOCUS_03490 837 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 2087 855 gene locus_tag LOCUS_03500 2087 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2259 2846 gene locus_tag LOCUS_03510 2259 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 2873 4138 gene locus_tag LOCUS_03520 gene purD 2873 4138 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_03520 4181 5245 gene locus_tag LOCUS_03530 4181 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5356 6123 gene locus_tag LOCUS_03540 5356 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 6172 6708 gene locus_tag LOCUS_03550 6172 6708 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167727.1 protein_id gnl|my_center|LOCUS_03550 6711 7559 gene locus_tag LOCUS_03560 6711 7559 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975595.1 protein_id gnl|my_center|LOCUS_03560 >Feature sequence044 <1 3723 gene locus_tag LOCUS_03570 <1 3723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028520.1:formylglycine-generating enzyme family protein 8051 3882 gene locus_tag LOCUS_03580 8051 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence045 <1 2320 gene locus_tag LOCUS_03590 <1 2320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008672241.1:M28 family peptidase 2381 3268 gene locus_tag LOCUS_03600 2381 3268 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090906.1 protein_id gnl|my_center|LOCUS_03600 3285 4487 gene locus_tag LOCUS_03610 3285 4487 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_03610 5911 5117 gene locus_tag LOCUS_03620 5911 5117 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266284.1 protein_id gnl|my_center|LOCUS_03620 8704 6272 gene locus_tag LOCUS_03630 8704 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence046 273 695 gene locus_tag LOCUS_03640 273 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 788 1717 gene locus_tag LOCUS_03650 788 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 1760 2968 gene locus_tag LOCUS_03660 gene cruC 1760 2968 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_03660 3040 3501 gene locus_tag LOCUS_03670 3040 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3630 5393 gene locus_tag LOCUS_03680 gene argS 3630 5393 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_03680 6500 5733 gene locus_tag LOCUS_03690 6500 5733 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118984.1 protein_id gnl|my_center|LOCUS_03690 6815 8101 gene locus_tag LOCUS_03700 6815 8101 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence047 567 2063 gene locus_tag LOCUS_03710 567 2063 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_03710 2077 3321 gene locus_tag LOCUS_03720 gene rsmB 2077 3321 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_03720 4668 3388 gene locus_tag LOCUS_03730 4668 3388 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144136.1 protein_id gnl|my_center|LOCUS_03730 4804 5595 gene locus_tag LOCUS_03740 gene hisF 4804 5595 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_03740 5607 7190 gene locus_tag LOCUS_03750 5607 7190 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144137.1 protein_id gnl|my_center|LOCUS_03750 7183 8538 gene locus_tag LOCUS_03760 7183 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence048 2828 1785 gene locus_tag LOCUS_03770 gene rhaS 2828 1785 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978052.1 protein_id gnl|my_center|LOCUS_03770 3865 2828 gene locus_tag LOCUS_03780 3865 2828 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371220.1 protein_id gnl|my_center|LOCUS_03780 4798 3869 gene locus_tag LOCUS_03790 gene lsrC 4798 3869 CDS product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911130.1 protein_id gnl|my_center|LOCUS_03790 6344 4806 gene locus_tag LOCUS_03800 6344 4806 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 protein_id gnl|my_center|LOCUS_03800 7693 6371 gene locus_tag LOCUS_03810 7693 6371 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118020.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence049 3506 1086 gene locus_tag LOCUS_03820 3506 1086 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_03820 4571 3777 gene locus_tag LOCUS_03830 4571 3777 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 protein_id gnl|my_center|LOCUS_03830 4651 5199 gene locus_tag LOCUS_03840 gene ruvC 4651 5199 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084351.1 protein_id gnl|my_center|LOCUS_03840 5199 5876 gene locus_tag LOCUS_03850 gene lipB 5199 5876 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_03850 6620 5817 gene locus_tag LOCUS_03860 6620 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 7387 6710 gene locus_tag LOCUS_03870 7387 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 8185 7433 gene locus_tag LOCUS_03880 8185 7433 CDS product UDP-galactose-lipid carrier transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427389.1 protein_id gnl|my_center|LOCUS_03880 8461 8192 gene locus_tag LOCUS_03890 8461 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence050 186 839 gene locus_tag LOCUS_03900 gene pdxH 186 839 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112518.1 protein_id gnl|my_center|LOCUS_03900 1012 4218 gene locus_tag LOCUS_03910 1012 4218 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_03910 4236 5714 gene locus_tag LOCUS_03920 4236 5714 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence051 <1 639 gene locus_tag LOCUS_03930 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460180.1:uroporphyrinogen-III C-methyltransferase 2530 692 gene locus_tag LOCUS_03940 2530 692 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_03940 3391 2606 gene locus_tag LOCUS_03950 3391 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 3562 4170 gene locus_tag LOCUS_03960 3562 4170 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_03960 5228 4227 gene locus_tag LOCUS_03970 5228 4227 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_03970 5892 5233 gene locus_tag LOCUS_03980 gene plsY 5892 5233 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056950.1 protein_id gnl|my_center|LOCUS_03980 6725 5976 gene locus_tag LOCUS_03990 6725 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 <8473 6793 gene locus_tag LOCUS_04000 <8473 6793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530052.1:thioredoxin family protein >Feature sequence052 520 1152 gene locus_tag LOCUS_04010 520 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 1149 1766 gene locus_tag LOCUS_04020 1149 1766 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_04020 3315 1945 gene locus_tag LOCUS_04030 3315 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5771 3318 gene locus_tag LOCUS_04040 5771 3318 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_04040 8301 5779 gene locus_tag LOCUS_04050 8301 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence053 <1 2770 gene locus_tag LOCUS_04060 <1 2770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105494.1:ATP-dependent RNA helicase HrpA 6827 2832 gene locus_tag LOCUS_04070 6827 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 8261 6894 gene locus_tag LOCUS_04080 8261 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence054 1756 3465 gene locus_tag LOCUS_04090 1756 3465 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_04090 3486 6935 gene locus_tag LOCUS_04100 3486 6935 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence055 <1 764 gene locus_tag LOCUS_04110 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706805.1:FKBP-type peptidyl-prolyl cis-trans isomerase 989 1420 gene locus_tag LOCUS_04120 989 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 1637 3106 gene locus_tag LOCUS_04130 1637 3106 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963862.1 protein_id gnl|my_center|LOCUS_04130 4025 3249 gene locus_tag LOCUS_04140 4025 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 4975 6861 gene locus_tag LOCUS_04150 4975 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04150 >Feature sequence056 851 621 gene locus_tag LOCUS_04160 gene csrA 851 621 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965507.1 protein_id gnl|my_center|LOCUS_04160 1333 845 gene locus_tag LOCUS_04170 gene fliW 1333 845 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156273801.1 protein_id gnl|my_center|LOCUS_04170 1761 1519 gene locus_tag LOCUS_04180 gene acpP 1761 1519 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_04180 2920 1934 gene locus_tag LOCUS_04190 2920 1934 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_04190 3977 3063 gene locus_tag LOCUS_04200 3977 3063 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_04200 4117 5037 gene locus_tag LOCUS_04210 4117 5037 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385202.1 protein_id gnl|my_center|LOCUS_04210 5041 5943 gene locus_tag LOCUS_04220 5041 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6041 6814 gene locus_tag LOCUS_04230 6041 6814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_04230 6811 7608 gene locus_tag LOCUS_04240 6811 7608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_04240 7608 8084 gene locus_tag LOCUS_04250 gene mlaD 7608 8084 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545373.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence057 266 54 gene locus_tag LOCUS_04260 266 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 160 1440 gene locus_tag LOCUS_04270 160 1440 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_04270 1964 1503 gene locus_tag LOCUS_04280 gene rppH 1964 1503 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071540.1 protein_id gnl|my_center|LOCUS_04280 4513 1988 gene locus_tag LOCUS_04290 4513 1988 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_04290 6372 4594 gene locus_tag LOCUS_04300 6372 4594 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_04300 7619 6738 gene locus_tag LOCUS_04310 gene hisG 7619 6738 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence058 2723 492 gene locus_tag LOCUS_04320 2723 492 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 protein_id gnl|my_center|LOCUS_04320 3392 2808 gene locus_tag LOCUS_04330 3392 2808 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_04330 3790 3596 gene locus_tag LOCUS_04340 3790 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3954 4556 gene locus_tag LOCUS_04350 3954 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 4818 4573 gene locus_tag LOCUS_04360 4818 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5444 4815 gene locus_tag LOCUS_04370 5444 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 7205 5547 gene locus_tag LOCUS_04380 7205 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 7472 8086 gene locus_tag LOCUS_04390 7472 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence059 936 352 gene locus_tag LOCUS_04400 936 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 1146 1847 gene locus_tag LOCUS_04410 1146 1847 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566878.1 protein_id gnl|my_center|LOCUS_04410 1966 3051 gene locus_tag LOCUS_04420 1966 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 3293 3820 gene locus_tag LOCUS_04430 3293 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 3817 4821 gene locus_tag LOCUS_04440 3817 4821 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_04440 4899 7658 gene locus_tag LOCUS_04450 4899 7658 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933216.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence060 <1 2028 gene locus_tag LOCUS_04460 <1 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389244.1:polysaccharide biosynthesis tyrosine autokinase 3527 2397 gene locus_tag LOCUS_04470 3527 2397 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_04470 4804 3830 gene locus_tag LOCUS_04480 4804 3830 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_04480 5813 5052 gene locus_tag LOCUS_04490 5813 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 7664 5862 gene locus_tag LOCUS_04500 7664 5862 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671072.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence061 3817 239 gene locus_tag LOCUS_04510 3817 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4930 3890 gene locus_tag LOCUS_04520 gene rsmH 4930 3890 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_04520 5286 4927 gene locus_tag LOCUS_04530 5286 4927 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_04530 7872 5368 gene locus_tag LOCUS_04540 7872 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence062 230 994 gene locus_tag LOCUS_04550 230 994 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083078.1 protein_id gnl|my_center|LOCUS_04550 1043 1900 gene locus_tag LOCUS_04560 1043 1900 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528568.1 protein_id gnl|my_center|LOCUS_04560 1950 2822 gene locus_tag LOCUS_04570 1950 2822 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 protein_id gnl|my_center|LOCUS_04570 2822 3589 gene locus_tag LOCUS_04580 gene hpaI 2822 3589 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_04580 3655 4941 gene locus_tag LOCUS_04590 3655 4941 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_04590 6298 4958 gene locus_tag LOCUS_04600 gene lysA 6298 4958 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209846.1 protein_id gnl|my_center|LOCUS_04600 7307 6513 gene locus_tag LOCUS_04610 gene tatC 7307 6513 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887452.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence063 2785 1046 gene locus_tag LOCUS_04620 2785 1046 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105560.1 protein_id gnl|my_center|LOCUS_04620 3032 2778 gene locus_tag LOCUS_04630 3032 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 2979 4058 gene locus_tag LOCUS_04640 gene mqnE 2979 4058 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_04640 4055 4885 gene locus_tag LOCUS_04650 4055 4885 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940024.1 protein_id gnl|my_center|LOCUS_04650 5861 5106 gene locus_tag LOCUS_04660 5861 5106 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729648.1 protein_id gnl|my_center|LOCUS_04660 6134 7156 gene locus_tag LOCUS_04670 6134 7156 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803813.1 protein_id gnl|my_center|LOCUS_04670 7167 7691 gene locus_tag LOCUS_04680 7167 7691 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_04680 >Feature sequence064 1 690 gene locus_tag LOCUS_04690 1 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 1003 743 gene locus_tag LOCUS_04700 1003 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 2473 1067 gene locus_tag LOCUS_04710 2473 1067 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_04710 3276 2722 gene locus_tag LOCUS_04720 3276 2722 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_04720 3388 4089 gene locus_tag LOCUS_04730 3388 4089 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_04730 6691 4238 gene locus_tag LOCUS_04740 6691 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 7654 6824 gene locus_tag LOCUS_04750 7654 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760094.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence065 992 2044 gene locus_tag LOCUS_04760 992 2044 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918050.1 protein_id gnl|my_center|LOCUS_04760 4607 2076 gene locus_tag LOCUS_04770 4607 2076 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616124.1 protein_id gnl|my_center|LOCUS_04770 5878 4607 gene locus_tag LOCUS_04780 5878 4607 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123786.1 protein_id gnl|my_center|LOCUS_04780 7567 6287 gene locus_tag LOCUS_04790 7567 6287 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence066 <1 5141 gene locus_tag LOCUS_04800 <1 5141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein >Feature sequence067 119 1528 gene locus_tag LOCUS_04810 119 1528 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_04810 1204 1285 gene locus_tag LOCUS_t00030 1204 1285 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1667 2188 gene locus_tag LOCUS_04820 1667 2188 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_04820 2662 3651 gene locus_tag LOCUS_04830 2662 3651 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_04830 3676 4578 gene locus_tag LOCUS_04840 3676 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 4575 5201 gene locus_tag LOCUS_04850 4575 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 5198 6211 gene locus_tag LOCUS_04860 5198 6211 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence068 >Feature sequence069 2863 923 gene locus_tag LOCUS_04870 gene flgK 2863 923 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086484.1 protein_id gnl|my_center|LOCUS_04870 3397 2915 gene locus_tag LOCUS_04880 3397 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3881 3468 gene locus_tag LOCUS_04890 3881 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4974 3886 gene locus_tag LOCUS_04900 4974 3886 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_04900 5746 4994 gene locus_tag LOCUS_04910 5746 4994 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545249.1 protein_id gnl|my_center|LOCUS_04910 6533 5718 gene locus_tag LOCUS_04920 6533 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 7369 6581 gene locus_tag LOCUS_04930 gene flgG 7369 6581 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence070 1343 54 gene locus_tag LOCUS_04940 1343 54 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_04940 1982 1350 gene locus_tag LOCUS_04950 1982 1350 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_04950 3098 2031 gene locus_tag LOCUS_04960 3098 2031 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_04960 5330 3177 gene locus_tag LOCUS_04970 5330 3177 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943867.1 protein_id gnl|my_center|LOCUS_04970 5858 5496 gene locus_tag LOCUS_04980 5858 5496 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_04980 6620 5886 gene locus_tag LOCUS_04990 gene pyrF 6620 5886 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039203.1 protein_id gnl|my_center|LOCUS_04990 <7507 6705 gene locus_tag LOCUS_05000 <7507 6705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788605.1:undecaprenyl-phosphate glucose phosphotransferase >Feature sequence071 3025 4104 gene locus_tag LOCUS_05010 3025 4104 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405429.1 protein_id gnl|my_center|LOCUS_05010 4113 4889 gene locus_tag LOCUS_05020 4113 4889 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_05020 5368 4895 gene locus_tag LOCUS_05030 gene mog 5368 4895 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002842823.1 protein_id gnl|my_center|LOCUS_05030 5818 5372 gene locus_tag LOCUS_05040 gene moaC 5818 5372 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_05040 7001 5829 gene locus_tag LOCUS_05050 7001 5829 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921042.1 protein_id gnl|my_center|LOCUS_05050 7384 6995 gene locus_tag LOCUS_05060 7384 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence072 1253 270 gene locus_tag LOCUS_05070 1253 270 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_05070 1416 1748 gene locus_tag LOCUS_05080 1416 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 3320 1851 gene locus_tag LOCUS_05090 3320 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_05090 4608 3694 gene locus_tag LOCUS_05100 4608 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 6992 4632 gene locus_tag LOCUS_05110 6992 4632 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence073 <1 726 gene locus_tag LOCUS_05120 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941009.1:NADH dehydrogenase (quinone) subunit D 739 1092 gene locus_tag LOCUS_05130 739 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 1089 3116 gene locus_tag LOCUS_05140 1089 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 3135 4781 gene locus_tag LOCUS_05150 3135 4781 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_05150 4792 5937 gene locus_tag LOCUS_05160 gene nuoH 4792 5937 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552781.1 protein_id gnl|my_center|LOCUS_05160 5973 6503 gene locus_tag LOCUS_05170 5973 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 6516 7019 gene locus_tag LOCUS_05180 6516 7019 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_05180 7032 7358 gene locus_tag LOCUS_05190 gene nuoK 7032 7358 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence074 1554 2234 gene locus_tag LOCUS_05200 1554 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2291 3736 gene locus_tag LOCUS_05210 2291 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 5820 4036 gene locus_tag LOCUS_05220 5820 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6293 5841 gene locus_tag LOCUS_05230 6293 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 6879 6358 gene locus_tag LOCUS_05240 6879 6358 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227896.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence075 785 315 gene locus_tag LOCUS_05250 785 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2594 789 gene locus_tag LOCUS_05260 gene lepA 2594 789 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_05260 2751 3857 gene locus_tag LOCUS_05270 gene mqnC 2751 3857 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_05270 3251 3318 gene locus_tag LOCUS_t00040 3251 3318 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3969 4769 gene locus_tag LOCUS_05280 3969 4769 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107373.1 protein_id gnl|my_center|LOCUS_05280 4839 5627 gene locus_tag LOCUS_05290 4839 5627 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_05290 5643 6749 gene locus_tag LOCUS_05300 gene rodA 5643 6749 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_05300 7108 6908 gene locus_tag LOCUS_05310 7108 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence076 3289 773 gene locus_tag LOCUS_05320 gene gspD 3289 773 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208195.1 protein_id gnl|my_center|LOCUS_05320 3413 3586 gene locus_tag LOCUS_05330 3413 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4923 3775 gene locus_tag LOCUS_05340 4923 3775 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_05340 5964 4969 gene locus_tag LOCUS_05350 5964 4969 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_05350 6088 7098 gene locus_tag LOCUS_05360 6088 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence077 153 2120 gene locus_tag LOCUS_05370 153 2120 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104191.1 protein_id gnl|my_center|LOCUS_05370 2120 2737 gene locus_tag LOCUS_05380 2120 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 2915 3754 gene locus_tag LOCUS_05390 2915 3754 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268646.1 protein_id gnl|my_center|LOCUS_05390 4132 3785 gene locus_tag LOCUS_05400 4132 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4505 4134 gene locus_tag LOCUS_05410 4505 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 5646 4585 gene locus_tag LOCUS_05420 gene nagZ 5646 4585 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887975.1 protein_id gnl|my_center|LOCUS_05420 5822 6142 gene locus_tag LOCUS_05430 5822 6142 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266256.1 protein_id gnl|my_center|LOCUS_05430 6139 7194 gene locus_tag LOCUS_05440 6139 7194 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200876.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence078 442 1296 gene locus_tag LOCUS_05450 442 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3670 1421 gene locus_tag LOCUS_05460 3670 1421 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537562.1 protein_id gnl|my_center|LOCUS_05460 4034 5899 gene locus_tag LOCUS_05470 4034 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence079 2863 4044 gene locus_tag LOCUS_05480 2863 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5515 4373 gene locus_tag LOCUS_05490 5515 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 5663 5932 gene locus_tag LOCUS_05500 5663 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 5971 6183 gene locus_tag LOCUS_05510 5971 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence080 1049 639 gene locus_tag LOCUS_05520 1049 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1123 2307 gene locus_tag LOCUS_05530 1123 2307 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_05530 3781 2543 gene locus_tag LOCUS_05540 3781 2543 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_05540 4217 3849 gene locus_tag LOCUS_05550 4217 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5648 4281 gene locus_tag LOCUS_05560 5648 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 <7135 5751 gene locus_tag LOCUS_05570 <7135 5751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943869.1:glycogen synthase GlgA >Feature sequence081 <1 772 gene locus_tag LOCUS_05580 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969246.1:class I fructose-bisphosphate aldolase 1530 820 gene locus_tag LOCUS_05590 1530 820 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_05590 5814 1540 gene locus_tag LOCUS_05600 5814 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6840 6025 gene locus_tag LOCUS_05610 gene thiD 6840 6025 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055440.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence082 611 2650 gene locus_tag LOCUS_05620 611 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2678 5194 gene locus_tag LOCUS_05630 2678 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 5412 6572 gene locus_tag LOCUS_05640 5412 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence083 1433 1047 gene locus_tag LOCUS_05650 gene folB 1433 1047 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419537.1 protein_id gnl|my_center|LOCUS_05650 3556 1457 gene locus_tag LOCUS_05660 gene mrdA 3556 1457 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583753.1 protein_id gnl|my_center|LOCUS_05660 4359 3556 gene locus_tag LOCUS_05670 4359 3556 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_05670 4659 4390 gene locus_tag LOCUS_05680 4659 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 5231 4815 gene locus_tag LOCUS_05690 5231 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5357 6763 gene locus_tag LOCUS_05700 gene glmM 5357 6763 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence084 529 1767 gene locus_tag LOCUS_05710 529 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 1764 2297 gene locus_tag LOCUS_05720 1764 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2297 3112 gene locus_tag LOCUS_05730 2297 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3904 3257 gene locus_tag LOCUS_05740 gene rpe 3904 3257 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_05740 4135 4209 gene locus_tag LOCUS_t00050 4135 4209 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5295 4360 gene locus_tag LOCUS_05750 5295 4360 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_05750 5416 6585 gene locus_tag LOCUS_05760 gene metK 5416 6585 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461723.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence085 <1 568 gene locus_tag LOCUS_05770 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388360.1:phosphate signaling complex protein PhoU 589 1881 gene locus_tag LOCUS_05780 589 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2023 5973 gene locus_tag LOCUS_05790 2023 5973 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615507.1 protein_id gnl|my_center|LOCUS_05790 <6934 6075 gene locus_tag LOCUS_05800 <6934 6075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122515.1:AraC family transcriptional regulator >Feature sequence086 530 90 gene locus_tag LOCUS_05810 530 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 791 531 gene locus_tag LOCUS_05820 791 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 914 1084 gene locus_tag LOCUS_05830 914 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1825 3267 gene locus_tag LOCUS_05840 1825 3267 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921791.1 protein_id gnl|my_center|LOCUS_05840 3264 6596 gene locus_tag LOCUS_05850 3264 6596 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence087 941 270 gene locus_tag LOCUS_05860 941 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2225 1809 gene locus_tag LOCUS_05870 2225 1809 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_05870 2545 3594 gene locus_tag LOCUS_05880 gene ribD 2545 3594 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_05880 5236 3803 gene locus_tag LOCUS_05890 5236 3803 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence088 1279 800 gene locus_tag LOCUS_05900 gene ilvN 1279 800 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_05900 1467 2273 gene locus_tag LOCUS_05910 1467 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3034 2432 gene locus_tag LOCUS_05920 3034 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 3593 3123 gene locus_tag LOCUS_05930 gene smpB 3593 3123 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829588.1 protein_id gnl|my_center|LOCUS_05930 3935 3717 gene locus_tag LOCUS_05940 3935 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 5148 4237 gene locus_tag LOCUS_05950 5148 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 5236 6210 gene locus_tag LOCUS_05960 gene nadA 5236 6210 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence089 674 111 gene locus_tag LOCUS_05970 674 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 1370 768 gene locus_tag LOCUS_05980 1370 768 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 protein_id gnl|my_center|LOCUS_05980 1570 2325 gene locus_tag LOCUS_05990 gene kdsB 1570 2325 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_05990 2375 4006 gene locus_tag LOCUS_06000 2375 4006 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_06000 4051 4608 gene locus_tag LOCUS_06010 4051 4608 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_06010 4590 5642 gene locus_tag LOCUS_06020 gene queG 4590 5642 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_06020 6762 5698 gene locus_tag LOCUS_06030 gene glpX 6762 5698 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence090 273 1265 gene locus_tag LOCUS_06040 273 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 1294 3732 gene locus_tag LOCUS_06050 1294 3732 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668005.1 protein_id gnl|my_center|LOCUS_06050 3747 5129 gene locus_tag LOCUS_06060 3747 5129 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_06060 5126 6478 gene locus_tag LOCUS_06070 5126 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence091 1571 753 gene locus_tag LOCUS_06080 1571 753 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_06080 2547 2116 gene locus_tag LOCUS_06090 2547 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4934 2739 gene locus_tag LOCUS_06100 4934 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 6223 4970 gene locus_tag LOCUS_06110 6223 4970 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence092 <1 578 gene locus_tag LOCUS_06120 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120349.1:DUF1553 domain-containing protein 661 1998 gene locus_tag LOCUS_06130 661 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 2281 2027 gene locus_tag LOCUS_06140 2281 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3714 2278 gene locus_tag LOCUS_06150 3714 2278 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_06150 4641 3736 gene locus_tag LOCUS_06160 4641 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760094.1 protein_id gnl|my_center|LOCUS_06160 <6622 4653 gene locus_tag LOCUS_06170 <6622 4653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921983.1:DUF1553 domain-containing protein >Feature sequence093 641 297 gene locus_tag LOCUS_06180 gene rplT 641 297 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131615061.1 protein_id gnl|my_center|LOCUS_06180 2698 1310 gene locus_tag LOCUS_06190 2698 1310 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266384.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence094 1476 106 gene locus_tag LOCUS_06200 1476 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2416 1523 gene locus_tag LOCUS_06210 gene rfbA 2416 1523 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942725.1 protein_id gnl|my_center|LOCUS_06210 2578 3465 gene locus_tag LOCUS_06220 2578 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 4039 3383 gene locus_tag LOCUS_06230 4039 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 5069 4104 gene locus_tag LOCUS_06240 gene cysK 5069 4104 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_06240 5923 5219 gene locus_tag LOCUS_06250 5923 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence095 1734 2132 gene locus_tag LOCUS_06260 1734 2132 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939050.1 protein_id gnl|my_center|LOCUS_06260 2136 2465 gene locus_tag LOCUS_06270 2136 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2608 4008 gene locus_tag LOCUS_06280 gene rpoN 2608 4008 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_06280 4123 4827 gene locus_tag LOCUS_06290 4123 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 5299 4796 gene locus_tag LOCUS_06300 5299 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 5396 6406 gene locus_tag LOCUS_06310 5396 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence096 553 1338 gene locus_tag LOCUS_06320 553 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence097 861 2909 gene locus_tag LOCUS_06330 861 2909 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932948.1 protein_id gnl|my_center|LOCUS_06330 3644 3024 gene locus_tag LOCUS_06340 3644 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4714 3755 gene locus_tag LOCUS_06350 4714 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5979 4711 gene locus_tag LOCUS_06360 5979 4711 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681281.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence098 <1 1508 gene locus_tag LOCUS_06370 <1 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173442661.1:sialate O-acetylesterase 1698 2870 gene locus_tag LOCUS_06380 1698 2870 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986366.1 protein_id gnl|my_center|LOCUS_06380 3550 2957 gene locus_tag LOCUS_06390 3550 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 4929 3604 gene locus_tag LOCUS_06400 4929 3604 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_06400 <6425 4975 gene locus_tag LOCUS_06410 <6425 4975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332509.1:ATPase, T2SS/T4P/T4SS family >Feature sequence099 435 163 gene locus_tag LOCUS_06420 435 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 975 757 gene locus_tag LOCUS_06430 975 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1177 1422 gene locus_tag LOCUS_06440 1177 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 1440 2567 gene locus_tag LOCUS_06450 1440 2567 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_06450 4520 2757 gene locus_tag LOCUS_06460 gene recN 4520 2757 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_06460 <6397 4563 gene locus_tag LOCUS_06470 <6397 4563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942985.1:potassium transporter Kup >Feature sequence100 233 1450 gene locus_tag LOCUS_06480 233 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 3406 1877 gene locus_tag LOCUS_06490 3406 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_06490 5068 3440 gene locus_tag LOCUS_06500 5068 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 6152 5568 gene locus_tag LOCUS_06510 6152 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence101 <1 1060 gene locus_tag LOCUS_06520 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249842.1:glycosyltransferase family 4 protein 1552 2196 gene locus_tag LOCUS_06530 1552 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 2776 3441 gene locus_tag LOCUS_06540 2776 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3575 4738 gene locus_tag LOCUS_06550 3575 4738 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337933.1 protein_id gnl|my_center|LOCUS_06550 4916 4710 gene locus_tag LOCUS_06560 4916 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence102 232 2946 gene locus_tag LOCUS_06570 232 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3000 4301 gene locus_tag LOCUS_06580 3000 4301 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_06580 4430 4867 gene locus_tag LOCUS_06590 4430 4867 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 protein_id gnl|my_center|LOCUS_06590 5935 5063 gene locus_tag LOCUS_06600 gene htpX 5935 5063 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence103 <1 2315 gene locus_tag LOCUS_06610 <1 2315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921574.1:PSD1 and planctomycete cytochrome C domain-containing protein 2326 3684 gene locus_tag LOCUS_06620 2326 3684 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_06620 4831 3959 gene locus_tag LOCUS_06630 4831 3959 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence104 >Feature sequence105 <1 1317 gene locus_tag LOCUS_06640 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122658.1:oligoendopeptidase F 1320 1811 gene locus_tag LOCUS_06650 1320 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1808 2434 gene locus_tag LOCUS_06660 1808 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 4972 2444 gene locus_tag LOCUS_06670 gene hrpB 4972 2444 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_06670 6020 5004 gene locus_tag LOCUS_06680 gene galT 6020 5004 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943868.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence106 <1 1074 gene locus_tag LOCUS_06690 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117890.1:DUF1592 domain-containing protein 1113 2555 gene locus_tag LOCUS_06700 1113 2555 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_06700 2552 3817 gene locus_tag LOCUS_06710 2552 3817 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_06710 4460 3861 gene locus_tag LOCUS_06720 4460 3861 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803670.1 protein_id gnl|my_center|LOCUS_06720 6209 4470 gene locus_tag LOCUS_06730 6209 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence107 <1 1178 gene locus_tag LOCUS_06740 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259342.1:deoxyribodipyrimidine photo-lyase 2543 1386 gene locus_tag LOCUS_06750 gene nagA 2543 1386 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108898.1 protein_id gnl|my_center|LOCUS_06750 3525 2914 gene locus_tag LOCUS_06760 3525 2914 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_06760 3922 4593 gene locus_tag LOCUS_06770 3922 4593 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_06770 4604 5947 gene locus_tag LOCUS_06780 4604 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence108 2559 1570 gene locus_tag LOCUS_06790 gene dusB 2559 1570 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_06790 2676 3890 gene locus_tag LOCUS_06800 2676 3890 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_06800 3993 4961 gene locus_tag LOCUS_06810 3993 4961 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_06810 5084 5635 gene locus_tag LOCUS_06820 5084 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 >Feature sequence109 653 1255 gene locus_tag LOCUS_06830 653 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 1268 1768 gene locus_tag LOCUS_06840 1268 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2016 3854 gene locus_tag LOCUS_06850 2016 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4978 3878 gene locus_tag LOCUS_06860 gene rsgA 4978 3878 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_06860 5595 4975 gene locus_tag LOCUS_06870 gene yihA 5595 4975 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765852.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence110 3605 396 gene locus_tag LOCUS_06880 3605 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 5198 3627 gene locus_tag LOCUS_06890 gene cimA 5198 3627 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_06890 5449 5727 gene locus_tag LOCUS_06900 5449 5727 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975931.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence111 1710 931 gene locus_tag LOCUS_06910 1710 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1863 2681 gene locus_tag LOCUS_06920 gene mazG 1863 2681 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703306.1 protein_id gnl|my_center|LOCUS_06920 2697 4031 gene locus_tag LOCUS_06930 2697 4031 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_06930 4039 4485 gene locus_tag LOCUS_06940 4039 4485 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_06940 4492 5451 gene locus_tag LOCUS_06950 4492 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence112 2589 166 gene locus_tag LOCUS_06960 2589 166 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_06960 4079 2733 gene locus_tag LOCUS_06970 4079 2733 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_06970 5463 4093 gene locus_tag LOCUS_06980 5463 4093 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence113 >Feature sequence114 2248 434 gene locus_tag LOCUS_06990 gene ilvB 2248 434 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057136.1 protein_id gnl|my_center|LOCUS_06990 3244 2255 gene locus_tag LOCUS_07000 3244 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4207 3407 gene locus_tag LOCUS_07010 4207 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 <6068 4287 gene locus_tag LOCUS_07020 <6068 4287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088712.1:N-acetylneuraminate synthase family protein >Feature sequence115 84 158 gene locus_tag LOCUS_t00060 84 158 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 219 2294 gene locus_tag LOCUS_07030 219 2294 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389479.1 protein_id gnl|my_center|LOCUS_07030 2712 5135 gene locus_tag LOCUS_07040 2712 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 5132 5590 gene locus_tag LOCUS_07050 5132 5590 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence116 4236 4030 gene locus_tag LOCUS_07060 4236 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 4129 4686 gene locus_tag LOCUS_07070 gene lacC 4129 4686 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence117 <1 821 gene locus_tag LOCUS_07080 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921278.1:aldo/keto reductase 840 1868 gene locus_tag LOCUS_07090 840 1868 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_07090 1888 2739 gene locus_tag LOCUS_07100 1888 2739 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_07100 5108 2706 gene locus_tag LOCUS_07110 5108 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 5805 5212 gene locus_tag LOCUS_07120 5805 5212 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038600.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence118 90 968 gene locus_tag LOCUS_07130 90 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 1325 1672 gene locus_tag LOCUS_07140 1325 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1674 1997 gene locus_tag LOCUS_07150 1674 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2137 2589 gene locus_tag LOCUS_07160 2137 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 2709 3065 gene locus_tag LOCUS_07170 2709 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3178 5934 gene locus_tag LOCUS_07180 3178 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence119 <1 2295 gene locus_tag LOCUS_07190 <1 2295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008663427.1:GDSL-type esterase/lipase family protein 2737 2252 gene locus_tag LOCUS_07200 2737 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4039 2753 gene locus_tag LOCUS_07210 4039 2753 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_07210 4819 4043 gene locus_tag LOCUS_07220 4819 4043 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253881.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence120 128 355 gene locus_tag LOCUS_07230 128 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 392 1495 gene locus_tag LOCUS_07240 392 1495 CDS product IS630-like element ISBj5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085265.1 protein_id gnl|my_center|LOCUS_07240 1576 2037 gene locus_tag LOCUS_07250 1576 2037 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_07250 2034 3149 gene locus_tag LOCUS_07260 2034 3149 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_07260 3323 4468 gene locus_tag LOCUS_07270 3323 4468 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_07270 4465 5091 gene locus_tag LOCUS_07280 4465 5091 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066687.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence121 100 1206 gene locus_tag LOCUS_07290 100 1206 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_07290 1247 4276 gene locus_tag LOCUS_07300 1247 4276 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_07300 5258 4410 gene locus_tag LOCUS_07310 gene tsf 5258 4410 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence122 <1 1199 gene locus_tag LOCUS_07320 <1 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000849131.1:adenylate/guanylate cyclase domain-containing protein 1672 1223 gene locus_tag LOCUS_07330 1672 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2963 1683 gene locus_tag LOCUS_07340 2963 1683 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_07340 3733 2960 gene locus_tag LOCUS_07350 3733 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 4027 4833 gene locus_tag LOCUS_07360 4027 4833 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_07360 4923 5177 gene locus_tag LOCUS_07370 4923 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence123 3830 246 gene locus_tag LOCUS_07380 gene recB 3830 246 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707657.1 protein_id gnl|my_center|LOCUS_07380 <5906 3833 gene locus_tag LOCUS_07390 <5906 3833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942180.1:exodeoxyribonuclease V subunit gamma >Feature sequence124 <1 1962 gene locus_tag LOCUS_07400 <1 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000047238.1:alanine--tRNA ligase 2041 2787 gene locus_tag LOCUS_07410 gene rnc 2041 2787 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_07410 2989 3492 gene locus_tag LOCUS_07420 2989 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 5573 3573 gene locus_tag LOCUS_07430 gene tkt 5573 3573 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872129.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence125 1942 1139 gene locus_tag LOCUS_07440 1942 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3049 2153 gene locus_tag LOCUS_07450 3049 2153 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_07450 3163 4206 gene locus_tag LOCUS_07460 3163 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4329 5456 gene locus_tag LOCUS_07470 4329 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence126 1664 72 gene locus_tag LOCUS_07480 1664 72 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_07480 2587 1781 gene locus_tag LOCUS_07490 gene dapF 2587 1781 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939153.1 protein_id gnl|my_center|LOCUS_07490 2705 3055 gene locus_tag LOCUS_07500 2705 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3098 3571 gene locus_tag LOCUS_07510 3098 3571 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812063.1 protein_id gnl|my_center|LOCUS_07510 4752 3703 gene locus_tag LOCUS_07520 4752 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5169 4807 gene locus_tag LOCUS_07530 5169 4807 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_07530 5353 5748 gene locus_tag LOCUS_07540 5353 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence127 1077 196 gene locus_tag LOCUS_07550 1077 196 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529363.1 protein_id gnl|my_center|LOCUS_07550 1764 5555 gene locus_tag LOCUS_07560 1764 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence128 3344 180 gene locus_tag LOCUS_07570 3344 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3902 3483 gene locus_tag LOCUS_07580 3902 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 5039 3978 gene locus_tag LOCUS_07590 5039 3978 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence129 2311 1313 gene locus_tag LOCUS_07600 2311 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3939 2554 gene locus_tag LOCUS_07610 3939 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 5113 4298 gene locus_tag LOCUS_07620 5113 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence130 <1 594 gene locus_tag LOCUS_07630 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:DUF1549 domain-containing protein 673 2091 gene locus_tag LOCUS_07640 673 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2649 2185 gene locus_tag LOCUS_07650 2649 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4372 2696 gene locus_tag LOCUS_07660 gene leuA 4372 2696 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389681.1 protein_id gnl|my_center|LOCUS_07660 4520 5707 gene locus_tag LOCUS_07670 4520 5707 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence131 1728 784 gene locus_tag LOCUS_07680 1728 784 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143073.1 protein_id gnl|my_center|LOCUS_07680 2877 1843 gene locus_tag LOCUS_07690 2877 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3650 2874 gene locus_tag LOCUS_07700 3650 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3697 3975 gene locus_tag LOCUS_07710 3697 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence132 1152 265 gene locus_tag LOCUS_07720 1152 265 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972773.1 protein_id gnl|my_center|LOCUS_07720 1226 2128 gene locus_tag LOCUS_07730 1226 2128 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_07730 3013 2240 gene locus_tag LOCUS_07740 3013 2240 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122369.1 protein_id gnl|my_center|LOCUS_07740 3466 4446 gene locus_tag LOCUS_07750 3466 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5453 4869 gene locus_tag LOCUS_07760 gene lspA 5453 4869 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence133 143 508 gene locus_tag LOCUS_07770 143 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07770 1533 418 gene locus_tag LOCUS_07780 1533 418 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_07780 2264 1650 gene locus_tag LOCUS_07790 2264 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 2362 3213 gene locus_tag LOCUS_07800 2362 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3324 3587 gene locus_tag LOCUS_07810 gene rpsT 3324 3587 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094744.1 protein_id gnl|my_center|LOCUS_07810 4856 3759 gene locus_tag LOCUS_07820 gene leuB 4856 3759 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_07820 5003 5497 gene locus_tag LOCUS_07830 5003 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence134 1175 594 gene locus_tag LOCUS_07840 1175 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 2117 1260 gene locus_tag LOCUS_07850 2117 1260 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 protein_id gnl|my_center|LOCUS_07850 2469 3446 gene locus_tag LOCUS_07860 2469 3446 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence135 <1 2241 gene locus_tag LOCUS_07870 <1 2241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921574.1:PSD1 and planctomycete cytochrome C domain-containing protein 2248 3669 gene locus_tag LOCUS_07880 2248 3669 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_07880 3814 5004 gene locus_tag LOCUS_07890 3814 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07890 >Feature sequence136 470 955 gene locus_tag LOCUS_07900 470 955 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940845.1 protein_id gnl|my_center|LOCUS_07900 1050 1772 gene locus_tag LOCUS_07910 1050 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1827 2873 gene locus_tag LOCUS_07920 gene trpD 1827 2873 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_07920 2894 4903 gene locus_tag LOCUS_07930 2894 4903 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083788.1 protein_id gnl|my_center|LOCUS_07930 4967 5473 gene locus_tag LOCUS_07940 4967 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence137 1376 849 gene locus_tag LOCUS_07950 1376 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2721 1462 gene locus_tag LOCUS_07960 2721 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 3417 2869 gene locus_tag LOCUS_07970 3417 2869 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391311.1 protein_id gnl|my_center|LOCUS_07970 4414 3422 gene locus_tag LOCUS_07980 gene rfaE1 4414 3422 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_07980 5358 4420 gene locus_tag LOCUS_07990 5358 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence138 1000 2106 gene locus_tag LOCUS_08000 1000 2106 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_08000 3798 2161 gene locus_tag LOCUS_08010 3798 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 <5706 4397 gene locus_tag LOCUS_08020 <5706 4397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120758.1:DUF1501 domain-containing protein >Feature sequence139 431 210 gene locus_tag LOCUS_08030 431 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1379 498 gene locus_tag LOCUS_08040 1379 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1803 1399 gene locus_tag LOCUS_08050 1803 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2702 1884 gene locus_tag LOCUS_08060 2702 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4198 2699 gene locus_tag LOCUS_08070 4198 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4461 4195 gene locus_tag LOCUS_08080 4461 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence140 3623 1635 gene locus_tag LOCUS_08090 3623 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 3830 4744 gene locus_tag LOCUS_08100 3830 4744 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477146.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence141 208 2379 gene locus_tag LOCUS_08110 gene uvrB 208 2379 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920818.1 protein_id gnl|my_center|LOCUS_08110 3948 2656 gene locus_tag LOCUS_08120 3948 2656 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_08120 5203 4172 gene locus_tag LOCUS_08130 5203 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence142 <1 734 gene locus_tag LOCUS_08140 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194588.1:MFS transporter 2218 755 gene locus_tag LOCUS_08150 2218 755 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_08150 5051 2232 gene locus_tag LOCUS_08160 5051 2232 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117969.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence143 <1 1610 gene locus_tag LOCUS_08170 <1 1610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein <5613 2013 gene locus_tag LOCUS_08180 <5613 2013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615995.1:c-type cytochrome >Feature sequence144 368 1744 gene locus_tag LOCUS_08190 368 1744 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392614.1 protein_id gnl|my_center|LOCUS_08190 1741 2424 gene locus_tag LOCUS_08200 1741 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2421 4037 gene locus_tag LOCUS_08210 2421 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 4034 5218 gene locus_tag LOCUS_08220 gene cbiD 4034 5218 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392602.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence145 1548 817 gene locus_tag LOCUS_08230 gene clpP 1548 817 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_08230 3129 1807 gene locus_tag LOCUS_08240 gene tig 3129 1807 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144179.1 protein_id gnl|my_center|LOCUS_08240 4492 3470 gene locus_tag LOCUS_08250 4492 3470 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_08250 4731 4510 gene locus_tag LOCUS_08260 4731 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence146 194 1444 gene locus_tag LOCUS_08270 194 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1483 2544 gene locus_tag LOCUS_08280 gene rfbB 1483 2544 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_08280 2557 4104 gene locus_tag LOCUS_08290 2557 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4106 5452 gene locus_tag LOCUS_08300 4106 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence147 1142 492 gene locus_tag LOCUS_08310 gene recR 1142 492 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051621.1 protein_id gnl|my_center|LOCUS_08310 2359 1139 gene locus_tag LOCUS_08320 2359 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2429 2887 gene locus_tag LOCUS_08330 2429 2887 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_08330 2978 3673 gene locus_tag LOCUS_08340 2978 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence148 1983 1084 gene locus_tag LOCUS_08350 1983 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2229 3380 gene locus_tag LOCUS_08360 2229 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 3878 4663 gene locus_tag LOCUS_08370 3878 4663 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence149 1364 126 gene locus_tag LOCUS_08380 1364 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 2789 1431 gene locus_tag LOCUS_08390 2789 1431 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_08390 <5495 2853 gene locus_tag LOCUS_08400 <5495 2853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008668005.1:DUF1592 domain-containing protein >Feature sequence150 103 945 gene locus_tag LOCUS_08410 103 945 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031203.1 protein_id gnl|my_center|LOCUS_08410 1075 1833 gene locus_tag LOCUS_08420 1075 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08420 1826 2674 gene locus_tag LOCUS_08430 1826 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08430 2667 3458 gene locus_tag LOCUS_08440 gene pstB 2667 3458 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071864.1 protein_id gnl|my_center|LOCUS_08440 3553 4008 gene locus_tag LOCUS_08450 3553 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 4087 4287 gene locus_tag LOCUS_08460 4087 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 4284 4547 gene locus_tag LOCUS_08470 4284 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_08470 4548 4736 gene locus_tag LOCUS_08480 4548 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 5306 5082 gene locus_tag LOCUS_08490 5306 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence151 3 164 gene locus_tag LOCUS_08500 3 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 167 1189 gene locus_tag LOCUS_08510 167 1189 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_08510 1193 3238 gene locus_tag LOCUS_08520 1193 3238 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_08520 3235 4491 gene locus_tag LOCUS_08530 3235 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence152 174 1406 gene locus_tag LOCUS_08540 gene tolB 174 1406 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_08540 1603 3141 gene locus_tag LOCUS_08550 1603 3141 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_08550 <5476 3269 gene locus_tag LOCUS_08560 <5476 3269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921685.1:c-type cytochrome >Feature sequence153 >Feature sequence154 1319 333 gene locus_tag LOCUS_08570 1319 333 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_08570 2470 1319 gene locus_tag LOCUS_08580 gene purK 2470 1319 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 protein_id gnl|my_center|LOCUS_08580 2946 2467 gene locus_tag LOCUS_08590 gene purE 2946 2467 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_08590 3105 5222 gene locus_tag LOCUS_08600 3105 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence155 851 339 gene locus_tag LOCUS_08610 gene folK 851 339 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_08610 1609 866 gene locus_tag LOCUS_08620 gene dapB 1609 866 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_08620 2521 1646 gene locus_tag LOCUS_08630 gene dapA 2521 1646 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_08630 3573 2575 gene locus_tag LOCUS_08640 3573 2575 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964389.1 protein_id gnl|my_center|LOCUS_08640 3765 5147 gene locus_tag LOCUS_08650 gene xseA 3765 5147 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence156 425 1663 gene locus_tag LOCUS_08660 425 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3089 1734 gene locus_tag LOCUS_08670 3089 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 5119 3245 gene locus_tag LOCUS_08680 5119 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence157 <1 1070 gene locus_tag LOCUS_08690 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein 1272 1868 gene locus_tag LOCUS_08700 1272 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2046 2354 gene locus_tag LOCUS_08710 2046 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2364 2762 gene locus_tag LOCUS_08720 gene rpsI 2364 2762 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882898.1 protein_id gnl|my_center|LOCUS_08720 3047 5239 gene locus_tag LOCUS_08730 3047 5239 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258146.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence158 531 1832 gene locus_tag LOCUS_08740 531 1832 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_08740 2015 2563 gene locus_tag LOCUS_08750 2015 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2861 2595 gene locus_tag LOCUS_08760 2861 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2860 3573 gene locus_tag LOCUS_08770 2860 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence159 1588 2463 gene locus_tag LOCUS_08780 gene ubiA 1588 2463 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_08780 2833 4437 gene locus_tag LOCUS_08790 2833 4437 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435129.1 protein_id gnl|my_center|LOCUS_08790 4653 4580 gene locus_tag LOCUS_t00070 4653 4580 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence160 1247 165 gene locus_tag LOCUS_08800 1247 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence161 2473 149 gene locus_tag LOCUS_08810 2473 149 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169250172.1 protein_id gnl|my_center|LOCUS_08810 4084 2516 gene locus_tag LOCUS_08820 4084 2516 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836186.1 protein_id gnl|my_center|LOCUS_08820 5301 4114 gene locus_tag LOCUS_08830 5301 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence162 1834 602 gene locus_tag LOCUS_08840 1834 602 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_08840 4273 1859 gene locus_tag LOCUS_08850 4273 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 5199 4381 gene locus_tag LOCUS_08860 5199 4381 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence163 <1 3041 gene locus_tag LOCUS_08870 <1 3041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146390841.1:DUF1549 domain-containing protein 3208 4623 gene locus_tag LOCUS_08880 3208 4623 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_08880 4941 5108 gene locus_tag LOCUS_08890 4941 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence164 461 1222 gene locus_tag LOCUS_08900 461 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1219 2703 gene locus_tag LOCUS_08910 1219 2703 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_08910 4209 2764 gene locus_tag LOCUS_08920 gene der 4209 2764 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_08920 5012 4251 gene locus_tag LOCUS_08930 5012 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence165 2053 4602 gene locus_tag LOCUS_08940 2053 4602 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence166 2470 2033 gene locus_tag LOCUS_08950 2470 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2547 2960 gene locus_tag LOCUS_08960 2547 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 3305 4150 gene locus_tag LOCUS_08970 3305 4150 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_08970 4197 4658 gene locus_tag LOCUS_08980 gene folA 4197 4658 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence167 >Feature sequence168 <1 2946 gene locus_tag LOCUS_08990 <1 2946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615966.1:DUF1592 domain-containing protein 3016 4323 gene locus_tag LOCUS_09000 3016 4323 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence169 <1 852 gene locus_tag LOCUS_09010 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583299.1:branched-chain amino acid ABC transporter permease 849 1625 gene locus_tag LOCUS_09020 849 1625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_09020 1618 2325 gene locus_tag LOCUS_09030 1618 2325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_09030 2486 4855 gene locus_tag LOCUS_09040 2486 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence170 181 927 gene locus_tag LOCUS_09050 181 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2112 976 gene locus_tag LOCUS_09060 2112 976 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769406.1 protein_id gnl|my_center|LOCUS_09060 3813 2233 gene locus_tag LOCUS_09070 3813 2233 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922119.1 protein_id gnl|my_center|LOCUS_09070 <5121 3852 gene locus_tag LOCUS_09080 <5121 3852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173864.1:Fe-S cluster assembly protein SufD >Feature sequence171 >Feature sequence172 83 1615 gene locus_tag LOCUS_09090 83 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1650 2507 gene locus_tag LOCUS_09100 1650 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2543 3208 gene locus_tag LOCUS_09110 2543 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3205 3987 gene locus_tag LOCUS_09120 3205 3987 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_09120 4718 4011 gene locus_tag LOCUS_09130 4718 4011 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence173 1782 829 gene locus_tag LOCUS_09140 1782 829 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_09140 5083 1994 gene locus_tag LOCUS_09150 5083 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence174 1613 618 gene locus_tag LOCUS_09160 1613 618 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_09160 3199 1748 gene locus_tag LOCUS_09170 3199 1748 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_09170 <5073 3215 gene locus_tag LOCUS_09180 <5073 3215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120839.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence175 427 1245 gene locus_tag LOCUS_09190 427 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1242 2321 gene locus_tag LOCUS_09200 gene pheA 1242 2321 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_09200 2388 4250 gene locus_tag LOCUS_09210 gene yegI 2388 4250 CDS product protein kinase YegI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856071.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence176 3835 1301 gene locus_tag LOCUS_09220 3835 1301 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence177 290 78 gene locus_tag LOCUS_09230 290 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1599 418 gene locus_tag LOCUS_09240 1599 418 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_09240 2645 1605 gene locus_tag LOCUS_09250 2645 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 4350 2620 gene locus_tag LOCUS_09260 4350 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09260 <5062 4347 gene locus_tag LOCUS_09270 <5062 4347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942828.1:ABC transporter ATP-binding protein >Feature sequence178 <1 531 gene locus_tag LOCUS_09280 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335517.1:DUF1501 domain-containing protein 528 2996 gene locus_tag LOCUS_09290 528 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence179 <1 1561 gene locus_tag LOCUS_09300 <1 1561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963832.1:UDP-N-acetylmuramate dehydrogenase 1554 2498 gene locus_tag LOCUS_09310 1554 2498 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_09310 2495 3988 gene locus_tag LOCUS_09320 2495 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence180 467 1906 gene locus_tag LOCUS_09330 467 1906 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_09330 2021 3499 gene locus_tag LOCUS_09340 2021 3499 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence181 3551 2514 gene locus_tag LOCUS_09350 3551 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3988 3548 gene locus_tag LOCUS_09360 3988 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 4408 3992 gene locus_tag LOCUS_09370 4408 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 <5022 4412 gene locus_tag LOCUS_09380 <5022 4412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120828.1:MotA/TolQ/ExbB proton channel family protein >Feature sequence182 1038 403 gene locus_tag LOCUS_09390 1038 403 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_09390 1266 1949 gene locus_tag LOCUS_09400 1266 1949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence183 945 3545 gene locus_tag LOCUS_09410 945 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4654 3806 gene locus_tag LOCUS_09420 4654 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence184 2399 2833 gene locus_tag LOCUS_09430 2399 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 3735 2848 gene locus_tag LOCUS_09440 3735 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 <4991 3771 gene locus_tag LOCUS_09450 <4991 3771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140914.1:MFS transporter >Feature sequence185 <1 1245 gene locus_tag LOCUS_09460 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918789.1:flagellar basal-body MS-ring/collar protein FliF 1311 2306 gene locus_tag LOCUS_09470 gene fliG 1311 2306 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392293.1 protein_id gnl|my_center|LOCUS_09470 2310 2897 gene locus_tag LOCUS_09480 2310 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2956 4275 gene locus_tag LOCUS_09490 gene fliI 2956 4275 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_09490 4272 4736 gene locus_tag LOCUS_09500 4272 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence186 <1 655 gene locus_tag LOCUS_09510 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460181.1:hydroxymethylbilane synthase 1817 975 gene locus_tag LOCUS_09520 gene panC 1817 975 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_09520 2209 1946 gene locus_tag LOCUS_09530 2209 1946 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_09530 2448 2206 gene locus_tag LOCUS_09540 2448 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 3953 2595 gene locus_tag LOCUS_09550 3953 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4943 4056 gene locus_tag LOCUS_09560 4943 4056 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929260.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence187 2526 580 gene locus_tag LOCUS_09570 2526 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3567 2737 gene locus_tag LOCUS_09580 3567 2737 CDS product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530519.1 protein_id gnl|my_center|LOCUS_09580 4707 3592 gene locus_tag LOCUS_09590 4707 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence188 864 1613 gene locus_tag LOCUS_09600 864 1613 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088716.1 protein_id gnl|my_center|LOCUS_09600 1610 2437 gene locus_tag LOCUS_09610 1610 2437 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_09610 2446 3027 gene locus_tag LOCUS_09620 gene gmhA2 2446 3027 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857991.1 protein_id gnl|my_center|LOCUS_09620 3024 3704 gene locus_tag LOCUS_09630 3024 3704 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194086.1 protein_id gnl|my_center|LOCUS_09630 3713 4687 gene locus_tag LOCUS_09640 3713 4687 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence189 2993 1926 gene locus_tag LOCUS_09650 2993 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4084 3008 gene locus_tag LOCUS_09660 4084 3008 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_09660 <4953 4171 gene locus_tag LOCUS_09670 <4953 4171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933473.1:peptidylprolyl isomerase >Feature sequence190 300 893 gene locus_tag LOCUS_09680 300 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 982 1236 gene locus_tag LOCUS_09690 gene rpsO 982 1236 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_09690 1564 3699 gene locus_tag LOCUS_09700 gene pnp 1564 3699 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence191 3277 2621 gene locus_tag LOCUS_09710 3277 2621 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_09710 4270 3491 gene locus_tag LOCUS_09720 4270 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence192 435 1157 gene locus_tag LOCUS_09730 435 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1150 1986 gene locus_tag LOCUS_09740 1150 1986 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_09740 2838 2155 gene locus_tag LOCUS_09750 2838 2155 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921987.1 protein_id gnl|my_center|LOCUS_09750 4612 2903 gene locus_tag LOCUS_09760 gene recJ 4612 2903 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_09760 4917 4609 gene locus_tag LOCUS_09770 4917 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence193 756 472 gene locus_tag LOCUS_09780 gene gatC 756 472 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404034.1 protein_id gnl|my_center|LOCUS_09780 986 2191 gene locus_tag LOCUS_09790 986 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2362 3771 gene locus_tag LOCUS_09800 gene purF 2362 3771 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence194 1376 72 gene locus_tag LOCUS_09810 1376 72 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence195 2206 1250 gene locus_tag LOCUS_09820 2206 1250 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence196 1315 2619 gene locus_tag LOCUS_09830 1315 2619 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_09830 2644 3009 gene locus_tag LOCUS_09840 2644 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3014 3808 gene locus_tag LOCUS_09850 3014 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence197 140 778 gene locus_tag LOCUS_09860 140 778 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_09860 789 2615 gene locus_tag LOCUS_09870 gene recQ 789 2615 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_09870 2994 2665 gene locus_tag LOCUS_09880 2994 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 3897 3145 gene locus_tag LOCUS_09890 3897 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4152 4574 gene locus_tag LOCUS_09900 4152 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence198 3219 451 gene locus_tag LOCUS_09910 gene glnD 3219 451 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_09910 3422 4153 gene locus_tag LOCUS_09920 3422 4153 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence199 3101 1851 gene locus_tag LOCUS_09930 3101 1851 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406534.1 protein_id gnl|my_center|LOCUS_09930 4483 3713 gene locus_tag LOCUS_09940 4483 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence200 2169 670 gene locus_tag LOCUS_09950 2169 670 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085251832.1 protein_id gnl|my_center|LOCUS_09950 4272 2476 gene locus_tag LOCUS_09960 4272 2476 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence201 <1 764 gene locus_tag LOCUS_09970 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387785.1:trypsin-like peptidase domain-containing protein 882 1076 gene locus_tag LOCUS_09980 882 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2170 1172 gene locus_tag LOCUS_09990 2170 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2531 3679 gene locus_tag LOCUS_10000 2531 3679 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_10000 3717 4640 gene locus_tag LOCUS_10010 3717 4640 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence202 1452 940 gene locus_tag LOCUS_10020 1452 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2008 1433 gene locus_tag LOCUS_10030 2008 1433 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 protein_id gnl|my_center|LOCUS_10030 2479 2231 gene locus_tag LOCUS_10040 2479 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2771 2499 gene locus_tag LOCUS_10050 2771 2499 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142059.1 protein_id gnl|my_center|LOCUS_10050 4075 2813 gene locus_tag LOCUS_10060 gene thrC 4075 2813 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence203 157 480 gene locus_tag LOCUS_10070 157 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1528 503 gene locus_tag LOCUS_10080 1528 503 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_10080 2117 1533 gene locus_tag LOCUS_10090 gene dcd 2117 1533 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056667.1 protein_id gnl|my_center|LOCUS_10090 3088 2219 gene locus_tag LOCUS_10100 3088 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 3235 3792 gene locus_tag LOCUS_10110 3235 3792 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109176.1 protein_id gnl|my_center|LOCUS_10110 <4783 3819 gene locus_tag LOCUS_10120 <4783 3819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein >Feature sequence204 1326 2708 gene locus_tag LOCUS_10130 1326 2708 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_10130 2909 3277 gene locus_tag LOCUS_10140 2909 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3953 3465 gene locus_tag LOCUS_10150 3953 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10150 <4779 4044 gene locus_tag LOCUS_10160 <4779 4044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943931.1:DUF4139 domain-containing protein note possible pseudo, internal stop codon >Feature sequence205 <1 535 gene locus_tag LOCUS_10170 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400151.1:thioredoxin-disulfide reductase 584 3757 gene locus_tag LOCUS_10180 584 3757 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence206 419 2575 gene locus_tag LOCUS_10190 419 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2581 3480 gene locus_tag LOCUS_10200 2581 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 3544 4536 gene locus_tag LOCUS_10210 gene hemB 3544 4536 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence207 92 565 gene locus_tag LOCUS_10220 gene bcp 92 565 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_10220 602 1183 gene locus_tag LOCUS_10230 602 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1364 2140 gene locus_tag LOCUS_10240 1364 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2211 3656 gene locus_tag LOCUS_10250 2211 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3661 4332 gene locus_tag LOCUS_10260 3661 4332 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185660149.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence208 <1 977 gene locus_tag LOCUS_10270 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122381.1:DUF1501 domain-containing protein 974 2716 gene locus_tag LOCUS_10280 974 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2734 4215 gene locus_tag LOCUS_10290 2734 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4231 4533 gene locus_tag LOCUS_10300 4231 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence209 1117 3165 gene locus_tag LOCUS_10310 1117 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence210 1399 644 gene locus_tag LOCUS_10320 1399 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2402 1470 gene locus_tag LOCUS_10330 2402 1470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_10330 <4731 2576 gene locus_tag LOCUS_10340 <4731 2576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267333.1:ATP-binding protein >Feature sequence211 118 657 gene locus_tag LOCUS_10350 118 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1465 731 gene locus_tag LOCUS_10360 1465 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1860 1483 gene locus_tag LOCUS_10370 1860 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2573 1866 gene locus_tag LOCUS_10380 gene motB 2573 1866 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948025.1 protein_id gnl|my_center|LOCUS_10380 3468 2611 gene locus_tag LOCUS_10390 gene motA 3468 2611 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 protein_id gnl|my_center|LOCUS_10390 4244 3459 gene locus_tag LOCUS_10400 gene whiG 4244 3459 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_10400 4519 4262 gene locus_tag LOCUS_10410 4519 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence212 1422 46 gene locus_tag LOCUS_10420 1422 46 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326881.1 protein_id gnl|my_center|LOCUS_10420 3866 1467 gene locus_tag LOCUS_10430 3866 1467 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668005.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence213 <1 895 gene locus_tag LOCUS_10440 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:PSD1 and planctomycete cytochrome C domain-containing protein 944 2416 gene locus_tag LOCUS_10450 944 2416 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_10450 2888 3862 gene locus_tag LOCUS_10460 2888 3862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_10460 3859 4593 gene locus_tag LOCUS_10470 3859 4593 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence214 <1 581 gene locus_tag LOCUS_10480 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116878287.1:HAD family hydrolase 969 1544 gene locus_tag LOCUS_10490 969 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1595 2560 gene locus_tag LOCUS_10500 1595 2560 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964900.1 protein_id gnl|my_center|LOCUS_10500 2596 3537 gene locus_tag LOCUS_10510 2596 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3553 4299 gene locus_tag LOCUS_10520 3553 4299 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883163.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence215 788 2290 gene locus_tag LOCUS_10530 788 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119646.1 protein_id gnl|my_center|LOCUS_10530 3236 2454 gene locus_tag LOCUS_10540 3236 2454 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974207.1 protein_id gnl|my_center|LOCUS_10540 4201 3461 gene locus_tag LOCUS_10550 4201 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence216 >Feature sequence217 <1 1235 gene locus_tag LOCUS_10560 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118167.1:PQQ-binding-like beta-propeller repeat protein 1270 2361 gene locus_tag LOCUS_10570 1270 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3671 2388 gene locus_tag LOCUS_10580 3671 2388 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198019.1 protein_id gnl|my_center|LOCUS_10580 4661 3810 gene locus_tag LOCUS_10590 4661 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence218 1258 338 gene locus_tag LOCUS_10600 1258 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3250 1424 gene locus_tag LOCUS_10610 3250 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4301 3270 gene locus_tag LOCUS_10620 4301 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence219 1089 2507 gene locus_tag LOCUS_10630 1089 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3975 2578 gene locus_tag LOCUS_10640 3975 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 <4637 3998 gene locus_tag LOCUS_10650 <4637 3998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102111.1:MFS transporter >Feature sequence220 <1 901 gene locus_tag LOCUS_10660 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205417.1:transglutaminase family protein 1135 3540 gene locus_tag LOCUS_10670 1135 3540 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_10670 3558 4466 gene locus_tag LOCUS_10680 3558 4466 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence221 4293 250 gene locus_tag LOCUS_10690 4293 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence222 1545 142 gene locus_tag LOCUS_10700 1545 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1766 2125 gene locus_tag LOCUS_10710 1766 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2122 2643 gene locus_tag LOCUS_10720 2122 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3009 3476 gene locus_tag LOCUS_10730 3009 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3454 4113 gene locus_tag LOCUS_10740 3454 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence223 245 99 gene locus_tag LOCUS_10750 245 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 493 257 gene locus_tag LOCUS_10760 gene dltC 493 257 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640705.1 protein_id gnl|my_center|LOCUS_10760 1734 499 gene locus_tag LOCUS_10770 1734 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3096 1918 gene locus_tag LOCUS_10780 gene odhB 3096 1918 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528851.1 protein_id gnl|my_center|LOCUS_10780 3785 3135 gene locus_tag LOCUS_10790 3785 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10790 <4568 3816 gene locus_tag LOCUS_10800 <4568 3816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972453.1:2-oxoglutarate dehydrogenase E1 component note possible pseudo, internal stop codon >Feature sequence224 198 1436 gene locus_tag LOCUS_10810 198 1436 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_10810 3209 1881 gene locus_tag LOCUS_10820 3209 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4497 3235 gene locus_tag LOCUS_10830 4497 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence225 1336 713 gene locus_tag LOCUS_10840 1336 713 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889576.1 protein_id gnl|my_center|LOCUS_10840 2921 1359 gene locus_tag LOCUS_10850 2921 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10850 3700 2918 gene locus_tag LOCUS_10860 3700 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 4473 3700 gene locus_tag LOCUS_10870 gene cobM 4473 3700 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976965.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence226 1751 960 gene locus_tag LOCUS_10880 gene tcdA 1751 960 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112469.1 protein_id gnl|my_center|LOCUS_10880 2548 1757 gene locus_tag LOCUS_10890 2548 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2632 3681 gene locus_tag LOCUS_10900 2632 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence227 <1 1435 gene locus_tag LOCUS_10910 <1 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140166.1:PBP1A family penicillin-binding protein 3352 1550 gene locus_tag LOCUS_10920 3352 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 <4483 3425 gene locus_tag LOCUS_10930 <4483 3425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057315.1:Gldg family protein >Feature sequence228 401 1072 gene locus_tag LOCUS_10940 401 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1035 1241 gene locus_tag LOCUS_10950 1035 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1336 2055 gene locus_tag LOCUS_10960 1336 2055 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142748.1 protein_id gnl|my_center|LOCUS_10960 2082 2525 gene locus_tag LOCUS_10970 2082 2525 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227792.1 protein_id gnl|my_center|LOCUS_10970 2602 3723 gene locus_tag LOCUS_10980 gene tgt 2602 3723 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_10980 3745 4398 gene locus_tag LOCUS_10990 3745 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence229 <4480 3769 gene locus_tag LOCUS_11000 <4480 3769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921971.1:VWA domain-containing protein >Feature sequence230 <1 2788 gene locus_tag LOCUS_11010 <1 2788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146849598.1:PSD1 and planctomycete cytochrome C domain-containing protein 2816 4303 gene locus_tag LOCUS_11020 2816 4303 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence231 782 2212 gene locus_tag LOCUS_11030 782 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence232 605 1735 gene locus_tag LOCUS_11040 605 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence233 619 2481 gene locus_tag LOCUS_11050 619 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2595 3026 gene locus_tag LOCUS_11060 2595 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3114 4112 gene locus_tag LOCUS_11070 3114 4112 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence234 673 56 gene locus_tag LOCUS_11080 673 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1749 760 gene locus_tag LOCUS_11090 gene waaC 1749 760 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_11090 2531 1809 gene locus_tag LOCUS_11100 2531 1809 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 protein_id gnl|my_center|LOCUS_11100 3404 2610 gene locus_tag LOCUS_11110 3404 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4282 3401 gene locus_tag LOCUS_11120 4282 3401 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence235 1990 398 gene locus_tag LOCUS_11130 1990 398 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence236 <1 812 gene locus_tag LOCUS_11140 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001029966.1:chaperonin GroEL 1420 2220 gene locus_tag LOCUS_11150 1420 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence237 2934 793 gene locus_tag LOCUS_11160 2934 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 3165 3677 gene locus_tag LOCUS_11170 3165 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3746 4354 gene locus_tag LOCUS_11180 3746 4354 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032614391.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence238 912 2147 gene locus_tag LOCUS_11190 912 2147 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_11190 1928 2020 gene locus_tag LOCUS_t00080 1928 2020 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2160 2465 gene locus_tag LOCUS_11200 2160 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2568 2492 gene locus_tag LOCUS_t00090 2568 2492 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3912 4241 gene locus_tag LOCUS_11210 3912 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence239 1023 3260 gene locus_tag LOCUS_11220 1023 3260 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence240 85 1437 gene locus_tag LOCUS_11230 85 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_11230 1507 2532 gene locus_tag LOCUS_11240 1507 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 2526 2717 gene locus_tag LOCUS_11250 2526 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2714 4009 gene locus_tag LOCUS_11260 2714 4009 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence241 132 851 gene locus_tag LOCUS_11270 132 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 848 1837 gene locus_tag LOCUS_11280 gene fliM 848 1837 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763575.1 protein_id gnl|my_center|LOCUS_11280 1840 2100 gene locus_tag LOCUS_11290 1840 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2114 2644 gene locus_tag LOCUS_11300 2114 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2644 3474 gene locus_tag LOCUS_11310 gene fliP 2644 3474 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_11310 3471 3740 gene locus_tag LOCUS_11320 gene fliQ 3471 3740 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence242 <4393 1778 gene locus_tag LOCUS_11330 <4393 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099260401.1:PPC domain-containing protein >Feature sequence243 474 1859 gene locus_tag LOCUS_11340 474 1859 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence244 2071 254 gene locus_tag LOCUS_11350 2071 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 3464 2058 gene locus_tag LOCUS_11360 3464 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 <4383 3758 gene locus_tag LOCUS_11370 <4383 3758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921825.1:DUF1552 domain-containing protein >Feature sequence245 483 4103 gene locus_tag LOCUS_11380 483 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence246 1488 529 gene locus_tag LOCUS_11390 1488 529 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_11390 2660 1605 gene locus_tag LOCUS_11400 2660 1605 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640051.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence247 1998 511 gene locus_tag LOCUS_11410 1998 511 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_11410 3279 2131 gene locus_tag LOCUS_11420 gene ychF 3279 2131 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_11420 <4309 3432 gene locus_tag LOCUS_11430 <4309 3432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546821.1:replication-associated recombination protein A >Feature sequence248 1315 485 gene locus_tag LOCUS_11440 1315 485 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_11440 2976 1432 gene locus_tag LOCUS_11450 2976 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_11450 3259 2990 gene locus_tag LOCUS_11460 3259 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4274 3171 gene locus_tag LOCUS_11470 4274 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence249 1566 427 gene locus_tag LOCUS_11480 1566 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1821 2606 gene locus_tag LOCUS_11490 1821 2606 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_11490 3515 2682 gene locus_tag LOCUS_11500 3515 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence250 63 139 gene locus_tag LOCUS_t00100 63 139 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 915 1739 gene locus_tag LOCUS_11510 915 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2389 3945 gene locus_tag LOCUS_11520 2389 3945 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence251 1836 2606 gene locus_tag LOCUS_11530 1836 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence252 305 1348 gene locus_tag LOCUS_11540 305 1348 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085740.1 protein_id gnl|my_center|LOCUS_11540 1350 2909 gene locus_tag LOCUS_11550 gene mqo 1350 2909 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099345.1 protein_id gnl|my_center|LOCUS_11550 2945 3904 gene locus_tag LOCUS_11560 gene dapA 2945 3904 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172098.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence253 <1 1036 gene locus_tag LOCUS_11570 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813875.1:NAD-dependent DNA ligase LigA 1067 1693 gene locus_tag LOCUS_11580 1067 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 <4284 1975 gene locus_tag LOCUS_11590 <4284 1975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258815.1:pyruvate, phosphate dikinase >Feature sequence254 3965 1758 gene locus_tag LOCUS_11600 3965 1758 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120924.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence255 <1 1179 gene locus_tag LOCUS_11610 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120107.1:PSD1 and planctomycete cytochrome C domain-containing protein 1299 2015 gene locus_tag LOCUS_11620 gene lutA 1299 2015 CDS product lactate utilization iron-sulfur protein LutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244353.1 protein_id gnl|my_center|LOCUS_11620 2071 3519 gene locus_tag LOCUS_11630 gene lutB 2071 3519 CDS product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 protein_id gnl|my_center|LOCUS_11630 3516 4214 gene locus_tag LOCUS_11640 3516 4214 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence256 1886 369 gene locus_tag LOCUS_11650 1886 369 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_11650 2036 2722 gene locus_tag LOCUS_11660 2036 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2818 4188 gene locus_tag LOCUS_11670 2818 4188 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462056.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence257 <1 3097 gene locus_tag LOCUS_11680 <1 3097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121858.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence258 2173 1304 gene locus_tag LOCUS_11690 2173 1304 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_11690 3282 2146 gene locus_tag LOCUS_11700 3282 2146 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_11700 <4224 3304 gene locus_tag LOCUS_11710 <4224 3304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007340179.1:circularly permuted type 2 ATP-grasp protein >Feature sequence259 <1 2027 gene locus_tag LOCUS_11720 <1 2027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666716.1:PSD1 and planctomycete cytochrome C domain-containing protein 2037 3473 gene locus_tag LOCUS_11730 2037 3473 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_11730 3663 3750 gene locus_tag LOCUS_t00110 3663 3750 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence260 1950 1129 gene locus_tag LOCUS_11740 1950 1129 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255197.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence261 807 1055 gene locus_tag LOCUS_11750 807 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1172 1465 gene locus_tag LOCUS_11760 1172 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1462 1890 gene locus_tag LOCUS_11770 1462 1890 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_11770 1909 2421 gene locus_tag LOCUS_11780 1909 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2436 3641 gene locus_tag LOCUS_11790 2436 3641 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_11790 3638 3979 gene locus_tag LOCUS_11800 3638 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence262 608 339 gene locus_tag LOCUS_11810 gene rpsN 608 339 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_11810 1034 1897 gene locus_tag LOCUS_11820 1034 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2035 3144 gene locus_tag LOCUS_11830 gene aroB 2035 3144 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence263 1853 468 gene locus_tag LOCUS_11840 1853 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2800 1850 gene locus_tag LOCUS_11850 2800 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence264 1338 553 gene locus_tag LOCUS_11860 1338 553 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_11860 2420 1365 gene locus_tag LOCUS_11870 2420 1365 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615432.1 protein_id gnl|my_center|LOCUS_11870 <4174 2445 gene locus_tag LOCUS_11880 <4174 2445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189933.1:tetratricopeptide repeat protein >Feature sequence265 103 1143 gene locus_tag LOCUS_11890 103 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1189 1908 gene locus_tag LOCUS_11900 1189 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 2184 3440 gene locus_tag LOCUS_11910 2184 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence266 265 2958 gene locus_tag LOCUS_11920 265 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3571 3188 gene locus_tag LOCUS_11930 gene gcvH 3571 3188 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069578.1 protein_id gnl|my_center|LOCUS_11930 <4158 3606 gene locus_tag LOCUS_11940 <4158 3606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393443.1:glycine cleavage system aminomethyltransferase GcvT >Feature sequence267 1661 342 gene locus_tag LOCUS_11950 gene argA 1661 342 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_11950 1993 2388 gene locus_tag LOCUS_11960 1993 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2483 3115 gene locus_tag LOCUS_11970 gene tmk 2483 3115 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039005.1 protein_id gnl|my_center|LOCUS_11970 3276 3662 gene locus_tag LOCUS_11980 3276 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence268 <4135 1241 gene locus_tag LOCUS_11990 <4135 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120107.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence269 1172 390 gene locus_tag LOCUS_12000 gene sufC 1172 390 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_12000 1795 1235 gene locus_tag LOCUS_12010 1795 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2068 3909 gene locus_tag LOCUS_12020 2068 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence270 640 44 gene locus_tag LOCUS_12030 640 44 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_12030 2018 780 gene locus_tag LOCUS_12040 2018 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3145 2015 gene locus_tag LOCUS_12050 3145 2015 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388688.1 protein_id gnl|my_center|LOCUS_12050 <4114 3142 gene locus_tag LOCUS_12060 <4114 3142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257103.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence271 150 1310 gene locus_tag LOCUS_12070 150 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1524 2090 gene locus_tag LOCUS_12080 1524 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2195 2593 gene locus_tag LOCUS_12090 2195 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence272 961 584 gene locus_tag LOCUS_12100 gene rplL 961 584 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975165.1 protein_id gnl|my_center|LOCUS_12100 1724 1164 gene locus_tag LOCUS_12110 gene rplJ 1724 1164 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700677.1 protein_id gnl|my_center|LOCUS_12110 2440 1739 gene locus_tag LOCUS_12120 gene rplA 2440 1739 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811658.1 protein_id gnl|my_center|LOCUS_12120 2748 3710 gene locus_tag LOCUS_12130 2748 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence273 1406 669 gene locus_tag LOCUS_12140 1406 669 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_12140 2342 1413 gene locus_tag LOCUS_12150 2342 1413 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_12150 2890 2339 gene locus_tag LOCUS_12160 2890 2339 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12160 >Feature sequence274 263 2431 gene locus_tag LOCUS_12170 263 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2438 3142 gene locus_tag LOCUS_12180 2438 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence275 816 2897 gene locus_tag LOCUS_12190 816 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2977 3870 gene locus_tag LOCUS_12200 gene glxR 2977 3870 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765839.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence276 1523 2419 gene locus_tag LOCUS_12210 1523 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence277 264 1946 gene locus_tag LOCUS_12220 gene rpsA 264 1946 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882963.1 protein_id gnl|my_center|LOCUS_12220 1989 2144 gene locus_tag LOCUS_12230 1989 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2152 2505 gene locus_tag LOCUS_12240 2152 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence278 2142 496 gene locus_tag LOCUS_12250 2142 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2761 2345 gene locus_tag LOCUS_12260 2761 2345 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546768.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence279 2361 1297 gene locus_tag LOCUS_12270 2361 1297 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087343.1 protein_id gnl|my_center|LOCUS_12270 2549 3523 gene locus_tag LOCUS_12280 2549 3523 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705966.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence280 1472 27 gene locus_tag LOCUS_12290 1472 27 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_12290 3811 1469 gene locus_tag LOCUS_12300 3811 1469 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence281 3504 1840 gene locus_tag LOCUS_12310 3504 1840 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence282 <1 1546 gene locus_tag LOCUS_12320 <1 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001098240.1:sodium/solute symporter 1723 2487 gene locus_tag LOCUS_12330 gene fabG 1723 2487 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_12330 2499 2960 gene locus_tag LOCUS_12340 2499 2960 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035432.1 protein_id gnl|my_center|LOCUS_12340 2945 3643 gene locus_tag LOCUS_12350 gene pgl 2945 3643 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence283 583 1617 gene locus_tag LOCUS_12360 583 1617 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921628.1 protein_id gnl|my_center|LOCUS_12360 2947 1802 gene locus_tag LOCUS_12370 2947 1802 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_12370 3102 3830 gene locus_tag LOCUS_12380 gene nth 3102 3830 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence284 608 1441 gene locus_tag LOCUS_12390 608 1441 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388866.1 protein_id gnl|my_center|LOCUS_12390 3399 1660 gene locus_tag LOCUS_12400 3399 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence285 2693 510 gene locus_tag LOCUS_12410 2693 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3732 2740 gene locus_tag LOCUS_12420 3732 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence286 3819 454 gene locus_tag LOCUS_12430 3819 454 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence287 659 435 gene locus_tag LOCUS_12440 659 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1311 805 gene locus_tag LOCUS_12450 1311 805 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023176053.1 protein_id gnl|my_center|LOCUS_12450 1427 3622 gene locus_tag LOCUS_12460 gene ppk1 1427 3622 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039238.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence288 <1 984 gene locus_tag LOCUS_12470 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398810.1:citrate synthase 1619 1032 gene locus_tag LOCUS_12480 1619 1032 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_12480 2467 1634 gene locus_tag LOCUS_12490 gene ispE 2467 1634 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_12490 <3969 2645 gene locus_tag LOCUS_12500 <3969 2645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125298.1:acetoacetate metabolism transcriptional regulator AtoC >Feature sequence289 2112 562 gene locus_tag LOCUS_12510 2112 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3732 2122 gene locus_tag LOCUS_12520 3732 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence290 >Feature sequence291 2141 378 gene locus_tag LOCUS_12530 gene cysI 2141 378 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_12530 3445 2228 gene locus_tag LOCUS_12540 gene fabF 3445 2228 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence292 <1 1234 gene locus_tag LOCUS_12550 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031019.1:alkaline phosphatase family protein 1523 2026 gene locus_tag LOCUS_12560 1523 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 2030 2980 gene locus_tag LOCUS_12570 2030 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3523 3146 gene locus_tag LOCUS_12580 3523 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence293 <1 1354 gene locus_tag LOCUS_12590 <1 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922507.1:arylsulfatase 1402 3243 gene locus_tag LOCUS_12600 1402 3243 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence294 232 1815 gene locus_tag LOCUS_12610 gene guaB 232 1815 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_12610 2046 2816 gene locus_tag LOCUS_12620 2046 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2919 3389 gene locus_tag LOCUS_12630 2919 3389 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence295 2939 1602 gene locus_tag LOCUS_12640 2939 1602 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_12640 <3878 2976 gene locus_tag LOCUS_12650 <3878 2976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939521.1:Tex family protein >Feature sequence296 575 1036 gene locus_tag LOCUS_12660 575 1036 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810241.1 protein_id gnl|my_center|LOCUS_12660 1188 1994 gene locus_tag LOCUS_12670 gene proC 1188 1994 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_12670 2001 2843 gene locus_tag LOCUS_12680 2001 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2867 3814 gene locus_tag LOCUS_12690 2867 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence297 <1 2555 gene locus_tag LOCUS_12700 <1 2555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005692755.1:RNA polymerase-associated protein RapA >Feature sequence298 54 587 gene locus_tag LOCUS_12710 54 587 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921864.1 protein_id gnl|my_center|LOCUS_12710 584 2062 gene locus_tag LOCUS_12720 584 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence299 243 1631 gene locus_tag LOCUS_12730 243 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1762 1689 gene locus_tag LOCUS_t00120 1762 1689 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1990 2646 gene locus_tag LOCUS_12740 1990 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3749 2685 gene locus_tag LOCUS_12750 3749 2685 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence300 751 1770 gene locus_tag LOCUS_12760 751 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2874 1819 gene locus_tag LOCUS_12770 gene lpxD 2874 1819 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871590.1 protein_id gnl|my_center|LOCUS_12770 3470 2886 gene locus_tag LOCUS_12780 3470 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence301 387 1556 gene locus_tag LOCUS_12790 gene rlmN 387 1556 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_12790 2709 1831 gene locus_tag LOCUS_12800 2709 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence302 <3816 383 gene locus_tag LOCUS_12810 <3816 383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704393.1:response regulator >Feature sequence303 890 678 gene locus_tag LOCUS_12820 890 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2599 1226 gene locus_tag LOCUS_12830 2599 1226 CDS product IS66-like element ISBthe6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005805141.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12830 3508 2768 gene locus_tag LOCUS_12840 3508 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence304 411 76 gene locus_tag LOCUS_12850 411 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1257 919 gene locus_tag LOCUS_12860 1257 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1637 1494 gene locus_tag LOCUS_12870 1637 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1869 2777 gene locus_tag LOCUS_12880 1869 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 3364 2870 gene locus_tag LOCUS_12890 3364 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3608 3357 gene locus_tag LOCUS_12900 3608 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence305 <1 2130 gene locus_tag LOCUS_12910 <1 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938554.1:glutamine synthetase III <3789 2245 gene locus_tag LOCUS_12920 <3789 2245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940210.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence306 142 405 gene locus_tag LOCUS_12930 142 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 452 1852 gene locus_tag LOCUS_12940 452 1852 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_12940 1849 2784 gene locus_tag LOCUS_12950 1849 2784 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122544.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence307 3312 1882 gene locus_tag LOCUS_12960 gene lysA 3312 1882 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880764.1 protein_id gnl|my_center|LOCUS_12960 3781 3338 gene locus_tag LOCUS_12970 3781 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence308 1430 3721 gene locus_tag LOCUS_12980 gene rnr 1430 3721 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391817.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence309 3068 1905 gene locus_tag LOCUS_12990 3068 1905 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence310 532 50 gene locus_tag LOCUS_13000 532 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 622 1380 gene locus_tag LOCUS_13010 622 1380 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_13010 1391 2344 gene locus_tag LOCUS_13020 1391 2344 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_13020 2341 3591 gene locus_tag LOCUS_13030 2341 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence311 2495 1824 gene locus_tag LOCUS_13040 2495 1824 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence312 5 2524 gene locus_tag LOCUS_13050 5 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 <3763 2601 gene locus_tag LOCUS_13060 <3763 2601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921843.1:DUF1501 domain-containing protein >Feature sequence313 1008 2330 gene locus_tag LOCUS_13070 1008 2330 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531269.1 protein_id gnl|my_center|LOCUS_13070 <3761 2632 gene locus_tag LOCUS_13080 <3761 2632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028088.1:FdhF/YdeP family oxidoreductase >Feature sequence314 <1 1228 gene locus_tag LOCUS_13090 <1 1228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880145.1:serine--tRNA ligase 1243 2226 gene locus_tag LOCUS_13100 1243 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3213 2398 gene locus_tag LOCUS_13110 3213 2398 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_13110 3358 3600 gene locus_tag LOCUS_13120 3358 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence315 <1 1119 gene locus_tag LOCUS_13130 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119366.1:Gfo/Idh/MocA family oxidoreductase 2523 1156 gene locus_tag LOCUS_13140 2523 1156 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_13140 <3749 2610 gene locus_tag LOCUS_13150 <3749 2610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921690.1:acetylxylan esterase >Feature sequence316 1666 1325 gene locus_tag LOCUS_13160 1666 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1843 1768 gene locus_tag LOCUS_t00130 1843 1768 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence317 3449 414 gene locus_tag LOCUS_13170 3449 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence318 >Feature sequence319 348 266 gene locus_tag LOCUS_t00140 348 266 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2119 506 gene locus_tag LOCUS_13180 2119 506 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 protein_id gnl|my_center|LOCUS_13180 2921 2352 gene locus_tag LOCUS_13190 2921 2352 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_13190 3458 3003 gene locus_tag LOCUS_13200 3458 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence320 1511 381 gene locus_tag LOCUS_13210 1511 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2231 1545 gene locus_tag LOCUS_13220 2231 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2861 2250 gene locus_tag LOCUS_13230 2861 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13230 >Feature sequence321 <1 753 gene locus_tag LOCUS_13240 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008668648.1:DUF1553 domain-containing protein 775 2250 gene locus_tag LOCUS_13250 775 2250 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_13250 <3705 2297 gene locus_tag LOCUS_13260 <3705 2297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118026.1:arylsulfatase >Feature sequence322 <1 1609 gene locus_tag LOCUS_13270 <1 1609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615881.1:c-type cytochrome >Feature sequence323 1087 194 gene locus_tag LOCUS_13280 1087 194 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_13280 2202 1177 gene locus_tag LOCUS_13290 2202 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13290 <3683 2497 gene locus_tag LOCUS_13300 <3683 2497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941319.1:ATP-dependent chaperone ClpB >Feature sequence324 <1 717 gene locus_tag LOCUS_13310 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120982.1:DUF1501 domain-containing protein 714 3488 gene locus_tag LOCUS_13320 714 3488 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence325 495 3185 gene locus_tag LOCUS_13330 495 3185 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence326 2308 1874 gene locus_tag LOCUS_13340 gene flgD 2308 1874 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666981.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence327 744 1430 gene locus_tag LOCUS_13350 744 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_13350 1457 3376 gene locus_tag LOCUS_13360 1457 3376 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence328 260 1630 gene locus_tag LOCUS_13370 260 1630 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_13370 1750 2292 gene locus_tag LOCUS_13380 1750 2292 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_13380 3548 2580 gene locus_tag LOCUS_13390 3548 2580 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence329 476 1141 gene locus_tag LOCUS_13400 476 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1661 1230 gene locus_tag LOCUS_13410 1661 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2610 1675 gene locus_tag LOCUS_13420 gene rnhC 2610 1675 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_13420 3330 2989 gene locus_tag LOCUS_13430 3330 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence330 245 913 gene locus_tag LOCUS_13440 245 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1059 2246 gene locus_tag LOCUS_13450 1059 2246 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_13450 2669 2848 gene locus_tag LOCUS_13460 2669 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3158 3613 gene locus_tag LOCUS_13470 3158 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence331 3413 1143 gene locus_tag LOCUS_13480 3413 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence332 298 2991 gene locus_tag LOCUS_13490 298 2991 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120136.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence333 1211 597 gene locus_tag LOCUS_13500 1211 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1423 2031 gene locus_tag LOCUS_13510 1423 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2114 3013 gene locus_tag LOCUS_13520 2114 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence334 289 2415 gene locus_tag LOCUS_13530 gene recG 289 2415 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence335 352 44 gene locus_tag LOCUS_13540 352 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 929 366 gene locus_tag LOCUS_13550 gene pabA 929 366 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602287.1 protein_id gnl|my_center|LOCUS_13550 2472 943 gene locus_tag LOCUS_13560 gene trpE 2472 943 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_13560 2862 2476 gene locus_tag LOCUS_13570 gene hisI 2862 2476 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403778.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence336 845 2275 gene locus_tag LOCUS_13580 845 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2283 3101 gene locus_tag LOCUS_13590 2283 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence337 <1 1578 gene locus_tag LOCUS_13600 <1 1578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615966.1:DUF1592 domain-containing protein 1600 2931 gene locus_tag LOCUS_13610 1600 2931 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence338 <1 690 gene locus_tag LOCUS_13620 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932017.1:MlaD family protein 687 1124 gene locus_tag LOCUS_13630 687 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1144 2439 gene locus_tag LOCUS_13640 1144 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence339 2755 461 gene locus_tag LOCUS_13650 2755 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 <3573 2752 gene locus_tag LOCUS_13660 <3573 2752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939072.1:SDR family oxidoreductase >Feature sequence340 188 742 gene locus_tag LOCUS_13670 gene pyrR 188 742 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938679.1 protein_id gnl|my_center|LOCUS_13670 739 1719 gene locus_tag LOCUS_13680 739 1719 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_13680 1769 3049 gene locus_tag LOCUS_13690 1769 3049 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence341 521 48 gene locus_tag LOCUS_13700 521 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 660 1439 gene locus_tag LOCUS_13710 660 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971058.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13710 1897 2088 gene locus_tag LOCUS_13720 1897 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2326 3516 gene locus_tag LOCUS_13730 gene moeB 2326 3516 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence342 2199 1996 gene locus_tag LOCUS_13740 2199 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence343 77 1003 gene locus_tag LOCUS_13750 77 1003 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930066.1 protein_id gnl|my_center|LOCUS_13750 2644 1037 gene locus_tag LOCUS_13760 2644 1037 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400549.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence344 <3550 2828 gene locus_tag LOCUS_13770 <3550 2828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121153.1:DUF1552 domain-containing protein >Feature sequence345 1836 919 gene locus_tag LOCUS_13780 1836 919 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_13780 2794 1916 gene locus_tag LOCUS_13790 gene folD 2794 1916 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_13790 <3550 2875 gene locus_tag LOCUS_13800 <3550 2875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147367246.1:lysophospholipid acyltransferase family protein >Feature sequence346 1434 544 gene locus_tag LOCUS_13810 1434 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1617 2585 gene locus_tag LOCUS_13820 1617 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence347 <1 3084 gene locus_tag LOCUS_13830 <1 3084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117890.1:DUF1592 domain-containing protein >Feature sequence348 78 494 gene locus_tag LOCUS_13840 78 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence349 551 288 gene locus_tag LOCUS_13850 551 288 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_13850 766 1332 gene locus_tag LOCUS_13860 766 1332 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 protein_id gnl|my_center|LOCUS_13860 1372 1824 gene locus_tag LOCUS_13870 1372 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2702 2061 gene locus_tag LOCUS_13880 2702 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence350 1546 158 gene locus_tag LOCUS_13890 gene lpdA 1546 158 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_13890 2380 1613 gene locus_tag LOCUS_13900 2380 1613 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672317.1 protein_id gnl|my_center|LOCUS_13900 <3529 2522 gene locus_tag LOCUS_13910 <3529 2522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259099.1:glutamate synthase large subunit >Feature sequence351 <1 1530 gene locus_tag LOCUS_13920 <1 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922542.1:DUF1553 domain-containing protein 1548 3002 gene locus_tag LOCUS_13930 1548 3002 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671603.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence352 653 2851 gene locus_tag LOCUS_13940 653 2851 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence353 <3526 857 gene locus_tag LOCUS_13950 <3526 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008664503.1:DUF1592 domain-containing protein >Feature sequence354 156 1031 gene locus_tag LOCUS_13960 156 1031 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_13960 2365 1076 gene locus_tag LOCUS_13970 2365 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence355 52 1467 gene locus_tag LOCUS_13980 52 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2814 1495 gene locus_tag LOCUS_13990 2814 1495 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence356 >Feature sequence357 135 1325 gene locus_tag LOCUS_14000 135 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1330 2490 gene locus_tag LOCUS_14010 1330 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence358 2258 2330 gene locus_tag LOCUS_t00150 2258 2330 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence359 <1 1309 gene locus_tag LOCUS_14020 <1 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968790.1:chromate transporter 1433 3379 gene locus_tag LOCUS_14030 1433 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence360 218 1516 gene locus_tag LOCUS_14040 218 1516 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_14040 1748 1578 gene locus_tag LOCUS_14050 1748 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 2710 3096 gene locus_tag LOCUS_14060 2710 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence361 <1 3225 gene locus_tag LOCUS_14070 <1 3225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein >Feature sequence362 >Feature sequence363 441 677 gene locus_tag LOCUS_14080 441 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1267 782 gene locus_tag LOCUS_14090 1267 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence364 1585 806 gene locus_tag LOCUS_14100 1585 806 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_14100 2641 1682 gene locus_tag LOCUS_14110 2641 1682 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_14110 2761 3075 gene locus_tag LOCUS_14120 2761 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence365 <1 2990 gene locus_tag LOCUS_14130 <1 2990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167355187.1:autotransporter domain-containing protein 3067 3279 gene locus_tag LOCUS_14140 3067 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence366 1470 1141 gene locus_tag LOCUS_14150 1470 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068582.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence367 1948 455 gene locus_tag LOCUS_14160 1948 455 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence368 1815 3209 gene locus_tag LOCUS_14170 1815 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence369 897 262 gene locus_tag LOCUS_14180 897 262 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_14180 1583 921 gene locus_tag LOCUS_14190 gene cmk 1583 921 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408441.1 protein_id gnl|my_center|LOCUS_14190 2959 1580 gene locus_tag LOCUS_14200 gene aroA 2959 1580 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_14200 <3433 2931 gene locus_tag LOCUS_14210 <3433 2931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084213.1:prephenate/arogenate dehydrogenase family protein >Feature sequence370 3 215 gene locus_tag LOCUS_14220 3 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1594 602 gene locus_tag LOCUS_14230 1594 602 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141246.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence371 >Feature sequence372 708 1079 gene locus_tag LOCUS_14240 708 1079 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_14240 1166 1831 gene locus_tag LOCUS_14250 1166 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1936 3210 gene locus_tag LOCUS_14260 1936 3210 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence373 <1 740 gene locus_tag LOCUS_14270 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087229.1:efflux RND transporter permease subunit >Feature sequence374 <1 575 gene locus_tag LOCUS_14280 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392309.1:flagellar biosynthetic protein FliR 611 1705 gene locus_tag LOCUS_14290 gene flhB 611 1705 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870058.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence375 <1 2382 gene locus_tag LOCUS_14300 <1 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140940.1:DUF3656 domain-containing protein 3255 3055 gene locus_tag LOCUS_14310 3255 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence376 213 1589 gene locus_tag LOCUS_14320 213 1589 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_14320 1586 2911 gene locus_tag LOCUS_14330 1586 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence377 <1 579 gene locus_tag LOCUS_14340 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258970.1:SPFH domain-containing protein 2090 747 gene locus_tag LOCUS_14350 2090 747 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_14350 2169 2954 gene locus_tag LOCUS_14360 2169 2954 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence378 1753 1220 gene locus_tag LOCUS_14370 gene cobU 1753 1220 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_14370 2508 1750 gene locus_tag LOCUS_14380 2508 1750 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_14380 <3403 2505 gene locus_tag LOCUS_14390 <3403 2505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258437.1:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase >Feature sequence379 423 1670 gene locus_tag LOCUS_14400 423 1670 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391965.1 protein_id gnl|my_center|LOCUS_14400 2324 1722 gene locus_tag LOCUS_14410 2324 1722 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356449.1 protein_id gnl|my_center|LOCUS_14410 <3391 2336 gene locus_tag LOCUS_14420 <3391 2336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940832.1:argininosuccinate lyase >Feature sequence380 1041 634 gene locus_tag LOCUS_14430 1041 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1734 1057 gene locus_tag LOCUS_14440 1734 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1852 3162 gene locus_tag LOCUS_14450 1852 3162 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759880.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence381 1418 2677 gene locus_tag LOCUS_14460 gene bioA 1418 2677 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence382 349 540 gene locus_tag LOCUS_14470 349 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 737 3124 gene locus_tag LOCUS_14480 737 3124 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence383 1270 653 gene locus_tag LOCUS_14490 1270 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2089 1469 gene locus_tag LOCUS_14500 2089 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence384 <1 961 gene locus_tag LOCUS_14510 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922313.1:TIGR00730 family Rossman fold protein 973 1311 gene locus_tag LOCUS_14520 973 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1308 1799 gene locus_tag LOCUS_14530 1308 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence385 <3361 268 gene locus_tag LOCUS_14540 <3361 268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941791.1:chromosome segregation protein SMC >Feature sequence386 198 125 gene locus_tag LOCUS_t00160 198 125 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 712 2067 gene locus_tag LOCUS_14550 712 2067 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_14550 2175 2804 gene locus_tag LOCUS_14560 2175 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence387 <3354 2259 gene locus_tag LOCUS_14570 <3354 2259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943238.1:tetratricopeptide repeat protein >Feature sequence388 <1 890 gene locus_tag LOCUS_14580 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583633.1:glutamate--tRNA ligase 890 1804 gene locus_tag LOCUS_14590 890 1804 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_14590 1817 3277 gene locus_tag LOCUS_14600 1817 3277 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101332.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence389 173 1279 gene locus_tag LOCUS_14610 173 1279 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_14610 1305 2378 gene locus_tag LOCUS_14620 1305 2378 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_14620 <3350 2411 gene locus_tag LOCUS_14630 <3350 2411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064254968.1:family 16 glycosylhydrolase >Feature sequence390 <1 2312 gene locus_tag LOCUS_14640 <1 2312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722364.1:ferrous iron transport protein B <3350 2542 gene locus_tag LOCUS_14650 <3350 2542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583238.1:type II secretion system ATPase GspE >Feature sequence391 131 2176 gene locus_tag LOCUS_14660 131 2176 CDS product DUF5722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921675.1 protein_id gnl|my_center|LOCUS_14660 2557 2225 gene locus_tag LOCUS_14670 2557 2225 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_14670 2584 3213 gene locus_tag LOCUS_14680 2584 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence392 327 1367 gene locus_tag LOCUS_14690 gene gmd 327 1367 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709513.1 protein_id gnl|my_center|LOCUS_14690 2454 1495 gene locus_tag LOCUS_14700 2454 1495 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193905664.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence393 1084 2412 gene locus_tag LOCUS_14710 1084 2412 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence394 589 1983 gene locus_tag LOCUS_14720 589 1983 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence395 399 184 gene locus_tag LOCUS_14730 399 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 286 3090 gene locus_tag LOCUS_14740 286 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence396 272 1003 gene locus_tag LOCUS_14750 272 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1596 1102 gene locus_tag LOCUS_14760 gene ssb 1596 1102 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_14760 1963 1661 gene locus_tag LOCUS_14770 1963 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2574 2011 gene locus_tag LOCUS_14780 gene pth 2574 2011 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_14780 <3315 2713 gene locus_tag LOCUS_14790 <3315 2713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941323.1:50S ribosomal protein L25 >Feature sequence397 >Feature sequence398 1217 177 gene locus_tag LOCUS_14800 1217 177 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531909.1 protein_id gnl|my_center|LOCUS_14800 1364 2404 gene locus_tag LOCUS_14810 1364 2404 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938297.1 protein_id gnl|my_center|LOCUS_14810 2418 3248 gene locus_tag LOCUS_14820 2418 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence399 <1 1389 gene locus_tag LOCUS_14830 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258936.1:DEAD/DEAH box helicase 1429 2013 gene locus_tag LOCUS_14840 1429 2013 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109429.1 protein_id gnl|my_center|LOCUS_14840 <3289 2153 gene locus_tag LOCUS_14850 <3289 2153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962256.1:di-heme oxidoredictase family protein >Feature sequence400 <1 1742 gene locus_tag LOCUS_14860 <1 1742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120136.1:DUF1592 domain-containing protein 1785 3089 gene locus_tag LOCUS_14870 1785 3089 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence401 1230 7 gene locus_tag LOCUS_14880 1230 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2391 1375 gene locus_tag LOCUS_14890 2391 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 <3268 2388 gene locus_tag LOCUS_14900 <3268 2388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207603.1:SAM-dependent methyltransferase >Feature sequence402 1587 3032 gene locus_tag LOCUS_14910 1587 3032 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence403 <1 741 gene locus_tag LOCUS_14920 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112884.1:MBOAT family protein 742 2445 gene locus_tag LOCUS_14930 742 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2950 2636 gene locus_tag LOCUS_14940 2950 2636 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546807.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence404 1601 141 gene locus_tag LOCUS_14950 1601 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 <3214 1619 gene locus_tag LOCUS_14960 <3214 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082341.1:type III-B CRISPR-associated protein Cas10/Cmr2 >Feature sequence405 <1 1230 gene locus_tag LOCUS_14970 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888658.1:dipeptidase 1869 1273 gene locus_tag LOCUS_14980 gene pgsA 1869 1273 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence406 1143 463 gene locus_tag LOCUS_14990 1143 463 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392446.1 protein_id gnl|my_center|LOCUS_14990 2048 1200 gene locus_tag LOCUS_15000 2048 1200 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence407 <3195 1250 gene locus_tag LOCUS_15010 <3195 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023031.1:formylglycine-generating enzyme family protein >Feature sequence408 715 191 gene locus_tag LOCUS_15020 715 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2854 824 gene locus_tag LOCUS_15030 2854 824 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence409 1375 2826 gene locus_tag LOCUS_15040 gene rseP 1375 2826 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence410 1291 548 gene locus_tag LOCUS_15050 gene pyrH 1291 548 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_15050 1267 2172 gene locus_tag LOCUS_15060 gene trpC 1267 2172 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328328.1 protein_id gnl|my_center|LOCUS_15060 <3171 2207 gene locus_tag LOCUS_15070 <3171 2207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941112.1:ribonuclease D >Feature sequence411 2102 1002 gene locus_tag LOCUS_15080 gene hisC 2102 1002 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence412 2529 1342 gene locus_tag LOCUS_15090 gene speY 2529 1342 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence413 >Feature sequence414 190 1005 gene locus_tag LOCUS_15100 190 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2828 1002 gene locus_tag LOCUS_15110 2828 1002 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643601.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence415 575 1612 gene locus_tag LOCUS_15120 575 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1645 2076 gene locus_tag LOCUS_15130 gene gspG 1645 2076 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070566.1 protein_id gnl|my_center|LOCUS_15130 2171 3085 gene locus_tag LOCUS_15140 2171 3085 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence416 175 1803 gene locus_tag LOCUS_15150 175 1803 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_15150 2906 1800 gene locus_tag LOCUS_15160 2906 1800 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036868.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence417 <1 589 gene locus_tag LOCUS_15170 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038462.1:pyridoxal phosphate-dependent aminotransferase 837 2741 gene locus_tag LOCUS_15180 gene dnaG 837 2741 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence418 564 791 gene locus_tag LOCUS_15190 564 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2023 884 gene locus_tag LOCUS_15200 2023 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2191 2120 gene locus_tag LOCUS_t00170 2191 2120 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2322 3101 gene locus_tag LOCUS_15210 2322 3101 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence419 <1 2444 gene locus_tag LOCUS_15220 <1 2444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120107.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence420 236 493 gene locus_tag LOCUS_15230 236 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 490 711 gene locus_tag LOCUS_15240 490 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 716 1111 gene locus_tag LOCUS_15250 716 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1191 1676 gene locus_tag LOCUS_15260 1191 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1673 3049 gene locus_tag LOCUS_15270 gene hpnJ 1673 3049 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence421 <1 915 gene locus_tag LOCUS_15280 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258563.1:tryptophan synthase subunit beta 934 1809 gene locus_tag LOCUS_15290 934 1809 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_15290 1812 2453 gene locus_tag LOCUS_15300 gene gmk 1812 2453 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_15300 2450 3022 gene locus_tag LOCUS_15310 2450 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence422 2572 1682 gene locus_tag LOCUS_15320 2572 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15320 <3108 2569 gene locus_tag LOCUS_15330 <3108 2569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120961.1:DUF1501 domain-containing protein note possible pseudo, frameshifted >Feature sequence423 326 682 gene locus_tag LOCUS_15340 gene tnpB 326 682 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612591.1 protein_id gnl|my_center|LOCUS_15340 770 2353 gene locus_tag LOCUS_15350 770 2353 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000402.1 protein_id gnl|my_center|LOCUS_15350 2601 2257 gene locus_tag LOCUS_15360 2601 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence424 605 78 gene locus_tag LOCUS_15370 605 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 695 1780 gene locus_tag LOCUS_15380 gene rlmN 695 1780 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450546.1 protein_id gnl|my_center|LOCUS_15380 1910 2569 gene locus_tag LOCUS_15390 1910 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence425 856 2103 gene locus_tag LOCUS_15400 856 2103 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_15400 2100 2591 gene locus_tag LOCUS_15410 2100 2591 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence426 >Feature sequence427 1474 731 gene locus_tag LOCUS_15420 1474 731 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_15420 2473 2015 gene locus_tag LOCUS_15430 2473 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence428 40 1638 gene locus_tag LOCUS_15440 40 1638 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence429 <1 2368 gene locus_tag LOCUS_15450 <1 2368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146849598.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence430 323 1927 gene locus_tag LOCUS_15460 323 1927 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037069003.1 protein_id gnl|my_center|LOCUS_15460 3003 1831 gene locus_tag LOCUS_15470 3003 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence431 183 1 gene locus_tag LOCUS_15480 183 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 574 921 gene locus_tag LOCUS_15490 574 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 926 1264 gene locus_tag LOCUS_15500 926 1264 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142157.1 protein_id gnl|my_center|LOCUS_15500 1397 1777 gene locus_tag LOCUS_15510 1397 1777 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184510.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence432 >Feature sequence433 324 1109 gene locus_tag LOCUS_15520 324 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 994 1446 gene locus_tag LOCUS_15530 994 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1458 1808 gene locus_tag LOCUS_15540 1458 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2765 2226 gene locus_tag LOCUS_15550 2765 2226 CDS product 5'-nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208025.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence434 <1 521 gene locus_tag LOCUS_15560 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546348.1:ABC transporter substrate-binding protein 534 1385 gene locus_tag LOCUS_15570 534 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1478 2686 gene locus_tag LOCUS_15580 1478 2686 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_15580 2827 2742 gene locus_tag LOCUS_t00180 2827 2742 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence435 2245 311 gene locus_tag LOCUS_15590 gene ettA 2245 311 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_15590 2485 2255 gene locus_tag LOCUS_15600 2485 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 <3057 2485 gene locus_tag LOCUS_15610 <3057 2485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186468.1:NADH-quinone oxidoreductase subunit NuoN >Feature sequence436 >Feature sequence437 <1 593 gene locus_tag LOCUS_15620 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027423.1:FAD-dependent oxidoreductase 667 1398 gene locus_tag LOCUS_15630 667 1398 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356161.1 protein_id gnl|my_center|LOCUS_15630 <3054 1890 gene locus_tag LOCUS_15640 <3054 1890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119052.1:DUF1501 domain-containing protein >Feature sequence438 1866 256 gene locus_tag LOCUS_15650 1866 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2283 3029 gene locus_tag LOCUS_15660 2283 3029 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence439 585 1643 gene locus_tag LOCUS_15670 585 1643 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522216.1 protein_id gnl|my_center|LOCUS_15670 1746 2651 gene locus_tag LOCUS_15680 1746 2651 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence440 1 1779 gene locus_tag LOCUS_15690 1 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 <3045 2226 gene locus_tag LOCUS_15700 <3045 2226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118969.1:xylose isomerase >Feature sequence441 >Feature sequence442 375 1682 gene locus_tag LOCUS_15710 375 1682 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_15710 1816 2934 gene locus_tag LOCUS_15720 1816 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence443 1575 1183 gene locus_tag LOCUS_15730 1575 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2054 1644 gene locus_tag LOCUS_15740 gene fliS 2054 1644 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050477.1 protein_id gnl|my_center|LOCUS_15740 2381 2079 gene locus_tag LOCUS_15750 2381 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence444 385 1662 gene locus_tag LOCUS_15760 385 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2508 1786 gene locus_tag LOCUS_15770 2508 1786 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929203.1 protein_id gnl|my_center|LOCUS_15770 2851 2591 gene locus_tag LOCUS_15780 2851 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence445 1680 394 gene locus_tag LOCUS_15790 1680 394 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_15790 2680 1796 gene locus_tag LOCUS_15800 2680 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence446 1819 386 gene locus_tag LOCUS_15810 1819 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2746 1892 gene locus_tag LOCUS_15820 gene purU 2746 1892 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence447 <3008 97 gene locus_tag LOCUS_15830 <3008 97 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921983.1:DUF1553 domain-containing protein >Feature sequence448 1473 73 gene locus_tag LOCUS_15840 1473 73 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123574.1 protein_id gnl|my_center|LOCUS_15840 2587 1538 gene locus_tag LOCUS_15850 2587 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence449 649 804 gene locus_tag LOCUS_15860 649 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2138 954 gene locus_tag LOCUS_15870 2138 954 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence450 584 30 gene locus_tag LOCUS_15880 584 30 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_15880 2102 603 gene locus_tag LOCUS_15890 gene xylB 2102 603 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267678.1 protein_id gnl|my_center|LOCUS_15890 2197 2580 gene locus_tag LOCUS_15900 2197 2580 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530919.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence451 1750 2721 gene locus_tag LOCUS_15910 1750 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence452 <1 522 gene locus_tag LOCUS_15920 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337278.1:glucose 1-dehydrogenase >Feature sequence453 1878 775 gene locus_tag LOCUS_15930 gene murG 1878 775 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_15930 <2986 1880 gene locus_tag LOCUS_15940 <2986 1880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460697.1:stage V sporulation protein E >Feature sequence454 1782 625 gene locus_tag LOCUS_15950 1782 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 <2981 1779 gene locus_tag LOCUS_15960 <2981 1779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099260568.1:sulfatase-like hydrolase/transferase >Feature sequence455 <2972 2273 gene locus_tag LOCUS_15970 <2972 2273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056537.1:phenylalanine--tRNA ligase subunit alpha >Feature sequence456 634 296 gene locus_tag LOCUS_15980 634 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1459 830 gene locus_tag LOCUS_15990 1459 830 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_15990 1822 1535 gene locus_tag LOCUS_16000 1822 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence457 1459 431 gene locus_tag LOCUS_16010 1459 431 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338084.1 protein_id gnl|my_center|LOCUS_16010 2457 1459 gene locus_tag LOCUS_16020 2457 1459 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence458 <1 1260 gene locus_tag LOCUS_16030 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941582.1:DEAD/DEAH box helicase >Feature sequence459 1829 774 gene locus_tag LOCUS_16040 1829 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1973 2593 gene locus_tag LOCUS_16050 1973 2593 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231038.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence460 >Feature sequence461 1458 487 gene locus_tag LOCUS_16060 1458 487 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531149.1 protein_id gnl|my_center|LOCUS_16060 1831 1460 gene locus_tag LOCUS_16070 1831 1460 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_16070 <2948 1868 gene locus_tag LOCUS_16080 <2948 1868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928957.1:acyltransferase family protein >Feature sequence462 <1 1138 gene locus_tag LOCUS_16090 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922220.1:aldehyde dehydrogenase family protein 1150 2286 gene locus_tag LOCUS_16100 1150 2286 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence463 <1 880 gene locus_tag LOCUS_16110 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203586.1:nucleotidyltransferase 2126 1128 gene locus_tag LOCUS_16120 2126 1128 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_16120 2161 2622 gene locus_tag LOCUS_16130 2161 2622 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_16130 2706 2828 gene locus_tag LOCUS_16140 2706 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence464 344 135 gene locus_tag LOCUS_16150 344 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 844 771 gene locus_tag LOCUS_t00190 844 771 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1114 1884 gene locus_tag LOCUS_16160 1114 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 <2933 1898 gene locus_tag LOCUS_16170 <2933 1898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727730.1:heme-binding protein >Feature sequence465 <1 2466 gene locus_tag LOCUS_16180 <1 2466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038548.1:carboxy terminal-processing peptidase >Feature sequence466 <1 1860 gene locus_tag LOCUS_16190 <1 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615806.1:tetratricopeptide repeat protein 1857 2720 gene locus_tag LOCUS_16200 1857 2720 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence467 560 1507 gene locus_tag LOCUS_16210 560 1507 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_16210 1514 2668 gene locus_tag LOCUS_16220 1514 2668 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence468 1176 463 gene locus_tag LOCUS_16230 1176 463 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_16230 2065 1265 gene locus_tag LOCUS_16240 2065 1265 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_16240 2333 2626 gene locus_tag LOCUS_16250 2333 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence469 >Feature sequence470 1495 98 gene locus_tag LOCUS_16260 1495 98 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_16260 <2887 1638 gene locus_tag LOCUS_16270 <2887 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940682.1:DNA gyrase subunit A >Feature sequence471 351 1190 gene locus_tag LOCUS_16280 351 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1685 1209 gene locus_tag LOCUS_16290 1685 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 <2887 1805 gene locus_tag LOCUS_16300 <2887 1805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257333.1:cysteine desulfurase family protein >Feature sequence472 506 1915 gene locus_tag LOCUS_16310 506 1915 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence473 1937 735 gene locus_tag LOCUS_16320 1937 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence474 <1 977 gene locus_tag LOCUS_16330 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064291.1:acetamidase/formamidase family protein 989 1324 gene locus_tag LOCUS_16340 989 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1487 2008 gene locus_tag LOCUS_16350 1487 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence475 188 457 gene locus_tag LOCUS_16360 188 457 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878321.1 protein_id gnl|my_center|LOCUS_16360 566 1393 gene locus_tag LOCUS_16370 566 1393 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228130.1 protein_id gnl|my_center|LOCUS_16370 1436 1849 gene locus_tag LOCUS_16380 1436 1849 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887102.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence476 314 1975 gene locus_tag LOCUS_16390 314 1975 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_16390 1978 2706 gene locus_tag LOCUS_16400 1978 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence477 <1 527 gene locus_tag LOCUS_16410 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964744.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 672 1178 gene locus_tag LOCUS_16420 672 1178 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_16420 1233 1799 gene locus_tag LOCUS_16430 1233 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2538 1954 gene locus_tag LOCUS_16440 gene purN 2538 1954 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence478 <1 672 gene locus_tag LOCUS_16450 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076054256.1:alpha/beta hydrolase 769 1257 gene locus_tag LOCUS_16460 769 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1437 1805 gene locus_tag LOCUS_16470 1437 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence479 680 1990 gene locus_tag LOCUS_16480 680 1990 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence480 239 1816 gene locus_tag LOCUS_16490 239 1816 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_16490 2313 2080 gene locus_tag LOCUS_16500 2313 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2624 2451 gene locus_tag LOCUS_16510 2624 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence481 1110 1376 gene locus_tag LOCUS_16520 gene rpmB 1110 1376 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882975.1 protein_id gnl|my_center|LOCUS_16520 1516 1719 gene locus_tag LOCUS_16530 1516 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence482 2708 1998 gene locus_tag LOCUS_16540 2708 1998 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence483 >Feature sequence484 <2828 107 gene locus_tag LOCUS_16550 <2828 107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120525.1:serine/threonine-protein kinase >Feature sequence485 1378 2649 gene locus_tag LOCUS_16560 1378 2649 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence486 1011 85 gene locus_tag LOCUS_16570 gene metA 1011 85 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_16570 2370 1081 gene locus_tag LOCUS_16580 2370 1081 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence487 >Feature sequence488 331 1326 gene locus_tag LOCUS_16590 331 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1326 2762 gene locus_tag LOCUS_16600 1326 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence489 316 2349 gene locus_tag LOCUS_16610 316 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence490 2016 1132 gene locus_tag LOCUS_16620 2016 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2072 2386 gene locus_tag LOCUS_16630 2072 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence491 2121 151 gene locus_tag LOCUS_16640 2121 151 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 protein_id gnl|my_center|LOCUS_16640 <2793 2163 gene locus_tag LOCUS_16650 <2793 2163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117890.1:DUF1592 domain-containing protein >Feature sequence492 3 1247 gene locus_tag LOCUS_16660 3 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2522 1563 gene locus_tag LOCUS_16670 2522 1563 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228903.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence493 723 2069 gene locus_tag LOCUS_16680 723 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2110 2490 gene locus_tag LOCUS_16690 2110 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence494 672 64 gene locus_tag LOCUS_16700 672 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 717 2192 gene locus_tag LOCUS_16710 gene recD 717 2192 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence495 1865 2161 gene locus_tag LOCUS_16720 1865 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence496 >Feature sequence497 <1 891 gene locus_tag LOCUS_16730 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933145.1:UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase 1913 897 gene locus_tag LOCUS_16740 1913 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence498 <1 849 gene locus_tag LOCUS_16750 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838490.1:TolC family protein 846 1538 gene locus_tag LOCUS_16760 846 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1984 1481 gene locus_tag LOCUS_16770 1984 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence499 284 1909 gene locus_tag LOCUS_16780 284 1909 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence500 1546 215 gene locus_tag LOCUS_16790 1546 215 CDS product IS4-like element ISGvi2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140150.1 protein_id gnl|my_center|LOCUS_16790 2251 2745 gene locus_tag LOCUS_16800 2251 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence501 <1 1069 gene locus_tag LOCUS_16810 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545685.1:DegQ family serine endoprotease >Feature sequence502 >Feature sequence503 393 983 gene locus_tag LOCUS_16820 gene hisB 393 983 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_16820 998 1615 gene locus_tag LOCUS_16830 gene hisH 998 1615 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023176026.1 protein_id gnl|my_center|LOCUS_16830 1663 2388 gene locus_tag LOCUS_16840 gene hisA 1663 2388 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436675.1 protein_id gnl|my_center|LOCUS_16840 2747 2385 gene locus_tag LOCUS_16850 2747 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence504 493 1539 gene locus_tag LOCUS_16860 493 1539 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_16860 1622 2431 gene locus_tag LOCUS_16870 gene mreC 1622 2431 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence505 479 2692 gene locus_tag LOCUS_16880 479 2692 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922366.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence506 <1 1182 gene locus_tag LOCUS_16890 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120539.1:acetylxylan esterase 1313 2500 gene locus_tag LOCUS_16900 1313 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence507 1080 169 gene locus_tag LOCUS_16910 1080 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2325 1090 gene locus_tag LOCUS_16920 2325 1090 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence508 >Feature sequence509 56 1585 gene locus_tag LOCUS_16930 56 1585 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530716.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence510 <2716 95 gene locus_tag LOCUS_16940 <2716 95 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122384.1:vegetatible incompatibility protein HET-E1 >Feature sequence511 290 1042 gene locus_tag LOCUS_16950 290 1042 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_16950 1136 2326 gene locus_tag LOCUS_16960 1136 2326 CDS product CBU_0270 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957471.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence512 <2714 1282 gene locus_tag LOCUS_16970 <2714 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729624.1:methionine synthase >Feature sequence513 185 1714 gene locus_tag LOCUS_16980 185 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence514 1831 548 gene locus_tag LOCUS_16990 1831 548 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038748.1 protein_id gnl|my_center|LOCUS_16990 <2708 2046 gene locus_tag LOCUS_17000 <2708 2046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001168054.1:3-deoxy-7-phosphoheptulonate synthase AroF >Feature sequence515 2470 1208 gene locus_tag LOCUS_17010 2470 1208 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence516 1708 1145 gene locus_tag LOCUS_17020 1708 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 <2692 1710 gene locus_tag LOCUS_17030 <2692 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272501.1:chemotaxis protein CheA >Feature sequence517 <1 897 gene locus_tag LOCUS_17040 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074106.1:ATP-binding protein 2304 919 gene locus_tag LOCUS_17050 2304 919 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence518 2209 1817 gene locus_tag LOCUS_17060 2209 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2673 2245 gene locus_tag LOCUS_17070 2673 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence519 967 284 gene locus_tag LOCUS_17080 gene trmD 967 284 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_17080 1281 1009 gene locus_tag LOCUS_17090 1281 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence520 >Feature sequence521 29 1774 gene locus_tag LOCUS_17100 29 1774 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence522 2453 1044 gene locus_tag LOCUS_17110 2453 1044 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence523 103 1707 gene locus_tag LOCUS_17120 103 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1819 2508 gene locus_tag LOCUS_17130 1819 2508 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence524 1280 651 gene locus_tag LOCUS_17140 1280 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2404 1376 gene locus_tag LOCUS_17150 2404 1376 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383116.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence525 1631 717 gene locus_tag LOCUS_17160 gene argB 1631 717 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_17160 <2644 1880 gene locus_tag LOCUS_17170 <2644 1880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390590.1:phosphoenolpyruvate hydrolase family protein >Feature sequence526 232 1014 gene locus_tag LOCUS_17180 gene ccsB 232 1014 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944563.1 protein_id gnl|my_center|LOCUS_17180 1019 2098 gene locus_tag LOCUS_17190 gene hemA 1019 2098 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence527 <1 2268 gene locus_tag LOCUS_17200 <1 2268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816832.1:DUF1549 and DUF1553 domain-containing protein >Feature sequence528 488 721 gene locus_tag LOCUS_17210 488 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 751 1875 gene locus_tag LOCUS_17220 gene alr 751 1875 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence529 <1 569 gene locus_tag LOCUS_17230 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922035.1:SDR family NAD(P)-dependent oxidoreductase 889 800 gene locus_tag LOCUS_t00200 889 800 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <2628 1411 gene locus_tag LOCUS_17240 <2628 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940636.1:sigma 54-interacting transcriptional regulator >Feature sequence530 <1 720 gene locus_tag LOCUS_17250 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118996.1:sulfatase 882 1775 gene locus_tag LOCUS_17260 882 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760094.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence531 272 517 gene locus_tag LOCUS_17270 272 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 657 1280 gene locus_tag LOCUS_17280 657 1280 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_17280 1291 2349 gene locus_tag LOCUS_17290 1291 2349 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence532 >Feature sequence533 953 105 gene locus_tag LOCUS_17300 953 105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_17300 1051 1803 gene locus_tag LOCUS_17310 1051 1803 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_17310 2034 1828 gene locus_tag LOCUS_17320 2034 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence534 <2607 1252 gene locus_tag LOCUS_17330 <2607 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119295.1:c-type cytochrome >Feature sequence535 2075 288 gene locus_tag LOCUS_17340 2075 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence536 788 1489 gene locus_tag LOCUS_17350 788 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence537 <1 1388 gene locus_tag LOCUS_17360 <1 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530383.1:multicopper oxidase domain-containing protein 1902 1732 gene locus_tag LOCUS_17370 1902 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2187 1960 gene locus_tag LOCUS_17380 2187 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence538 2343 925 gene locus_tag LOCUS_17390 2343 925 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence539 1984 332 gene locus_tag LOCUS_17400 1984 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence540 2055 1111 gene locus_tag LOCUS_17410 2055 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 <2588 2052 gene locus_tag LOCUS_17420 <2588 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227986.1:FAD-linked oxidase C-terminal domain-containing protein >Feature sequence541 >Feature sequence542 >Feature sequence543 >Feature sequence544 <1 1091 gene locus_tag LOCUS_17430 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122517.1:DUF1553 domain-containing protein 1097 2566 gene locus_tag LOCUS_17440 1097 2566 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence545 1537 377 gene locus_tag LOCUS_17450 1537 377 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_17450 <2565 1547 gene locus_tag LOCUS_17460 <2565 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546781.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence546 >Feature sequence547 >Feature sequence548 <1 856 gene locus_tag LOCUS_17470 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921296.1:NAD(P)/FAD-dependent oxidoreductase 853 2208 gene locus_tag LOCUS_17480 853 2208 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence549 >Feature sequence550 <2541 1427 gene locus_tag LOCUS_17490 <2541 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115359.1:dihydrolipoyllysine-residue acetyltransferase >Feature sequence551 <1 788 gene locus_tag LOCUS_17500 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258797.1:WYL domain-containing protein 900 1454 gene locus_tag LOCUS_17510 900 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence552 1549 386 gene locus_tag LOCUS_17520 1549 386 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176146113.1 protein_id gnl|my_center|LOCUS_17520 1757 2305 gene locus_tag LOCUS_17530 1757 2305 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence553 <1 1154 gene locus_tag LOCUS_17540 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897970.1:tRNA guanosine(34) transglycosylase Tgt <2529 1181 gene locus_tag LOCUS_17550 <2529 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149560136.1:DNA recombination protein RmuC >Feature sequence554 <1 2120 gene locus_tag LOCUS_17560 <1 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090339627.1:ThuA domain-containing protein >Feature sequence555 1462 293 gene locus_tag LOCUS_17570 1462 293 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence556 429 118 gene locus_tag LOCUS_17580 429 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 536 2338 gene locus_tag LOCUS_17590 gene ilvD 536 2338 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence557 1310 174 gene locus_tag LOCUS_17600 1310 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1576 1343 gene locus_tag LOCUS_17610 1576 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence558 236 1252 gene locus_tag LOCUS_17620 236 1252 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 protein_id gnl|my_center|LOCUS_17620 1405 1989 gene locus_tag LOCUS_17630 1405 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence559 516 1913 gene locus_tag LOCUS_17640 516 1913 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326881.1 protein_id gnl|my_center|LOCUS_17640 <2508 1987 gene locus_tag LOCUS_17650 <2508 1987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922839.1:DUF1501 domain-containing protein >Feature sequence560 233 586 gene locus_tag LOCUS_17660 233 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1045 1800 gene locus_tag LOCUS_17670 1045 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 <2508 1863 gene locus_tag LOCUS_17680 <2508 1863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001198019.1:cation diffusion facilitator family transporter >Feature sequence561 <1 898 gene locus_tag LOCUS_17690 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004533671.1:transaldolase 1053 1844 gene locus_tag LOCUS_17700 1053 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17700 1930 2415 gene locus_tag LOCUS_17710 1930 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17710 >Feature sequence562 344 1450 gene locus_tag LOCUS_17720 344 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 2143 1658 gene locus_tag LOCUS_17730 2143 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence563 >Feature sequence564 <2504 893 gene locus_tag LOCUS_17740 <2504 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275348.1:formylglycine-generating enzyme family protein >Feature sequence565 >Feature sequence566 >Feature sequence567 1382 114 gene locus_tag LOCUS_17750 1382 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2404 1481 gene locus_tag LOCUS_17760 2404 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence568 330 1592 gene locus_tag LOCUS_17770 330 1592 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence569 833 144 gene locus_tag LOCUS_17780 gene urtE 833 144 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767488.1 protein_id gnl|my_center|LOCUS_17780 1610 864 gene locus_tag LOCUS_17790 gene urtD 1610 864 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 protein_id gnl|my_center|LOCUS_17790 <2481 1607 gene locus_tag LOCUS_17800 <2481 1607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104863.1:urea ABC transporter permease subunit UrtC >Feature sequence570 <1 682 gene locus_tag LOCUS_17810 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015670.1:ATP/GTP-binding protein 688 1311 gene locus_tag LOCUS_17820 688 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1902 1672 gene locus_tag LOCUS_17830 1902 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence571 1671 4 gene locus_tag LOCUS_17840 1671 4 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927177.1 protein_id gnl|my_center|LOCUS_17840 2032 1733 gene locus_tag LOCUS_17850 2032 1733 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336823.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence572 387 1322 gene locus_tag LOCUS_17860 387 1322 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975555.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence573 442 212 gene locus_tag LOCUS_17870 442 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 487 831 gene locus_tag LOCUS_17880 487 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence574 <1 1440 gene locus_tag LOCUS_17890 <1 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388279.1:chemotaxis protein CheW 1464 1922 gene locus_tag LOCUS_17900 1464 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence575 2191 2355 gene locus_tag LOCUS_17910 2191 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence576 85 561 gene locus_tag LOCUS_17920 85 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 638 1582 gene locus_tag LOCUS_17930 gene ribF 638 1582 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073366.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence577 >Feature sequence578 1611 160 gene locus_tag LOCUS_17940 gene dnaB 1611 160 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_17940 2278 1715 gene locus_tag LOCUS_17950 gene rplI 2278 1715 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence579 1809 835 gene locus_tag LOCUS_17960 1809 835 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 protein_id gnl|my_center|LOCUS_17960 <2451 1813 gene locus_tag LOCUS_17970 <2451 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032828680.1:ABC transporter substrate-binding protein >Feature sequence580 1 1182 gene locus_tag LOCUS_17980 1 1182 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_17980 1308 1640 gene locus_tag LOCUS_17990 1308 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1722 2279 gene locus_tag LOCUS_18000 1722 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence581 469 1278 gene locus_tag LOCUS_18010 469 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 <2448 1379 gene locus_tag LOCUS_18020 <2448 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793798.1:sigma-54 dependent transcriptional regulator >Feature sequence582 <1 703 gene locus_tag LOCUS_18030 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943825.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 738 1607 gene locus_tag LOCUS_18040 738 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2192 1638 gene locus_tag LOCUS_18050 2192 1638 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence583 <1 501 gene locus_tag LOCUS_18060 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099260488.1:prenyltransferase/squalene oxidase repeat-containing protein 551 1693 gene locus_tag LOCUS_18070 551 1693 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence584 1114 200 gene locus_tag LOCUS_18080 1114 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence585 1804 380 gene locus_tag LOCUS_18090 gene rho 1804 380 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871853.1 protein_id gnl|my_center|LOCUS_18090 2336 1731 gene locus_tag LOCUS_18100 gene coaE 2336 1731 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405495.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence586 134 2365 gene locus_tag LOCUS_18110 134 2365 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence587 586 2088 gene locus_tag LOCUS_18120 586 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence588 >Feature sequence589 <1 528 gene locus_tag LOCUS_18130 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887812.1:VWA-like domain-containing protein 2063 588 gene locus_tag LOCUS_18140 2063 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2428 2060 gene locus_tag LOCUS_18150 2428 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence590 832 1188 gene locus_tag LOCUS_18160 832 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 <2421 1276 gene locus_tag LOCUS_18170 <2421 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein >Feature sequence591 450 136 gene locus_tag LOCUS_18180 450 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 665 456 gene locus_tag LOCUS_18190 665 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1130 681 gene locus_tag LOCUS_18200 1130 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2215 1310 gene locus_tag LOCUS_18210 2215 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence592 1940 729 gene locus_tag LOCUS_18220 gene acoC 1940 729 CDS product acetoin dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244059.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence593 666 139 gene locus_tag LOCUS_18230 gene efp 666 139 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258741.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence594 <1 535 gene locus_tag LOCUS_18240 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228961.1:bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE 568 1290 gene locus_tag LOCUS_18250 568 1290 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122308.1 protein_id gnl|my_center|LOCUS_18250 <2418 1452 gene locus_tag LOCUS_18260 <2418 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922453.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence595 2 1093 gene locus_tag LOCUS_18270 2 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence596 712 1449 gene locus_tag LOCUS_18280 712 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence597 >Feature sequence598 2088 217 gene locus_tag LOCUS_18290 gene mnmG 2088 217 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence599 489 1811 gene locus_tag LOCUS_18300 489 1811 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence600 277 978 gene locus_tag LOCUS_18310 277 978 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_18310 2373 1000 gene locus_tag LOCUS_18320 2373 1000 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence601 1843 254 gene locus_tag LOCUS_18330 gene pckA 1843 254 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence602 256 777 gene locus_tag LOCUS_18340 gene ispF 256 777 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_18340 954 2369 gene locus_tag LOCUS_18350 gene cysS 954 2369 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence603 >Feature sequence604 1789 323 gene locus_tag LOCUS_18360 1789 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_18360 <2399 1837 gene locus_tag LOCUS_18370 <2399 1837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047813379.1:HEAT repeat domain-containing protein >Feature sequence605 2206 923 gene locus_tag LOCUS_18380 2206 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence606 <1 547 gene locus_tag LOCUS_18390 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120139.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence607 <2394 911 gene locus_tag LOCUS_18400 <2394 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence608 >Feature sequence609 <1 1300 gene locus_tag LOCUS_18410 <1 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391629.1:transcription-repair coupling factor 1617 1363 gene locus_tag LOCUS_18420 1617 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence610 >Feature sequence611 1520 129 gene locus_tag LOCUS_18430 1520 129 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122362.1 protein_id gnl|my_center|LOCUS_18430 2074 1517 gene locus_tag LOCUS_18440 2074 1517 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence612 >Feature sequence613 <1 699 gene locus_tag LOCUS_18450 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947895.1:chromosomal replication initiator protein DnaA 829 1923 gene locus_tag LOCUS_18460 gene dnaN 829 1923 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_18460 2030 2114 gene locus_tag LOCUS_t00210 2030 2114 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence614 1108 1692 gene locus_tag LOCUS_18470 1108 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence615 1248 211 gene locus_tag LOCUS_18480 1248 211 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence616 <1 577 gene locus_tag LOCUS_18490 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114901.1:TonB-dependent receptor 626 1216 gene locus_tag LOCUS_18500 626 1216 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_18500 1222 1638 gene locus_tag LOCUS_18510 1222 1638 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881197.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence617 <1 1945 gene locus_tag LOCUS_18520 <1 1945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921992.1:prolyl oligopeptidase family serine peptidase >Feature sequence618 <2364 303 gene locus_tag LOCUS_18530 <2364 303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259718.1:phosphoenolpyruvate carboxylase >Feature sequence619 282 866 gene locus_tag LOCUS_18540 282 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 859 1476 gene locus_tag LOCUS_18550 gene nusB 859 1476 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393030.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence620 1452 181 gene locus_tag LOCUS_18560 1452 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 <2356 1519 gene locus_tag LOCUS_18570 <2356 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002468764.1:adenylyl-sulfate kinase >Feature sequence621 <2354 732 gene locus_tag LOCUS_18580 <2354 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013008044.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence622 244 17 gene locus_tag LOCUS_18590 244 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 <2354 497 gene locus_tag LOCUS_18600 <2354 497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202616.1:sugar-binding protein >Feature sequence623 >Feature sequence624 >Feature sequence625 <1 561 gene locus_tag LOCUS_18610 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545828.1:S41 family peptidase 558 1634 gene locus_tag LOCUS_18620 gene tsaD 558 1634 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_18620 <2352 1720 gene locus_tag LOCUS_18630 <2352 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545645.1:polyprenyl synthetase family protein >Feature sequence626 <1 581 gene locus_tag LOCUS_18640 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122524.1:DJ-1/PfpI family protein 630 1553 gene locus_tag LOCUS_18650 630 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence627 515 261 gene locus_tag LOCUS_18660 515 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 907 548 gene locus_tag LOCUS_18670 907 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1609 2046 gene locus_tag LOCUS_18680 1609 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence628 1035 2066 gene locus_tag LOCUS_18690 1035 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence629 <1 1871 gene locus_tag LOCUS_18700 <1 1871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104711.1:AAA family ATPase 2231 2013 gene locus_tag LOCUS_18710 2231 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence630 <1 727 gene locus_tag LOCUS_18720 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883567.1:cysteine--tRNA ligase >Feature sequence631 1427 1999 gene locus_tag LOCUS_18730 1427 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence632 636 854 gene locus_tag LOCUS_18740 636 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2191 1148 gene locus_tag LOCUS_18750 gene rbsR 2191 1148 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099392.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence633 >Feature sequence634 2333 1716 gene locus_tag LOCUS_18760 2333 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence635 1937 852 gene locus_tag LOCUS_18770 1937 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence636 <1 580 gene locus_tag LOCUS_18780 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036521.1:cyclopropane-fatty-acyl-phospholipid synthase family protein 618 956 gene locus_tag LOCUS_18790 618 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 996 1802 gene locus_tag LOCUS_18800 996 1802 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence637 >Feature sequence638 2132 864 gene locus_tag LOCUS_18810 2132 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence639 <1 608 gene locus_tag LOCUS_18820 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117943.1:DUF1501 domain-containing protein 613 1674 gene locus_tag LOCUS_18830 613 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence640 318 1241 gene locus_tag LOCUS_18840 318 1241 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876261.1 protein_id gnl|my_center|LOCUS_18840 1822 1289 gene locus_tag LOCUS_18850 1822 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1992 1819 gene locus_tag LOCUS_18860 1992 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence641 >Feature sequence642 981 55 gene locus_tag LOCUS_18870 gene lipA 981 55 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919603.1 protein_id gnl|my_center|LOCUS_18870 1095 1538 gene locus_tag LOCUS_18880 1095 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence643 1627 470 gene locus_tag LOCUS_18890 1627 470 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence644 252 1745 gene locus_tag LOCUS_18900 252 1745 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968967.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence645 853 1083 gene locus_tag LOCUS_18910 853 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence646 <1 2288 gene locus_tag LOCUS_18920 <1 2288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120525.1:serine/threonine-protein kinase >Feature sequence647 >Feature sequence648 1252 392 gene locus_tag LOCUS_18930 1252 392 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210026.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence649 <1 915 gene locus_tag LOCUS_18940 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123371.1:MFS transporter 939 2009 gene locus_tag LOCUS_18950 939 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence650 666 971 gene locus_tag LOCUS_18960 666 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence651 186 1451 gene locus_tag LOCUS_18970 186 1451 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_18970 2283 1513 gene locus_tag LOCUS_18980 2283 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence652 349 1245 gene locus_tag LOCUS_18990 349 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 1297 2232 gene locus_tag LOCUS_19000 1297 2232 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence653 1915 899 gene locus_tag LOCUS_19010 1915 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence654 715 569 gene locus_tag LOCUS_19020 715 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1495 1923 gene locus_tag LOCUS_19030 1495 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence655 280 1371 gene locus_tag LOCUS_19040 280 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence656 890 1081 gene locus_tag LOCUS_19050 890 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1709 1377 gene locus_tag LOCUS_19060 1709 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence657 <2262 925 gene locus_tag LOCUS_19070 <2262 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120136.1:DUF1592 domain-containing protein >Feature sequence658 1170 301 gene locus_tag LOCUS_19080 1170 301 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907735.1 protein_id gnl|my_center|LOCUS_19080 2060 1167 gene locus_tag LOCUS_19090 2060 1167 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence659 <1 1086 gene locus_tag LOCUS_19100 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546585.1:DNA-processing protein DprA 1244 1327 gene locus_tag LOCUS_t00220 1244 1327 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <2257 1436 gene locus_tag LOCUS_19110 <2257 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921559.1:DUF1501 domain-containing protein >Feature sequence660 1112 1339 gene locus_tag LOCUS_19120 1112 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 1336 1734 gene locus_tag LOCUS_19130 1336 1734 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_19130 <2252 1739 gene locus_tag LOCUS_19140 <2252 1739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123573.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence661 951 142 gene locus_tag LOCUS_19150 951 142 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_19150 1117 1617 gene locus_tag LOCUS_19160 1117 1617 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence662 >Feature sequence663 >Feature sequence664 >Feature sequence665 490 152 gene locus_tag LOCUS_19170 490 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 654 1904 gene locus_tag LOCUS_19180 654 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence666 <1 652 gene locus_tag LOCUS_19190 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272342.1:DNA translocase FtsK 734 1150 gene locus_tag LOCUS_19200 734 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1152 2123 gene locus_tag LOCUS_19210 gene miaA 1152 2123 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804679.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence667 380 1987 gene locus_tag LOCUS_19220 380 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence668 739 95 gene locus_tag LOCUS_19230 739 95 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838510.1 protein_id gnl|my_center|LOCUS_19230 878 1435 gene locus_tag LOCUS_19240 878 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1475 2014 gene locus_tag LOCUS_19250 1475 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence669 >Feature sequence670 1638 106 gene locus_tag LOCUS_19260 1638 106 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836208.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence671 146 730 gene locus_tag LOCUS_19270 146 730 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_19270 2220 922 gene locus_tag LOCUS_19280 2220 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence672 >Feature sequence673 <2214 464 gene locus_tag LOCUS_19290 <2214 464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948104.1:ABC transporter ATP-binding protein >Feature sequence674 514 1929 gene locus_tag LOCUS_19300 514 1929 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence675 48 506 gene locus_tag LOCUS_19310 48 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 <2213 824 gene locus_tag LOCUS_19320 <2213 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403103.1:cytochrome c >Feature sequence676 >Feature sequence677 1700 204 gene locus_tag LOCUS_19330 1700 204 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence678 1558 68 gene locus_tag LOCUS_19340 gene istA 1558 68 CDS product IS21-like element ISMac9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022071.1 protein_id gnl|my_center|LOCUS_19340 1992 1555 gene locus_tag LOCUS_19350 1992 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence679 1080 178 gene locus_tag LOCUS_19360 1080 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence680 >Feature sequence681 2007 616 gene locus_tag LOCUS_19370 2007 616 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence682 >Feature sequence683 280 2151 gene locus_tag LOCUS_19380 280 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence684 >Feature sequence685 28 723 gene locus_tag LOCUS_19390 28 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 761 1171 gene locus_tag LOCUS_19400 761 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence686 >Feature sequence687 <1 719 gene locus_tag LOCUS_19410 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232156.1:ABC transporter ATP-binding protein 1401 1967 gene locus_tag LOCUS_19420 1401 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence688 1026 52 gene locus_tag LOCUS_19430 1026 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence689 >Feature sequence690 1543 164 gene locus_tag LOCUS_19440 1543 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1667 1882 gene locus_tag LOCUS_19450 1667 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence691 1729 8 gene locus_tag LOCUS_19460 1729 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2166 1747 gene locus_tag LOCUS_19470 2166 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence692 1679 1071 gene locus_tag LOCUS_19480 1679 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 >Feature sequence693 3 536 gene locus_tag LOCUS_19490 3 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 529 1926 gene locus_tag LOCUS_19500 529 1926 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence694 <2163 1486 gene locus_tag LOCUS_19510 <2163 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328387.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence695 763 1743 gene locus_tag LOCUS_19520 gene queA 763 1743 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence696 943 1662 gene locus_tag LOCUS_19530 943 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence697 1285 419 gene locus_tag LOCUS_19540 1285 419 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_19540 2043 1267 gene locus_tag LOCUS_19550 2043 1267 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810950.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence698 378 1841 gene locus_tag LOCUS_19560 378 1841 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118989.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence699 1500 406 gene locus_tag LOCUS_19570 gene mutY 1500 406 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522857.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence700 1554 673 gene locus_tag LOCUS_19580 gene atpG 1554 673 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817813.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence701 <2148 1288 gene locus_tag LOCUS_19590 <2148 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121134.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence702 1303 419 gene locus_tag LOCUS_19600 1303 419 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969937.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence703 1727 951 gene locus_tag LOCUS_19610 1727 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence704 <1 569 gene locus_tag LOCUS_19620 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545913.1:membrane protein insertase YidC 597 1043 gene locus_tag LOCUS_19630 597 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence705 1460 279 gene locus_tag LOCUS_19640 1460 279 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065728133.1 protein_id gnl|my_center|LOCUS_19640 1775 1629 gene locus_tag LOCUS_19650 1775 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence706 87 764 gene locus_tag LOCUS_19660 gene bioD 87 764 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_19660 2002 812 gene locus_tag LOCUS_19670 2002 812 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence707 1771 809 gene locus_tag LOCUS_19680 1771 809 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence708 911 654 gene locus_tag LOCUS_19690 911 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 <2125 937 gene locus_tag LOCUS_19700 <2125 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000533659.1:tyrosine-type recombinase/integrase >Feature sequence709 539 1465 gene locus_tag LOCUS_19710 539 1465 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_19710 1526 2107 gene locus_tag LOCUS_19720 1526 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence710 <1 670 gene locus_tag LOCUS_19730 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001177846.1:two-component system response regulator <2124 748 gene locus_tag LOCUS_19740 <2124 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546879.1:carbamoyl-phosphate synthase large subunit >Feature sequence711 <1 1427 gene locus_tag LOCUS_19750 <1 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460040.1:molecular chaperone HtpG >Feature sequence712 <2119 272 gene locus_tag LOCUS_19760 <2119 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814928.1:ribonucleoside-diphosphate reductase subunit alpha >Feature sequence713 <2118 1541 gene locus_tag LOCUS_19770 <2118 1541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868851.1:phosphate ABC transporter substrate-binding protein >Feature sequence714 3 1106 gene locus_tag LOCUS_19780 3 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1884 1174 gene locus_tag LOCUS_19790 1884 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence715 1159 221 gene locus_tag LOCUS_19800 1159 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2030 1218 gene locus_tag LOCUS_19810 2030 1218 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence716 >Feature sequence717 <2110 38 gene locus_tag LOCUS_19820 <2110 38 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198495.1:autotransporter BcaA >Feature sequence718 1495 95 gene locus_tag LOCUS_19830 1495 95 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_19830 2107 1514 gene locus_tag LOCUS_19840 2107 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence719 >Feature sequence720 <1 1626 gene locus_tag LOCUS_19850 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269157.1:non-ribosomal peptide synthetase >Feature sequence721 116 427 gene locus_tag LOCUS_19860 gene rplU 116 427 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_19860 469 735 gene locus_tag LOCUS_19870 gene rpmA 469 735 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence722 689 1069 gene locus_tag LOCUS_19880 689 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1050 1433 gene locus_tag LOCUS_19890 1050 1433 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227979.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence723 <1 1721 gene locus_tag LOCUS_19900 <1 1721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939362.1:DEAD/DEAH box helicase >Feature sequence724 <2093 532 gene locus_tag LOCUS_19910 <2093 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118036.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence725 >Feature sequence726 1301 324 gene locus_tag LOCUS_19920 1301 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1828 1298 gene locus_tag LOCUS_19930 1828 1298 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence727 <1 579 gene locus_tag LOCUS_19940 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035441.1:undecaprenyl-diphosphate phosphatase 592 1935 gene locus_tag LOCUS_19950 592 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence728 1910 777 gene locus_tag LOCUS_19960 1910 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence729 >Feature sequence730 >Feature sequence731 >Feature sequence732 502 38 gene locus_tag LOCUS_19970 gene mntR 502 38 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725831.1 protein_id gnl|my_center|LOCUS_19970 631 1974 gene locus_tag LOCUS_19980 631 1974 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530120.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence733 1791 214 gene locus_tag LOCUS_19990 1791 214 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence734 1409 393 gene locus_tag LOCUS_20000 gene ruvB 1409 393 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_20000 1880 1527 gene locus_tag LOCUS_20010 1880 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence735 1264 17 gene locus_tag LOCUS_20020 1264 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_20020 1760 1377 gene locus_tag LOCUS_20030 1760 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence736 >Feature sequence737 <2061 863 gene locus_tag LOCUS_20040 <2061 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392626.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence738 107 1222 gene locus_tag LOCUS_20050 107 1222 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence739 <1 730 gene locus_tag LOCUS_20060 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122858.1:terpene cyclase/mutase family protein >Feature sequence740 1810 392 gene locus_tag LOCUS_20070 1810 392 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence741 <1 833 gene locus_tag LOCUS_20080 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545591.1:1,4-alpha-glucan branching protein GlgB 988 1629 gene locus_tag LOCUS_20090 988 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence742 >Feature sequence743 1110 679 gene locus_tag LOCUS_20100 1110 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 <2035 1195 gene locus_tag LOCUS_20110 <2035 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029883886.1:metal ABC transporter substrate-binding protein >Feature sequence744 >Feature sequence745 1669 728 gene locus_tag LOCUS_20120 1669 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence746 <1 1344 gene locus_tag LOCUS_20130 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150556097.1:autotransporter outer membrane beta-barrel domain-containing protein >Feature sequence747 >Feature sequence748 474 1136 gene locus_tag LOCUS_20140 474 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 1133 1960 gene locus_tag LOCUS_20150 1133 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence749 1616 672 gene locus_tag LOCUS_20160 1616 672 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326973.1 protein_id gnl|my_center|LOCUS_20160 2017 1613 gene locus_tag LOCUS_20170 2017 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence750 1887 328 gene locus_tag LOCUS_20180 1887 328 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence751 247 648 gene locus_tag LOCUS_20190 247 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1307 675 gene locus_tag LOCUS_20200 1307 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 1864 1307 gene locus_tag LOCUS_20210 1864 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence752 392 1564 gene locus_tag LOCUS_20220 392 1564 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124855.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence753 >Feature sequence754 1281 295 gene locus_tag LOCUS_20230 1281 295 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392149.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence755 1412 201 gene locus_tag LOCUS_20240 1412 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence756 <1 1595 gene locus_tag LOCUS_20250 <1 1595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000033190.1:DUF885 domain-containing protein >Feature sequence757 81 1016 gene locus_tag LOCUS_20260 81 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 1401 1042 gene locus_tag LOCUS_20270 1401 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1470 1838 gene locus_tag LOCUS_20280 1470 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1942 1868 gene locus_tag LOCUS_t00230 1942 1868 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence758 1157 633 gene locus_tag LOCUS_20290 1157 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence759 1097 225 gene locus_tag LOCUS_20300 1097 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1607 1146 gene locus_tag LOCUS_20310 1607 1146 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388845.1 protein_id gnl|my_center|LOCUS_20310 1854 1609 gene locus_tag LOCUS_20320 1854 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence760 194 1651 gene locus_tag LOCUS_20330 194 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence761 >Feature sequence762 1237 80 gene locus_tag LOCUS_20340 1237 80 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227073.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence763 >Feature sequence764 663 97 gene locus_tag LOCUS_20350 663 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20350 1587 706 gene locus_tag LOCUS_20360 1587 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence765 <1 1071 gene locus_tag LOCUS_20370 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616124.1:DUF1592 domain-containing protein 1082 1696 gene locus_tag LOCUS_20380 1082 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence766 161 1459 gene locus_tag LOCUS_20390 gene larA 161 1459 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence767 <1 1836 gene locus_tag LOCUS_20400 <1 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203175.1:NAD(+) synthase >Feature sequence768 >Feature sequence769 >Feature sequence770 1601 834 gene locus_tag LOCUS_20410 1601 834 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528140.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence771 >Feature sequence772 944 42 gene locus_tag LOCUS_20420 944 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 1769 1173 gene locus_tag LOCUS_20430 1769 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence773 637 1050 gene locus_tag LOCUS_20440 637 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 1082 1492 gene locus_tag LOCUS_20450 1082 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence774 >Feature sequence775 814 1869 gene locus_tag LOCUS_20460 gene thiH 814 1869 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008477.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence776 <1 793 gene locus_tag LOCUS_20470 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122548.1:PA14 domain-containing protein >Feature sequence777 909 1697 gene locus_tag LOCUS_20480 909 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence778 >Feature sequence779 <1919 261 gene locus_tag LOCUS_20490 <1919 261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121181.1:L-sorbosone dehydrogenase >Feature sequence780 164 1114 gene locus_tag LOCUS_20500 164 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1115 1588 gene locus_tag LOCUS_20510 1115 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20510 >Feature sequence781 1538 36 gene locus_tag LOCUS_20520 gene lysS 1538 36 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583287.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence782 >Feature sequence783 >Feature sequence784 <1 1106 gene locus_tag LOCUS_20530 <1 1106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939356.1:chemotaxis response regulator protein-glutamate methylesterase 1103 1540 gene locus_tag LOCUS_20540 1103 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence785 >Feature sequence786 744 349 gene locus_tag LOCUS_20550 744 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20550 <1909 755 gene locus_tag LOCUS_20560 <1909 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921309.1:DUF1549 and DUF1553 domain-containing protein >Feature sequence787 >Feature sequence788 <1 664 gene locus_tag LOCUS_20570 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425940.1:cation diffusion facilitator family transporter 1903 698 gene locus_tag LOCUS_20580 1903 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence789 <1899 691 gene locus_tag LOCUS_20590 <1899 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393372.1:DNA polymerase III subunit alpha >Feature sequence790 <1898 1068 gene locus_tag LOCUS_20600 <1898 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261887.1:carboxy terminal-processing peptidase >Feature sequence791 1383 103 gene locus_tag LOCUS_20610 1383 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence792 330 1079 gene locus_tag LOCUS_20620 330 1079 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_20620 1083 1820 gene locus_tag LOCUS_20630 1083 1820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence793 362 979 gene locus_tag LOCUS_20640 362 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1070 1780 gene locus_tag LOCUS_20650 1070 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence794 25 216 gene locus_tag LOCUS_20660 25 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 686 913 gene locus_tag LOCUS_20670 686 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 910 1338 gene locus_tag LOCUS_20680 gene fitB 910 1338 CDS product type II toxin-antitoxin system toxin FitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691083.1 protein_id gnl|my_center|LOCUS_20680 1588 1403 gene locus_tag LOCUS_20690 1588 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1850 1614 gene locus_tag LOCUS_20700 1850 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence795 >Feature sequence796 1303 431 gene locus_tag LOCUS_20710 1303 431 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 protein_id gnl|my_center|LOCUS_20710 1493 1828 gene locus_tag LOCUS_20720 1493 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence797 <1 1133 gene locus_tag LOCUS_20730 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942896.1:lipopolysaccharide heptosyltransferase II >Feature sequence798 1165 38 gene locus_tag LOCUS_20740 1165 38 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence799 >Feature sequence800 >Feature sequence801 <1 592 gene locus_tag LOCUS_20750 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081072.1:bifunctional phosphoglycerate kinase/triose-phosphate isomerase note possible pseudo, internal stop codon 662 1423 gene locus_tag LOCUS_20760 662 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20760 >Feature sequence802 1688 636 gene locus_tag LOCUS_20770 1688 636 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence803 <1 1715 gene locus_tag LOCUS_20780 <1 1715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038369.1:SirB1 family protein >Feature sequence804 806 93 gene locus_tag LOCUS_20790 806 93 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444156.1 protein_id gnl|my_center|LOCUS_20790 1299 820 gene locus_tag LOCUS_20800 1299 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1750 1340 gene locus_tag LOCUS_20810 1750 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence805 306 1709 gene locus_tag LOCUS_20820 306 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence806 106 1518 gene locus_tag LOCUS_20830 106 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence807 <1 604 gene locus_tag LOCUS_20840 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056965.1:urea ABC transporter ATP-binding protein UrtD 607 1302 gene locus_tag LOCUS_20850 gene urtE 607 1302 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 protein_id gnl|my_center|LOCUS_20850 1375 1575 gene locus_tag LOCUS_20860 1375 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence808 554 357 gene locus_tag LOCUS_20870 554 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 748 551 gene locus_tag LOCUS_20880 748 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 898 1143 gene locus_tag LOCUS_20890 898 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence809 <1857 370 gene locus_tag LOCUS_20900 <1857 370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189933.1:tetratricopeptide repeat protein >Feature sequence810 <1 603 gene locus_tag LOCUS_20910 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117861.1:FAD-dependent oxidoreductase 1393 587 gene locus_tag LOCUS_20920 1393 587 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017868968.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence811 1078 107 gene locus_tag LOCUS_20930 1078 107 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957776.1 protein_id gnl|my_center|LOCUS_20930 <1852 1109 gene locus_tag LOCUS_20940 <1852 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007539814.1:Tm-1-like ATP-binding domain-containing protein >Feature sequence812 1408 614 gene locus_tag LOCUS_20950 gene folE2 1408 614 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence813 1257 133 gene locus_tag LOCUS_20960 1257 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 <1849 1313 gene locus_tag LOCUS_20970 <1849 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393241.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence814 2 673 gene locus_tag LOCUS_20980 2 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 685 1053 gene locus_tag LOCUS_20990 685 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence815 1 399 gene locus_tag LOCUS_21000 1 399 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_21000 625 1158 gene locus_tag LOCUS_21010 625 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence816 >Feature sequence817 <1 1082 gene locus_tag LOCUS_21020 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615966.1:DUF1592 domain-containing protein >Feature sequence818 586 987 gene locus_tag LOCUS_21030 586 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1345 1257 gene locus_tag LOCUS_t00240 1345 1257 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence819 628 1065 gene locus_tag LOCUS_21040 628 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1790 1194 gene locus_tag LOCUS_21050 1790 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence820 <1835 494 gene locus_tag LOCUS_21060 <1835 494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922252.1:sialate O-acetylesterase >Feature sequence821 <1832 1016 gene locus_tag LOCUS_21070 <1832 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880834.1:homoserine kinase >Feature sequence822 <1 983 gene locus_tag LOCUS_21080 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269033.1:urease subunit alpha 1020 1454 gene locus_tag LOCUS_21090 1020 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence823 <1830 269 gene locus_tag LOCUS_21100 <1830 269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000770505.1:D-alanine--poly(phosphoribitol) ligase subunit DltA >Feature sequence824 <1 982 gene locus_tag LOCUS_21110 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326676.1:DUF1501 domain-containing protein >Feature sequence825 >Feature sequence826 <1826 1098 gene locus_tag LOCUS_21120 <1826 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001069020.1:carbon-nitrogen family hydrolase >Feature sequence827 1087 653 gene locus_tag LOCUS_21130 gene queF 1087 653 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689837.1 protein_id gnl|my_center|LOCUS_21130 <1826 1152 gene locus_tag LOCUS_21140 <1826 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921002.1:acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase >Feature sequence828 1781 204 gene locus_tag LOCUS_21150 1781 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence829 1591 1166 gene locus_tag LOCUS_21160 1591 1166 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence830 62 673 gene locus_tag LOCUS_21170 62 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 1810 710 gene locus_tag LOCUS_21180 1810 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence831 <1 1578 gene locus_tag LOCUS_21190 <1 1578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_075123474.1:DEAD/DEAH box helicase >Feature sequence832 <1 946 gene locus_tag LOCUS_21200 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256457.1:CRISPR-associated endonuclease Cas1 967 1341 gene locus_tag LOCUS_21210 967 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1559 >1796 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtccgccacgcggtcaccgccgaaaggcactgatgac >Feature sequence833 1483 551 gene locus_tag LOCUS_21220 1483 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence834 1300 287 gene locus_tag LOCUS_21230 1300 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence835 222 1028 gene locus_tag LOCUS_21240 222 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence836 <1 1218 gene locus_tag LOCUS_21250 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141076.1:folylpolyglutamate synthase/dihydrofolate synthase family protein 1334 1155 gene locus_tag LOCUS_21260 1334 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence837 >Feature sequence838 >Feature sequence839 933 517 gene locus_tag LOCUS_21270 933 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 1403 1023 gene locus_tag LOCUS_21280 1403 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence840 >Feature sequence841 <1774 953 gene locus_tag LOCUS_21290 <1774 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013060927.1:sodium:solute symporter >Feature sequence842 1021 47 gene locus_tag LOCUS_21300 1021 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 <1771 1090 gene locus_tag LOCUS_21310 <1771 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243252.1:glycosyltransferase family 1 protein >Feature sequence843 >Feature sequence844 <1 791 gene locus_tag LOCUS_21320 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121153.1:DUF1552 domain-containing protein 805 942 gene locus_tag LOCUS_21330 805 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 <1764 1253 gene locus_tag LOCUS_21340 <1764 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120135.1:DUF1552 domain-containing protein >Feature sequence845 >Feature sequence846 153 1052 gene locus_tag LOCUS_21350 153 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence847 1169 78 gene locus_tag LOCUS_21360 1169 78 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_21360 1693 1298 gene locus_tag LOCUS_21370 1693 1298 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174212.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence848 577 1224 gene locus_tag LOCUS_21380 577 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence849 1365 400 gene locus_tag LOCUS_21390 1365 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 1570 1367 gene locus_tag LOCUS_21400 1570 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence850 1094 105 gene locus_tag LOCUS_21410 1094 105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 protein_id gnl|my_center|LOCUS_21410 <1740 1096 gene locus_tag LOCUS_21420 <1740 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104585.1:sugar ABC transporter ATP-binding protein >Feature sequence851 >Feature sequence852 <1 541 gene locus_tag LOCUS_21430 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008668648.1:DUF1553 domain-containing protein >Feature sequence853 164 1567 gene locus_tag LOCUS_21440 164 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence854 <1 1467 gene locus_tag LOCUS_21450 <1 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119792.1:FecR domain-containing protein >Feature sequence855 1304 162 gene locus_tag LOCUS_21460 gene urtC 1304 162 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244009.1 protein_id gnl|my_center|LOCUS_21460 1732 1304 gene locus_tag LOCUS_21470 1732 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence856 115 321 gene locus_tag LOCUS_21480 115 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 736 999 gene locus_tag LOCUS_21490 736 999 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_21490 1400 1062 gene locus_tag LOCUS_21500 1400 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1621 1397 gene locus_tag LOCUS_21510 1621 1397 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence857 <1 1431 gene locus_tag LOCUS_21520 <1 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein >Feature sequence858 595 1350 gene locus_tag LOCUS_21530 595 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence859 >Feature sequence860 506 225 gene locus_tag LOCUS_21540 506 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 <1717 503 gene locus_tag LOCUS_21550 <1717 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939873.1:portal protein >Feature sequence861 <1 774 gene locus_tag LOCUS_21560 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039570.1:aspartate aminotransferase family protein >Feature sequence862 190 756 gene locus_tag LOCUS_21570 190 756 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_21570 <1712 807 gene locus_tag LOCUS_21580 <1712 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119052.1:DUF1501 domain-containing protein >Feature sequence863 429 1487 gene locus_tag LOCUS_21590 gene plsX 429 1487 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence864 <1 580 gene locus_tag LOCUS_21600 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403448.1:response regulator transcription factor 833 967 gene locus_tag LOCUS_21610 833 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1157 1231 gene locus_tag LOCUS_t00250 1157 1231 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence865 <1700 503 gene locus_tag LOCUS_21620 <1700 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164923035.1:alpha/beta hydrolase-fold protein >Feature sequence866 >Feature sequence867 >Feature sequence868 <1 715 gene locus_tag LOCUS_21630 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003148161.1:two-partner secretion system adhesin CdrA >Feature sequence869 >Feature sequence870 1304 168 gene locus_tag LOCUS_21640 1304 168 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence871 <1 1585 gene locus_tag LOCUS_21650 <1 1585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223297.1:alkaline phosphatase family protein >Feature sequence872 1448 36 gene locus_tag LOCUS_21660 1448 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence873 626 147 gene locus_tag LOCUS_21670 626 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence874 1185 1535 gene locus_tag LOCUS_21680 1185 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence875 >Feature sequence876 >Feature sequence877 <1 606 gene locus_tag LOCUS_21690 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117868.1:BtaA family protein >Feature sequence878 1455 316 gene locus_tag LOCUS_21700 1455 316 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence879 656 327 gene locus_tag LOCUS_21710 656 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence880 >Feature sequence881 <1 1558 gene locus_tag LOCUS_21720 <1 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200858940.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence882 485 1312 gene locus_tag LOCUS_21730 485 1312 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence883 88 711 gene locus_tag LOCUS_21740 gene ureG 88 711 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_21740 708 1577 gene locus_tag LOCUS_21750 708 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence884 1397 243 gene locus_tag LOCUS_21760 1397 243 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence885 >Feature sequence886 1376 327 gene locus_tag LOCUS_21770 1376 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence887 >Feature sequence888 >Feature sequence889 27 734 gene locus_tag LOCUS_21780 27 734 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921555.1 protein_id gnl|my_center|LOCUS_21780 1561 890 gene locus_tag LOCUS_21790 1561 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence890 304 1425 gene locus_tag LOCUS_21800 304 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence891 >Feature sequence892 <1 767 gene locus_tag LOCUS_21810 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791960.1:glycoside hydrolase family 95 protein >Feature sequence893 >Feature sequence894 >Feature sequence895 1424 861 gene locus_tag LOCUS_21820 gene pyrE 1424 861 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393616.1 protein_id gnl|my_center|LOCUS_21820 1640 1443 gene locus_tag LOCUS_21830 1640 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence896 >Feature sequence897 1530 673 gene locus_tag LOCUS_21840 gene kdsA 1530 673 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence898 >Feature sequence899 >Feature sequence900 1037 531 gene locus_tag LOCUS_21850 1037 531 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence901 1427 663 gene locus_tag LOCUS_21860 1427 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence902 1109 225 gene locus_tag LOCUS_21870 1109 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21870 1319 1119 gene locus_tag LOCUS_21880 1319 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21880 >Feature sequence903 >Feature sequence904 574 248 gene locus_tag LOCUS_21890 574 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 1404 1174 gene locus_tag LOCUS_21900 1404 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence905 573 265 gene locus_tag LOCUS_21910 gene phnA 573 265 CDS product alkylphosphonate utilization operon protein PhnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212737.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence906 <1 1117 gene locus_tag LOCUS_21920 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813193.1:signal recognition particle protein 1190 1465 gene locus_tag LOCUS_21930 gene rpsP 1190 1465 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence907 381 1193 gene locus_tag LOCUS_21940 381 1193 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence908 >Feature sequence909 <1 651 gene locus_tag LOCUS_21950 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117890.1:DUF1592 domain-containing protein 648 1208 gene locus_tag LOCUS_21960 648 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence910 84 1487 gene locus_tag LOCUS_21970 84 1487 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence911 523 1512 gene locus_tag LOCUS_21980 523 1512 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546289.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence912 >Feature sequence913 1608 985 gene locus_tag LOCUS_21990 1608 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence914 >Feature sequence915 697 248 gene locus_tag LOCUS_22000 697 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 973 1398 gene locus_tag LOCUS_22010 gene furA3 973 1398 CDS product fur family transcriptional regulator FurA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence916 >Feature sequence917 >Feature sequence918 >Feature sequence919 511 666 gene locus_tag LOCUS_22020 511 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1450 821 gene locus_tag LOCUS_22030 1450 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence920 >Feature sequence921 >Feature sequence922 >Feature sequence923 >Feature sequence924 >Feature sequence925 <1 624 gene locus_tag LOCUS_22040 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665997.1:M28 family peptidase >Feature sequence926 >Feature sequence927 <1575 700 gene locus_tag LOCUS_22050 <1575 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338403.1:MoxR family ATPase >Feature sequence928 <1 1377 gene locus_tag LOCUS_22060 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940711.1:molecular chaperone DnaK >Feature sequence929 1334 747 gene locus_tag LOCUS_22070 1334 747 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547672.1 protein_id gnl|my_center|LOCUS_22070 1570 1331 gene locus_tag LOCUS_22080 1570 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence930 >Feature sequence931 >Feature sequence932 >Feature sequence933 >Feature sequence934 120 779 gene locus_tag LOCUS_22090 120 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence935 >Feature sequence936 1457 168 gene locus_tag LOCUS_22100 1457 168 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229155.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence937 <1545 751 gene locus_tag LOCUS_22110 <1545 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121674.1:formylglycine-generating enzyme family protein >Feature sequence938 1094 285 gene locus_tag LOCUS_22120 gene pphC 1094 285 CDS product protein-serine/threonine phosphatase PphC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119099.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence939 >Feature sequence940 >Feature sequence941 172 567 gene locus_tag LOCUS_22130 172 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence942 >Feature sequence943 <1 594 gene locus_tag LOCUS_22140 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392501.1:NADH-quinone oxidoreductase subunit M >Feature sequence944 >Feature sequence945 <1 927 gene locus_tag LOCUS_22150 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938761.1:DegQ family serine endoprotease >Feature sequence946 <1 600 gene locus_tag LOCUS_22160 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120870.1:cbb3-type cytochrome c oxidase N-terminal domain-containing protein >Feature sequence947 >Feature sequence948 >Feature sequence949 1 1077 gene locus_tag LOCUS_22170 1 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence950 >Feature sequence951 196 849 gene locus_tag LOCUS_22180 196 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence952 1439 423 gene locus_tag LOCUS_22190 1439 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence953 >Feature sequence954 167 832 gene locus_tag LOCUS_22200 167 832 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225250.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence955 <1515 509 gene locus_tag LOCUS_22210 <1515 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087212.1:glycosyltransferase family 39 protein >Feature sequence956 1514 1224 gene locus_tag LOCUS_22220 1514 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence957 355 167 gene locus_tag LOCUS_22230 355 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 758 381 gene locus_tag LOCUS_22240 758 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence958 324 554 gene locus_tag LOCUS_22250 324 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 551 946 gene locus_tag LOCUS_22260 551 946 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_22260 <1511 961 gene locus_tag LOCUS_22270 <1511 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921659.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence959 292 1077 gene locus_tag LOCUS_22280 292 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence960 >Feature sequence961 >Feature sequence962 873 355 gene locus_tag LOCUS_22290 873 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290