>Feature sequence001 480 731 gene locus_tag LOCUS_00010 480 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1159 4350 gene locus_tag LOCUS_00020 1159 4350 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_00020 6946 4421 gene locus_tag LOCUS_00030 6946 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 8169 7285 gene locus_tag LOCUS_00040 8169 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 9349 8189 gene locus_tag LOCUS_00050 9349 8189 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010707087.1 protein_id gnl|my_center|LOCUS_00050 9570 9499 gene locus_tag LOCUS_t00010 9570 9499 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9664 10407 gene locus_tag LOCUS_00060 9664 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 11772 10612 gene locus_tag LOCUS_00070 11772 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 12462 11785 gene locus_tag LOCUS_00080 12462 11785 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175599.1 protein_id gnl|my_center|LOCUS_00080 13374 12529 gene locus_tag LOCUS_00090 gene map 13374 12529 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056279.1 protein_id gnl|my_center|LOCUS_00090 13618 15117 gene locus_tag LOCUS_00100 13618 15117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15294 15662 gene locus_tag LOCUS_00110 15294 15662 CDS product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214035.1 protein_id gnl|my_center|LOCUS_00110 17354 15684 gene locus_tag LOCUS_00120 17354 15684 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_00120 17543 17361 gene locus_tag LOCUS_00130 17543 17361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 20360 17634 gene locus_tag LOCUS_00140 20360 17634 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057343.1 protein_id gnl|my_center|LOCUS_00140 20707 21264 gene locus_tag LOCUS_00150 20707 21264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 21903 21355 gene locus_tag LOCUS_00160 21903 21355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23299 22034 gene locus_tag LOCUS_00170 23299 22034 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057168.1 protein_id gnl|my_center|LOCUS_00170 23535 25214 gene locus_tag LOCUS_00180 23535 25214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 27350 25245 gene locus_tag LOCUS_00190 27350 25245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 28224 28631 gene locus_tag LOCUS_00200 28224 28631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28644 29036 gene locus_tag LOCUS_00210 28644 29036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 29499 30044 gene locus_tag LOCUS_00220 29499 30044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 >Feature sequence002 962 735 gene locus_tag LOCUS_00230 962 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 965 1252 gene locus_tag LOCUS_00240 965 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 1230 1478 gene locus_tag LOCUS_00250 1230 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 1747 1487 gene locus_tag LOCUS_00260 1747 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 2032 1847 gene locus_tag LOCUS_00270 2032 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 2825 2019 gene locus_tag LOCUS_00280 2825 2019 CDS product protein rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322009.1 protein_id gnl|my_center|LOCUS_00280 3181 2921 gene locus_tag LOCUS_00290 3181 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 3324 3689 gene locus_tag LOCUS_00300 3324 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 3868 4155 gene locus_tag LOCUS_00310 3868 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 4320 5429 gene locus_tag LOCUS_00320 4320 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 6666 6004 gene locus_tag LOCUS_00330 6666 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 7358 6942 gene locus_tag LOCUS_00340 7358 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 10035 8380 gene locus_tag LOCUS_00350 10035 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 10197 10454 gene locus_tag LOCUS_00360 10197 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 10712 10975 gene locus_tag LOCUS_00370 10712 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 11510 12523 gene locus_tag LOCUS_00380 11510 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 16920 12727 gene locus_tag LOCUS_00390 16920 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 17359 20772 gene locus_tag LOCUS_00400 17359 20772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 20966 22078 gene locus_tag LOCUS_00410 20966 22078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 22392 22111 gene locus_tag LOCUS_00420 22392 22111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 24026 22947 gene locus_tag LOCUS_00430 24026 22947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 24624 24364 gene locus_tag LOCUS_00440 24624 24364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 25414 24980 gene locus_tag LOCUS_00450 25414 24980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 25820 25530 gene locus_tag LOCUS_00460 25820 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 26207 25953 gene locus_tag LOCUS_00470 26207 25953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 26725 27336 gene locus_tag LOCUS_00480 26725 27336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 >Feature sequence003 607 1146 gene locus_tag LOCUS_00490 gene ilvN 607 1146 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141136.1 protein_id gnl|my_center|LOCUS_00490 1264 2394 gene locus_tag LOCUS_00500 1264 2394 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_00500 3042 2431 gene locus_tag LOCUS_00510 3042 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 3126 4466 gene locus_tag LOCUS_00520 gene aroA 3126 4466 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056198.1 protein_id gnl|my_center|LOCUS_00520 5197 4541 gene locus_tag LOCUS_00530 5197 4541 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895592.1 protein_id gnl|my_center|LOCUS_00530 5943 5215 gene locus_tag LOCUS_00540 5943 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 6206 5940 gene locus_tag LOCUS_00550 6206 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 7726 6344 gene locus_tag LOCUS_00560 7726 6344 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058082.1 protein_id gnl|my_center|LOCUS_00560 7855 8178 gene locus_tag LOCUS_00570 7855 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 8241 9758 gene locus_tag LOCUS_00580 8241 9758 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 protein_id gnl|my_center|LOCUS_00580 9991 11406 gene locus_tag LOCUS_00590 9991 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 11943 11413 gene locus_tag LOCUS_00600 11943 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 13990 12323 gene locus_tag LOCUS_00610 13990 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 14221 14703 gene locus_tag LOCUS_00620 14221 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 14831 16117 gene locus_tag LOCUS_00630 14831 16117 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_00630 17123 16254 gene locus_tag LOCUS_00640 gene menH 17123 16254 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933504.1 protein_id gnl|my_center|LOCUS_00640 17145 17897 gene locus_tag LOCUS_00650 17145 17897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 18463 18263 gene locus_tag LOCUS_00660 18463 18263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 18687 19730 gene locus_tag LOCUS_00670 gene queA 18687 19730 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056766.1 protein_id gnl|my_center|LOCUS_00670 20576 19761 gene locus_tag LOCUS_00680 20576 19761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 21718 20612 gene locus_tag LOCUS_00690 21718 20612 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_00690 21956 22498 gene locus_tag LOCUS_00700 21956 22498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 22639 23175 gene locus_tag LOCUS_00710 gene rsmD 22639 23175 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_00710 23375 24268 gene locus_tag LOCUS_00720 23375 24268 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_00720 26841 24388 gene locus_tag LOCUS_00730 26841 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 27137 27841 gene locus_tag LOCUS_00740 27137 27841 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_00740 28345 27845 gene locus_tag LOCUS_00750 28345 27845 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_00750 28367 28564 gene locus_tag LOCUS_00760 28367 28564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence004 1693 2655 gene locus_tag LOCUS_00770 gene bioB 1693 2655 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015185990.1 protein_id gnl|my_center|LOCUS_00770 5079 2878 gene locus_tag LOCUS_00780 gene ppk1 5079 2878 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_00780 5872 5399 gene locus_tag LOCUS_00790 5872 5399 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657853.1 protein_id gnl|my_center|LOCUS_00790 5948 6448 gene locus_tag LOCUS_00800 5948 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 6694 6909 gene locus_tag LOCUS_00810 6694 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 6949 7392 gene locus_tag LOCUS_00820 6949 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 7626 7886 gene locus_tag LOCUS_00830 7626 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 8539 7847 gene locus_tag LOCUS_00840 gene rsmG 8539 7847 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140710.1 protein_id gnl|my_center|LOCUS_00840 8757 8996 gene locus_tag LOCUS_00850 8757 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 9082 9582 gene locus_tag LOCUS_00860 9082 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 13035 9616 gene locus_tag LOCUS_00870 13035 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 13983 13270 gene locus_tag LOCUS_00880 13983 13270 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143627.1 protein_id gnl|my_center|LOCUS_00880 14556 14062 gene locus_tag LOCUS_00890 14556 14062 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_00890 14824 16572 gene locus_tag LOCUS_00900 14824 16572 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141773.1 protein_id gnl|my_center|LOCUS_00900 17343 16600 gene locus_tag LOCUS_00910 gene uppS 17343 16600 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920928.1 protein_id gnl|my_center|LOCUS_00910 18230 17340 gene locus_tag LOCUS_00920 gene cdaA 18230 17340 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057599.1 protein_id gnl|my_center|LOCUS_00920 19694 18264 gene locus_tag LOCUS_00930 gene lysA 19694 18264 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057598.1 protein_id gnl|my_center|LOCUS_00930 20294 19884 gene locus_tag LOCUS_00940 20294 19884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 20880 23093 gene locus_tag LOCUS_00950 20880 23093 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_00950 24290 23157 gene locus_tag LOCUS_00960 24290 23157 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058078.1 protein_id gnl|my_center|LOCUS_00960 24436 25164 gene locus_tag LOCUS_00970 24436 25164 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142610.1 protein_id gnl|my_center|LOCUS_00970 25325 25173 gene locus_tag LOCUS_00980 25325 25173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 26296 26979 gene locus_tag LOCUS_00990 26296 26979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929300.1 protein_id gnl|my_center|LOCUS_00990 <28203 27107 gene locus_tag LOCUS_01000 <28203 27107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058049.1:Hsp70 family protein >Feature sequence005 1200 460 gene locus_tag LOCUS_01010 1200 460 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082969.1 protein_id gnl|my_center|LOCUS_01010 2994 1258 gene locus_tag LOCUS_01020 2994 1258 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228000.1 protein_id gnl|my_center|LOCUS_01020 3673 3209 gene locus_tag LOCUS_01030 3673 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 6291 3787 gene locus_tag LOCUS_01040 6291 3787 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056008.1 protein_id gnl|my_center|LOCUS_01040 6476 6772 gene locus_tag LOCUS_01050 6476 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 7846 6824 gene locus_tag LOCUS_01060 7846 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 8858 7899 gene locus_tag LOCUS_01070 8858 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 9064 10125 gene locus_tag LOCUS_01080 9064 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 13510 10172 gene locus_tag LOCUS_01090 13510 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 13936 13514 gene locus_tag LOCUS_01100 13936 13514 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_01100 16557 14254 gene locus_tag LOCUS_01110 16557 14254 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943441.1 protein_id gnl|my_center|LOCUS_01110 16993 17178 gene locus_tag LOCUS_01120 16993 17178 CDS product PCP reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143955.1 protein_id gnl|my_center|LOCUS_01120 17175 18098 gene locus_tag LOCUS_01130 gene murQ 17175 18098 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057013.1 protein_id gnl|my_center|LOCUS_01130 18271 18582 gene locus_tag LOCUS_01140 18271 18582 CDS product DUF3067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_01140 18814 21594 gene locus_tag LOCUS_01150 18814 21594 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057287.1 protein_id gnl|my_center|LOCUS_01150 21898 21641 gene locus_tag LOCUS_01160 21898 21641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 23221 21947 gene locus_tag LOCUS_01170 23221 21947 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_01170 24099 23365 gene locus_tag LOCUS_01180 24099 23365 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_01180 24160 25404 gene locus_tag LOCUS_01190 24160 25404 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_01190 25522 26634 gene locus_tag LOCUS_01200 25522 26634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 26862 27098 gene locus_tag LOCUS_01210 26862 27098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 27954 27148 gene locus_tag LOCUS_01220 27954 27148 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922383.1 protein_id gnl|my_center|LOCUS_01220 >Feature sequence006 215 793 gene locus_tag LOCUS_01230 215 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 854 1393 gene locus_tag LOCUS_01240 854 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 1462 2256 gene locus_tag LOCUS_01250 1462 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 2407 4905 gene locus_tag LOCUS_01260 2407 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 5264 6097 gene locus_tag LOCUS_01270 5264 6097 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920890.1 protein_id gnl|my_center|LOCUS_01270 6309 8510 gene locus_tag LOCUS_01280 6309 8510 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 protein_id gnl|my_center|LOCUS_01280 8701 8979 gene locus_tag LOCUS_01290 8701 8979 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143413.1 protein_id gnl|my_center|LOCUS_01290 9086 10006 gene locus_tag LOCUS_01300 9086 10006 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_01300 10460 10008 gene locus_tag LOCUS_01310 10460 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 11419 10529 gene locus_tag LOCUS_01320 11419 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 12635 11556 gene locus_tag LOCUS_01330 gene fba 12635 11556 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_01330 13275 12778 gene locus_tag LOCUS_01340 gene apcB 13275 12778 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_01340 13707 14918 gene locus_tag LOCUS_01350 13707 14918 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_01350 15229 15035 gene locus_tag LOCUS_01360 15229 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 16047 15442 gene locus_tag LOCUS_01370 16047 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 18038 16119 gene locus_tag LOCUS_01380 gene dxs 18038 16119 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056470.1 protein_id gnl|my_center|LOCUS_01380 18448 18212 gene locus_tag LOCUS_01390 18448 18212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 18778 19893 gene locus_tag LOCUS_01400 18778 19893 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 protein_id gnl|my_center|LOCUS_01400 20092 21213 gene locus_tag LOCUS_01410 20092 21213 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 protein_id gnl|my_center|LOCUS_01410 21513 22799 gene locus_tag LOCUS_01420 21513 22799 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_01420 23465 22926 gene locus_tag LOCUS_01430 23465 22926 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140752.1 protein_id gnl|my_center|LOCUS_01430 24195 23455 gene locus_tag LOCUS_01440 gene ndhK 24195 23455 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056552.1 protein_id gnl|my_center|LOCUS_01440 24551 24192 gene locus_tag LOCUS_01450 gene ndhC 24551 24192 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986108.1 protein_id gnl|my_center|LOCUS_01450 24953 25687 gene locus_tag LOCUS_01460 24953 25687 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920678.1 protein_id gnl|my_center|LOCUS_01460 26882 25731 gene locus_tag LOCUS_01470 gene hemH 26882 25731 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920998.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence007 87 1055 gene locus_tag LOCUS_01480 87 1055 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056480.1 protein_id gnl|my_center|LOCUS_01480 1174 1260 gene locus_tag LOCUS_t00020 1174 1260 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1511 2512 gene locus_tag LOCUS_01490 1511 2512 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 protein_id gnl|my_center|LOCUS_01490 3919 2546 gene locus_tag LOCUS_01500 3919 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055996.1 protein_id gnl|my_center|LOCUS_01500 4411 5034 gene locus_tag LOCUS_01510 4411 5034 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143116.1 protein_id gnl|my_center|LOCUS_01510 5185 6516 gene locus_tag LOCUS_01520 gene guaD 5185 6516 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_01520 8007 6607 gene locus_tag LOCUS_01530 gene asnS 8007 6607 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_01530 8384 8175 gene locus_tag LOCUS_01540 8384 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 8783 9499 gene locus_tag LOCUS_01550 gene pgl 8783 9499 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_01550 9555 9797 gene locus_tag LOCUS_01560 9555 9797 CDS product DUF3493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057674.1 protein_id gnl|my_center|LOCUS_01560 10058 11113 gene locus_tag LOCUS_01570 10058 11113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 12132 11308 gene locus_tag LOCUS_01580 12132 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 13211 12129 gene locus_tag LOCUS_01590 13211 12129 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_01590 14089 13322 gene locus_tag LOCUS_01600 14089 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 14319 15005 gene locus_tag LOCUS_01610 14319 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 15090 15743 gene locus_tag LOCUS_01620 15090 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 15773 16282 gene locus_tag LOCUS_01630 15773 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928632.1 protein_id gnl|my_center|LOCUS_01630 16275 16655 gene locus_tag LOCUS_01640 16275 16655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 16712 17764 gene locus_tag LOCUS_01650 16712 17764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 20654 17814 gene locus_tag LOCUS_01660 20654 17814 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268475.1 protein_id gnl|my_center|LOCUS_01660 21401 22045 gene locus_tag LOCUS_01670 gene rplC 21401 22045 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055936.1 protein_id gnl|my_center|LOCUS_01670 22112 22783 gene locus_tag LOCUS_01680 gene rplD 22112 22783 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055937.1 protein_id gnl|my_center|LOCUS_01680 22812 23126 gene locus_tag LOCUS_01690 22812 23126 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125859.1 protein_id gnl|my_center|LOCUS_01690 23180 24046 gene locus_tag LOCUS_01700 gene rplB 23180 24046 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055939.1 protein_id gnl|my_center|LOCUS_01700 24109 24387 gene locus_tag LOCUS_01710 gene rpsS 24109 24387 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055940.1 protein_id gnl|my_center|LOCUS_01710 24405 24761 gene locus_tag LOCUS_01720 gene rplV 24405 24761 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055941.1 protein_id gnl|my_center|LOCUS_01720 >Feature sequence008 1103 51 gene locus_tag LOCUS_01730 1103 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 2994 1318 gene locus_tag LOCUS_01740 2994 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3320 2991 gene locus_tag LOCUS_01750 3320 2991 CDS product DUF3007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_01750 5476 3842 gene locus_tag LOCUS_01760 5476 3842 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087216.1 protein_id gnl|my_center|LOCUS_01760 5752 6066 gene locus_tag LOCUS_01770 gene rpsJ 5752 6066 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143917.1 protein_id gnl|my_center|LOCUS_01770 6385 7398 gene locus_tag LOCUS_01780 6385 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 7465 8367 gene locus_tag LOCUS_01790 7465 8367 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057801.1 protein_id gnl|my_center|LOCUS_01790 9230 8397 gene locus_tag LOCUS_01800 9230 8397 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799517.1 protein_id gnl|my_center|LOCUS_01800 9703 9308 gene locus_tag LOCUS_01810 9703 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 9946 10734 gene locus_tag LOCUS_01820 9946 10734 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921210.1 protein_id gnl|my_center|LOCUS_01820 10874 12220 gene locus_tag LOCUS_01830 10874 12220 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_01830 12386 13534 gene locus_tag LOCUS_01840 12386 13534 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_01840 13608 14468 gene locus_tag LOCUS_01850 gene cysT 13608 14468 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056130.1 protein_id gnl|my_center|LOCUS_01850 14461 15336 gene locus_tag LOCUS_01860 gene cysW 14461 15336 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_01860 15505 15774 gene locus_tag LOCUS_01870 15505 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 15972 16042 gene locus_tag LOCUS_t00030 15972 16042 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 17038 16094 gene locus_tag LOCUS_01880 17038 16094 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_01880 17497 17970 gene locus_tag LOCUS_01890 17497 17970 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_01890 18759 19145 gene locus_tag LOCUS_01900 18759 19145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 19153 20106 gene locus_tag LOCUS_01910 19153 20106 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143278.1 protein_id gnl|my_center|LOCUS_01910 20201 21697 gene locus_tag LOCUS_01920 20201 21697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 21833 23023 gene locus_tag LOCUS_01930 21833 23023 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_01930 23269 23760 gene locus_tag LOCUS_01940 23269 23760 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406022.1 protein_id gnl|my_center|LOCUS_01940 24236 23811 gene locus_tag LOCUS_01950 24236 23811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 >Feature sequence009 2241 3557 gene locus_tag LOCUS_01960 2241 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 3602 4396 gene locus_tag LOCUS_01970 3602 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 5790 4342 gene locus_tag LOCUS_01980 5790 4342 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_01980 6476 5793 gene locus_tag LOCUS_01990 6476 5793 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300395.1 protein_id gnl|my_center|LOCUS_01990 6980 7171 gene locus_tag LOCUS_02000 6980 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 7289 8653 gene locus_tag LOCUS_02010 gene rfbH 7289 8653 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_02010 8646 9692 gene locus_tag LOCUS_02020 8646 9692 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105806.1 protein_id gnl|my_center|LOCUS_02020 9755 10567 gene locus_tag LOCUS_02030 9755 10567 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_02030 10564 11478 gene locus_tag LOCUS_02040 10564 11478 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_02040 13126 11588 gene locus_tag LOCUS_02050 13126 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 14184 13210 gene locus_tag LOCUS_02060 14184 13210 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_02060 14586 15938 gene locus_tag LOCUS_02070 14586 15938 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928800.1 protein_id gnl|my_center|LOCUS_02070 16543 15935 gene locus_tag LOCUS_02080 16543 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 17314 16862 gene locus_tag LOCUS_02090 17314 16862 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056075.1 protein_id gnl|my_center|LOCUS_02090 18682 17366 gene locus_tag LOCUS_02100 18682 17366 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 protein_id gnl|my_center|LOCUS_02100 20310 18772 gene locus_tag LOCUS_02110 20310 18772 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920778.1 protein_id gnl|my_center|LOCUS_02110 22174 20339 gene locus_tag LOCUS_02120 22174 20339 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056748.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence010 1898 159 gene locus_tag LOCUS_02130 1898 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 1980 2171 gene locus_tag LOCUS_02140 1980 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2596 2138 gene locus_tag LOCUS_02150 2596 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 3024 2578 gene locus_tag LOCUS_02160 3024 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 4564 3623 gene locus_tag LOCUS_02170 4564 3623 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_02170 4875 6704 gene locus_tag LOCUS_02180 4875 6704 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199341128.1 protein_id gnl|my_center|LOCUS_02180 6691 7647 gene locus_tag LOCUS_02190 6691 7647 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056403.1 protein_id gnl|my_center|LOCUS_02190 7746 7570 gene locus_tag LOCUS_02200 7746 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 7764 8729 gene locus_tag LOCUS_02210 7764 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 8704 10296 gene locus_tag LOCUS_02220 8704 10296 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256724.1 protein_id gnl|my_center|LOCUS_02220 10326 10655 gene locus_tag LOCUS_02230 10326 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 12893 10698 gene locus_tag LOCUS_02240 12893 10698 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083633.1 protein_id gnl|my_center|LOCUS_02240 14030 13077 gene locus_tag LOCUS_02250 14030 13077 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_02250 14628 14083 gene locus_tag LOCUS_02260 14628 14083 CDS product putative colanic acid biosynthesis acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_02260 14747 15130 gene locus_tag LOCUS_02270 14747 15130 CDS product DUF3110 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 protein_id gnl|my_center|LOCUS_02270 15156 15626 gene locus_tag LOCUS_02280 15156 15626 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124513.1 protein_id gnl|my_center|LOCUS_02280 15686 16897 gene locus_tag LOCUS_02290 gene argJ 15686 16897 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057748.1 protein_id gnl|my_center|LOCUS_02290 17144 18412 gene locus_tag LOCUS_02300 17144 18412 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_02300 18416 19801 gene locus_tag LOCUS_02310 18416 19801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence011 140 877 gene locus_tag LOCUS_02320 140 877 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_02320 867 1541 gene locus_tag LOCUS_02330 867 1541 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_02330 2789 1503 gene locus_tag LOCUS_02340 gene sbcD 2789 1503 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057812.1 protein_id gnl|my_center|LOCUS_02340 3199 2786 gene locus_tag LOCUS_02350 3199 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056714.1 protein_id gnl|my_center|LOCUS_02350 4282 3320 gene locus_tag LOCUS_02360 gene secF 4282 3320 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056057.1 protein_id gnl|my_center|LOCUS_02360 5769 4279 gene locus_tag LOCUS_02370 gene secD 5769 4279 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056058.1 protein_id gnl|my_center|LOCUS_02370 6505 5879 gene locus_tag LOCUS_02380 6505 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6899 7183 gene locus_tag LOCUS_02390 6899 7183 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_02390 7214 8038 gene locus_tag LOCUS_02400 7214 8038 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143437.1 protein_id gnl|my_center|LOCUS_02400 8149 8661 gene locus_tag LOCUS_02410 8149 8661 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057365.1 protein_id gnl|my_center|LOCUS_02410 8704 8994 gene locus_tag LOCUS_02420 gene gatC 8704 8994 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057364.1 protein_id gnl|my_center|LOCUS_02420 9056 9484 gene locus_tag LOCUS_02430 9056 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 9880 9593 gene locus_tag LOCUS_02440 gene rpmA 9880 9593 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056021.1 protein_id gnl|my_center|LOCUS_02440 10290 9961 gene locus_tag LOCUS_02450 gene rplU 10290 9961 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056022.1 protein_id gnl|my_center|LOCUS_02450 11345 10503 gene locus_tag LOCUS_02460 11345 10503 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143271.1 protein_id gnl|my_center|LOCUS_02460 11575 11745 gene locus_tag LOCUS_02470 11575 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 12284 13420 gene locus_tag LOCUS_02480 12284 13420 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_02480 15527 13530 gene locus_tag LOCUS_02490 15527 13530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 16310 15858 gene locus_tag LOCUS_02500 16310 15858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 17219 16746 gene locus_tag LOCUS_02510 17219 16746 CDS product photosystem I reaction center protein subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058236.1 protein_id gnl|my_center|LOCUS_02510 18103 17447 gene locus_tag LOCUS_02520 gene nth 18103 17447 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_02520 18291 19238 gene locus_tag LOCUS_02530 18291 19238 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055982.1 protein_id gnl|my_center|LOCUS_02530 20160 19231 gene locus_tag LOCUS_02540 20160 19231 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836797.1 protein_id gnl|my_center|LOCUS_02540 21118 20180 gene locus_tag LOCUS_02550 21118 20180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 22002 21115 gene locus_tag LOCUS_02560 22002 21115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 <23532 22663 gene locus_tag LOCUS_02570 <23532 22663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257983.1:glycosyltransferase >Feature sequence012 44 1132 gene locus_tag LOCUS_02580 44 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 1450 2304 gene locus_tag LOCUS_02590 gene aguB 1450 2304 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141681.1 protein_id gnl|my_center|LOCUS_02590 3097 2324 gene locus_tag LOCUS_02600 3097 2324 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_02600 3506 4414 gene locus_tag LOCUS_02610 gene truB 3506 4414 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041244185.1 protein_id gnl|my_center|LOCUS_02610 6373 4478 gene locus_tag LOCUS_02620 gene htpG 6373 4478 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057033.1 protein_id gnl|my_center|LOCUS_02620 6736 6981 gene locus_tag LOCUS_02630 6736 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 7006 7818 gene locus_tag LOCUS_02640 7006 7818 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920645.1 protein_id gnl|my_center|LOCUS_02640 7960 9243 gene locus_tag LOCUS_02650 gene ftsZ 7960 9243 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_02650 9524 10426 gene locus_tag LOCUS_02660 9524 10426 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_02660 10911 11573 gene locus_tag LOCUS_02670 gene ntcA 10911 11573 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920910.1 protein_id gnl|my_center|LOCUS_02670 11676 12017 gene locus_tag LOCUS_02680 11676 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 12776 12168 gene locus_tag LOCUS_02690 gene coaE 12776 12168 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056742.1 protein_id gnl|my_center|LOCUS_02690 12845 13099 gene locus_tag LOCUS_02700 12845 13099 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125345.1 protein_id gnl|my_center|LOCUS_02700 13216 13941 gene locus_tag LOCUS_02710 13216 13941 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 protein_id gnl|my_center|LOCUS_02710 15267 14155 gene locus_tag LOCUS_02720 15267 14155 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055884.1 protein_id gnl|my_center|LOCUS_02720 15327 16493 gene locus_tag LOCUS_02730 15327 16493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 16602 17246 gene locus_tag LOCUS_02740 16602 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 17307 19469 gene locus_tag LOCUS_02750 17307 19469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 20725 19511 gene locus_tag LOCUS_02760 20725 19511 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928828.1 protein_id gnl|my_center|LOCUS_02760 20981 21805 gene locus_tag LOCUS_02770 gene cpdA 20981 21805 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence013 2697 3137 gene locus_tag LOCUS_02780 2697 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 3248 5200 gene locus_tag LOCUS_02790 3248 5200 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140428.1 protein_id gnl|my_center|LOCUS_02790 5271 5663 gene locus_tag LOCUS_02800 5271 5663 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_02800 5680 6087 gene locus_tag LOCUS_02810 5680 6087 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928771.1 protein_id gnl|my_center|LOCUS_02810 6250 8463 gene locus_tag LOCUS_02820 6250 8463 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141412.1 protein_id gnl|my_center|LOCUS_02820 8556 9584 gene locus_tag LOCUS_02830 8556 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 9696 11147 gene locus_tag LOCUS_02840 9696 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 11331 12704 gene locus_tag LOCUS_02850 11331 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 12717 14885 gene locus_tag LOCUS_02860 12717 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141408.1 protein_id gnl|my_center|LOCUS_02860 15854 14907 gene locus_tag LOCUS_02870 15854 14907 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_02870 16427 15882 gene locus_tag LOCUS_02880 16427 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 17369 16494 gene locus_tag LOCUS_02890 17369 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 18176 17451 gene locus_tag LOCUS_02900 18176 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 21144 18469 gene locus_tag LOCUS_02910 gene mgtA 21144 18469 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047937.1 protein_id gnl|my_center|LOCUS_02910 21768 21343 gene locus_tag LOCUS_02920 21768 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 22300 21998 gene locus_tag LOCUS_02930 22300 21998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 22490 22341 gene locus_tag LOCUS_02940 22490 22341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence014 <1 706 gene locus_tag LOCUS_02950 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057667.1:LOG family protein 798 2126 gene locus_tag LOCUS_02960 798 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 2196 3458 gene locus_tag LOCUS_02970 2196 3458 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920848.1 protein_id gnl|my_center|LOCUS_02970 5346 3742 gene locus_tag LOCUS_02980 5346 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 5829 5608 gene locus_tag LOCUS_02990 5829 5608 CDS product Calvin cycle protein CP12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_02990 6815 5919 gene locus_tag LOCUS_03000 6815 5919 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143417.1 protein_id gnl|my_center|LOCUS_03000 7334 7855 gene locus_tag LOCUS_03010 7334 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 7919 7993 gene locus_tag LOCUS_t00040 7919 7993 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9098 8049 gene locus_tag LOCUS_03020 gene hisC 9098 8049 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_03020 10137 9211 gene locus_tag LOCUS_03030 10137 9211 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_03030 10157 11197 gene locus_tag LOCUS_03040 10157 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 11397 11897 gene locus_tag LOCUS_03050 11397 11897 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058135.1 protein_id gnl|my_center|LOCUS_03050 11983 12663 gene locus_tag LOCUS_03060 11983 12663 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799489.1 protein_id gnl|my_center|LOCUS_03060 12660 12941 gene locus_tag LOCUS_03070 12660 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 13060 13518 gene locus_tag LOCUS_03080 13060 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 13531 14187 gene locus_tag LOCUS_03090 13531 14187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058134.1 protein_id gnl|my_center|LOCUS_03090 14750 14268 gene locus_tag LOCUS_03100 14750 14268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 15079 14810 gene locus_tag LOCUS_03110 gene rpsO 15079 14810 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057049.1 protein_id gnl|my_center|LOCUS_03110 16422 15706 gene locus_tag LOCUS_03120 16422 15706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 16786 17172 gene locus_tag LOCUS_03130 16786 17172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 17153 17515 gene locus_tag LOCUS_03140 17153 17515 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920785.1 protein_id gnl|my_center|LOCUS_03140 17539 18069 gene locus_tag LOCUS_03150 17539 18069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 19177 18251 gene locus_tag LOCUS_03160 19177 18251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088891.1 protein_id gnl|my_center|LOCUS_03160 20374 19286 gene locus_tag LOCUS_03170 20374 19286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088890.1 protein_id gnl|my_center|LOCUS_03170 21662 20463 gene locus_tag LOCUS_03180 21662 20463 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966718.1 protein_id gnl|my_center|LOCUS_03180 <22721 21864 gene locus_tag LOCUS_03190 <22721 21864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928564.1:iron uptake porin >Feature sequence015 1309 128 gene locus_tag LOCUS_03200 gene lpxB 1309 128 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_03200 1416 1613 gene locus_tag LOCUS_03210 gene rpmI 1416 1613 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057993.1 protein_id gnl|my_center|LOCUS_03210 1685 2038 gene locus_tag LOCUS_03220 gene rplT 1685 2038 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057992.1 protein_id gnl|my_center|LOCUS_03220 2113 2943 gene locus_tag LOCUS_03230 2113 2943 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142777.1 protein_id gnl|my_center|LOCUS_03230 3789 2971 gene locus_tag LOCUS_03240 3789 2971 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920721.1 protein_id gnl|my_center|LOCUS_03240 4804 3938 gene locus_tag LOCUS_03250 4804 3938 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_03250 4981 6249 gene locus_tag LOCUS_03260 4981 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057390.1 protein_id gnl|my_center|LOCUS_03260 6938 6285 gene locus_tag LOCUS_03270 gene msrA 6938 6285 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_03270 7631 7335 gene locus_tag LOCUS_03280 7631 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 9193 7727 gene locus_tag LOCUS_03290 9193 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 9585 9190 gene locus_tag LOCUS_03300 9585 9190 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056283.1 protein_id gnl|my_center|LOCUS_03300 10521 10042 gene locus_tag LOCUS_03310 10521 10042 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524127.1 protein_id gnl|my_center|LOCUS_03310 11180 11743 gene locus_tag LOCUS_03320 11180 11743 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_03320 11818 13278 gene locus_tag LOCUS_03330 gene gatA 11818 13278 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_03330 14737 13448 gene locus_tag LOCUS_03340 14737 13448 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920845.1 protein_id gnl|my_center|LOCUS_03340 15008 16333 gene locus_tag LOCUS_03350 15008 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 16379 17593 gene locus_tag LOCUS_03360 16379 17593 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267844.1 protein_id gnl|my_center|LOCUS_03360 18306 17731 gene locus_tag LOCUS_03370 18306 17731 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140022.1 protein_id gnl|my_center|LOCUS_03370 18506 19729 gene locus_tag LOCUS_03380 gene chrA 18506 19729 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_03380 19741 20574 gene locus_tag LOCUS_03390 19741 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 <22455 20561 gene locus_tag LOCUS_03400 <22455 20561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144069.1:DNA primase >Feature sequence016 <1 1179 gene locus_tag LOCUS_03410 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056530.1:cytochrome c biogenesis protein 1182 1751 gene locus_tag LOCUS_03420 1182 1751 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142811.1 protein_id gnl|my_center|LOCUS_03420 3078 1987 gene locus_tag LOCUS_03430 3078 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_03430 4315 3143 gene locus_tag LOCUS_03440 gene carA 4315 3143 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056605.1 protein_id gnl|my_center|LOCUS_03440 4962 4444 gene locus_tag LOCUS_03450 4962 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_03450 5539 5057 gene locus_tag LOCUS_03460 5539 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 6788 5565 gene locus_tag LOCUS_03470 6788 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7218 6877 gene locus_tag LOCUS_03480 7218 6877 CDS product NIF family HAD-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816113.1 protein_id gnl|my_center|LOCUS_03480 7685 7323 gene locus_tag LOCUS_03490 7685 7323 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_03490 8302 7736 gene locus_tag LOCUS_03500 gene def 8302 7736 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142225.1 protein_id gnl|my_center|LOCUS_03500 9693 8425 gene locus_tag LOCUS_03510 9693 8425 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798996.1 protein_id gnl|my_center|LOCUS_03510 10030 9674 gene locus_tag LOCUS_03520 10030 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 10713 10228 gene locus_tag LOCUS_03530 10713 10228 CDS product CGLD27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056906.1 protein_id gnl|my_center|LOCUS_03530 11035 14337 gene locus_tag LOCUS_03540 gene rpoB 11035 14337 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056489.1 protein_id gnl|my_center|LOCUS_03540 14443 16479 gene locus_tag LOCUS_03550 14443 16479 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056488.1 protein_id gnl|my_center|LOCUS_03550 16568 20545 gene locus_tag LOCUS_03560 16568 20545 CDS product DNA-directed RNA polymerase subunit beta'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056487.1 protein_id gnl|my_center|LOCUS_03560 20664 20930 gene locus_tag LOCUS_03570 gene purS 20664 20930 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_03570 20927 21625 gene locus_tag LOCUS_03580 gene purQ 20927 21625 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence017 1388 189 gene locus_tag LOCUS_03590 1388 189 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331373.1 protein_id gnl|my_center|LOCUS_03590 3235 1385 gene locus_tag LOCUS_03600 gene asnB 3235 1385 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 protein_id gnl|my_center|LOCUS_03600 6166 3740 gene locus_tag LOCUS_03610 6166 3740 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143682.1 protein_id gnl|my_center|LOCUS_03610 7325 8134 gene locus_tag LOCUS_03620 7325 8134 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928594.1 protein_id gnl|my_center|LOCUS_03620 8269 8553 gene locus_tag LOCUS_03630 8269 8553 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918134.1 protein_id gnl|my_center|LOCUS_03630 9572 8583 gene locus_tag LOCUS_03640 gene galE 9572 8583 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_03640 9892 9608 gene locus_tag LOCUS_03650 9892 9608 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057771.1 protein_id gnl|my_center|LOCUS_03650 11195 9954 gene locus_tag LOCUS_03660 gene nusA 11195 9954 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171888.1 protein_id gnl|my_center|LOCUS_03660 11811 11350 gene locus_tag LOCUS_03670 gene rimP 11811 11350 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929303.1 protein_id gnl|my_center|LOCUS_03670 12418 12200 gene locus_tag LOCUS_03680 12418 12200 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141485.1 protein_id gnl|my_center|LOCUS_03680 12969 14114 gene locus_tag LOCUS_03690 12969 14114 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544567.1 protein_id gnl|my_center|LOCUS_03690 17974 14240 gene locus_tag LOCUS_03700 17974 14240 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_03700 18278 19393 gene locus_tag LOCUS_03710 18278 19393 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_03710 19433 21610 gene locus_tag LOCUS_03720 19433 21610 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence018 <1 1447 gene locus_tag LOCUS_03730 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140837.1:DASH family cryptochrome 1552 2238 gene locus_tag LOCUS_03740 1552 2238 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_03740 2467 4044 gene locus_tag LOCUS_03750 gene purH 2467 4044 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057387.1 protein_id gnl|my_center|LOCUS_03750 7320 4264 gene locus_tag LOCUS_03760 7320 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 8770 7400 gene locus_tag LOCUS_03770 8770 7400 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089836.1 protein_id gnl|my_center|LOCUS_03770 9480 8827 gene locus_tag LOCUS_03780 9480 8827 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_03780 10509 9568 gene locus_tag LOCUS_03790 10509 9568 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_03790 11627 10605 gene locus_tag LOCUS_03800 11627 10605 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057257.1 protein_id gnl|my_center|LOCUS_03800 12449 11688 gene locus_tag LOCUS_03810 gene fabG 12449 11688 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_03810 12913 12464 gene locus_tag LOCUS_03820 12913 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 14694 13042 gene locus_tag LOCUS_03830 14694 13042 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_03830 15268 16110 gene locus_tag LOCUS_03840 15268 16110 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056446.1 protein_id gnl|my_center|LOCUS_03840 16273 16509 gene locus_tag LOCUS_03850 gene acpP 16273 16509 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_03850 16705 17961 gene locus_tag LOCUS_03860 gene fabF 16705 17961 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057708.1 protein_id gnl|my_center|LOCUS_03860 19028 18021 gene locus_tag LOCUS_03870 19028 18021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 19081 19395 gene locus_tag LOCUS_03880 19081 19395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 20600 19524 gene locus_tag LOCUS_03890 20600 19524 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 protein_id gnl|my_center|LOCUS_03890 21163 20762 gene locus_tag LOCUS_03900 21163 20762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence019 118 738 gene locus_tag LOCUS_03910 118 738 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880571.1 protein_id gnl|my_center|LOCUS_03910 1610 786 gene locus_tag LOCUS_03920 1610 786 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_03920 2256 1801 gene locus_tag LOCUS_03930 2256 1801 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142755.1 protein_id gnl|my_center|LOCUS_03930 3388 2750 gene locus_tag LOCUS_03940 3388 2750 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140957.1 protein_id gnl|my_center|LOCUS_03940 4101 3385 gene locus_tag LOCUS_03950 4101 3385 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170061.1 protein_id gnl|my_center|LOCUS_03950 4090 5109 gene locus_tag LOCUS_03960 4090 5109 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391987.1 protein_id gnl|my_center|LOCUS_03960 5315 6670 gene locus_tag LOCUS_03970 5315 6670 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057019.1 protein_id gnl|my_center|LOCUS_03970 7406 6798 gene locus_tag LOCUS_03980 7406 6798 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_03980 7576 8013 gene locus_tag LOCUS_03990 7576 8013 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225192.1 protein_id gnl|my_center|LOCUS_03990 8017 8805 gene locus_tag LOCUS_04000 8017 8805 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_04000 8822 9802 gene locus_tag LOCUS_04010 8822 9802 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688696.1 protein_id gnl|my_center|LOCUS_04010 9969 10286 gene locus_tag LOCUS_04020 9969 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 10621 11580 gene locus_tag LOCUS_04030 10621 11580 CDS product orange carotenoid protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140054.1 protein_id gnl|my_center|LOCUS_04030 12134 11955 gene locus_tag LOCUS_04040 12134 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 12724 14982 gene locus_tag LOCUS_04050 gene glgB 12724 14982 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_04050 16066 15020 gene locus_tag LOCUS_04060 16066 15020 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928708.1 protein_id gnl|my_center|LOCUS_04060 16778 16254 gene locus_tag LOCUS_04070 16778 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 17293 17012 gene locus_tag LOCUS_04080 17293 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 18842 17433 gene locus_tag LOCUS_04090 18842 17433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence020 55 687 gene locus_tag LOCUS_04100 55 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 826 2655 gene locus_tag LOCUS_04110 826 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 4377 2782 gene locus_tag LOCUS_04120 gene lysS 4377 2782 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583287.1 protein_id gnl|my_center|LOCUS_04120 5517 4615 gene locus_tag LOCUS_04130 5517 4615 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_04130 5480 5620 gene locus_tag LOCUS_04140 5480 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 5704 6261 gene locus_tag LOCUS_04150 5704 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6297 6569 gene locus_tag LOCUS_04160 6297 6569 CDS product DUF3143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_04160 6753 7769 gene locus_tag LOCUS_04170 6753 7769 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_04170 7822 8715 gene locus_tag LOCUS_04180 gene dapA 7822 8715 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057061.1 protein_id gnl|my_center|LOCUS_04180 8936 10837 gene locus_tag LOCUS_04190 8936 10837 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057062.1 protein_id gnl|my_center|LOCUS_04190 11060 11287 gene locus_tag LOCUS_04200 11060 11287 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673486.1 protein_id gnl|my_center|LOCUS_04200 11370 11969 gene locus_tag LOCUS_04210 gene cbiT 11370 11969 CDS product precorrin-6Y C5,15-methyltransferase subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144345.1 protein_id gnl|my_center|LOCUS_04210 12711 11998 gene locus_tag LOCUS_04220 gene rpiA 12711 11998 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_04220 12923 14044 gene locus_tag LOCUS_04230 12923 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 14120 15232 gene locus_tag LOCUS_04240 14120 15232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 15252 17051 gene locus_tag LOCUS_04250 15252 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 17144 17695 gene locus_tag LOCUS_04260 17144 17695 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530085.1 protein_id gnl|my_center|LOCUS_04260 17877 18506 gene locus_tag LOCUS_04270 17877 18506 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057508.1 protein_id gnl|my_center|LOCUS_04270 19094 18543 gene locus_tag LOCUS_04280 19094 18543 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140402.1 protein_id gnl|my_center|LOCUS_04280 20543 19230 gene locus_tag LOCUS_04290 20543 19230 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_04290 21087 20761 gene locus_tag LOCUS_04300 21087 20761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence021 1024 323 gene locus_tag LOCUS_04310 1024 323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_04310 2375 1080 gene locus_tag LOCUS_04320 2375 1080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530116.1 protein_id gnl|my_center|LOCUS_04320 3733 2393 gene locus_tag LOCUS_04330 3733 2393 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140777.1 protein_id gnl|my_center|LOCUS_04330 4204 4818 gene locus_tag LOCUS_04340 4204 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 4946 5440 gene locus_tag LOCUS_04350 4946 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5454 6926 gene locus_tag LOCUS_04360 5454 6926 CDS product glycoside hydrolase 100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_04360 6910 7659 gene locus_tag LOCUS_04370 6910 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 7855 8925 gene locus_tag LOCUS_04380 7855 8925 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_04380 9162 10457 gene locus_tag LOCUS_04390 9162 10457 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057429.1 protein_id gnl|my_center|LOCUS_04390 10594 10851 gene locus_tag LOCUS_04400 10594 10851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 10993 11574 gene locus_tag LOCUS_04410 10993 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 11571 12509 gene locus_tag LOCUS_04420 11571 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 12548 14821 gene locus_tag LOCUS_04430 12548 14821 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929205.1 protein_id gnl|my_center|LOCUS_04430 15563 14856 gene locus_tag LOCUS_04440 15563 14856 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529467.1 protein_id gnl|my_center|LOCUS_04440 15841 16470 gene locus_tag LOCUS_04450 15841 16470 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_04450 16509 17738 gene locus_tag LOCUS_04460 16509 17738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 17704 18372 gene locus_tag LOCUS_04470 17704 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 18718 18374 gene locus_tag LOCUS_04480 18718 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 20952 18883 gene locus_tag LOCUS_04490 20952 18883 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056167.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence022 <1 1677 gene locus_tag LOCUS_04500 <1 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392228.1:energy-coupling factor transporter ATPase 1767 2612 gene locus_tag LOCUS_04510 1767 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 7017 2671 gene locus_tag LOCUS_04520 7017 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 12026 7023 gene locus_tag LOCUS_04530 12026 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 15242 12105 gene locus_tag LOCUS_04540 15242 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 19383 15256 gene locus_tag LOCUS_04550 19383 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 <20896 19582 gene locus_tag LOCUS_04560 <20896 19582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921089.1:phosphomethylpyrimidine synthase >Feature sequence023 2075 399 gene locus_tag LOCUS_04570 2075 399 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_04570 3503 2283 gene locus_tag LOCUS_04580 3503 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 5667 3514 gene locus_tag LOCUS_04590 5667 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 7156 5762 gene locus_tag LOCUS_04600 gene fslC 7156 5762 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_04600 8211 7159 gene locus_tag LOCUS_04610 8211 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 8468 8208 gene locus_tag LOCUS_04620 8468 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 9382 8540 gene locus_tag LOCUS_04630 9382 8540 CDS product YHYH protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112220.1 protein_id gnl|my_center|LOCUS_04630 9963 9568 gene locus_tag LOCUS_04640 9963 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 10115 10786 gene locus_tag LOCUS_04650 10115 10786 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_04650 10838 12436 gene locus_tag LOCUS_04660 10838 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 12804 13484 gene locus_tag LOCUS_04670 12804 13484 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368006.1 protein_id gnl|my_center|LOCUS_04670 14233 13544 gene locus_tag LOCUS_04680 14233 13544 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109966.1 protein_id gnl|my_center|LOCUS_04680 15261 14596 gene locus_tag LOCUS_04690 15261 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 15615 15316 gene locus_tag LOCUS_04700 15615 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 16422 16958 gene locus_tag LOCUS_04710 16422 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04710 17210 18697 gene locus_tag LOCUS_04720 17210 18697 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138556.1 protein_id gnl|my_center|LOCUS_04720 18690 19691 gene locus_tag LOCUS_04730 18690 19691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016656.1 protein_id gnl|my_center|LOCUS_04730 19901 20239 gene locus_tag LOCUS_04740 19901 20239 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142158.1 protein_id gnl|my_center|LOCUS_04740 20232 20639 gene locus_tag LOCUS_04750 20232 20639 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142157.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence024 207 872 gene locus_tag LOCUS_04760 207 872 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_04760 891 1364 gene locus_tag LOCUS_04770 891 1364 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 protein_id gnl|my_center|LOCUS_04770 1923 1372 gene locus_tag LOCUS_04780 1923 1372 CDS product protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 protein_id gnl|my_center|LOCUS_04780 2444 1923 gene locus_tag LOCUS_04790 gene purE 2444 1923 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056434.1 protein_id gnl|my_center|LOCUS_04790 3559 2663 gene locus_tag LOCUS_04800 3559 2663 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_04800 4344 3589 gene locus_tag LOCUS_04810 4344 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 5953 4436 gene locus_tag LOCUS_04820 5953 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 6975 6193 gene locus_tag LOCUS_04830 6975 6193 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_04830 7106 7330 gene locus_tag LOCUS_04840 7106 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 7917 7360 gene locus_tag LOCUS_04850 7917 7360 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_04850 9282 7978 gene locus_tag LOCUS_04860 9282 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 9448 10299 gene locus_tag LOCUS_04870 gene nadC 9448 10299 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_04870 10572 11057 gene locus_tag LOCUS_04880 10572 11057 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_04880 11070 12671 gene locus_tag LOCUS_04890 11070 12671 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_04890 13447 12668 gene locus_tag LOCUS_04900 13447 12668 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618819.1 protein_id gnl|my_center|LOCUS_04900 14197 13544 gene locus_tag LOCUS_04910 14197 13544 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266926.1 protein_id gnl|my_center|LOCUS_04910 15183 14227 gene locus_tag LOCUS_04920 15183 14227 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056398.1 protein_id gnl|my_center|LOCUS_04920 15482 16645 gene locus_tag LOCUS_04930 15482 16645 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141602.1 protein_id gnl|my_center|LOCUS_04930 17053 17430 gene locus_tag LOCUS_04940 17053 17430 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_04940 17417 18427 gene locus_tag LOCUS_04950 17417 18427 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377275.1 protein_id gnl|my_center|LOCUS_04950 18448 19170 gene locus_tag LOCUS_04960 18448 19170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 19929 20564 gene locus_tag LOCUS_04970 19929 20564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence025 1610 81 gene locus_tag LOCUS_04980 gene psbB 1610 81 CDS product photosystem II chlorophyll-binding protein CP47 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057370.1 protein_id gnl|my_center|LOCUS_04980 3016 1925 gene locus_tag LOCUS_04990 3016 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 3225 3626 gene locus_tag LOCUS_05000 3225 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 3906 4418 gene locus_tag LOCUS_05010 3906 4418 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141154.1 protein_id gnl|my_center|LOCUS_05010 4434 5177 gene locus_tag LOCUS_05020 4434 5177 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141153.1 protein_id gnl|my_center|LOCUS_05020 6187 5849 gene locus_tag LOCUS_05030 6187 5849 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_05030 9035 6285 gene locus_tag LOCUS_05040 9035 6285 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_05040 9223 10326 gene locus_tag LOCUS_05050 9223 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 10378 12075 gene locus_tag LOCUS_05060 gene mutL 10378 12075 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137908825.1 protein_id gnl|my_center|LOCUS_05060 12308 12853 gene locus_tag LOCUS_05070 12308 12853 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_05070 13048 13386 gene locus_tag LOCUS_05080 13048 13386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 13399 15093 gene locus_tag LOCUS_05090 13399 15093 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812216.1 protein_id gnl|my_center|LOCUS_05090 15392 15153 gene locus_tag LOCUS_05100 15392 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 15363 16331 gene locus_tag LOCUS_05110 15363 16331 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057398.1 protein_id gnl|my_center|LOCUS_05110 17260 16379 gene locus_tag LOCUS_05120 gene fabD 17260 16379 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920631.1 protein_id gnl|my_center|LOCUS_05120 18768 17551 gene locus_tag LOCUS_05130 18768 17551 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_05130 19205 18993 gene locus_tag LOCUS_05140 19205 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 19432 19211 gene locus_tag LOCUS_05150 19432 19211 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_05150 19716 19456 gene locus_tag LOCUS_05160 19716 19456 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_05160 19967 19719 gene locus_tag LOCUS_05170 19967 19719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 20305 20030 gene locus_tag LOCUS_05180 20305 20030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence026 199 579 gene locus_tag LOCUS_05190 199 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 1803 688 gene locus_tag LOCUS_05200 1803 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 6981 2026 gene locus_tag LOCUS_05210 6981 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 7375 6998 gene locus_tag LOCUS_05220 7375 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8303 7965 gene locus_tag LOCUS_05230 8303 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 9200 12712 gene locus_tag LOCUS_05240 9200 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 14841 12895 gene locus_tag LOCUS_05250 14841 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 16354 15008 gene locus_tag LOCUS_05260 16354 15008 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_05260 18354 16462 gene locus_tag LOCUS_05270 18354 16462 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975320.1 protein_id gnl|my_center|LOCUS_05270 >Feature sequence027 162 878 gene locus_tag LOCUS_05280 162 878 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 protein_id gnl|my_center|LOCUS_05280 1344 904 gene locus_tag LOCUS_05290 1344 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 1612 1358 gene locus_tag LOCUS_05300 1612 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 1799 3010 gene locus_tag LOCUS_05310 gene moeB 1799 3010 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_05310 3956 3060 gene locus_tag LOCUS_05320 3956 3060 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809696.1 protein_id gnl|my_center|LOCUS_05320 4313 6331 gene locus_tag LOCUS_05330 4313 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 7703 6495 gene locus_tag LOCUS_05340 7703 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 8481 7783 gene locus_tag LOCUS_05350 8481 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 8928 8593 gene locus_tag LOCUS_05360 8928 8593 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_05360 9947 9357 gene locus_tag LOCUS_05370 9947 9357 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_05370 10058 11308 gene locus_tag LOCUS_05380 10058 11308 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_05380 11389 11997 gene locus_tag LOCUS_05390 11389 11997 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142877.1 protein_id gnl|my_center|LOCUS_05390 12933 12052 gene locus_tag LOCUS_05400 12933 12052 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_05400 14045 13404 gene locus_tag LOCUS_05410 14045 13404 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057443.1 protein_id gnl|my_center|LOCUS_05410 14440 14024 gene locus_tag LOCUS_05420 14440 14024 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_05420 15514 14480 gene locus_tag LOCUS_05430 gene aroF 15514 14480 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_05430 16141 17235 gene locus_tag LOCUS_05440 16141 17235 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928544.1 protein_id gnl|my_center|LOCUS_05440 17272 17937 gene locus_tag LOCUS_05450 17272 17937 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174178.1 protein_id gnl|my_center|LOCUS_05450 18895 18026 gene locus_tag LOCUS_05460 18895 18026 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057406.1 protein_id gnl|my_center|LOCUS_05460 19170 18979 gene locus_tag LOCUS_05470 19170 18979 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143397.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence028 61 621 gene locus_tag LOCUS_05480 61 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 1342 632 gene locus_tag LOCUS_05490 1342 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 2250 1339 gene locus_tag LOCUS_05500 2250 1339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057164.1 protein_id gnl|my_center|LOCUS_05500 2454 3152 gene locus_tag LOCUS_05510 2454 3152 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_05510 3352 3281 gene locus_tag LOCUS_t00050 3352 3281 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3557 5023 gene locus_tag LOCUS_05520 3557 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5104 5823 gene locus_tag LOCUS_05530 gene rph 5104 5823 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920723.1 protein_id gnl|my_center|LOCUS_05530 6330 5866 gene locus_tag LOCUS_05540 6330 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6669 7706 gene locus_tag LOCUS_05550 gene hemE 6669 7706 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_05550 8637 7762 gene locus_tag LOCUS_05560 8637 7762 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_05560 9870 8932 gene locus_tag LOCUS_05570 gene hslO 9870 8932 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056651.1 protein_id gnl|my_center|LOCUS_05570 10069 11598 gene locus_tag LOCUS_05580 10069 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 11616 15269 gene locus_tag LOCUS_05590 11616 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 15436 15627 gene locus_tag LOCUS_05600 gene rpsU 15436 15627 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124743.1 protein_id gnl|my_center|LOCUS_05600 16243 15719 gene locus_tag LOCUS_05610 16243 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 16838 16341 gene locus_tag LOCUS_05620 16838 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 17009 17620 gene locus_tag LOCUS_05630 17009 17620 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_05630 17617 18096 gene locus_tag LOCUS_05640 17617 18096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 18157 18756 gene locus_tag LOCUS_05650 18157 18756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence029 1068 175 gene locus_tag LOCUS_05660 1068 175 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057053.1 protein_id gnl|my_center|LOCUS_05660 1570 1722 gene locus_tag LOCUS_05670 1570 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 1748 3511 gene locus_tag LOCUS_05680 gene ilvB 1748 3511 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057136.1 protein_id gnl|my_center|LOCUS_05680 3636 4121 gene locus_tag LOCUS_05690 3636 4121 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360600.1 protein_id gnl|my_center|LOCUS_05690 4446 4276 gene locus_tag LOCUS_05700 4446 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 5642 5307 gene locus_tag LOCUS_05710 5642 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 6531 5992 gene locus_tag LOCUS_05720 6531 5992 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_05720 7047 6658 gene locus_tag LOCUS_05730 7047 6658 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_05730 8357 7131 gene locus_tag LOCUS_05740 8357 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 8501 8746 gene locus_tag LOCUS_05750 gene psbE 8501 8746 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057381.1 protein_id gnl|my_center|LOCUS_05750 9794 10648 gene locus_tag LOCUS_05760 9794 10648 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920906.1 protein_id gnl|my_center|LOCUS_05760 11064 10792 gene locus_tag LOCUS_05770 11064 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 11322 11711 gene locus_tag LOCUS_05780 gene rplS 11322 11711 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057143.1 protein_id gnl|my_center|LOCUS_05780 11801 11874 gene locus_tag LOCUS_t00060 11801 11874 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 11963 12214 gene locus_tag LOCUS_05790 11963 12214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 12214 12858 gene locus_tag LOCUS_05800 gene nusG 12214 12858 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056149.1 protein_id gnl|my_center|LOCUS_05800 12944 13369 gene locus_tag LOCUS_05810 gene rplK 12944 13369 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_05810 13472 14185 gene locus_tag LOCUS_05820 gene rplA 13472 14185 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056151.1 protein_id gnl|my_center|LOCUS_05820 14458 14985 gene locus_tag LOCUS_05830 gene rplJ 14458 14985 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056152.1 protein_id gnl|my_center|LOCUS_05830 15069 15455 gene locus_tag LOCUS_05840 gene rplL 15069 15455 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056153.1 protein_id gnl|my_center|LOCUS_05840 15572 15850 gene locus_tag LOCUS_05850 15572 15850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 15953 17884 gene locus_tag LOCUS_05860 15953 17884 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_05860 18678 18223 gene locus_tag LOCUS_05870 18678 18223 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence030 619 1131 gene locus_tag LOCUS_05880 619 1131 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943391.1 protein_id gnl|my_center|LOCUS_05880 1353 1069 gene locus_tag LOCUS_05890 1353 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1843 1475 gene locus_tag LOCUS_05900 1843 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 3386 2166 gene locus_tag LOCUS_05910 3386 2166 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 protein_id gnl|my_center|LOCUS_05910 3651 3578 gene locus_tag LOCUS_t00070 3651 3578 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4258 4127 gene locus_tag LOCUS_05920 4258 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 4476 4401 gene locus_tag LOCUS_t00080 4476 4401 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4669 4593 gene locus_tag LOCUS_t00090 4669 4593 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4812 4741 gene locus_tag LOCUS_t00100 4812 4741 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4941 4867 gene locus_tag LOCUS_t00110 4941 4867 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5019 4945 gene locus_tag LOCUS_t00120 5019 4945 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5778 5296 gene locus_tag LOCUS_05930 5778 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 6304 5771 gene locus_tag LOCUS_05940 6304 5771 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889035.1 protein_id gnl|my_center|LOCUS_05940 6878 7213 gene locus_tag LOCUS_05950 6878 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141134.1 protein_id gnl|my_center|LOCUS_05950 10238 7626 gene locus_tag LOCUS_05960 10238 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 14107 10280 gene locus_tag LOCUS_05970 14107 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 14154 14294 gene locus_tag LOCUS_05980 14154 14294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 14731 16158 gene locus_tag LOCUS_05990 14731 16158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 16487 16732 gene locus_tag LOCUS_06000 16487 16732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 17071 18924 gene locus_tag LOCUS_06010 17071 18924 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence031 865 1689 gene locus_tag LOCUS_06020 865 1689 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524138.1 protein_id gnl|my_center|LOCUS_06020 2012 3502 gene locus_tag LOCUS_06030 2012 3502 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_06030 3632 4780 gene locus_tag LOCUS_06040 3632 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4823 6616 gene locus_tag LOCUS_06050 4823 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6622 7422 gene locus_tag LOCUS_06060 6622 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7905 7450 gene locus_tag LOCUS_06070 7905 7450 CDS product DUF2996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799827.1 protein_id gnl|my_center|LOCUS_06070 8273 7923 gene locus_tag LOCUS_06080 8273 7923 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141521.1 protein_id gnl|my_center|LOCUS_06080 9400 8390 gene locus_tag LOCUS_06090 9400 8390 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329020.1 protein_id gnl|my_center|LOCUS_06090 11284 12000 gene locus_tag LOCUS_06100 11284 12000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 12562 13446 gene locus_tag LOCUS_06110 12562 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 13570 13887 gene locus_tag LOCUS_06120 13570 13887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 13971 14246 gene locus_tag LOCUS_06130 13971 14246 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056384.1 protein_id gnl|my_center|LOCUS_06130 14293 15078 gene locus_tag LOCUS_06140 gene fabI 14293 15078 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057530.1 protein_id gnl|my_center|LOCUS_06140 15169 15852 gene locus_tag LOCUS_06150 15169 15852 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921101.1 protein_id gnl|my_center|LOCUS_06150 16892 15888 gene locus_tag LOCUS_06160 16892 15888 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_06160 17489 16902 gene locus_tag LOCUS_06170 17489 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 17882 18346 gene locus_tag LOCUS_06180 17882 18346 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124656.1 protein_id gnl|my_center|LOCUS_06180 18796 18479 gene locus_tag LOCUS_06190 18796 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055877.1 protein_id gnl|my_center|LOCUS_06190 18927 18856 gene locus_tag LOCUS_t00130 18927 18856 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 222 2132 gene locus_tag LOCUS_06200 222 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2332 2670 gene locus_tag LOCUS_06210 2332 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2766 2554 gene locus_tag LOCUS_06220 2766 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2994 3362 gene locus_tag LOCUS_06230 2994 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 3606 5450 gene locus_tag LOCUS_06240 3606 5450 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_06240 5460 6986 gene locus_tag LOCUS_06250 5460 6986 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_06250 7525 7121 gene locus_tag LOCUS_06260 7525 7121 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144256.1 protein_id gnl|my_center|LOCUS_06260 7618 8106 gene locus_tag LOCUS_06270 7618 8106 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_06270 8570 8121 gene locus_tag LOCUS_06280 8570 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 9424 8633 gene locus_tag LOCUS_06290 gene xth 9424 8633 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920930.1 protein_id gnl|my_center|LOCUS_06290 10141 9767 gene locus_tag LOCUS_06300 10141 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 11030 10266 gene locus_tag LOCUS_06310 11030 10266 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550381.1 protein_id gnl|my_center|LOCUS_06310 11209 11841 gene locus_tag LOCUS_06320 11209 11841 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 protein_id gnl|my_center|LOCUS_06320 11934 13142 gene locus_tag LOCUS_06330 11934 13142 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055994.1 protein_id gnl|my_center|LOCUS_06330 13298 13747 gene locus_tag LOCUS_06340 13298 13747 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_06340 14034 15506 gene locus_tag LOCUS_06350 14034 15506 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_06350 15608 16513 gene locus_tag LOCUS_06360 15608 16513 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_06360 16753 17784 gene locus_tag LOCUS_06370 gene tgt 16753 17784 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055935.1 protein_id gnl|my_center|LOCUS_06370 17787 18146 gene locus_tag LOCUS_06380 17787 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence033 2343 2699 gene locus_tag LOCUS_06390 2343 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2704 3393 gene locus_tag LOCUS_06400 2704 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 3630 3403 gene locus_tag LOCUS_06410 3630 3403 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_06410 3830 3627 gene locus_tag LOCUS_06420 3830 3627 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_06420 4045 3839 gene locus_tag LOCUS_06430 4045 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 7245 4042 gene locus_tag LOCUS_06440 7245 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 7521 7775 gene locus_tag LOCUS_06450 7521 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 7925 8821 gene locus_tag LOCUS_06460 7925 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 8958 10049 gene locus_tag LOCUS_06470 8958 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 11661 10135 gene locus_tag LOCUS_06480 11661 10135 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272619.1 protein_id gnl|my_center|LOCUS_06480 12376 11672 gene locus_tag LOCUS_06490 12376 11672 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272620.1 protein_id gnl|my_center|LOCUS_06490 12724 12542 gene locus_tag LOCUS_06500 12724 12542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 12769 13137 gene locus_tag LOCUS_06510 12769 13137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06510 13633 13214 gene locus_tag LOCUS_06520 13633 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 13632 13910 gene locus_tag LOCUS_06530 13632 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 14049 14288 gene locus_tag LOCUS_06540 14049 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 14536 14384 gene locus_tag LOCUS_06550 14536 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence034 1003 59 gene locus_tag LOCUS_06560 1003 59 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083253.1 protein_id gnl|my_center|LOCUS_06560 1014 1178 gene locus_tag LOCUS_06570 1014 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1579 2430 gene locus_tag LOCUS_06580 1579 2430 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_06580 3570 2569 gene locus_tag LOCUS_06590 3570 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 4004 3759 gene locus_tag LOCUS_06600 gene psaC 4004 3759 CDS product photosystem I iron-sulfur center protein PsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056855.1 protein_id gnl|my_center|LOCUS_06600 4346 5470 gene locus_tag LOCUS_06610 4346 5470 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_06610 6886 5639 gene locus_tag LOCUS_06620 6886 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 7806 7144 gene locus_tag LOCUS_06630 7806 7144 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184994.1 protein_id gnl|my_center|LOCUS_06630 8278 8994 gene locus_tag LOCUS_06640 8278 8994 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_06640 9242 9628 gene locus_tag LOCUS_06650 gene gcvH 9242 9628 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143520.1 protein_id gnl|my_center|LOCUS_06650 12388 9746 gene locus_tag LOCUS_06660 12388 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 12648 13055 gene locus_tag LOCUS_06670 12648 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 13595 13161 gene locus_tag LOCUS_06680 13595 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 17161 13994 gene locus_tag LOCUS_06690 17161 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 17954 17451 gene locus_tag LOCUS_06700 17954 17451 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_06700 18080 18493 gene locus_tag LOCUS_06710 18080 18493 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057574.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence035 776 477 gene locus_tag LOCUS_06720 776 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 6239 780 gene locus_tag LOCUS_06730 6239 780 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 protein_id gnl|my_center|LOCUS_06730 8416 6317 gene locus_tag LOCUS_06740 8416 6317 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142731.1 protein_id gnl|my_center|LOCUS_06740 8808 8419 gene locus_tag LOCUS_06750 8808 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9134 8808 gene locus_tag LOCUS_06760 9134 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 9612 9193 gene locus_tag LOCUS_06770 9612 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 9860 9609 gene locus_tag LOCUS_06780 9860 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 10226 9954 gene locus_tag LOCUS_06790 10226 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 14520 10267 gene locus_tag LOCUS_06800 14520 10267 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_06800 17476 14609 gene locus_tag LOCUS_06810 17476 14609 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256729.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence036 520 179 gene locus_tag LOCUS_06820 520 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200805564.1 protein_id gnl|my_center|LOCUS_06820 1437 517 gene locus_tag LOCUS_06830 1437 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 1499 1702 gene locus_tag LOCUS_06840 1499 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2175 2014 gene locus_tag LOCUS_06850 2175 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 2589 2248 gene locus_tag LOCUS_06860 2589 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2888 2592 gene locus_tag LOCUS_06870 2888 2592 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096894563.1 protein_id gnl|my_center|LOCUS_06870 3161 2931 gene locus_tag LOCUS_06880 3161 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3318 3148 gene locus_tag LOCUS_06890 3318 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3543 3322 gene locus_tag LOCUS_06900 3543 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3833 3603 gene locus_tag LOCUS_06910 3833 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 5125 3929 gene locus_tag LOCUS_06920 5125 3929 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142934.1 protein_id gnl|my_center|LOCUS_06920 6410 5277 gene locus_tag LOCUS_06930 6410 5277 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_06930 7232 6498 gene locus_tag LOCUS_06940 7232 6498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 protein_id gnl|my_center|LOCUS_06940 8133 7366 gene locus_tag LOCUS_06950 gene cbiQ 8133 7366 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893990.1 protein_id gnl|my_center|LOCUS_06950 8627 8307 gene locus_tag LOCUS_06960 8627 8307 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140295.1 protein_id gnl|my_center|LOCUS_06960 9355 8663 gene locus_tag LOCUS_06970 9355 8663 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_06970 11369 9618 gene locus_tag LOCUS_06980 11369 9618 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704133.1 protein_id gnl|my_center|LOCUS_06980 12055 15516 gene locus_tag LOCUS_06990 12055 15516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 >Feature sequence037 1276 305 gene locus_tag LOCUS_07000 1276 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071996.1 protein_id gnl|my_center|LOCUS_07000 1596 1318 gene locus_tag LOCUS_07010 1596 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 1882 1544 gene locus_tag LOCUS_07020 1882 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2072 4120 gene locus_tag LOCUS_07030 gene bchD 2072 4120 CDS product magnesium chelatase ATPase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057253.1 protein_id gnl|my_center|LOCUS_07030 4177 4854 gene locus_tag LOCUS_07040 4177 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 6138 4879 gene locus_tag LOCUS_07050 6138 4879 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_07050 6978 6157 gene locus_tag LOCUS_07060 6978 6157 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056998.1 protein_id gnl|my_center|LOCUS_07060 7358 8749 gene locus_tag LOCUS_07070 gene murD 7358 8749 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055928.1 protein_id gnl|my_center|LOCUS_07070 8746 10620 gene locus_tag LOCUS_07080 8746 10620 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 protein_id gnl|my_center|LOCUS_07080 10925 11182 gene locus_tag LOCUS_07090 gene grxC 10925 11182 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_07090 12572 11424 gene locus_tag LOCUS_07100 12572 11424 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_07100 13163 13318 gene locus_tag LOCUS_07110 13163 13318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 13888 13721 gene locus_tag LOCUS_07120 13888 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 14249 15451 gene locus_tag LOCUS_07130 14249 15451 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058101.1 protein_id gnl|my_center|LOCUS_07130 16209 15511 gene locus_tag LOCUS_07140 16209 15511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 17499 16675 gene locus_tag LOCUS_07150 17499 16675 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence038 3636 88 gene locus_tag LOCUS_07160 3636 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3906 4442 gene locus_tag LOCUS_07170 3906 4442 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_07170 4576 5487 gene locus_tag LOCUS_07180 gene argF 4576 5487 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920816.1 protein_id gnl|my_center|LOCUS_07180 6649 5528 gene locus_tag LOCUS_07190 gene murG 6649 5528 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724779.1 protein_id gnl|my_center|LOCUS_07190 7485 6787 gene locus_tag LOCUS_07200 7485 6787 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036904.1 protein_id gnl|my_center|LOCUS_07200 7786 7550 gene locus_tag LOCUS_07210 7786 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 7925 8317 gene locus_tag LOCUS_07220 7925 8317 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242640.1 protein_id gnl|my_center|LOCUS_07220 10115 8373 gene locus_tag LOCUS_07230 10115 8373 CDS product DUF3352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057437.1 protein_id gnl|my_center|LOCUS_07230 11108 10365 gene locus_tag LOCUS_07240 11108 10365 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_07240 12063 11113 gene locus_tag LOCUS_07250 12063 11113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 12325 13011 gene locus_tag LOCUS_07260 12325 13011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 14276 13125 gene locus_tag LOCUS_07270 14276 13125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 14838 14404 gene locus_tag LOCUS_07280 14838 14404 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920634.1 protein_id gnl|my_center|LOCUS_07280 15349 14966 gene locus_tag LOCUS_07290 gene queF 15349 14966 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143582.1 protein_id gnl|my_center|LOCUS_07290 16021 15446 gene locus_tag LOCUS_07300 gene raiA 16021 15446 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_07300 16340 17929 gene locus_tag LOCUS_07310 16340 17929 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence039 706 170 gene locus_tag LOCUS_07320 706 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1750 4074 gene locus_tag LOCUS_07330 1750 4074 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 protein_id gnl|my_center|LOCUS_07330 4159 6219 gene locus_tag LOCUS_07340 4159 6219 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056000.1 protein_id gnl|my_center|LOCUS_07340 6271 6858 gene locus_tag LOCUS_07350 6271 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 6930 8108 gene locus_tag LOCUS_07360 6930 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 8275 10269 gene locus_tag LOCUS_07370 8275 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 10516 11127 gene locus_tag LOCUS_07380 gene rdgB 10516 11127 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057634.1 protein_id gnl|my_center|LOCUS_07380 12049 11087 gene locus_tag LOCUS_07390 12049 11087 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_07390 15933 12385 gene locus_tag LOCUS_07400 15933 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 17257 16520 gene locus_tag LOCUS_07410 17257 16520 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524184.1 protein_id gnl|my_center|LOCUS_07410 17500 17673 gene locus_tag LOCUS_07420 17500 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence040 1100 570 gene locus_tag LOCUS_07430 gene ssuE 1100 570 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 protein_id gnl|my_center|LOCUS_07430 1956 1183 gene locus_tag LOCUS_07440 gene ssuB 1956 1183 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210036.1 protein_id gnl|my_center|LOCUS_07440 2835 1996 gene locus_tag LOCUS_07450 gene ssuC 2835 1996 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213853.1 protein_id gnl|my_center|LOCUS_07450 4032 2836 gene locus_tag LOCUS_07460 gene ssuD 4032 2836 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208027.1 protein_id gnl|my_center|LOCUS_07460 4365 4946 gene locus_tag LOCUS_07470 4365 4946 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_07470 5123 6409 gene locus_tag LOCUS_07480 5123 6409 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_07480 6579 7625 gene locus_tag LOCUS_07490 gene metX 6579 7625 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_07490 8620 7745 gene locus_tag LOCUS_07500 8620 7745 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_07500 10432 8645 gene locus_tag LOCUS_07510 10432 8645 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079894.1 protein_id gnl|my_center|LOCUS_07510 11560 10487 gene locus_tag LOCUS_07520 11560 10487 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112406.1 protein_id gnl|my_center|LOCUS_07520 12694 11768 gene locus_tag LOCUS_07530 12694 11768 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_07530 13589 13074 gene locus_tag LOCUS_07540 13589 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 13777 15006 gene locus_tag LOCUS_07550 13777 15006 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228175.1 protein_id gnl|my_center|LOCUS_07550 <17911 15073 gene locus_tag LOCUS_07560 <17911 15073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058165.1:carbamoyl-phosphate synthase large subunit >Feature sequence041 2580 2362 gene locus_tag LOCUS_07570 2580 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 2932 2537 gene locus_tag LOCUS_07580 2932 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07580 4172 3042 gene locus_tag LOCUS_07590 4172 3042 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_07590 4251 4796 gene locus_tag LOCUS_07600 gene rfbC 4251 4796 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_07600 4793 5821 gene locus_tag LOCUS_07610 gene rfbB 4793 5821 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258175.1 protein_id gnl|my_center|LOCUS_07610 5818 6696 gene locus_tag LOCUS_07620 gene rfbD 5818 6696 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_07620 6755 7828 gene locus_tag LOCUS_07630 6755 7828 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_07630 7981 8748 gene locus_tag LOCUS_07640 gene rfbF 7981 8748 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987009.1 protein_id gnl|my_center|LOCUS_07640 8748 9818 gene locus_tag LOCUS_07650 gene rfbG 8748 9818 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_07650 9850 11085 gene locus_tag LOCUS_07660 9850 11085 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_07660 11082 11621 gene locus_tag LOCUS_07670 gene rfbC 11082 11621 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_07670 11649 11825 gene locus_tag LOCUS_07680 11649 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 11828 12679 gene locus_tag LOCUS_07690 11828 12679 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071741117.1 protein_id gnl|my_center|LOCUS_07690 12679 13743 gene locus_tag LOCUS_07700 12679 13743 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987004.1 protein_id gnl|my_center|LOCUS_07700 13746 14486 gene locus_tag LOCUS_07710 13746 14486 CDS product cephalosporin hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526207.1 protein_id gnl|my_center|LOCUS_07710 14486 16168 gene locus_tag LOCUS_07720 14486 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 17245 17613 gene locus_tag LOCUS_07730 17245 17613 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986781.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence042 1725 49 gene locus_tag LOCUS_07740 1725 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 2552 1899 gene locus_tag LOCUS_07750 2552 1899 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_07750 3337 2852 gene locus_tag LOCUS_07760 gene petD 3337 2852 CDS product cytochrome b6-f complex subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056640.1 protein_id gnl|my_center|LOCUS_07760 4066 3419 gene locus_tag LOCUS_07770 4066 3419 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056639.1 protein_id gnl|my_center|LOCUS_07770 4384 4971 gene locus_tag LOCUS_07780 4384 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6148 5084 gene locus_tag LOCUS_07790 6148 5084 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012163110.1 protein_id gnl|my_center|LOCUS_07790 6299 8071 gene locus_tag LOCUS_07800 gene pyk 6299 8071 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058108.1 protein_id gnl|my_center|LOCUS_07800 8223 9377 gene locus_tag LOCUS_07810 8223 9377 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143816.1 protein_id gnl|my_center|LOCUS_07810 9501 9971 gene locus_tag LOCUS_07820 9501 9971 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_07820 10034 10930 gene locus_tag LOCUS_07830 10034 10930 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_07830 11065 10982 gene locus_tag LOCUS_t00140 11065 10982 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11215 11610 gene locus_tag LOCUS_07840 11215 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928881.1 protein_id gnl|my_center|LOCUS_07840 11783 12229 gene locus_tag LOCUS_07850 11783 12229 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057630.1 protein_id gnl|my_center|LOCUS_07850 12893 12234 gene locus_tag LOCUS_07860 12893 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929189.1 protein_id gnl|my_center|LOCUS_07860 14005 12890 gene locus_tag LOCUS_07870 14005 12890 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_07870 15432 14068 gene locus_tag LOCUS_07880 15432 14068 CDS product trans-splicing intein-formed DNA polymerase III subunit alpha C-terminal partner DnaE-C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057904.1 protein_id gnl|my_center|LOCUS_07880 15891 15541 gene locus_tag LOCUS_07890 15891 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 16331 15888 gene locus_tag LOCUS_07900 16331 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 17460 16660 gene locus_tag LOCUS_07910 17460 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence043 412 1647 gene locus_tag LOCUS_07920 412 1647 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_07920 1737 2774 gene locus_tag LOCUS_07930 1737 2774 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_07930 2848 3480 gene locus_tag LOCUS_07940 2848 3480 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259738.1 protein_id gnl|my_center|LOCUS_07940 3506 4426 gene locus_tag LOCUS_07950 3506 4426 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_07950 4426 4998 gene locus_tag LOCUS_07960 4426 4998 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_07960 5140 5478 gene locus_tag LOCUS_07970 5140 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 5759 7054 gene locus_tag LOCUS_07980 5759 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7349 7855 gene locus_tag LOCUS_07990 7349 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07990 7921 9243 gene locus_tag LOCUS_08000 7921 9243 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921284.1 protein_id gnl|my_center|LOCUS_08000 10382 10879 gene locus_tag LOCUS_08010 10382 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 10918 11904 gene locus_tag LOCUS_08020 10918 11904 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_08020 11988 12332 gene locus_tag LOCUS_08030 11988 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 13105 14190 gene locus_tag LOCUS_08040 gene hppD 13105 14190 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_08040 14535 17198 gene locus_tag LOCUS_08050 14535 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence044 796 347 gene locus_tag LOCUS_08060 gene ndk 796 347 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_08060 2264 993 gene locus_tag LOCUS_08070 2264 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2938 2294 gene locus_tag LOCUS_08080 2938 2294 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 protein_id gnl|my_center|LOCUS_08080 3690 2971 gene locus_tag LOCUS_08090 3690 2971 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920819.1 protein_id gnl|my_center|LOCUS_08090 3849 5384 gene locus_tag LOCUS_08100 3849 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 5478 6413 gene locus_tag LOCUS_08110 5478 6413 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_08110 6467 7813 gene locus_tag LOCUS_08120 6467 7813 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_08120 8948 7872 gene locus_tag LOCUS_08130 gene acsF 8948 7872 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057559.1 protein_id gnl|my_center|LOCUS_08130 9477 9058 gene locus_tag LOCUS_08140 9477 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 10936 9536 gene locus_tag LOCUS_08150 gene hemN 10936 9536 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057557.1 protein_id gnl|my_center|LOCUS_08150 11710 10967 gene locus_tag LOCUS_08160 11710 10967 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920678.1 protein_id gnl|my_center|LOCUS_08160 13553 11823 gene locus_tag LOCUS_08170 13553 11823 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058229.1 protein_id gnl|my_center|LOCUS_08170 15169 13805 gene locus_tag LOCUS_08180 15169 13805 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056736.1 protein_id gnl|my_center|LOCUS_08180 15684 16973 gene locus_tag LOCUS_08190 15684 16973 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039737632.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence045 661 2394 gene locus_tag LOCUS_08200 661 2394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707092.1 protein_id gnl|my_center|LOCUS_08200 2456 3823 gene locus_tag LOCUS_08210 2456 3823 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_08210 4032 5483 gene locus_tag LOCUS_08220 4032 5483 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_08220 5506 6072 gene locus_tag LOCUS_08230 5506 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 6062 7528 gene locus_tag LOCUS_08240 6062 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08240 7685 8404 gene locus_tag LOCUS_08250 7685 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 8519 9421 gene locus_tag LOCUS_08260 8519 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 9414 10583 gene locus_tag LOCUS_08270 9414 10583 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_08270 10663 11115 gene locus_tag LOCUS_08280 gene nrdR 10663 11115 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057698.1 protein_id gnl|my_center|LOCUS_08280 11269 11628 gene locus_tag LOCUS_08290 11269 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 12446 12249 gene locus_tag LOCUS_08300 12446 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 13115 12693 gene locus_tag LOCUS_08310 13115 12693 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920771.1 protein_id gnl|my_center|LOCUS_08310 13333 14100 gene locus_tag LOCUS_08320 13333 14100 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_08320 14326 15792 gene locus_tag LOCUS_08330 14326 15792 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056473.1 protein_id gnl|my_center|LOCUS_08330 16930 15926 gene locus_tag LOCUS_08340 16930 15926 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184994.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence046 1651 167 gene locus_tag LOCUS_08350 1651 167 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_08350 3150 1960 gene locus_tag LOCUS_08360 3150 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402537.1 protein_id gnl|my_center|LOCUS_08360 3665 3336 gene locus_tag LOCUS_08370 3665 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 5053 4235 gene locus_tag LOCUS_08380 gene lpxA 5053 4235 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_08380 5657 5151 gene locus_tag LOCUS_08390 gene fabZ 5657 5151 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057628.1 protein_id gnl|my_center|LOCUS_08390 6600 5761 gene locus_tag LOCUS_08400 gene lpxC 6600 5761 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057627.1 protein_id gnl|my_center|LOCUS_08400 8636 6603 gene locus_tag LOCUS_08410 8636 6603 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141861.1 protein_id gnl|my_center|LOCUS_08410 9539 8820 gene locus_tag LOCUS_08420 9539 8820 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057336.1 protein_id gnl|my_center|LOCUS_08420 12187 9629 gene locus_tag LOCUS_08430 12187 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 13052 12168 gene locus_tag LOCUS_08440 13052 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 14357 13278 gene locus_tag LOCUS_08450 14357 13278 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887482.1 protein_id gnl|my_center|LOCUS_08450 16904 14502 gene locus_tag LOCUS_08460 16904 14502 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259686.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence047 1863 916 gene locus_tag LOCUS_08470 1863 916 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_08470 2688 1939 gene locus_tag LOCUS_08480 2688 1939 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_08480 4509 3712 gene locus_tag LOCUS_08490 gene cysE 4509 3712 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_08490 4867 6138 gene locus_tag LOCUS_08500 4867 6138 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213222.1 protein_id gnl|my_center|LOCUS_08500 6923 6120 gene locus_tag LOCUS_08510 gene phnD 6923 6120 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_08510 7316 7041 gene locus_tag LOCUS_08520 7316 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 9272 7425 gene locus_tag LOCUS_08530 9272 7425 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_08530 10492 9662 gene locus_tag LOCUS_08540 10492 9662 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259018.1 protein_id gnl|my_center|LOCUS_08540 11116 10502 gene locus_tag LOCUS_08550 gene ssuE 11116 10502 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 protein_id gnl|my_center|LOCUS_08550 11938 11177 gene locus_tag LOCUS_08560 gene ssuB 11938 11177 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105420.1 protein_id gnl|my_center|LOCUS_08560 12863 12012 gene locus_tag LOCUS_08570 gene ssuC 12863 12012 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407339.1 protein_id gnl|my_center|LOCUS_08570 13356 14117 gene locus_tag LOCUS_08580 13356 14117 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_08580 14411 14995 gene locus_tag LOCUS_08590 14411 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 15736 16041 gene locus_tag LOCUS_08600 15736 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence048 306 1565 gene locus_tag LOCUS_08610 306 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1929 1777 gene locus_tag LOCUS_08620 1929 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2408 8809 gene locus_tag LOCUS_08630 2408 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 8802 10010 gene locus_tag LOCUS_08640 8802 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 10080 15056 gene locus_tag LOCUS_08650 10080 15056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 16659 15214 gene locus_tag LOCUS_08660 16659 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence049 79 1377 gene locus_tag LOCUS_08670 79 1377 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08670 2679 2185 gene locus_tag LOCUS_08680 2679 2185 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944499.1 protein_id gnl|my_center|LOCUS_08680 6316 2879 gene locus_tag LOCUS_08690 6316 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 7061 6393 gene locus_tag LOCUS_08700 7061 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 7210 8889 gene locus_tag LOCUS_08710 7210 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 9132 8923 gene locus_tag LOCUS_08720 9132 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 9264 11702 gene locus_tag LOCUS_08730 9264 11702 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140434.1 protein_id gnl|my_center|LOCUS_08730 12491 12249 gene locus_tag LOCUS_08740 12491 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 12844 12569 gene locus_tag LOCUS_08750 12844 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 13446 13649 gene locus_tag LOCUS_08760 13446 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 14045 13536 gene locus_tag LOCUS_08770 14045 13536 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_08770 15261 14431 gene locus_tag LOCUS_08780 15261 14431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 16169 15651 gene locus_tag LOCUS_08790 16169 15651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence050 316 534 gene locus_tag LOCUS_08800 316 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2232 580 gene locus_tag LOCUS_08810 2232 580 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043195.1 protein_id gnl|my_center|LOCUS_08810 3014 4066 gene locus_tag LOCUS_08820 3014 4066 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193905664.1 protein_id gnl|my_center|LOCUS_08820 4367 4843 gene locus_tag LOCUS_08830 gene ispF 4367 4843 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_08830 5184 6866 gene locus_tag LOCUS_08840 5184 6866 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_08840 6914 7603 gene locus_tag LOCUS_08850 6914 7603 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930431.1 protein_id gnl|my_center|LOCUS_08850 9047 7614 gene locus_tag LOCUS_08860 9047 7614 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193501.1 protein_id gnl|my_center|LOCUS_08860 9425 9192 gene locus_tag LOCUS_08870 9425 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 10114 9431 gene locus_tag LOCUS_08880 10114 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 10971 10183 gene locus_tag LOCUS_08890 10971 10183 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705540.1 protein_id gnl|my_center|LOCUS_08890 11716 11147 gene locus_tag LOCUS_08900 11716 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 13845 12652 gene locus_tag LOCUS_08910 13845 12652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 14091 15080 gene locus_tag LOCUS_08920 14091 15080 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_08920 15289 16350 gene locus_tag LOCUS_08930 15289 16350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence051 1802 2470 gene locus_tag LOCUS_08940 1802 2470 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 protein_id gnl|my_center|LOCUS_08940 3359 3946 gene locus_tag LOCUS_08950 3359 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4066 4863 gene locus_tag LOCUS_08960 gene proC 4066 4863 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_08960 4986 6017 gene locus_tag LOCUS_08970 gene purM 4986 6017 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140722.1 protein_id gnl|my_center|LOCUS_08970 6083 7798 gene locus_tag LOCUS_08980 6083 7798 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_08980 8142 9851 gene locus_tag LOCUS_08990 8142 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 9951 10727 gene locus_tag LOCUS_09000 9951 10727 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_09000 11419 10784 gene locus_tag LOCUS_09010 11419 10784 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084189.1 protein_id gnl|my_center|LOCUS_09010 12147 11419 gene locus_tag LOCUS_09020 12147 11419 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 protein_id gnl|my_center|LOCUS_09020 12481 14397 gene locus_tag LOCUS_09030 12481 14397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 14428 15951 gene locus_tag LOCUS_09040 14428 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence052 1691 480 gene locus_tag LOCUS_09050 1691 480 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_09050 2909 1749 gene locus_tag LOCUS_09060 2909 1749 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_09060 5069 3054 gene locus_tag LOCUS_09070 5069 3054 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_09070 7423 5438 gene locus_tag LOCUS_09080 7423 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 7794 8600 gene locus_tag LOCUS_09090 7794 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 9398 8601 gene locus_tag LOCUS_09100 9398 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 9567 10139 gene locus_tag LOCUS_09110 9567 10139 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_09110 10415 11350 gene locus_tag LOCUS_09120 10415 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 11683 12093 gene locus_tag LOCUS_09130 11683 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 12086 12517 gene locus_tag LOCUS_09140 12086 12517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 14101 12695 gene locus_tag LOCUS_09150 14101 12695 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082008.1 protein_id gnl|my_center|LOCUS_09150 14564 14202 gene locus_tag LOCUS_09160 14564 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 15178 14630 gene locus_tag LOCUS_09170 15178 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 15406 15936 gene locus_tag LOCUS_09180 15406 15936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence053 976 194 gene locus_tag LOCUS_09190 976 194 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_09190 2272 1028 gene locus_tag LOCUS_09200 2272 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3303 2320 gene locus_tag LOCUS_09210 3303 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 4219 3362 gene locus_tag LOCUS_09220 4219 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4729 4277 gene locus_tag LOCUS_09230 4729 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 5133 4870 gene locus_tag LOCUS_09240 5133 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5680 5288 gene locus_tag LOCUS_09250 5680 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 protein_id gnl|my_center|LOCUS_09250 7269 5938 gene locus_tag LOCUS_09260 7269 5938 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_09260 7384 8103 gene locus_tag LOCUS_09270 gene rnc 7384 8103 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142642.1 protein_id gnl|my_center|LOCUS_09270 8500 10119 gene locus_tag LOCUS_09280 8500 10119 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530067.1 protein_id gnl|my_center|LOCUS_09280 10170 11075 gene locus_tag LOCUS_09290 10170 11075 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_09290 11124 12104 gene locus_tag LOCUS_09300 11124 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 12229 12687 gene locus_tag LOCUS_09310 12229 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 12684 12887 gene locus_tag LOCUS_09320 12684 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 12933 13607 gene locus_tag LOCUS_09330 12933 13607 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140988.1 protein_id gnl|my_center|LOCUS_09330 14264 13965 gene locus_tag LOCUS_09340 14264 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 15040 14264 gene locus_tag LOCUS_09350 15040 14264 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057791.1 protein_id gnl|my_center|LOCUS_09350 <16064 15114 gene locus_tag LOCUS_09360 <16064 15114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005109925.1:DNA phosphorothioation-associated putative methyltransferase >Feature sequence054 947 27 gene locus_tag LOCUS_09370 947 27 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141225.1 protein_id gnl|my_center|LOCUS_09370 1195 2112 gene locus_tag LOCUS_09380 gene moaA 1195 2112 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143017.1 protein_id gnl|my_center|LOCUS_09380 2720 3001 gene locus_tag LOCUS_09390 2720 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 3293 5386 gene locus_tag LOCUS_09400 3293 5386 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 protein_id gnl|my_center|LOCUS_09400 6560 5982 gene locus_tag LOCUS_09410 6560 5982 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017302344.1 protein_id gnl|my_center|LOCUS_09410 7187 6957 gene locus_tag LOCUS_09420 7187 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 7332 8306 gene locus_tag LOCUS_09430 7332 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 8416 8231 gene locus_tag LOCUS_09440 8416 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 8437 9714 gene locus_tag LOCUS_09450 8437 9714 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_09450 9721 10482 gene locus_tag LOCUS_09460 9721 10482 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259645.1 protein_id gnl|my_center|LOCUS_09460 10522 11085 gene locus_tag LOCUS_09470 10522 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 11134 11907 gene locus_tag LOCUS_09480 11134 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 12048 13256 gene locus_tag LOCUS_09490 12048 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 13465 15684 gene locus_tag LOCUS_09500 13465 15684 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence055 1909 224 gene locus_tag LOCUS_09510 gene ilvD 1909 224 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_09510 2001 2450 gene locus_tag LOCUS_09520 2001 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2944 2477 gene locus_tag LOCUS_09530 gene tadA 2944 2477 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056032.1 protein_id gnl|my_center|LOCUS_09530 3065 4633 gene locus_tag LOCUS_09540 gene metG 3065 4633 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056597.1 protein_id gnl|my_center|LOCUS_09540 5055 5687 gene locus_tag LOCUS_09550 5055 5687 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_09550 5949 6332 gene locus_tag LOCUS_09560 gene rpsM 5949 6332 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055958.1 protein_id gnl|my_center|LOCUS_09560 6353 6748 gene locus_tag LOCUS_09570 gene rpsK 6353 6748 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055959.1 protein_id gnl|my_center|LOCUS_09570 6892 7845 gene locus_tag LOCUS_09580 6892 7845 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143560.1 protein_id gnl|my_center|LOCUS_09580 7906 8340 gene locus_tag LOCUS_09590 gene rplQ 7906 8340 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143559.1 protein_id gnl|my_center|LOCUS_09590 8349 9188 gene locus_tag LOCUS_09600 gene truA 8349 9188 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055962.1 protein_id gnl|my_center|LOCUS_09600 9251 9718 gene locus_tag LOCUS_09610 gene rplM 9251 9718 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055963.1 protein_id gnl|my_center|LOCUS_09610 9731 10144 gene locus_tag LOCUS_09620 gene rpsI 9731 10144 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144402.1 protein_id gnl|my_center|LOCUS_09620 11984 10266 gene locus_tag LOCUS_09630 11984 10266 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_09630 12679 12134 gene locus_tag LOCUS_09640 12679 12134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 14461 12764 gene locus_tag LOCUS_09650 14461 12764 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144395.1 protein_id gnl|my_center|LOCUS_09650 14549 15637 gene locus_tag LOCUS_09660 gene gcvT 14549 15637 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143519.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence056 5926 113 gene locus_tag LOCUS_09670 5926 113 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_09670 12170 6360 gene locus_tag LOCUS_09680 12170 6360 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_09680 12687 13853 gene locus_tag LOCUS_09690 12687 13853 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479813.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence057 376 122 gene locus_tag LOCUS_09700 376 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1038 676 gene locus_tag LOCUS_09710 1038 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1420 1953 gene locus_tag LOCUS_09720 1420 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2013 3152 gene locus_tag LOCUS_09730 2013 3152 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_09730 2485 2401 gene locus_tag LOCUS_t00150 2485 2401 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4129 3149 gene locus_tag LOCUS_09740 4129 3149 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227675.1 protein_id gnl|my_center|LOCUS_09740 4614 4126 gene locus_tag LOCUS_09750 4614 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 5042 5362 gene locus_tag LOCUS_09760 5042 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6111 5734 gene locus_tag LOCUS_09770 gene glnB 6111 5734 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860685.1 protein_id gnl|my_center|LOCUS_09770 7892 6213 gene locus_tag LOCUS_09780 7892 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 9175 9903 gene locus_tag LOCUS_09790 9175 9903 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_09790 9980 10936 gene locus_tag LOCUS_09800 9980 10936 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_09800 11790 10948 gene locus_tag LOCUS_09810 gene rsmI 11790 10948 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_09810 12199 11876 gene locus_tag LOCUS_09820 12199 11876 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_09820 12357 12839 gene locus_tag LOCUS_09830 12357 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 14586 12898 gene locus_tag LOCUS_09840 14586 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 <15701 14865 gene locus_tag LOCUS_09850 <15701 14865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056993.1:ABC transporter permease >Feature sequence058 4326 322 gene locus_tag LOCUS_09860 4326 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5361 4402 gene locus_tag LOCUS_09870 5361 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6627 5392 gene locus_tag LOCUS_09880 6627 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7039 6635 gene locus_tag LOCUS_09890 7039 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 7281 7036 gene locus_tag LOCUS_09900 7281 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 9270 7285 gene locus_tag LOCUS_09910 9270 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 12711 9742 gene locus_tag LOCUS_09920 12711 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 13043 12768 gene locus_tag LOCUS_09930 13043 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 14317 13457 gene locus_tag LOCUS_09940 14317 13457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 15358 14321 gene locus_tag LOCUS_09950 15358 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 15643 15570 gene locus_tag LOCUS_t00160 15643 15570 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence059 106 732 gene locus_tag LOCUS_09960 106 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 2653 1136 gene locus_tag LOCUS_09970 gene atpA 2653 1136 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056290.1 protein_id gnl|my_center|LOCUS_09970 3352 2795 gene locus_tag LOCUS_09980 gene atpH 3352 2795 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056289.1 protein_id gnl|my_center|LOCUS_09980 3895 3362 gene locus_tag LOCUS_09990 3895 3362 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524128.1 protein_id gnl|my_center|LOCUS_09990 4428 3961 gene locus_tag LOCUS_10000 4428 3961 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173636.1 protein_id gnl|my_center|LOCUS_10000 4787 4539 gene locus_tag LOCUS_10010 gene atpE 4787 4539 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125758.1 protein_id gnl|my_center|LOCUS_10010 5707 4946 gene locus_tag LOCUS_10020 gene atpB 5707 4946 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056285.1 protein_id gnl|my_center|LOCUS_10020 6135 5740 gene locus_tag LOCUS_10030 6135 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 6520 7137 gene locus_tag LOCUS_10040 6520 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055990.1 protein_id gnl|my_center|LOCUS_10040 9021 7354 gene locus_tag LOCUS_10050 9021 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 10343 9252 gene locus_tag LOCUS_10060 10343 9252 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388234.1 protein_id gnl|my_center|LOCUS_10060 10606 10935 gene locus_tag LOCUS_10070 10606 10935 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259894.1 protein_id gnl|my_center|LOCUS_10070 11756 10962 gene locus_tag LOCUS_10080 11756 10962 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414103.1 protein_id gnl|my_center|LOCUS_10080 11966 11799 gene locus_tag LOCUS_10090 11966 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 15403 11996 gene locus_tag LOCUS_10100 15403 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence060 342 731 gene locus_tag LOCUS_10110 342 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1559 774 gene locus_tag LOCUS_10120 1559 774 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141718.1 protein_id gnl|my_center|LOCUS_10120 2436 1531 gene locus_tag LOCUS_10130 2436 1531 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_10130 2594 3619 gene locus_tag LOCUS_10140 2594 3619 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928874.1 protein_id gnl|my_center|LOCUS_10140 4159 3710 gene locus_tag LOCUS_10150 4159 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4380 6050 gene locus_tag LOCUS_10160 4380 6050 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928564.1 protein_id gnl|my_center|LOCUS_10160 6064 7458 gene locus_tag LOCUS_10170 6064 7458 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080314.1 protein_id gnl|my_center|LOCUS_10170 7636 13026 gene locus_tag LOCUS_10180 7636 13026 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_10180 13273 14394 gene locus_tag LOCUS_10190 13273 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 15401 14400 gene locus_tag LOCUS_10200 15401 14400 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546734.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence061 451 1560 gene locus_tag LOCUS_10210 451 1560 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_10210 1762 2397 gene locus_tag LOCUS_10220 1762 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2536 3126 gene locus_tag LOCUS_10230 2536 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3102 3452 gene locus_tag LOCUS_10240 3102 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 5462 3489 gene locus_tag LOCUS_10250 5462 3489 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_10250 6038 5646 gene locus_tag LOCUS_10260 6038 5646 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 protein_id gnl|my_center|LOCUS_10260 6532 6356 gene locus_tag LOCUS_10270 gene rpmF 6532 6356 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125133.1 protein_id gnl|my_center|LOCUS_10270 6731 8353 gene locus_tag LOCUS_10280 6731 8353 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 protein_id gnl|my_center|LOCUS_10280 8286 8450 gene locus_tag LOCUS_10290 8286 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 11106 8569 gene locus_tag LOCUS_10300 11106 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 11434 12117 gene locus_tag LOCUS_10310 11434 12117 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence062 2327 2879 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaatcgccctcccagacatgggcaggttgaaag 3175 3102 gene locus_tag LOCUS_t00170 3175 3102 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3224 3481 gene locus_tag LOCUS_10320 3224 3481 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_10320 5045 3744 gene locus_tag LOCUS_10330 5045 3744 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143911.1 protein_id gnl|my_center|LOCUS_10330 5478 5062 gene locus_tag LOCUS_10340 5478 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 5683 5763 gene locus_tag LOCUS_t00180 5683 5763 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5886 6914 gene locus_tag LOCUS_10350 5886 6914 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_10350 7031 7681 gene locus_tag LOCUS_10360 7031 7681 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_10360 9052 7730 gene locus_tag LOCUS_10370 9052 7730 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921237.1 protein_id gnl|my_center|LOCUS_10370 9332 9042 gene locus_tag LOCUS_10380 9332 9042 CDS product DUF3181 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920922.1 protein_id gnl|my_center|LOCUS_10380 9944 9381 gene locus_tag LOCUS_10390 9944 9381 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_10390 10228 9986 gene locus_tag LOCUS_10400 10228 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 10588 11814 gene locus_tag LOCUS_10410 10588 11814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_10410 11874 12629 gene locus_tag LOCUS_10420 11874 12629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_10420 14373 12679 gene locus_tag LOCUS_10430 14373 12679 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058118.1 protein_id gnl|my_center|LOCUS_10430 14609 15307 gene locus_tag LOCUS_10440 14609 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence063 89 652 gene locus_tag LOCUS_10450 89 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10450 612 1661 gene locus_tag LOCUS_10460 612 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2437 1979 gene locus_tag LOCUS_10470 2437 1979 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_10470 3536 2430 gene locus_tag LOCUS_10480 3536 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10480 4993 3557 gene locus_tag LOCUS_10490 4993 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 5362 6312 gene locus_tag LOCUS_10500 5362 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 6331 9381 gene locus_tag LOCUS_10510 6331 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10510 9393 11210 gene locus_tag LOCUS_10520 9393 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 11543 13000 gene locus_tag LOCUS_10530 11543 13000 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence064 <1 1138 gene locus_tag LOCUS_10540 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090321.1:MDR family MFS transporter 3071 1692 gene locus_tag LOCUS_10550 3071 1692 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966096.1 protein_id gnl|my_center|LOCUS_10550 4110 3484 gene locus_tag LOCUS_10560 4110 3484 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_10560 7157 4116 gene locus_tag LOCUS_10570 7157 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 7481 8017 gene locus_tag LOCUS_10580 gene dps 7481 8017 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_10580 8151 8744 gene locus_tag LOCUS_10590 8151 8744 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227501.1 protein_id gnl|my_center|LOCUS_10590 8760 9284 gene locus_tag LOCUS_10600 8760 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 9445 10983 gene locus_tag LOCUS_10610 9445 10983 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057086.1 protein_id gnl|my_center|LOCUS_10610 11505 11176 gene locus_tag LOCUS_10620 11505 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 11789 11505 gene locus_tag LOCUS_10630 11789 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 11933 12160 gene locus_tag LOCUS_10640 11933 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 12160 12576 gene locus_tag LOCUS_10650 12160 12576 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_10650 13120 12704 gene locus_tag LOCUS_10660 13120 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 13352 13113 gene locus_tag LOCUS_10670 13352 13113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 13521 13811 gene locus_tag LOCUS_10680 13521 13811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 13817 14233 gene locus_tag LOCUS_10690 13817 14233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 14407 15186 gene locus_tag LOCUS_10700 14407 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence065 728 309 gene locus_tag LOCUS_10710 728 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1499 831 gene locus_tag LOCUS_10720 gene trmD 1499 831 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057450.1 protein_id gnl|my_center|LOCUS_10720 1558 2811 gene locus_tag LOCUS_10730 1558 2811 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_10730 3075 4280 gene locus_tag LOCUS_10740 3075 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4840 4436 gene locus_tag LOCUS_10750 gene atpC 4840 4436 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056376.1 protein_id gnl|my_center|LOCUS_10750 6279 4846 gene locus_tag LOCUS_10760 gene atpD 6279 4846 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056375.1 protein_id gnl|my_center|LOCUS_10760 7318 6530 gene locus_tag LOCUS_10770 7318 6530 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_10770 7499 7927 gene locus_tag LOCUS_10780 7499 7927 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_10780 8038 8112 gene locus_tag LOCUS_t00190 8038 8112 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9014 8193 gene locus_tag LOCUS_10790 gene dapB 9014 8193 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920961.1 protein_id gnl|my_center|LOCUS_10790 9189 9425 gene locus_tag LOCUS_10800 gene rpmB 9189 9425 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 protein_id gnl|my_center|LOCUS_10800 9565 10425 gene locus_tag LOCUS_10810 9565 10425 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_10810 11750 10542 gene locus_tag LOCUS_10820 11750 10542 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_10820 12210 12809 gene locus_tag LOCUS_10830 12210 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 13178 12906 gene locus_tag LOCUS_10840 13178 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 14986 13346 gene locus_tag LOCUS_10850 14986 13346 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence066 1292 858 gene locus_tag LOCUS_10860 1292 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1668 2156 gene locus_tag LOCUS_10870 1668 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 2273 2344 gene locus_tag LOCUS_t00200 2273 2344 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2433 3875 gene locus_tag LOCUS_10880 2433 3875 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056233.1 protein_id gnl|my_center|LOCUS_10880 4116 3952 gene locus_tag LOCUS_10890 4116 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5924 4326 gene locus_tag LOCUS_10900 5924 4326 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_10900 6908 9478 gene locus_tag LOCUS_10910 6908 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 9590 10594 gene locus_tag LOCUS_10920 gene pheS 9590 10594 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056537.1 protein_id gnl|my_center|LOCUS_10920 10887 10684 gene locus_tag LOCUS_10930 10887 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 11018 12463 gene locus_tag LOCUS_10940 11018 12463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928959.1 protein_id gnl|my_center|LOCUS_10940 12558 13400 gene locus_tag LOCUS_10950 12558 13400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_10950 <14773 13402 gene locus_tag LOCUS_10960 <14773 13402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920940.1:cobyrinate a,c-diamide synthase >Feature sequence067 1235 93 gene locus_tag LOCUS_10970 1235 93 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661226.1 protein_id gnl|my_center|LOCUS_10970 1356 1553 gene locus_tag LOCUS_10980 1356 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1830 2963 gene locus_tag LOCUS_10990 1830 2963 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971975.1 protein_id gnl|my_center|LOCUS_10990 4745 3105 gene locus_tag LOCUS_11000 4745 3105 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_11000 5174 4806 gene locus_tag LOCUS_11010 5174 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530034.1 protein_id gnl|my_center|LOCUS_11010 6073 5189 gene locus_tag LOCUS_11020 6073 5189 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_11020 6630 6259 gene locus_tag LOCUS_11030 6630 6259 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921050.1 protein_id gnl|my_center|LOCUS_11030 6918 7931 gene locus_tag LOCUS_11040 6918 7931 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016873987.1 protein_id gnl|my_center|LOCUS_11040 9469 8072 gene locus_tag LOCUS_11050 9469 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 9598 9524 gene locus_tag LOCUS_t00210 9598 9524 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9776 10219 gene locus_tag LOCUS_11060 9776 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 10219 12078 gene locus_tag LOCUS_11070 10219 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence068 352 945 gene locus_tag LOCUS_11080 352 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1053 2336 gene locus_tag LOCUS_11090 1053 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2974 2390 gene locus_tag LOCUS_11100 2974 2390 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920984.1 protein_id gnl|my_center|LOCUS_11100 3769 3185 gene locus_tag LOCUS_11110 3769 3185 CDS product DUF2854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 protein_id gnl|my_center|LOCUS_11110 4144 5325 gene locus_tag LOCUS_11120 gene rpoD 4144 5325 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920727.1 protein_id gnl|my_center|LOCUS_11120 5599 5357 gene locus_tag LOCUS_11130 5599 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5673 6026 gene locus_tag LOCUS_11140 5673 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11140 6016 6414 gene locus_tag LOCUS_11150 6016 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11150 6516 7808 gene locus_tag LOCUS_11160 gene yidC 6516 7808 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056448.1 protein_id gnl|my_center|LOCUS_11160 7833 8402 gene locus_tag LOCUS_11170 7833 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 8402 8908 gene locus_tag LOCUS_11180 8402 8908 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055932.1 protein_id gnl|my_center|LOCUS_11180 10586 9045 gene locus_tag LOCUS_11190 10586 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 10916 11068 gene locus_tag LOCUS_11200 10916 11068 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056299.1 protein_id gnl|my_center|LOCUS_11200 11512 11138 gene locus_tag LOCUS_11210 11512 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 11729 12859 gene locus_tag LOCUS_11220 11729 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence069 <1 1089 gene locus_tag LOCUS_11230 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066867760.1:UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase 1102 1539 gene locus_tag LOCUS_11240 1102 1539 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_11240 1569 2264 gene locus_tag LOCUS_11250 gene pseF 1569 2264 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_11250 2289 3275 gene locus_tag LOCUS_11260 2289 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3288 4583 gene locus_tag LOCUS_11270 3288 4583 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_11270 4576 5118 gene locus_tag LOCUS_11280 4576 5118 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925129.1 protein_id gnl|my_center|LOCUS_11280 5111 6025 gene locus_tag LOCUS_11290 5111 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 6041 7171 gene locus_tag LOCUS_11300 6041 7171 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015749.1 protein_id gnl|my_center|LOCUS_11300 7168 7809 gene locus_tag LOCUS_11310 gene hisH 7168 7809 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579150.1 protein_id gnl|my_center|LOCUS_11310 7772 8557 gene locus_tag LOCUS_11320 7772 8557 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_11320 8550 9803 gene locus_tag LOCUS_11330 gene pseA 8550 9803 CDS product pseudaminic acid biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_11330 9824 10858 gene locus_tag LOCUS_11340 gene pseG 9824 10858 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965485.1 protein_id gnl|my_center|LOCUS_11340 10887 11570 gene locus_tag LOCUS_11350 10887 11570 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141382.1 protein_id gnl|my_center|LOCUS_11350 11669 12244 gene locus_tag LOCUS_11360 11669 12244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 12265 13317 gene locus_tag LOCUS_11370 gene pseI 12265 13317 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_11370 13320 14018 gene locus_tag LOCUS_11380 13320 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence070 <1 971 gene locus_tag LOCUS_11390 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963143.1:oleate hydratase 1005 2054 gene locus_tag LOCUS_11400 1005 2054 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943746.1 protein_id gnl|my_center|LOCUS_11400 2065 2868 gene locus_tag LOCUS_11410 2065 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_11410 2903 3706 gene locus_tag LOCUS_11420 2903 3706 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931878.1 protein_id gnl|my_center|LOCUS_11420 7509 4546 gene locus_tag LOCUS_11430 7509 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 9970 7511 gene locus_tag LOCUS_11440 9970 7511 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_11440 10805 13228 gene locus_tag LOCUS_11450 10805 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 13611 13889 gene locus_tag LOCUS_11460 13611 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence071 352 1278 gene locus_tag LOCUS_11470 352 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2231 1431 gene locus_tag LOCUS_11480 2231 1431 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141159.1 protein_id gnl|my_center|LOCUS_11480 2811 2245 gene locus_tag LOCUS_11490 2811 2245 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141762.1 protein_id gnl|my_center|LOCUS_11490 3200 4594 gene locus_tag LOCUS_11500 3200 4594 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088430287.1 protein_id gnl|my_center|LOCUS_11500 4867 5937 gene locus_tag LOCUS_11510 4867 5937 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066853.1 protein_id gnl|my_center|LOCUS_11510 6016 6483 gene locus_tag LOCUS_11520 6016 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 6601 8220 gene locus_tag LOCUS_11530 6601 8220 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_11530 9735 8254 gene locus_tag LOCUS_11540 9735 8254 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 protein_id gnl|my_center|LOCUS_11540 9880 10452 gene locus_tag LOCUS_11550 9880 10452 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 protein_id gnl|my_center|LOCUS_11550 12149 10596 gene locus_tag LOCUS_11560 12149 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 12983 12378 gene locus_tag LOCUS_11570 12983 12378 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142137.1 protein_id gnl|my_center|LOCUS_11570 13612 13884 gene locus_tag LOCUS_11580 13612 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence072 400 155 gene locus_tag LOCUS_11590 400 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2245 437 gene locus_tag LOCUS_11600 2245 437 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928808.1 protein_id gnl|my_center|LOCUS_11600 2666 2352 gene locus_tag LOCUS_11610 2666 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3106 3624 gene locus_tag LOCUS_11620 3106 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3718 4725 gene locus_tag LOCUS_11630 3718 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 5245 4943 gene locus_tag LOCUS_11640 5245 4943 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055968.1 protein_id gnl|my_center|LOCUS_11640 5617 6282 gene locus_tag LOCUS_11650 5617 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 6383 7381 gene locus_tag LOCUS_11660 gene trpS 6383 7381 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057831.1 protein_id gnl|my_center|LOCUS_11660 7491 7709 gene locus_tag LOCUS_11670 7491 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 7699 8127 gene locus_tag LOCUS_11680 7699 8127 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_11680 8876 8166 gene locus_tag LOCUS_11690 gene trmB 8876 8166 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_11690 9027 10049 gene locus_tag LOCUS_11700 9027 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 10564 10746 gene locus_tag LOCUS_11710 10564 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11710 11328 11582 gene locus_tag LOCUS_11720 11328 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 11980 11627 gene locus_tag LOCUS_11730 11980 11627 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144365.1 protein_id gnl|my_center|LOCUS_11730 12233 12021 gene locus_tag LOCUS_11740 12233 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 12344 13513 gene locus_tag LOCUS_11750 12344 13513 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124972844.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence073 432 2126 gene locus_tag LOCUS_11760 432 2126 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056613.1 protein_id gnl|my_center|LOCUS_11760 2314 2625 gene locus_tag LOCUS_11770 gene groES 2314 2625 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125740.1 protein_id gnl|my_center|LOCUS_11770 2723 4357 gene locus_tag LOCUS_11780 gene groL 2723 4357 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056040.1 protein_id gnl|my_center|LOCUS_11780 4564 5865 gene locus_tag LOCUS_11790 4564 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6319 5924 gene locus_tag LOCUS_11800 6319 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 6719 7804 gene locus_tag LOCUS_11810 6719 7804 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388802.1 protein_id gnl|my_center|LOCUS_11810 7891 8919 gene locus_tag LOCUS_11820 7891 8919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence074 2218 134 gene locus_tag LOCUS_11830 2218 134 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_11830 3151 2309 gene locus_tag LOCUS_11840 3151 2309 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_11840 3336 3187 gene locus_tag LOCUS_11850 3336 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3683 4705 gene locus_tag LOCUS_11860 3683 4705 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338207.1 protein_id gnl|my_center|LOCUS_11860 5609 4764 gene locus_tag LOCUS_11870 5609 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 6644 5886 gene locus_tag LOCUS_11880 6644 5886 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269042.1 protein_id gnl|my_center|LOCUS_11880 7089 6634 gene locus_tag LOCUS_11890 gene ureE 7089 6634 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057206.1 protein_id gnl|my_center|LOCUS_11890 7152 7745 gene locus_tag LOCUS_11900 gene ureG 7152 7745 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055912.1 protein_id gnl|my_center|LOCUS_11900 8046 9254 gene locus_tag LOCUS_11910 8046 9254 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064291.1 protein_id gnl|my_center|LOCUS_11910 9608 11020 gene locus_tag LOCUS_11920 gene urtA 9608 11020 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_11920 11222 12184 gene locus_tag LOCUS_11930 11222 12184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 12243 13337 gene locus_tag LOCUS_11940 gene urtC 12243 13337 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_11940 13611 13390 gene locus_tag LOCUS_11950 13611 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence075 2443 23 gene locus_tag LOCUS_11960 2443 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4193 2697 gene locus_tag LOCUS_11970 4193 2697 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057081.1 protein_id gnl|my_center|LOCUS_11970 4943 4305 gene locus_tag LOCUS_11980 gene purN 4943 4305 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524113.1 protein_id gnl|my_center|LOCUS_11980 5108 6154 gene locus_tag LOCUS_11990 gene dusA 5108 6154 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888333.1 protein_id gnl|my_center|LOCUS_11990 6526 7542 gene locus_tag LOCUS_12000 gene nagA 6526 7542 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057928.1 protein_id gnl|my_center|LOCUS_12000 8434 7466 gene locus_tag LOCUS_12010 gene accD 8434 7466 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057480.1 protein_id gnl|my_center|LOCUS_12010 10462 8597 gene locus_tag LOCUS_12020 gene dnaK 10462 8597 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056634.1 protein_id gnl|my_center|LOCUS_12020 11355 10603 gene locus_tag LOCUS_12030 gene grpE 11355 10603 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057154.1 protein_id gnl|my_center|LOCUS_12030 13595 11610 gene locus_tag LOCUS_12040 13595 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence076 1753 1394 gene locus_tag LOCUS_12050 1753 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1960 2178 gene locus_tag LOCUS_12060 1960 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2346 2780 gene locus_tag LOCUS_12070 2346 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3217 3435 gene locus_tag LOCUS_12080 3217 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 3432 3851 gene locus_tag LOCUS_12090 3432 3851 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249840.1 protein_id gnl|my_center|LOCUS_12090 5451 4150 gene locus_tag LOCUS_12100 5451 4150 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057139.1 protein_id gnl|my_center|LOCUS_12100 7183 5648 gene locus_tag LOCUS_12110 gene pxcA 7183 5648 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056595.1 protein_id gnl|my_center|LOCUS_12110 9334 7412 gene locus_tag LOCUS_12120 9334 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 9438 10565 gene locus_tag LOCUS_12130 9438 10565 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_12130 10642 11619 gene locus_tag LOCUS_12140 10642 11619 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_12140 11714 11986 gene locus_tag LOCUS_12150 11714 11986 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_12150 12218 11961 gene locus_tag LOCUS_12160 12218 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence077 789 82 gene locus_tag LOCUS_12170 789 82 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_12170 1145 792 gene locus_tag LOCUS_12180 1145 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1374 1126 gene locus_tag LOCUS_12190 1374 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1676 2221 gene locus_tag LOCUS_12200 1676 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2232 3800 gene locus_tag LOCUS_12210 2232 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 3862 4212 gene locus_tag LOCUS_12220 3862 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 4554 4318 gene locus_tag LOCUS_12230 4554 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5803 4856 gene locus_tag LOCUS_12240 5803 4856 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_12240 6957 5944 gene locus_tag LOCUS_12250 6957 5944 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141680.1 protein_id gnl|my_center|LOCUS_12250 7420 7082 gene locus_tag LOCUS_12260 7420 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 7824 7405 gene locus_tag LOCUS_12270 7824 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 8100 8276 gene locus_tag LOCUS_12280 8100 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8401 10416 gene locus_tag LOCUS_12290 8401 10416 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071086.1 protein_id gnl|my_center|LOCUS_12290 10429 11058 gene locus_tag LOCUS_12300 10429 11058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 11810 11190 gene locus_tag LOCUS_12310 11810 11190 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_12310 12084 12629 gene locus_tag LOCUS_12320 12084 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence078 1946 132 gene locus_tag LOCUS_12330 1946 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2757 1927 gene locus_tag LOCUS_12340 gene modA 2757 1927 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_12340 3145 2936 gene locus_tag LOCUS_12350 3145 2936 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021259.1 protein_id gnl|my_center|LOCUS_12350 3468 3259 gene locus_tag LOCUS_12360 3468 3259 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071920.1 protein_id gnl|my_center|LOCUS_12360 4180 3551 gene locus_tag LOCUS_12370 4180 3551 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946184.1 protein_id gnl|my_center|LOCUS_12370 4451 4191 gene locus_tag LOCUS_12380 4451 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4787 4452 gene locus_tag LOCUS_12390 4787 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 5232 4795 gene locus_tag LOCUS_12400 5232 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 protein_id gnl|my_center|LOCUS_12400 5915 5271 gene locus_tag LOCUS_12410 5915 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 6229 5927 gene locus_tag LOCUS_12420 gene fdxB 6229 5927 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_12420 6549 6250 gene locus_tag LOCUS_12430 gene petF1 6549 6250 CDS product ferredoxin PetF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056851.1 protein_id gnl|my_center|LOCUS_12430 7098 6733 gene locus_tag LOCUS_12440 7098 6733 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214438544.1 protein_id gnl|my_center|LOCUS_12440 7961 7146 gene locus_tag LOCUS_12450 7961 7146 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545472.1 protein_id gnl|my_center|LOCUS_12450 8293 7964 gene locus_tag LOCUS_12460 8293 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 8534 8295 gene locus_tag LOCUS_12470 8534 8295 CDS product CCE_0567 family metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875126.1 protein_id gnl|my_center|LOCUS_12470 9052 8564 gene locus_tag LOCUS_12480 9052 8564 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_12480 9630 9229 gene locus_tag LOCUS_12490 gene nifX 9630 9229 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084556.1 protein_id gnl|my_center|LOCUS_12490 12383 9630 gene locus_tag LOCUS_12500 12383 9630 CDS product bifunctional nitrogenase iron-molybdenum cofactor biosynthesis protein NifEN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943433.1 protein_id gnl|my_center|LOCUS_12500 12734 12432 gene locus_tag LOCUS_12510 12734 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 <13468 12935 gene locus_tag LOCUS_12520 <13468 12935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056695.1:serine O-acetyltransferase >Feature sequence079 370 1296 gene locus_tag LOCUS_12530 370 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1563 2447 gene locus_tag LOCUS_12540 1563 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3756 2557 gene locus_tag LOCUS_12550 3756 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4676 3804 gene locus_tag LOCUS_12560 4676 3804 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056938.1 protein_id gnl|my_center|LOCUS_12560 4842 5624 gene locus_tag LOCUS_12570 4842 5624 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141382.1 protein_id gnl|my_center|LOCUS_12570 5961 6941 gene locus_tag LOCUS_12580 5961 6941 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058018.1 protein_id gnl|my_center|LOCUS_12580 7587 7204 gene locus_tag LOCUS_12590 7587 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 7696 8412 gene locus_tag LOCUS_12600 7696 8412 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963855.1 protein_id gnl|my_center|LOCUS_12600 8537 8467 gene locus_tag LOCUS_t00220 8537 8467 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9423 8662 gene locus_tag LOCUS_12610 9423 8662 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_12610 9649 10188 gene locus_tag LOCUS_12620 9649 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 10643 10488 gene locus_tag LOCUS_12630 10643 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 11241 10660 gene locus_tag LOCUS_12640 11241 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 12917 11508 gene locus_tag LOCUS_12650 12917 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 13067 13378 gene locus_tag LOCUS_12660 13067 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence080 913 1887 gene locus_tag LOCUS_12670 913 1887 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 protein_id gnl|my_center|LOCUS_12670 5000 2088 gene locus_tag LOCUS_12680 5000 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5324 5055 gene locus_tag LOCUS_12690 5324 5055 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116175.1 protein_id gnl|my_center|LOCUS_12690 6011 5418 gene locus_tag LOCUS_12700 gene lepB 6011 5418 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_12700 7099 6071 gene locus_tag LOCUS_12710 7099 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 7254 7910 gene locus_tag LOCUS_12720 gene deoC 7254 7910 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056922.1 protein_id gnl|my_center|LOCUS_12720 8217 8678 gene locus_tag LOCUS_12730 8217 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 9876 8761 gene locus_tag LOCUS_12740 9876 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 10754 12178 gene locus_tag LOCUS_12750 gene gndA 10754 12178 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056424.1 protein_id gnl|my_center|LOCUS_12750 12388 12218 gene locus_tag LOCUS_12760 12388 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 12686 12501 gene locus_tag LOCUS_12770 12686 12501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence081 881 1798 gene locus_tag LOCUS_12780 881 1798 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_12780 1795 2130 gene locus_tag LOCUS_12790 1795 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2127 2975 gene locus_tag LOCUS_12800 2127 2975 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054642.1 protein_id gnl|my_center|LOCUS_12800 3379 3143 gene locus_tag LOCUS_12810 3379 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 5630 3384 gene locus_tag LOCUS_12820 5630 3384 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056504.1 protein_id gnl|my_center|LOCUS_12820 5765 7066 gene locus_tag LOCUS_12830 5765 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 8390 7206 gene locus_tag LOCUS_12840 8390 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 11634 8677 gene locus_tag LOCUS_12850 11634 8677 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056504.1 protein_id gnl|my_center|LOCUS_12850 12131 11799 gene locus_tag LOCUS_12860 12131 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence082 2925 4622 gene locus_tag LOCUS_12870 2925 4622 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799342.1 protein_id gnl|my_center|LOCUS_12870 7889 6240 gene locus_tag LOCUS_12880 7889 6240 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799342.1 protein_id gnl|my_center|LOCUS_12880 11889 7960 gene locus_tag LOCUS_12890 11889 7960 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057482.1 protein_id gnl|my_center|LOCUS_12890 12481 12173 gene locus_tag LOCUS_12900 12481 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 13233 12865 gene locus_tag LOCUS_12910 13233 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence083 966 1211 gene locus_tag LOCUS_12920 966 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1283 1774 gene locus_tag LOCUS_12930 1283 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1776 2042 gene locus_tag LOCUS_12940 1776 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 2039 2293 gene locus_tag LOCUS_12950 2039 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2813 2316 gene locus_tag LOCUS_12960 2813 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3940 2810 gene locus_tag LOCUS_12970 3940 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6165 4078 gene locus_tag LOCUS_12980 6165 4078 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922418.1 protein_id gnl|my_center|LOCUS_12980 6378 6920 gene locus_tag LOCUS_12990 6378 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 7458 8015 gene locus_tag LOCUS_13000 7458 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 8169 9017 gene locus_tag LOCUS_13010 8169 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 9409 9056 gene locus_tag LOCUS_13020 9409 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 10661 9507 gene locus_tag LOCUS_13030 10661 9507 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence084 83 2494 gene locus_tag LOCUS_13040 83 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3620 2559 gene locus_tag LOCUS_13050 3620 2559 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_13050 4238 7483 gene locus_tag LOCUS_13060 4238 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7553 10750 gene locus_tag LOCUS_13070 7553 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 11684 10785 gene locus_tag LOCUS_13080 11684 10785 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_13080 12386 13084 gene locus_tag LOCUS_13090 12386 13084 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence085 1001 381 gene locus_tag LOCUS_13100 1001 381 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140740.1 protein_id gnl|my_center|LOCUS_13100 1498 998 gene locus_tag LOCUS_13110 1498 998 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140739.1 protein_id gnl|my_center|LOCUS_13110 2051 3928 gene locus_tag LOCUS_13120 gene uvrC 2051 3928 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057590.1 protein_id gnl|my_center|LOCUS_13120 5285 4050 gene locus_tag LOCUS_13130 5285 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6458 7888 gene locus_tag LOCUS_13140 6458 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 9143 8457 gene locus_tag LOCUS_13150 9143 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 10509 9253 gene locus_tag LOCUS_13160 10509 9253 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768840.1 protein_id gnl|my_center|LOCUS_13160 12139 10583 gene locus_tag LOCUS_13170 12139 10583 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140695.1 protein_id gnl|my_center|LOCUS_13170 12984 12406 gene locus_tag LOCUS_13180 12984 12406 CDS product DUF4360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028347.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence086 <1 777 gene locus_tag LOCUS_13190 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945405.1:putative DNA binding domain-containing protein 770 2422 gene locus_tag LOCUS_13200 770 2422 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110073.1 protein_id gnl|my_center|LOCUS_13200 2434 4302 gene locus_tag LOCUS_13210 2434 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 5177 4614 gene locus_tag LOCUS_13220 5177 4614 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180487.1 protein_id gnl|my_center|LOCUS_13220 6006 5338 gene locus_tag LOCUS_13230 6006 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6523 5984 gene locus_tag LOCUS_13240 6523 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 6954 6520 gene locus_tag LOCUS_13250 6954 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 8434 6959 gene locus_tag LOCUS_13260 8434 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 9363 8431 gene locus_tag LOCUS_13270 9363 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 9752 9372 gene locus_tag LOCUS_13280 9752 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 10186 9752 gene locus_tag LOCUS_13290 10186 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 10411 10187 gene locus_tag LOCUS_13300 10411 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 10768 10520 gene locus_tag LOCUS_13310 10768 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 11471 11076 gene locus_tag LOCUS_13320 11471 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 11596 11841 gene locus_tag LOCUS_13330 11596 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 11834 12466 gene locus_tag LOCUS_13340 11834 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 12463 13029 gene locus_tag LOCUS_13350 12463 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence087 871 452 gene locus_tag LOCUS_13360 871 452 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249647.1 protein_id gnl|my_center|LOCUS_13360 1085 864 gene locus_tag LOCUS_13370 1085 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2029 1250 gene locus_tag LOCUS_13380 gene fetB 2029 1250 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_13380 2575 2099 gene locus_tag LOCUS_13390 2575 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 3663 2812 gene locus_tag LOCUS_13400 3663 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 5501 3924 gene locus_tag LOCUS_13410 gene cobA 5501 3924 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920993.1 protein_id gnl|my_center|LOCUS_13410 7373 5577 gene locus_tag LOCUS_13420 gene lepA 7373 5577 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056160.1 protein_id gnl|my_center|LOCUS_13420 7821 11270 gene locus_tag LOCUS_13430 gene infB 7821 11270 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056909.1 protein_id gnl|my_center|LOCUS_13430 11683 11312 gene locus_tag LOCUS_13440 11683 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 11955 11680 gene locus_tag LOCUS_13450 11955 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_13450 12167 12820 gene locus_tag LOCUS_13460 12167 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence088 102 635 gene locus_tag LOCUS_13470 102 635 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141192.1 protein_id gnl|my_center|LOCUS_13470 640 1251 gene locus_tag LOCUS_13480 640 1251 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141193.1 protein_id gnl|my_center|LOCUS_13480 1310 1615 gene locus_tag LOCUS_13490 1310 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1839 2093 gene locus_tag LOCUS_13500 1839 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2129 3001 gene locus_tag LOCUS_13510 2129 3001 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 protein_id gnl|my_center|LOCUS_13510 3747 3142 gene locus_tag LOCUS_13520 3747 3142 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124494.1 protein_id gnl|my_center|LOCUS_13520 5048 3765 gene locus_tag LOCUS_13530 5048 3765 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 protein_id gnl|my_center|LOCUS_13530 5676 5182 gene locus_tag LOCUS_13540 5676 5182 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 protein_id gnl|my_center|LOCUS_13540 6335 5781 gene locus_tag LOCUS_13550 6335 5781 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 protein_id gnl|my_center|LOCUS_13550 7203 6547 gene locus_tag LOCUS_13560 7203 6547 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141257.1 protein_id gnl|my_center|LOCUS_13560 7443 8030 gene locus_tag LOCUS_13570 7443 8030 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 protein_id gnl|my_center|LOCUS_13570 8131 8862 gene locus_tag LOCUS_13580 8131 8862 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058141.1 protein_id gnl|my_center|LOCUS_13580 8941 10743 gene locus_tag LOCUS_13590 8941 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 10756 11130 gene locus_tag LOCUS_13600 10756 11130 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_13600 11214 12746 gene locus_tag LOCUS_13610 11214 12746 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence089 178 471 gene locus_tag LOCUS_13620 178 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 948 1313 gene locus_tag LOCUS_13630 948 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1387 1764 gene locus_tag LOCUS_13640 1387 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2021 2998 gene locus_tag LOCUS_13650 2021 2998 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078330037.1 protein_id gnl|my_center|LOCUS_13650 3278 5347 gene locus_tag LOCUS_13660 3278 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 6507 5353 gene locus_tag LOCUS_13670 6507 5353 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140086.1 protein_id gnl|my_center|LOCUS_13670 6815 6742 gene locus_tag LOCUS_t00230 6815 6742 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8244 6892 gene locus_tag LOCUS_13680 gene miaB 8244 6892 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057155.1 protein_id gnl|my_center|LOCUS_13680 8413 8664 gene locus_tag LOCUS_13690 8413 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 8720 8962 gene locus_tag LOCUS_13700 8720 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 8962 9150 gene locus_tag LOCUS_13710 8962 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 9214 10308 gene locus_tag LOCUS_13720 9214 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 12698 10509 gene locus_tag LOCUS_13730 12698 10509 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140924.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence090 275 913 gene locus_tag LOCUS_13740 275 913 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038060574.1 protein_id gnl|my_center|LOCUS_13740 924 2363 gene locus_tag LOCUS_13750 924 2363 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966096.1 protein_id gnl|my_center|LOCUS_13750 2381 3979 gene locus_tag LOCUS_13760 2381 3979 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_13760 4686 4003 gene locus_tag LOCUS_13770 4686 4003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920717.1 protein_id gnl|my_center|LOCUS_13770 5043 4780 gene locus_tag LOCUS_13780 5043 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 5426 5596 gene locus_tag LOCUS_13790 5426 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 6639 5653 gene locus_tag LOCUS_13800 gene nadA 6639 5653 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_13800 7076 7984 gene locus_tag LOCUS_13810 7076 7984 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141339.1 protein_id gnl|my_center|LOCUS_13810 8234 9409 gene locus_tag LOCUS_13820 8234 9409 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598138.1 protein_id gnl|my_center|LOCUS_13820 9635 10834 gene locus_tag LOCUS_13830 9635 10834 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_13830 11617 12405 gene locus_tag LOCUS_13840 11617 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 13010 12417 gene locus_tag LOCUS_13850 13010 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence091 301 1002 gene locus_tag LOCUS_13860 301 1002 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125538.1 protein_id gnl|my_center|LOCUS_13860 1075 1668 gene locus_tag LOCUS_13870 1075 1668 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056914.1 protein_id gnl|my_center|LOCUS_13870 1783 3057 gene locus_tag LOCUS_13880 1783 3057 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731523.1 protein_id gnl|my_center|LOCUS_13880 3457 3113 gene locus_tag LOCUS_13890 3457 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3567 4586 gene locus_tag LOCUS_13900 3567 4586 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_13900 4957 4628 gene locus_tag LOCUS_13910 4957 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 5374 5093 gene locus_tag LOCUS_13920 5374 5093 CDS product DUF3593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_13920 5785 5486 gene locus_tag LOCUS_13930 5785 5486 CDS product DUF2499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_13930 6778 5801 gene locus_tag LOCUS_13940 6778 5801 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140505.1 protein_id gnl|my_center|LOCUS_13940 9376 6788 gene locus_tag LOCUS_13950 gene cphA 9376 6788 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 protein_id gnl|my_center|LOCUS_13950 10824 9664 gene locus_tag LOCUS_13960 10824 9664 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056850.1 protein_id gnl|my_center|LOCUS_13960 11978 11145 gene locus_tag LOCUS_13970 11978 11145 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_13970 12870 12199 gene locus_tag LOCUS_13980 gene phoU 12870 12199 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582863.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence092 <1 2100 gene locus_tag LOCUS_13990 <1 2100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056499.1:ribonuclease R 2667 2993 gene locus_tag LOCUS_14000 2667 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3228 3148 gene locus_tag LOCUS_t00240 3228 3148 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4260 3466 gene locus_tag LOCUS_14010 4260 3466 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 protein_id gnl|my_center|LOCUS_14010 4939 4658 gene locus_tag LOCUS_14020 gene clpS 4939 4658 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024123996.1 protein_id gnl|my_center|LOCUS_14020 6325 5243 gene locus_tag LOCUS_14030 6325 5243 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_14030 7796 6387 gene locus_tag LOCUS_14040 7796 6387 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 protein_id gnl|my_center|LOCUS_14040 8600 10741 gene locus_tag LOCUS_14050 8600 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 12565 10796 gene locus_tag LOCUS_14060 12565 10796 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence093 195 635 gene locus_tag LOCUS_14070 195 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 703 1629 gene locus_tag LOCUS_14080 703 1629 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552051.1 protein_id gnl|my_center|LOCUS_14080 2186 1647 gene locus_tag LOCUS_14090 2186 1647 CDS product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 protein_id gnl|my_center|LOCUS_14090 2869 4920 gene locus_tag LOCUS_14100 2869 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4978 5838 gene locus_tag LOCUS_14110 4978 5838 CDS product DUF3598 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057503.1 protein_id gnl|my_center|LOCUS_14110 5876 6760 gene locus_tag LOCUS_14120 5876 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 6901 8376 gene locus_tag LOCUS_14130 6901 8376 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_14130 9990 8485 gene locus_tag LOCUS_14140 9990 8485 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141648.1 protein_id gnl|my_center|LOCUS_14140 10280 12205 gene locus_tag LOCUS_14150 gene speA 10280 12205 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057644.1 protein_id gnl|my_center|LOCUS_14150 12626 12255 gene locus_tag LOCUS_14160 12626 12255 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866414.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence094 1066 62 gene locus_tag LOCUS_14170 1066 62 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920628.1 protein_id gnl|my_center|LOCUS_14170 1627 2169 gene locus_tag LOCUS_14180 1627 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2476 3789 gene locus_tag LOCUS_14190 2476 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3889 4755 gene locus_tag LOCUS_14200 3889 4755 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425211.1 protein_id gnl|my_center|LOCUS_14200 5327 4938 gene locus_tag LOCUS_14210 5327 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 5807 7603 gene locus_tag LOCUS_14220 5807 7603 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_14220 7714 8094 gene locus_tag LOCUS_14230 7714 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 8719 8318 gene locus_tag LOCUS_14240 8719 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 9046 9888 gene locus_tag LOCUS_14250 gene tatC 9046 9888 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056797.1 protein_id gnl|my_center|LOCUS_14250 9961 11574 gene locus_tag LOCUS_14260 gene cimA 9961 11574 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_14260 <12562 11701 gene locus_tag LOCUS_14270 <12562 11701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057229.1:ATP-dependent chaperone ClpB >Feature sequence095 139 1398 gene locus_tag LOCUS_14280 139 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1433 2380 gene locus_tag LOCUS_14290 1433 2380 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629595.1 protein_id gnl|my_center|LOCUS_14290 2390 3214 gene locus_tag LOCUS_14300 2390 3214 CDS product [alpha-L-fucopyranosyl-(1->3)-alpha-L-rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L-rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 2'''-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899556.1 protein_id gnl|my_center|LOCUS_14300 3341 4258 gene locus_tag LOCUS_14310 3341 4258 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266853.1 protein_id gnl|my_center|LOCUS_14310 4346 4921 gene locus_tag LOCUS_14320 4346 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 4918 5865 gene locus_tag LOCUS_14330 4918 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 5928 6917 gene locus_tag LOCUS_14340 5928 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 7212 7493 gene locus_tag LOCUS_14350 7212 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 7483 8502 gene locus_tag LOCUS_14360 7483 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 8518 9501 gene locus_tag LOCUS_14370 8518 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 9498 10259 gene locus_tag LOCUS_14380 9498 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 10292 11440 gene locus_tag LOCUS_14390 10292 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 11539 12306 gene locus_tag LOCUS_14400 11539 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence096 114 302 gene locus_tag LOCUS_14410 114 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1195 530 gene locus_tag LOCUS_14420 1195 530 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243932.1 protein_id gnl|my_center|LOCUS_14420 2338 5892 gene locus_tag LOCUS_14430 gene metH 2338 5892 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921137.1 protein_id gnl|my_center|LOCUS_14430 5961 7013 gene locus_tag LOCUS_14440 5961 7013 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_14440 7017 7655 gene locus_tag LOCUS_14450 7017 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 7760 8650 gene locus_tag LOCUS_14460 7760 8650 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 protein_id gnl|my_center|LOCUS_14460 8796 9962 gene locus_tag LOCUS_14470 8796 9962 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_14470 10014 10556 gene locus_tag LOCUS_14480 10014 10556 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_14480 10610 12103 gene locus_tag LOCUS_14490 10610 12103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence097 1849 296 gene locus_tag LOCUS_14500 1849 296 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058227.1 protein_id gnl|my_center|LOCUS_14500 3746 1863 gene locus_tag LOCUS_14510 3746 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 4231 5295 gene locus_tag LOCUS_14520 gene hrcA 4231 5295 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056606.1 protein_id gnl|my_center|LOCUS_14520 5515 5282 gene locus_tag LOCUS_14530 5515 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 6706 5723 gene locus_tag LOCUS_14540 gene sds 6706 5723 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_14540 6985 7722 gene locus_tag LOCUS_14550 6985 7722 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144148.1 protein_id gnl|my_center|LOCUS_14550 7853 9229 gene locus_tag LOCUS_14560 gene glgA 7853 9229 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056608.1 protein_id gnl|my_center|LOCUS_14560 9443 10348 gene locus_tag LOCUS_14570 9443 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 10500 10922 gene locus_tag LOCUS_14580 10500 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_14580 <12435 11002 gene locus_tag LOCUS_14590 <12435 11002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence098 381 1397 gene locus_tag LOCUS_14600 381 1397 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058242.1 protein_id gnl|my_center|LOCUS_14600 6751 1829 gene locus_tag LOCUS_14610 6751 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 8325 6970 gene locus_tag LOCUS_14620 8325 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 9792 8503 gene locus_tag LOCUS_14630 gene ahcY 9792 8503 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058222.1 protein_id gnl|my_center|LOCUS_14630 11127 10570 gene locus_tag LOCUS_14640 11127 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 11484 12260 gene locus_tag LOCUS_14650 11484 12260 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence099 1055 396 gene locus_tag LOCUS_14660 1055 396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_14660 1344 1712 gene locus_tag LOCUS_14670 1344 1712 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_14670 1854 3179 gene locus_tag LOCUS_14680 1854 3179 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_14680 4045 3347 gene locus_tag LOCUS_14690 gene msrA 4045 3347 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928865.1 protein_id gnl|my_center|LOCUS_14690 5274 4366 gene locus_tag LOCUS_14700 5274 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_14700 6100 5264 gene locus_tag LOCUS_14710 6100 5264 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920966.1 protein_id gnl|my_center|LOCUS_14710 8183 6186 gene locus_tag LOCUS_14720 8183 6186 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057837.1 protein_id gnl|my_center|LOCUS_14720 9269 8427 gene locus_tag LOCUS_14730 gene ntrB 9269 8427 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920965.1 protein_id gnl|my_center|LOCUS_14730 11098 9359 gene locus_tag LOCUS_14740 11098 9359 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_14740 <12295 11149 gene locus_tag LOCUS_14750 <12295 11149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057835.1:CmpA/NrtA family ABC transporter substrate-binding protein >Feature sequence100 278 1186 gene locus_tag LOCUS_14760 278 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1829 2320 gene locus_tag LOCUS_14770 1829 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888249.1 protein_id gnl|my_center|LOCUS_14770 2377 2748 gene locus_tag LOCUS_14780 2377 2748 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057825.1 protein_id gnl|my_center|LOCUS_14780 2857 3396 gene locus_tag LOCUS_14790 2857 3396 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057826.1 protein_id gnl|my_center|LOCUS_14790 3451 4302 gene locus_tag LOCUS_14800 3451 4302 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057827.1 protein_id gnl|my_center|LOCUS_14800 5723 4746 gene locus_tag LOCUS_14810 gene ppk2 5723 4746 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_14810 6396 5980 gene locus_tag LOCUS_14820 6396 5980 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920821.1 protein_id gnl|my_center|LOCUS_14820 6536 8443 gene locus_tag LOCUS_14830 6536 8443 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530091.1 protein_id gnl|my_center|LOCUS_14830 8784 8494 gene locus_tag LOCUS_14840 8784 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 9819 9010 gene locus_tag LOCUS_14850 9819 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 10642 9926 gene locus_tag LOCUS_14860 10642 9926 CDS product DUF3386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_14860 10762 11508 gene locus_tag LOCUS_14870 10762 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence101 3338 75 gene locus_tag LOCUS_14880 3338 75 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_14880 4102 3608 gene locus_tag LOCUS_14890 4102 3608 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920902.1 protein_id gnl|my_center|LOCUS_14890 4879 4388 gene locus_tag LOCUS_14900 gene ybeY 4879 4388 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057424.1 protein_id gnl|my_center|LOCUS_14900 5382 5158 gene locus_tag LOCUS_14910 5382 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 5709 5927 gene locus_tag LOCUS_14920 5709 5927 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_14920 6180 7325 gene locus_tag LOCUS_14930 6180 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 7322 8203 gene locus_tag LOCUS_14940 gene gvpN 7322 8203 CDS product gas vesicle protein GvpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904110.1 protein_id gnl|my_center|LOCUS_14940 8203 8529 gene locus_tag LOCUS_14950 8203 8529 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972473.1 protein_id gnl|my_center|LOCUS_14950 9788 8565 gene locus_tag LOCUS_14960 9788 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 10561 9917 gene locus_tag LOCUS_14970 10561 9917 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144411.1 protein_id gnl|my_center|LOCUS_14970 10749 11351 gene locus_tag LOCUS_14980 10749 11351 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_14980 11427 11981 gene locus_tag LOCUS_14990 11427 11981 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142701.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence102 638 405 gene locus_tag LOCUS_15000 638 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1790 915 gene locus_tag LOCUS_15010 gene lipA 1790 915 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921111.1 protein_id gnl|my_center|LOCUS_15010 1904 2083 gene locus_tag LOCUS_15020 1904 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2153 2449 gene locus_tag LOCUS_15030 2153 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 3927 5456 gene locus_tag LOCUS_15040 gene malQ 3927 5456 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_15040 6764 5505 gene locus_tag LOCUS_15050 6764 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 9841 7133 gene locus_tag LOCUS_15060 gene mutS 9841 7133 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058073.1 protein_id gnl|my_center|LOCUS_15060 10022 11692 gene locus_tag LOCUS_15070 10022 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence103 577 68 gene locus_tag LOCUS_15080 577 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1877 621 gene locus_tag LOCUS_15090 gene rodA 1877 621 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920901.1 protein_id gnl|my_center|LOCUS_15090 2528 1959 gene locus_tag LOCUS_15100 2528 1959 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_15100 3255 2548 gene locus_tag LOCUS_15110 gene ubiE 3255 2548 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140131.1 protein_id gnl|my_center|LOCUS_15110 3439 4044 gene locus_tag LOCUS_15120 3439 4044 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406089.1 protein_id gnl|my_center|LOCUS_15120 4111 5691 gene locus_tag LOCUS_15130 4111 5691 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056886.1 protein_id gnl|my_center|LOCUS_15130 5700 6350 gene locus_tag LOCUS_15140 5700 6350 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928824.1 protein_id gnl|my_center|LOCUS_15140 6580 8103 gene locus_tag LOCUS_15150 gene dacB 6580 8103 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 protein_id gnl|my_center|LOCUS_15150 8184 8576 gene locus_tag LOCUS_15160 8184 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 8869 9651 gene locus_tag LOCUS_15170 8869 9651 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_15170 11848 9701 gene locus_tag LOCUS_15180 11848 9701 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058027.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence104 <1 664 gene locus_tag LOCUS_15190 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003084587.1:twitching motility response regulator PilH 845 1261 gene locus_tag LOCUS_15200 845 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1264 1845 gene locus_tag LOCUS_15210 1264 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1964 7333 gene locus_tag LOCUS_15220 1964 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 7777 9168 gene locus_tag LOCUS_15230 7777 9168 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256741.1 protein_id gnl|my_center|LOCUS_15230 9168 11804 gene locus_tag LOCUS_15240 9168 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence105 <1 2602 gene locus_tag LOCUS_15250 <1 2602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057229.1:ATP-dependent chaperone ClpB 3993 2836 gene locus_tag LOCUS_15260 gene bioF 3993 2836 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140400.1 protein_id gnl|my_center|LOCUS_15260 4051 4935 gene locus_tag LOCUS_15270 4051 4935 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142304.1 protein_id gnl|my_center|LOCUS_15270 6294 5557 gene locus_tag LOCUS_15280 6294 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 6703 7875 gene locus_tag LOCUS_15290 6703 7875 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057098.1 protein_id gnl|my_center|LOCUS_15290 9048 8188 gene locus_tag LOCUS_15300 gene lipA 9048 8188 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172396.1 protein_id gnl|my_center|LOCUS_15300 9263 10624 gene locus_tag LOCUS_15310 9263 10624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 11257 10739 gene locus_tag LOCUS_15320 11257 10739 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142919.1 protein_id gnl|my_center|LOCUS_15320 11506 11961 gene locus_tag LOCUS_15330 11506 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence106 630 1664 gene locus_tag LOCUS_15340 630 1664 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_15340 1944 2606 gene locus_tag LOCUS_15350 1944 2606 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056234.1 protein_id gnl|my_center|LOCUS_15350 2722 3525 gene locus_tag LOCUS_15360 2722 3525 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143173.1 protein_id gnl|my_center|LOCUS_15360 3610 4266 gene locus_tag LOCUS_15370 3610 4266 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766796.1 protein_id gnl|my_center|LOCUS_15370 4370 4549 gene locus_tag LOCUS_15380 4370 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4613 6265 gene locus_tag LOCUS_15390 4613 6265 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036534662.1 protein_id gnl|my_center|LOCUS_15390 6800 6351 gene locus_tag LOCUS_15400 6800 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 7321 6797 gene locus_tag LOCUS_15410 7321 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 7797 8111 gene locus_tag LOCUS_15420 7797 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057712.1 protein_id gnl|my_center|LOCUS_15420 8193 9707 gene locus_tag LOCUS_15430 8193 9707 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_15430 9895 10245 gene locus_tag LOCUS_15440 9895 10245 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124912.1 protein_id gnl|my_center|LOCUS_15440 10397 11032 gene locus_tag LOCUS_15450 10397 11032 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143129.1 protein_id gnl|my_center|LOCUS_15450 11130 11786 gene locus_tag LOCUS_15460 11130 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence107 <1 1053 gene locus_tag LOCUS_15470 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057208.1:glutamate synthase-related protein 2458 2024 gene locus_tag LOCUS_15480 2458 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3118 3762 gene locus_tag LOCUS_15490 3118 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 4237 4593 gene locus_tag LOCUS_15500 4237 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5250 6176 gene locus_tag LOCUS_15510 5250 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 6653 6234 gene locus_tag LOCUS_15520 6653 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15520 6969 6814 gene locus_tag LOCUS_15530 6969 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 8227 7046 gene locus_tag LOCUS_15540 8227 7046 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_15540 8486 8340 gene locus_tag LOCUS_15550 8486 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 8990 10993 gene locus_tag LOCUS_15560 gene tkt 8990 10993 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057707.1 protein_id gnl|my_center|LOCUS_15560 11113 11736 gene locus_tag LOCUS_15570 11113 11736 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence108 2554 140 gene locus_tag LOCUS_15580 2554 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 4565 2619 gene locus_tag LOCUS_15590 4565 2619 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 protein_id gnl|my_center|LOCUS_15590 5123 4596 gene locus_tag LOCUS_15600 5123 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 5209 6213 gene locus_tag LOCUS_15610 5209 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 6407 9043 gene locus_tag LOCUS_15620 6407 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 9989 9138 gene locus_tag LOCUS_15630 9989 9138 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055920.1 protein_id gnl|my_center|LOCUS_15630 10186 11133 gene locus_tag LOCUS_15640 10186 11133 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_15640 11322 11585 gene locus_tag LOCUS_15650 11322 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence109 112 471 gene locus_tag LOCUS_15660 112 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1893 661 gene locus_tag LOCUS_15670 gene tuf 1893 661 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057587.1 protein_id gnl|my_center|LOCUS_15670 4081 2000 gene locus_tag LOCUS_15680 gene fusA 4081 2000 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057586.1 protein_id gnl|my_center|LOCUS_15680 4550 4152 gene locus_tag LOCUS_15690 gene rpsG 4550 4152 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_15690 5128 4715 gene locus_tag LOCUS_15700 gene rpsL 5128 4715 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057584.1 protein_id gnl|my_center|LOCUS_15700 6071 5322 gene locus_tag LOCUS_15710 gene tpiA 6071 5322 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798681.1 protein_id gnl|my_center|LOCUS_15710 6899 8098 gene locus_tag LOCUS_15720 6899 8098 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_15720 8206 8607 gene locus_tag LOCUS_15730 8206 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 8600 8914 gene locus_tag LOCUS_15740 8600 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 8994 9893 gene locus_tag LOCUS_15750 8994 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 10359 10015 gene locus_tag LOCUS_15760 10359 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 10760 10347 gene locus_tag LOCUS_15770 10760 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 11775 10825 gene locus_tag LOCUS_15780 11775 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence110 224 2653 gene locus_tag LOCUS_15790 224 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2656 3066 gene locus_tag LOCUS_15800 2656 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 3448 7353 gene locus_tag LOCUS_15810 gene cobN 3448 7353 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056744.1 protein_id gnl|my_center|LOCUS_15810 7610 7371 gene locus_tag LOCUS_15820 7610 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 7886 8296 gene locus_tag LOCUS_15830 7886 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 8283 9167 gene locus_tag LOCUS_15840 8283 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 9148 9660 gene locus_tag LOCUS_15850 9148 9660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 9795 10022 gene locus_tag LOCUS_15860 9795 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 10019 10441 gene locus_tag LOCUS_15870 10019 10441 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_15870 10722 10519 gene locus_tag LOCUS_15880 10722 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 11717 10815 gene locus_tag LOCUS_15890 gene bchL 11717 10815 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124698.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence111 3216 1825 gene locus_tag LOCUS_15900 3216 1825 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530022.1 protein_id gnl|my_center|LOCUS_15900 3985 5250 gene locus_tag LOCUS_15910 3985 5250 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_15910 5777 5328 gene locus_tag LOCUS_15920 5777 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 6607 5882 gene locus_tag LOCUS_15930 6607 5882 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056571.1 protein_id gnl|my_center|LOCUS_15930 6836 7888 gene locus_tag LOCUS_15940 6836 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 7919 8764 gene locus_tag LOCUS_15950 7919 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 10954 8969 gene locus_tag LOCUS_15960 10954 8969 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 protein_id gnl|my_center|LOCUS_15960 11082 11714 gene locus_tag LOCUS_15970 11082 11714 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence112 1686 502 gene locus_tag LOCUS_15980 1686 502 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_15980 2931 4085 gene locus_tag LOCUS_15990 gene dnaN 2931 4085 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143222.1 protein_id gnl|my_center|LOCUS_15990 4323 6356 gene locus_tag LOCUS_16000 4323 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 7915 6437 gene locus_tag LOCUS_16010 7915 6437 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705187.1 protein_id gnl|my_center|LOCUS_16010 8791 8414 gene locus_tag LOCUS_16020 8791 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 9156 9758 gene locus_tag LOCUS_16030 9156 9758 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057359.1 protein_id gnl|my_center|LOCUS_16030 10946 9837 gene locus_tag LOCUS_16040 10946 9837 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_16040 11380 11033 gene locus_tag LOCUS_16050 11380 11033 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_16050 11582 11367 gene locus_tag LOCUS_16060 11582 11367 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140129.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence113 307 2112 gene locus_tag LOCUS_16070 307 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2682 2443 gene locus_tag LOCUS_16080 2682 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2569 3864 gene locus_tag LOCUS_16090 2569 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3930 4487 gene locus_tag LOCUS_16100 3930 4487 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_16100 5081 4593 gene locus_tag LOCUS_16110 5081 4593 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171945.1 protein_id gnl|my_center|LOCUS_16110 6070 5207 gene locus_tag LOCUS_16120 6070 5207 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 protein_id gnl|my_center|LOCUS_16120 6194 7429 gene locus_tag LOCUS_16130 6194 7429 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142861.1 protein_id gnl|my_center|LOCUS_16130 7582 7827 gene locus_tag LOCUS_16140 7582 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 7849 10005 gene locus_tag LOCUS_16150 7849 10005 CDS product IMS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920754.1 protein_id gnl|my_center|LOCUS_16150 11226 10084 gene locus_tag LOCUS_16160 gene recA 11226 10084 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057924.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence114 <1 643 gene locus_tag LOCUS_16170 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920872.1:DNA-processing protein DprA 2788 755 gene locus_tag LOCUS_16180 2788 755 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142141.1 protein_id gnl|my_center|LOCUS_16180 5317 2984 gene locus_tag LOCUS_16190 5317 2984 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798165.1 protein_id gnl|my_center|LOCUS_16190 6329 5505 gene locus_tag LOCUS_16200 6329 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 9176 6741 gene locus_tag LOCUS_16210 9176 6741 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_16210 <11421 9248 gene locus_tag LOCUS_16220 <11421 9248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence115 945 43 gene locus_tag LOCUS_16230 945 43 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_16230 2462 1122 gene locus_tag LOCUS_16240 2462 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 4561 2612 gene locus_tag LOCUS_16250 4561 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 5972 4629 gene locus_tag LOCUS_16260 5972 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 7191 6079 gene locus_tag LOCUS_16270 7191 6079 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 protein_id gnl|my_center|LOCUS_16270 7839 7420 gene locus_tag LOCUS_16280 7839 7420 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172237.1 protein_id gnl|my_center|LOCUS_16280 7913 8476 gene locus_tag LOCUS_16290 7913 8476 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_16290 8770 9390 gene locus_tag LOCUS_16300 8770 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 9403 10323 gene locus_tag LOCUS_16310 9403 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 11313 10408 gene locus_tag LOCUS_16320 11313 10408 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence116 215 1444 gene locus_tag LOCUS_16330 215 1444 CDS product FAD-dependent hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921015.1 protein_id gnl|my_center|LOCUS_16330 1538 2782 gene locus_tag LOCUS_16340 1538 2782 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799340.1 protein_id gnl|my_center|LOCUS_16340 2867 4153 gene locus_tag LOCUS_16350 2867 4153 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057231.1 protein_id gnl|my_center|LOCUS_16350 4657 4331 gene locus_tag LOCUS_16360 gene grxD 4657 4331 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143330.1 protein_id gnl|my_center|LOCUS_16360 5765 4743 gene locus_tag LOCUS_16370 5765 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 6624 6013 gene locus_tag LOCUS_16380 6624 6013 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 protein_id gnl|my_center|LOCUS_16380 6897 7298 gene locus_tag LOCUS_16390 6897 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 8770 7328 gene locus_tag LOCUS_16400 8770 7328 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042464373.1 protein_id gnl|my_center|LOCUS_16400 9315 9007 gene locus_tag LOCUS_16410 9315 9007 CDS product DUF5340 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058031.1 protein_id gnl|my_center|LOCUS_16410 9475 11142 gene locus_tag LOCUS_16420 9475 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence117 <1 3031 gene locus_tag LOCUS_16430 <1 3031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_175111133.1:autotransporter outer membrane beta-barrel domain-containing protein 3479 4237 gene locus_tag LOCUS_16440 3479 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4583 7318 gene locus_tag LOCUS_16450 4583 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 7356 9125 gene locus_tag LOCUS_16460 7356 9125 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799342.1 protein_id gnl|my_center|LOCUS_16460 9829 9185 gene locus_tag LOCUS_16470 9829 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 10533 9892 gene locus_tag LOCUS_16480 10533 9892 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920739.1 protein_id gnl|my_center|LOCUS_16480 11073 10594 gene locus_tag LOCUS_16490 gene lspA 11073 10594 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140076.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence118 112 1029 gene locus_tag LOCUS_16500 112 1029 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_16500 1664 2092 gene locus_tag LOCUS_16510 1664 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2214 2474 gene locus_tag LOCUS_16520 2214 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3617 2634 gene locus_tag LOCUS_16530 3617 2634 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_16530 4432 3782 gene locus_tag LOCUS_16540 4432 3782 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_16540 6182 4920 gene locus_tag LOCUS_16550 6182 4920 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768840.1 protein_id gnl|my_center|LOCUS_16550 7848 6307 gene locus_tag LOCUS_16560 7848 6307 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140695.1 protein_id gnl|my_center|LOCUS_16560 8208 7891 gene locus_tag LOCUS_16570 8208 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 9116 8262 gene locus_tag LOCUS_16580 9116 8262 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056352.1 protein_id gnl|my_center|LOCUS_16580 9893 9129 gene locus_tag LOCUS_16590 9893 9129 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057898.1 protein_id gnl|my_center|LOCUS_16590 11047 9974 gene locus_tag LOCUS_16600 11047 9974 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057897.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence119 <1 723 gene locus_tag LOCUS_16610 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003084969.1:class I SAM-dependent methyltransferase 713 1216 gene locus_tag LOCUS_16620 713 1216 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129831.1 protein_id gnl|my_center|LOCUS_16620 1264 1965 gene locus_tag LOCUS_16630 1264 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1992 2219 gene locus_tag LOCUS_16640 1992 2219 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058882.1 protein_id gnl|my_center|LOCUS_16640 2227 3222 gene locus_tag LOCUS_16650 2227 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 3230 3631 gene locus_tag LOCUS_16660 gene fosX 3230 3631 CDS product FosX/FosE/FosI family fosfomycin resistance hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014794455.1 protein_id gnl|my_center|LOCUS_16660 3628 4689 gene locus_tag LOCUS_16670 3628 4689 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_16670 4741 5829 gene locus_tag LOCUS_16680 4741 5829 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167770862.1 protein_id gnl|my_center|LOCUS_16680 5945 6796 gene locus_tag LOCUS_16690 5945 6796 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965193.1 protein_id gnl|my_center|LOCUS_16690 6806 7558 gene locus_tag LOCUS_16700 6806 7558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083741.1 protein_id gnl|my_center|LOCUS_16700 7674 8495 gene locus_tag LOCUS_16710 7674 8495 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226033.1 protein_id gnl|my_center|LOCUS_16710 8566 9624 gene locus_tag LOCUS_16720 8566 9624 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_16720 10141 9680 gene locus_tag LOCUS_16730 10141 9680 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence120 180 443 gene locus_tag LOCUS_16740 180 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 522 1451 gene locus_tag LOCUS_16750 522 1451 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928906.1 protein_id gnl|my_center|LOCUS_16750 2140 1490 gene locus_tag LOCUS_16760 2140 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2333 2406 gene locus_tag LOCUS_t00250 2333 2406 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4688 2604 gene locus_tag LOCUS_16770 4688 2604 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920964.1 protein_id gnl|my_center|LOCUS_16770 5529 5005 gene locus_tag LOCUS_16780 5529 5005 CDS product Ycf51 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144399.1 protein_id gnl|my_center|LOCUS_16780 5777 6520 gene locus_tag LOCUS_16790 5777 6520 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389415.1 protein_id gnl|my_center|LOCUS_16790 6944 7699 gene locus_tag LOCUS_16800 gene pgeF 6944 7699 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799068.1 protein_id gnl|my_center|LOCUS_16800 9776 7734 gene locus_tag LOCUS_16810 9776 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 <11311 10294 gene locus_tag LOCUS_16820 <11311 10294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005484168.1:extracellular solute-binding protein >Feature sequence121 211 1146 gene locus_tag LOCUS_16830 211 1146 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_16830 1357 1620 gene locus_tag LOCUS_16840 1357 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2154 3383 gene locus_tag LOCUS_16850 2154 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 3458 4465 gene locus_tag LOCUS_16860 gene uppG 3458 4465 CDS product polysaccharide biosynthesis glycosyltransferase UppG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992409.1 protein_id gnl|my_center|LOCUS_16860 4453 5187 gene locus_tag LOCUS_16870 4453 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 5234 6532 gene locus_tag LOCUS_16880 5234 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 6539 8005 gene locus_tag LOCUS_16890 6539 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 8005 9177 gene locus_tag LOCUS_16900 8005 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 10464 9208 gene locus_tag LOCUS_16910 gene ispG 10464 9208 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056840.1 protein_id gnl|my_center|LOCUS_16910 <11223 10681 gene locus_tag LOCUS_16920 <11223 10681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095143.1:diguanylate cyclase >Feature sequence122 468 190 gene locus_tag LOCUS_16930 468 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1901 495 gene locus_tag LOCUS_16940 1901 495 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_16940 3711 2047 gene locus_tag LOCUS_16950 3711 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4273 3920 gene locus_tag LOCUS_16960 4273 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056733.1 protein_id gnl|my_center|LOCUS_16960 6160 4514 gene locus_tag LOCUS_16970 gene nadB 6160 4514 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058240.1 protein_id gnl|my_center|LOCUS_16970 6678 6295 gene locus_tag LOCUS_16980 gene psbU 6678 6295 CDS product photosystem II complex extrinsic protein PsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058241.1 protein_id gnl|my_center|LOCUS_16980 7003 8595 gene locus_tag LOCUS_16990 gene ndhD1 7003 8595 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit D1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056566.1 protein_id gnl|my_center|LOCUS_16990 8682 11105 gene locus_tag LOCUS_17000 8682 11105 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053568.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence123 304 1941 gene locus_tag LOCUS_17010 304 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1926 2993 gene locus_tag LOCUS_17020 1926 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2993 3796 gene locus_tag LOCUS_17030 gene cmr4 2993 3796 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221897993.1 protein_id gnl|my_center|LOCUS_17030 3799 4185 gene locus_tag LOCUS_17040 3799 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 4200 5954 gene locus_tag LOCUS_17050 4200 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 6131 6331 gene locus_tag LOCUS_17060 6131 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 6378 6578 gene locus_tag LOCUS_17070 6378 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 6592 8211 gene locus_tag LOCUS_17080 6592 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 8254 9510 gene locus_tag LOCUS_17090 8254 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 9577 9828 gene locus_tag LOCUS_17100 9577 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 9854 10189 gene locus_tag LOCUS_17110 9854 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 10176 10817 gene locus_tag LOCUS_17120 10176 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence124 971 54 gene locus_tag LOCUS_17130 971 54 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022593.1 protein_id gnl|my_center|LOCUS_17130 1394 1002 gene locus_tag LOCUS_17140 1394 1002 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530842.1 protein_id gnl|my_center|LOCUS_17140 1557 2858 gene locus_tag LOCUS_17150 1557 2858 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_17150 2895 3551 gene locus_tag LOCUS_17160 2895 3551 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018207916.1 protein_id gnl|my_center|LOCUS_17160 3884 3579 gene locus_tag LOCUS_17170 3884 3579 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005643896.1 protein_id gnl|my_center|LOCUS_17170 4157 4378 gene locus_tag LOCUS_17180 4157 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 4371 4784 gene locus_tag LOCUS_17190 4371 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 4786 5544 gene locus_tag LOCUS_17200 4786 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5610 6515 gene locus_tag LOCUS_17210 5610 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 7712 7110 gene locus_tag LOCUS_17220 7712 7110 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_17220 10225 7805 gene locus_tag LOCUS_17230 10225 7805 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118806.1 protein_id gnl|my_center|LOCUS_17230 10798 10304 gene locus_tag LOCUS_17240 10798 10304 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969712.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence125 1095 1418 gene locus_tag LOCUS_17250 1095 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1831 3810 gene locus_tag LOCUS_17260 1831 3810 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 protein_id gnl|my_center|LOCUS_17260 3888 4985 gene locus_tag LOCUS_17270 3888 4985 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 protein_id gnl|my_center|LOCUS_17270 5128 5217 gene locus_tag LOCUS_t00260 5128 5217 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6166 5609 gene locus_tag LOCUS_17280 6166 5609 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056693.1 protein_id gnl|my_center|LOCUS_17280 8215 6191 gene locus_tag LOCUS_17290 8215 6191 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920844.1 protein_id gnl|my_center|LOCUS_17290 8519 9031 gene locus_tag LOCUS_17300 8519 9031 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056117.1 protein_id gnl|my_center|LOCUS_17300 9189 9668 gene locus_tag LOCUS_17310 9189 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 9795 10241 gene locus_tag LOCUS_17320 gene cynS 9795 10241 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_17320 10673 10284 gene locus_tag LOCUS_17330 10673 10284 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144047.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence126 347 1189 gene locus_tag LOCUS_17340 347 1189 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_17340 2808 1330 gene locus_tag LOCUS_17350 2808 1330 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920889.1 protein_id gnl|my_center|LOCUS_17350 3687 3238 gene locus_tag LOCUS_17360 3687 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4208 6001 gene locus_tag LOCUS_17370 4208 6001 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057086.1 protein_id gnl|my_center|LOCUS_17370 6231 7742 gene locus_tag LOCUS_17380 gene ilvA 6231 7742 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_17380 8546 9682 gene locus_tag LOCUS_17390 8546 9682 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_17390 9699 10841 gene locus_tag LOCUS_17400 9699 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence127 2 316 gene locus_tag LOCUS_17410 2 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 974 408 gene locus_tag LOCUS_17420 gene pyrE 974 408 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 protein_id gnl|my_center|LOCUS_17420 1396 1845 gene locus_tag LOCUS_17430 1396 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 3667 1925 gene locus_tag LOCUS_17440 3667 1925 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_17440 4687 3773 gene locus_tag LOCUS_17450 4687 3773 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 protein_id gnl|my_center|LOCUS_17450 5477 4992 gene locus_tag LOCUS_17460 5477 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 5821 6489 gene locus_tag LOCUS_17470 5821 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 6859 7632 gene locus_tag LOCUS_17480 6859 7632 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_17480 10096 7673 gene locus_tag LOCUS_17490 10096 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 10774 10283 gene locus_tag LOCUS_17500 10774 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence128 <1 1255 gene locus_tag LOCUS_17510 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530011.1:NB-ARC domain-containing protein 1763 1344 gene locus_tag LOCUS_17520 1763 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1964 1812 gene locus_tag LOCUS_17530 1964 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2156 1974 gene locus_tag LOCUS_17540 2156 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2247 2714 gene locus_tag LOCUS_17550 2247 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 4151 3306 gene locus_tag LOCUS_17560 4151 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 5354 4236 gene locus_tag LOCUS_17570 5354 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5705 8143 gene locus_tag LOCUS_17580 5705 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 8219 8440 gene locus_tag LOCUS_17590 8219 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 10070 8727 gene locus_tag LOCUS_17600 10070 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 10462 10755 gene locus_tag LOCUS_17610 10462 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140152.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence129 328 4989 gene locus_tag LOCUS_17620 328 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5354 5031 gene locus_tag LOCUS_17630 5354 5031 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_17630 6308 5577 gene locus_tag LOCUS_17640 gene psb29 6308 5577 CDS product photosystem II biogenesis protein Psp29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056976.1 protein_id gnl|my_center|LOCUS_17640 6417 7919 gene locus_tag LOCUS_17650 6417 7919 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243929.1 protein_id gnl|my_center|LOCUS_17650 9756 7966 gene locus_tag LOCUS_17660 9756 7966 CDS product DUF3685 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058156.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence130 263 1345 gene locus_tag LOCUS_17670 263 1345 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_17670 1534 2727 gene locus_tag LOCUS_17680 1534 2727 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056036.1 protein_id gnl|my_center|LOCUS_17680 3086 3529 gene locus_tag LOCUS_17690 3086 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 4875 3559 gene locus_tag LOCUS_17700 4875 3559 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_17700 7181 5211 gene locus_tag LOCUS_17710 7181 5211 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393690.1 protein_id gnl|my_center|LOCUS_17710 7669 7274 gene locus_tag LOCUS_17720 7669 7274 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889330.1 protein_id gnl|my_center|LOCUS_17720 7914 8909 gene locus_tag LOCUS_17730 gene obgE 7914 8909 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058186.1 protein_id gnl|my_center|LOCUS_17730 9266 8937 gene locus_tag LOCUS_17740 9266 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 10327 9479 gene locus_tag LOCUS_17750 10327 9479 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929069.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence131 635 246 gene locus_tag LOCUS_17760 635 246 CDS product nuclease A inhibitor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142296.1 protein_id gnl|my_center|LOCUS_17760 1969 878 gene locus_tag LOCUS_17770 1969 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2467 2048 gene locus_tag LOCUS_17780 2467 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2718 3065 gene locus_tag LOCUS_17790 2718 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 3382 3062 gene locus_tag LOCUS_17800 3382 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 3585 3776 gene locus_tag LOCUS_17810 3585 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 4361 3849 gene locus_tag LOCUS_17820 4361 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4642 4508 gene locus_tag LOCUS_17830 4642 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 6447 6022 gene locus_tag LOCUS_17840 6447 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 6554 6991 gene locus_tag LOCUS_17850 6554 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 7239 7538 gene locus_tag LOCUS_17860 7239 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 7546 7965 gene locus_tag LOCUS_17870 7546 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 8041 8322 gene locus_tag LOCUS_17880 8041 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 8348 9307 gene locus_tag LOCUS_17890 8348 9307 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263960.1 protein_id gnl|my_center|LOCUS_17890 9681 9944 gene locus_tag LOCUS_17900 9681 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 10011 10175 gene locus_tag LOCUS_17910 10011 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 10284 10439 gene locus_tag LOCUS_17920 10284 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 10512 10721 gene locus_tag LOCUS_17930 10512 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence132 376 8 gene locus_tag LOCUS_17940 376 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 621 370 gene locus_tag LOCUS_17950 621 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 761 1027 gene locus_tag LOCUS_17960 761 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1020 1799 gene locus_tag LOCUS_17970 1020 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1944 2222 gene locus_tag LOCUS_17980 1944 2222 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_17980 2185 2463 gene locus_tag LOCUS_17990 2185 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2707 2946 gene locus_tag LOCUS_18000 2707 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2952 3194 gene locus_tag LOCUS_18010 2952 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3303 3557 gene locus_tag LOCUS_18020 3303 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3665 3898 gene locus_tag LOCUS_18030 3665 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 4553 3978 gene locus_tag LOCUS_18040 4553 3978 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_18040 5639 4725 gene locus_tag LOCUS_18050 5639 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 5720 6259 gene locus_tag LOCUS_18060 gene rimI 5720 6259 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056322.1 protein_id gnl|my_center|LOCUS_18060 6663 6274 gene locus_tag LOCUS_18070 6663 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 7095 6898 gene locus_tag LOCUS_18080 7095 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 7349 9520 gene locus_tag LOCUS_18090 7349 9520 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_18090 10150 9728 gene locus_tag LOCUS_18100 10150 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 10366 10151 gene locus_tag LOCUS_18110 10366 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence133 530 4534 gene locus_tag LOCUS_18120 530 4534 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056126.1 protein_id gnl|my_center|LOCUS_18120 5104 4844 gene locus_tag LOCUS_18130 5104 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 5156 5443 gene locus_tag LOCUS_18140 5156 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 6300 6665 gene locus_tag LOCUS_18150 6300 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 6988 6701 gene locus_tag LOCUS_18160 6988 6701 CDS product DUF3288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057272.1 protein_id gnl|my_center|LOCUS_18160 8190 7027 gene locus_tag LOCUS_18170 8190 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 8455 9639 gene locus_tag LOCUS_18180 8455 9639 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142859.1 protein_id gnl|my_center|LOCUS_18180 9823 9629 gene locus_tag LOCUS_18190 9823 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence134 1276 701 gene locus_tag LOCUS_18200 1276 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1816 1625 gene locus_tag LOCUS_18210 1816 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1842 2357 gene locus_tag LOCUS_18220 1842 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 3065 2514 gene locus_tag LOCUS_18230 3065 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057906.1 protein_id gnl|my_center|LOCUS_18230 3230 3871 gene locus_tag LOCUS_18240 3230 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 4505 3930 gene locus_tag LOCUS_18250 4505 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_18250 4810 5190 gene locus_tag LOCUS_18260 gene aroH 4810 5190 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057640.1 protein_id gnl|my_center|LOCUS_18260 5360 7435 gene locus_tag LOCUS_18270 5360 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 7799 8320 gene locus_tag LOCUS_18280 gene umuD 7799 8320 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946663.1 protein_id gnl|my_center|LOCUS_18280 8376 9551 gene locus_tag LOCUS_18290 8376 9551 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629647.1 protein_id gnl|my_center|LOCUS_18290 <10666 9605 gene locus_tag LOCUS_18300 <10666 9605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126986862.1:phosphoketolase >Feature sequence135 <1 744 gene locus_tag LOCUS_18310 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056567.1:NAD(P)H-quinone oxidoreductase subunit 5 1732 821 gene locus_tag LOCUS_18320 1732 821 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_18320 3486 1840 gene locus_tag LOCUS_18330 3486 1840 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_18330 4313 4675 gene locus_tag LOCUS_18340 4313 4675 CDS product DUF1830 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057308.1 protein_id gnl|my_center|LOCUS_18340 4679 6124 gene locus_tag LOCUS_18350 4679 6124 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946526.1 protein_id gnl|my_center|LOCUS_18350 6733 6212 gene locus_tag LOCUS_18360 6733 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 6815 7720 gene locus_tag LOCUS_18370 6815 7720 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905132.1 protein_id gnl|my_center|LOCUS_18370 7963 7775 gene locus_tag LOCUS_18380 7963 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 8438 7920 gene locus_tag LOCUS_18390 8438 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 9438 8431 gene locus_tag LOCUS_18400 9438 8431 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_18400 9611 10186 gene locus_tag LOCUS_18410 9611 10186 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929081.1 protein_id gnl|my_center|LOCUS_18410 10202 10510 gene locus_tag LOCUS_18420 10202 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence136 <1 570 gene locus_tag LOCUS_18430 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002936357.1:sugar transferase 1450 725 gene locus_tag LOCUS_18440 1450 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1959 1783 gene locus_tag LOCUS_18450 1959 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2538 2080 gene locus_tag LOCUS_18460 2538 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3260 2646 gene locus_tag LOCUS_18470 3260 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 3498 3379 gene locus_tag LOCUS_18480 3498 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3923 4480 gene locus_tag LOCUS_18490 3923 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 4906 5151 gene locus_tag LOCUS_18500 4906 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 5346 7673 gene locus_tag LOCUS_18510 5346 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 9121 7730 gene locus_tag LOCUS_18520 gene argH 9121 7730 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056221.1 protein_id gnl|my_center|LOCUS_18520 9938 9693 gene locus_tag LOCUS_18530 9938 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence137 320 180 gene locus_tag LOCUS_18540 320 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 552 1778 gene locus_tag LOCUS_18550 552 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2877 2689 gene locus_tag LOCUS_18560 2877 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2885 3091 gene locus_tag LOCUS_18570 2885 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3407 3634 gene locus_tag LOCUS_18580 3407 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 5973 3697 gene locus_tag LOCUS_18590 5973 3697 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798165.1 protein_id gnl|my_center|LOCUS_18590 6042 6839 gene locus_tag LOCUS_18600 6042 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 7948 6935 gene locus_tag LOCUS_18610 7948 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 8100 8891 gene locus_tag LOCUS_18620 8100 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 8928 9221 gene locus_tag LOCUS_18630 8928 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 9528 9749 gene locus_tag LOCUS_18640 9528 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence138 1758 58 gene locus_tag LOCUS_18650 1758 58 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_18650 3734 2106 gene locus_tag LOCUS_18660 3734 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 4536 3715 gene locus_tag LOCUS_18670 4536 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 5281 6522 gene locus_tag LOCUS_18680 5281 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 6536 7684 gene locus_tag LOCUS_18690 6536 7684 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_18690 7889 10522 gene locus_tag LOCUS_18700 7889 10522 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence139 2134 140 gene locus_tag LOCUS_18710 2134 140 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_18710 2892 2185 gene locus_tag LOCUS_18720 2892 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 3669 2944 gene locus_tag LOCUS_18730 3669 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 4654 3794 gene locus_tag LOCUS_18740 4654 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 7127 4776 gene locus_tag LOCUS_18750 7127 4776 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_18750 7358 7137 gene locus_tag LOCUS_18760 7358 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 7599 8507 gene locus_tag LOCUS_18770 7599 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 8607 10298 gene locus_tag LOCUS_18780 8607 10298 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088894694.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence140 735 46 gene locus_tag LOCUS_18790 735 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18790 1338 763 gene locus_tag LOCUS_18800 1338 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2301 1378 gene locus_tag LOCUS_18810 2301 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 3890 2376 gene locus_tag LOCUS_18820 3890 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4571 3894 gene locus_tag LOCUS_18830 4571 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 6598 4664 gene locus_tag LOCUS_18840 gene gyrB 6598 4664 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056494.1 protein_id gnl|my_center|LOCUS_18840 7201 6845 gene locus_tag LOCUS_18850 7201 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 7399 7914 gene locus_tag LOCUS_18860 gene ruvC 7399 7914 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190407846.1 protein_id gnl|my_center|LOCUS_18860 9927 8443 gene locus_tag LOCUS_18870 9927 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence141 <1 1408 gene locus_tag LOCUS_18880 <1 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056229.1:protoporphyrinogen oxidase 2655 1459 gene locus_tag LOCUS_18890 2655 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2866 5775 gene locus_tag LOCUS_18900 2866 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 5781 6761 gene locus_tag LOCUS_18910 5781 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence142 115 1725 gene locus_tag LOCUS_18920 115 1725 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143791.1 protein_id gnl|my_center|LOCUS_18920 1967 2443 gene locus_tag LOCUS_18930 1967 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2503 7362 gene locus_tag LOCUS_18940 2503 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 7388 7798 gene locus_tag LOCUS_18950 7388 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 9114 7927 gene locus_tag LOCUS_18960 9114 7927 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 protein_id gnl|my_center|LOCUS_18960 10237 9116 gene locus_tag LOCUS_18970 gene dusB 10237 9116 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207350.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence143 1998 745 gene locus_tag LOCUS_18980 1998 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 3092 2127 gene locus_tag LOCUS_18990 3092 2127 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_18990 3875 3105 gene locus_tag LOCUS_19000 3875 3105 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_19000 5034 3946 gene locus_tag LOCUS_19010 5034 3946 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_19010 6233 5124 gene locus_tag LOCUS_19020 6233 5124 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_19020 7122 6265 gene locus_tag LOCUS_19030 7122 6265 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226033.1 protein_id gnl|my_center|LOCUS_19030 8032 7151 gene locus_tag LOCUS_19040 8032 7151 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112661.1 protein_id gnl|my_center|LOCUS_19040 9270 8122 gene locus_tag LOCUS_19050 9270 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 <10160 9481 gene locus_tag LOCUS_19060 <10160 9481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947342.1:ABC transporter ATP-binding protein >Feature sequence144 241 1683 gene locus_tag LOCUS_19070 gene cysS 241 1683 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920936.1 protein_id gnl|my_center|LOCUS_19070 1991 4225 gene locus_tag LOCUS_19080 1991 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 4722 4273 gene locus_tag LOCUS_19090 4722 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 4939 4757 gene locus_tag LOCUS_19100 4939 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 5425 5697 gene locus_tag LOCUS_19110 5425 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 5909 6805 gene locus_tag LOCUS_19120 5909 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 8274 6946 gene locus_tag LOCUS_19130 8274 6946 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 protein_id gnl|my_center|LOCUS_19130 <10103 8814 gene locus_tag LOCUS_19140 <10103 8814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339591.1:DNA cytosine methyltransferase >Feature sequence145 18 1139 gene locus_tag LOCUS_19150 18 1139 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929514.1 protein_id gnl|my_center|LOCUS_19150 1714 1319 gene locus_tag LOCUS_19160 1714 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1873 3195 gene locus_tag LOCUS_19170 1873 3195 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144015.1 protein_id gnl|my_center|LOCUS_19170 3265 6528 gene locus_tag LOCUS_19180 3265 6528 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144016.1 protein_id gnl|my_center|LOCUS_19180 7060 9870 gene locus_tag LOCUS_19190 gene secA 7060 9870 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057688.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence146 378 4874 gene locus_tag LOCUS_19200 378 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5007 5423 gene locus_tag LOCUS_19210 5007 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 5455 6348 gene locus_tag LOCUS_19220 5455 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142558.1 protein_id gnl|my_center|LOCUS_19220 7223 6543 gene locus_tag LOCUS_19230 7223 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 7787 7260 gene locus_tag LOCUS_19240 7787 7260 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 protein_id gnl|my_center|LOCUS_19240 8856 8212 gene locus_tag LOCUS_19250 8856 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 9044 8871 gene locus_tag LOCUS_19260 9044 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 9510 9082 gene locus_tag LOCUS_19270 gene rpsK 9510 9082 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906297.1 protein_id gnl|my_center|LOCUS_19270 9873 9532 gene locus_tag LOCUS_19280 gene rpsM 9873 9532 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421125.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence147 907 2 gene locus_tag LOCUS_19290 gene potB 907 2 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715491.1 protein_id gnl|my_center|LOCUS_19290 1932 910 gene locus_tag LOCUS_19300 1932 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2848 2327 gene locus_tag LOCUS_19310 2848 2327 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141192.1 protein_id gnl|my_center|LOCUS_19310 3720 2971 gene locus_tag LOCUS_19320 3720 2971 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057799.1 protein_id gnl|my_center|LOCUS_19320 4015 4926 gene locus_tag LOCUS_19330 4015 4926 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141217.1 protein_id gnl|my_center|LOCUS_19330 5906 5025 gene locus_tag LOCUS_19340 gene pstA 5906 5025 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_19340 6967 6008 gene locus_tag LOCUS_19350 gene pstC 6967 6008 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_19350 8232 7096 gene locus_tag LOCUS_19360 gene pstS 8232 7096 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_19360 9134 9922 gene locus_tag LOCUS_19370 gene pstB 9134 9922 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence148 1905 3251 gene locus_tag LOCUS_19380 gene nifB 1905 3251 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_19380 3507 4712 gene locus_tag LOCUS_19390 gene nifS 3507 4712 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_19390 4801 5685 gene locus_tag LOCUS_19400 gene nifU 4801 5685 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_19400 5967 6866 gene locus_tag LOCUS_19410 gene nifH 5967 6866 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533491.1 protein_id gnl|my_center|LOCUS_19410 6946 8451 gene locus_tag LOCUS_19420 gene nifD 6946 8451 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence149 1623 3284 gene locus_tag LOCUS_19430 1623 3284 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124960.1 protein_id gnl|my_center|LOCUS_19430 3442 3744 gene locus_tag LOCUS_19440 3442 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4008 6743 gene locus_tag LOCUS_19450 4008 6743 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141077.1 protein_id gnl|my_center|LOCUS_19450 7189 8391 gene locus_tag LOCUS_19460 gene sat 7189 8391 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_19460 8470 8718 gene locus_tag LOCUS_19470 8470 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 <9885 8887 gene locus_tag LOCUS_19480 <9885 8887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140747.1:polysaccharide pyruvyl transferase CsaB >Feature sequence150 5833 3215 gene locus_tag LOCUS_19490 5833 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 8274 5902 gene locus_tag LOCUS_19500 8274 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 8899 8366 gene locus_tag LOCUS_19510 8899 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 9347 8913 gene locus_tag LOCUS_19520 9347 8913 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_19520 9717 9349 gene locus_tag LOCUS_19530 9717 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence151 680 1015 gene locus_tag LOCUS_19540 680 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 1214 1296 gene locus_tag LOCUS_t00270 1214 1296 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1471 1821 gene locus_tag LOCUS_19550 1471 1821 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359675.1 protein_id gnl|my_center|LOCUS_19550 2612 2148 gene locus_tag LOCUS_19560 2612 2148 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_19560 4126 2609 gene locus_tag LOCUS_19570 gene purF 4126 2609 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142112.1 protein_id gnl|my_center|LOCUS_19570 4646 5302 gene locus_tag LOCUS_19580 4646 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926920.1 protein_id gnl|my_center|LOCUS_19580 5559 6602 gene locus_tag LOCUS_19590 gene glpX 5559 6602 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057116.1 protein_id gnl|my_center|LOCUS_19590 6789 8090 gene locus_tag LOCUS_19600 6789 8090 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057575.1 protein_id gnl|my_center|LOCUS_19600 8364 8807 gene locus_tag LOCUS_19610 8364 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 9791 9408 gene locus_tag LOCUS_19620 9791 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence152 162 602 gene locus_tag LOCUS_19630 162 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1433 744 gene locus_tag LOCUS_19640 1433 744 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_19640 2849 1563 gene locus_tag LOCUS_19650 2849 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 5704 2975 gene locus_tag LOCUS_19660 5704 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 <9722 5733 gene locus_tag LOCUS_19670 <9722 5733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase >Feature sequence153 1473 103 gene locus_tag LOCUS_19680 1473 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1775 2185 gene locus_tag LOCUS_19690 1775 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2288 2803 gene locus_tag LOCUS_19700 2288 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2950 2783 gene locus_tag LOCUS_19710 2950 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 4200 3184 gene locus_tag LOCUS_19720 4200 3184 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_19720 5175 4303 gene locus_tag LOCUS_19730 5175 4303 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_19730 5683 5228 gene locus_tag LOCUS_19740 5683 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 7139 5715 gene locus_tag LOCUS_19750 gene ffh 7139 5715 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057808.1 protein_id gnl|my_center|LOCUS_19750 8395 7235 gene locus_tag LOCUS_19760 8395 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 8783 8637 gene locus_tag LOCUS_19770 8783 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 9267 8809 gene locus_tag LOCUS_19780 9267 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 9626 9441 gene locus_tag LOCUS_19790 9626 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence154 1767 172 gene locus_tag LOCUS_19800 1767 172 CDS product FAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020815.1 protein_id gnl|my_center|LOCUS_19800 3274 1937 gene locus_tag LOCUS_19810 gene clpX 3274 1937 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056361.1 protein_id gnl|my_center|LOCUS_19810 3891 3292 gene locus_tag LOCUS_19820 gene clpP 3891 3292 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_19820 5545 4133 gene locus_tag LOCUS_19830 gene tig 5545 4133 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144179.1 protein_id gnl|my_center|LOCUS_19830 6196 5798 gene locus_tag LOCUS_19840 6196 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 6340 7491 gene locus_tag LOCUS_19850 6340 7491 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920975.1 protein_id gnl|my_center|LOCUS_19850 7978 7601 gene locus_tag LOCUS_19860 7978 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 8294 7950 gene locus_tag LOCUS_19870 8294 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 <9671 8346 gene locus_tag LOCUS_19880 <9671 8346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056087.1:C-3',4' desaturase CrtD >Feature sequence155 302 523 gene locus_tag LOCUS_19890 302 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1466 600 gene locus_tag LOCUS_19900 1466 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2741 1575 gene locus_tag LOCUS_19910 2741 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 4433 2934 gene locus_tag LOCUS_19920 4433 2934 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_19920 5766 4660 gene locus_tag LOCUS_19930 gene prfA 5766 4660 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056003.1 protein_id gnl|my_center|LOCUS_19930 6100 5864 gene locus_tag LOCUS_19940 gene rpmE 6100 5864 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125833.1 protein_id gnl|my_center|LOCUS_19940 6753 6256 gene locus_tag LOCUS_19950 6753 6256 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_19950 7107 7823 gene locus_tag LOCUS_19960 7107 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057518.1 protein_id gnl|my_center|LOCUS_19960 9280 7853 gene locus_tag LOCUS_19970 9280 7853 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345479.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence156 1237 116 gene locus_tag LOCUS_19980 gene ribD 1237 116 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057986.1 protein_id gnl|my_center|LOCUS_19980 3908 1245 gene locus_tag LOCUS_19990 3908 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 6236 3978 gene locus_tag LOCUS_20000 6236 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 8050 6500 gene locus_tag LOCUS_20010 8050 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 8443 8186 gene locus_tag LOCUS_20020 8443 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence157 <1 1059 gene locus_tag LOCUS_20030 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein 1066 1341 gene locus_tag LOCUS_20040 1066 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20040 1311 1562 gene locus_tag LOCUS_20050 1311 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20050 1626 6710 gene locus_tag LOCUS_20060 1626 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077139241.1 protein_id gnl|my_center|LOCUS_20060 6936 7160 gene locus_tag LOCUS_20070 6936 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 7160 7450 gene locus_tag LOCUS_20080 7160 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 7558 7779 gene locus_tag LOCUS_20090 7558 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 9516 8044 gene locus_tag LOCUS_20100 9516 8044 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence158 1214 567 gene locus_tag LOCUS_20110 1214 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 3254 1590 gene locus_tag LOCUS_20120 3254 1590 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_20120 4407 3829 gene locus_tag LOCUS_20130 4407 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 4897 6255 gene locus_tag LOCUS_20140 gene gor 4897 6255 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_20140 7285 6590 gene locus_tag LOCUS_20150 gene surE 7285 6590 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_20150 7576 7358 gene locus_tag LOCUS_20160 7576 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 7719 7967 gene locus_tag LOCUS_20170 7719 7967 CDS product Ycf34 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_20170 8277 9221 gene locus_tag LOCUS_20180 8277 9221 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403590.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence159 606 1628 gene locus_tag LOCUS_20190 gene hemF 606 1628 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_20190 2431 2595 gene locus_tag LOCUS_20200 2431 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3108 3809 gene locus_tag LOCUS_20210 3108 3809 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888749.1 protein_id gnl|my_center|LOCUS_20210 3923 5017 gene locus_tag LOCUS_20220 3923 5017 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920638.1 protein_id gnl|my_center|LOCUS_20220 5289 5579 gene locus_tag LOCUS_20230 5289 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 5828 6148 gene locus_tag LOCUS_20240 5828 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056366.1 protein_id gnl|my_center|LOCUS_20240 7340 6219 gene locus_tag LOCUS_20250 7340 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 8978 7449 gene locus_tag LOCUS_20260 gene zwf 8978 7449 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence160 355 59 gene locus_tag LOCUS_20270 355 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1515 397 gene locus_tag LOCUS_20280 1515 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2714 1512 gene locus_tag LOCUS_20290 2714 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3891 3706 gene locus_tag LOCUS_20300 3891 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 7597 4289 gene locus_tag LOCUS_20310 7597 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 7838 7686 gene locus_tag LOCUS_20320 7838 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 8756 8061 gene locus_tag LOCUS_20330 8756 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 8993 8766 gene locus_tag LOCUS_20340 8993 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence161 3347 3730 gene locus_tag LOCUS_20350 3347 3730 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_20350 3846 4253 gene locus_tag LOCUS_20360 3846 4253 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_20360 5003 4350 gene locus_tag LOCUS_20370 gene upp 5003 4350 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920929.1 protein_id gnl|my_center|LOCUS_20370 5686 5126 gene locus_tag LOCUS_20380 5686 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524130.1 protein_id gnl|my_center|LOCUS_20380 6768 5683 gene locus_tag LOCUS_20390 6768 5683 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_20390 7057 7404 gene locus_tag LOCUS_20400 7057 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 7421 8680 gene locus_tag LOCUS_20410 7421 8680 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence162 2115 2354 gene locus_tag LOCUS_20420 2115 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2856 2422 gene locus_tag LOCUS_20430 2856 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4898 2886 gene locus_tag LOCUS_20440 4898 2886 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140570.1 protein_id gnl|my_center|LOCUS_20440 6646 5264 gene locus_tag LOCUS_20450 6646 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 7779 6706 gene locus_tag LOCUS_20460 7779 6706 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_20460 9116 7827 gene locus_tag LOCUS_20470 9116 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence163 282 1856 gene locus_tag LOCUS_20480 282 1856 CDS product bifunctional pantoate--beta-alanine ligase/(d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058282.1 protein_id gnl|my_center|LOCUS_20480 1853 2428 gene locus_tag LOCUS_20490 1853 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2537 3265 gene locus_tag LOCUS_20500 gene lptB 2537 3265 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045053120.1 protein_id gnl|my_center|LOCUS_20500 3447 4556 gene locus_tag LOCUS_20510 3447 4556 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_20510 5295 4663 gene locus_tag LOCUS_20520 5295 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 5584 7812 gene locus_tag LOCUS_20530 5584 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence164 262 110 gene locus_tag LOCUS_20540 262 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 439 699 gene locus_tag LOCUS_20550 439 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1062 880 gene locus_tag LOCUS_20560 1062 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 1515 2462 gene locus_tag LOCUS_20570 1515 2462 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_20570 2859 2548 gene locus_tag LOCUS_20580 2859 2548 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 protein_id gnl|my_center|LOCUS_20580 3426 3058 gene locus_tag LOCUS_20590 3426 3058 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125933.1 protein_id gnl|my_center|LOCUS_20590 6202 3482 gene locus_tag LOCUS_20600 gene gyrA 6202 3482 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142048.1 protein_id gnl|my_center|LOCUS_20600 7056 6472 gene locus_tag LOCUS_20610 7056 6472 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_20610 7349 7074 gene locus_tag LOCUS_20620 7349 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 8206 7412 gene locus_tag LOCUS_20630 8206 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20630 8553 8290 gene locus_tag LOCUS_20640 8553 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 9047 8568 gene locus_tag LOCUS_20650 9047 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence165 1149 22 gene locus_tag LOCUS_20660 1149 22 CDS product ISAs1-like element ISEc1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014966182.1 protein_id gnl|my_center|LOCUS_20660 1312 1542 gene locus_tag LOCUS_20670 1312 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1660 5127 gene locus_tag LOCUS_20680 gene mfd 1660 5127 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056796.1 protein_id gnl|my_center|LOCUS_20680 5338 7119 gene locus_tag LOCUS_20690 5338 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 7207 7953 gene locus_tag LOCUS_20700 7207 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 8011 8517 gene locus_tag LOCUS_20710 8011 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 8899 8549 gene locus_tag LOCUS_20720 8899 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence166 1975 4134 gene locus_tag LOCUS_20730 1975 4134 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920783.1 protein_id gnl|my_center|LOCUS_20730 5488 4283 gene locus_tag LOCUS_20740 5488 4283 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143975.1 protein_id gnl|my_center|LOCUS_20740 5373 5591 gene locus_tag LOCUS_20750 5373 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 6762 5776 gene locus_tag LOCUS_20760 gene chlG 6762 5776 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920891.1 protein_id gnl|my_center|LOCUS_20760 7454 6813 gene locus_tag LOCUS_20770 7454 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 8764 7451 gene locus_tag LOCUS_20780 8764 7451 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence167 1431 703 gene locus_tag LOCUS_20790 1431 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2399 1431 gene locus_tag LOCUS_20800 gene arsM 2399 1431 CDS product arsenosugar biosynthesis arsenite methyltransferase ArsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_20800 4372 2816 gene locus_tag LOCUS_20810 4372 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 5100 4681 gene locus_tag LOCUS_20820 5100 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_20820 5703 6293 gene locus_tag LOCUS_20830 5703 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 7736 6396 gene locus_tag LOCUS_20840 7736 6396 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058262.1 protein_id gnl|my_center|LOCUS_20840 8766 7942 gene locus_tag LOCUS_20850 8766 7942 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974966.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence168 2159 252 gene locus_tag LOCUS_20860 2159 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2540 4549 gene locus_tag LOCUS_20870 2540 4549 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583579.1 protein_id gnl|my_center|LOCUS_20870 5999 4611 gene locus_tag LOCUS_20880 gene sufD 5999 4611 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_20880 6781 5999 gene locus_tag LOCUS_20890 gene sufC 6781 5999 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_20890 7263 6826 gene locus_tag LOCUS_20900 7263 6826 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142568.1 protein_id gnl|my_center|LOCUS_20900 7707 7282 gene locus_tag LOCUS_20910 7707 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 <8982 7755 gene locus_tag LOCUS_20920 <8982 7755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056341.1:Fe-S cluster assembly protein SufB >Feature sequence169 462 289 gene locus_tag LOCUS_20930 462 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 764 537 gene locus_tag LOCUS_20940 764 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 979 761 gene locus_tag LOCUS_20950 979 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1142 972 gene locus_tag LOCUS_20960 1142 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3940 1352 gene locus_tag LOCUS_20970 3940 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4170 3937 gene locus_tag LOCUS_20980 4170 3937 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079902.1 protein_id gnl|my_center|LOCUS_20980 4400 4191 gene locus_tag LOCUS_20990 4400 4191 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083352.1 protein_id gnl|my_center|LOCUS_20990 4843 4415 gene locus_tag LOCUS_21000 4843 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 6607 5087 gene locus_tag LOCUS_21010 6607 5087 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142080.1 protein_id gnl|my_center|LOCUS_21010 8560 6689 gene locus_tag LOCUS_21020 8560 6689 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence170 487 281 gene locus_tag LOCUS_21030 487 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1017 652 gene locus_tag LOCUS_21040 1017 652 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803775.1 protein_id gnl|my_center|LOCUS_21040 2387 1086 gene locus_tag LOCUS_21050 2387 1086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252323.1 protein_id gnl|my_center|LOCUS_21050 2914 2411 gene locus_tag LOCUS_21060 2914 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 3842 2979 gene locus_tag LOCUS_21070 3842 2979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931877.1 protein_id gnl|my_center|LOCUS_21070 4662 3799 gene locus_tag LOCUS_21080 4662 3799 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931878.1 protein_id gnl|my_center|LOCUS_21080 5283 5038 gene locus_tag LOCUS_21090 5283 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21090 5814 6665 gene locus_tag LOCUS_21100 gene dmeF 5814 6665 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975930.1 protein_id gnl|my_center|LOCUS_21100 6996 7868 gene locus_tag LOCUS_21110 6996 7868 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140079.1 protein_id gnl|my_center|LOCUS_21110 8579 8421 gene locus_tag LOCUS_21120 8579 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 8521 8835 gene locus_tag LOCUS_21130 8521 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence171 4602 4273 gene locus_tag LOCUS_21140 4602 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 4786 4586 gene locus_tag LOCUS_21150 4786 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 5421 5212 gene locus_tag LOCUS_21160 5421 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 8443 5693 gene locus_tag LOCUS_21170 8443 5693 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928590.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence172 206 1204 gene locus_tag LOCUS_21180 206 1204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_21180 2206 1268 gene locus_tag LOCUS_21190 2206 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3562 2669 gene locus_tag LOCUS_21200 3562 2669 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_21200 4383 3475 gene locus_tag LOCUS_21210 4383 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 4934 4428 gene locus_tag LOCUS_21220 4934 4428 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_21220 5180 6094 gene locus_tag LOCUS_21230 5180 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 6834 6139 gene locus_tag LOCUS_21240 6834 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 6971 8113 gene locus_tag LOCUS_21250 6971 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence173 994 647 gene locus_tag LOCUS_21260 994 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2873 1509 gene locus_tag LOCUS_21270 2873 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 4414 2870 gene locus_tag LOCUS_21280 4414 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 6348 4408 gene locus_tag LOCUS_21290 6348 4408 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030148.1 protein_id gnl|my_center|LOCUS_21290 7315 6356 gene locus_tag LOCUS_21300 7315 6356 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033516.1 protein_id gnl|my_center|LOCUS_21300 7792 7322 gene locus_tag LOCUS_21310 7792 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 8241 7900 gene locus_tag LOCUS_21320 8241 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence174 178 843 gene locus_tag LOCUS_21330 178 843 CDS product DUF4033 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920954.1 protein_id gnl|my_center|LOCUS_21330 2951 1353 gene locus_tag LOCUS_21340 2951 1353 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704133.1 protein_id gnl|my_center|LOCUS_21340 3581 8077 gene locus_tag LOCUS_21350 3581 8077 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057482.1 protein_id gnl|my_center|LOCUS_21350 <8644 8136 gene locus_tag LOCUS_21360 <8644 8136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119731.1:cupin domain-containing protein >Feature sequence175 668 150 gene locus_tag LOCUS_21370 668 150 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921042.1 protein_id gnl|my_center|LOCUS_21370 1032 1105 gene locus_tag LOCUS_t00280 1032 1105 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1214 2296 gene locus_tag LOCUS_21380 gene aroC 1214 2296 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_21380 2794 2453 gene locus_tag LOCUS_21390 gene psb28 2794 2453 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920702.1 protein_id gnl|my_center|LOCUS_21390 3910 3044 gene locus_tag LOCUS_21400 3910 3044 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 protein_id gnl|my_center|LOCUS_21400 3935 6970 gene locus_tag LOCUS_21410 3935 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 6974 7420 gene locus_tag LOCUS_21420 6974 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 <8623 7460 gene locus_tag LOCUS_21430 <8623 7460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056280.1:deoxyribodipyrimidine photo-lyase, 8-HDF type >Feature sequence176 <1 595 gene locus_tag LOCUS_21440 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005679031.1:ADP-ribosylglycohydrolase family protein 629 2497 gene locus_tag LOCUS_21450 629 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2517 3569 gene locus_tag LOCUS_21460 2517 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3597 3758 gene locus_tag LOCUS_21470 3597 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 3970 4743 gene locus_tag LOCUS_21480 3970 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 4862 5356 gene locus_tag LOCUS_21490 4862 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 6962 5487 gene locus_tag LOCUS_21500 6962 5487 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 protein_id gnl|my_center|LOCUS_21500 7163 7708 gene locus_tag LOCUS_21510 7163 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 8380 7787 gene locus_tag LOCUS_21520 8380 7787 CDS product PAP/fibrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence177 442 978 gene locus_tag LOCUS_21530 442 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 1300 1064 gene locus_tag LOCUS_21540 1300 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1987 1499 gene locus_tag LOCUS_21550 gene accB 1987 1499 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141286.1 protein_id gnl|my_center|LOCUS_21550 2548 1988 gene locus_tag LOCUS_21560 gene efp 2548 1988 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057134.1 protein_id gnl|my_center|LOCUS_21560 2708 3025 gene locus_tag LOCUS_21570 gene trxA 2708 3025 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921014.1 protein_id gnl|my_center|LOCUS_21570 4169 3075 gene locus_tag LOCUS_21580 4169 3075 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124643.1 protein_id gnl|my_center|LOCUS_21580 4223 4720 gene locus_tag LOCUS_21590 4223 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 5380 5036 gene locus_tag LOCUS_21600 5380 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975312.1 protein_id gnl|my_center|LOCUS_21600 6007 5432 gene locus_tag LOCUS_21610 6007 5432 CDS product DUF6272 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387862.1 protein_id gnl|my_center|LOCUS_21610 6185 6397 gene locus_tag LOCUS_21620 6185 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141741.1 protein_id gnl|my_center|LOCUS_21620 6628 7422 gene locus_tag LOCUS_21630 gene trpA 6628 7422 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056294.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence178 1810 2178 gene locus_tag LOCUS_21640 1810 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4335 2347 gene locus_tag LOCUS_21650 4335 2347 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 protein_id gnl|my_center|LOCUS_21650 5824 4970 gene locus_tag LOCUS_21660 gene menA 5824 4970 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592656.1 protein_id gnl|my_center|LOCUS_21660 6078 7517 gene locus_tag LOCUS_21670 gene pds 6078 7517 CDS product 15-cis-phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057401.1 protein_id gnl|my_center|LOCUS_21670 7522 8409 gene locus_tag LOCUS_21680 7522 8409 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence179 2719 1973 gene locus_tag LOCUS_21690 2719 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3431 2721 gene locus_tag LOCUS_21700 3431 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 4548 3436 gene locus_tag LOCUS_21710 gene pilM 4548 3436 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921030.1 protein_id gnl|my_center|LOCUS_21710 5430 4987 gene locus_tag LOCUS_21720 5430 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 6718 5666 gene locus_tag LOCUS_21730 gene prfB 6718 5666 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126988096.1 protein_id gnl|my_center|LOCUS_21730 7171 7569 gene locus_tag LOCUS_21740 7171 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 7718 8065 gene locus_tag LOCUS_21750 7718 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence180 1198 191 gene locus_tag LOCUS_21760 1198 191 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_21760 1728 2474 gene locus_tag LOCUS_21770 1728 2474 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048869675.1 protein_id gnl|my_center|LOCUS_21770 2972 3136 gene locus_tag LOCUS_21780 2972 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 3105 3413 gene locus_tag LOCUS_21790 3105 3413 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056791.1 protein_id gnl|my_center|LOCUS_21790 3566 3907 gene locus_tag LOCUS_21800 3566 3907 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_21800 4048 4356 gene locus_tag LOCUS_21810 4048 4356 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_21810 4486 6516 gene locus_tag LOCUS_21820 4486 6516 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171949.1 protein_id gnl|my_center|LOCUS_21820 6664 7521 gene locus_tag LOCUS_21830 6664 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 8096 8275 gene locus_tag LOCUS_21840 8096 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence181 941 144 gene locus_tag LOCUS_21850 941 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 1225 983 gene locus_tag LOCUS_21860 1225 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2047 1487 gene locus_tag LOCUS_21870 2047 1487 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_21870 2229 2825 gene locus_tag LOCUS_21880 2229 2825 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117372.1 protein_id gnl|my_center|LOCUS_21880 2878 3423 gene locus_tag LOCUS_21890 2878 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3562 4155 gene locus_tag LOCUS_21900 3562 4155 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090559.1 protein_id gnl|my_center|LOCUS_21900 4158 4838 gene locus_tag LOCUS_21910 4158 4838 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_21910 4846 5271 gene locus_tag LOCUS_21920 4846 5271 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103775.1 protein_id gnl|my_center|LOCUS_21920 5804 5601 gene locus_tag LOCUS_21930 5804 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 6298 7323 gene locus_tag LOCUS_21940 6298 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence182 583 1095 gene locus_tag LOCUS_21950 gene moaC 583 1095 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971801.1 protein_id gnl|my_center|LOCUS_21950 1351 1157 gene locus_tag LOCUS_21960 1351 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1576 4158 gene locus_tag LOCUS_21970 1576 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 4538 6277 gene locus_tag LOCUS_21980 4538 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 6406 7476 gene locus_tag LOCUS_21990 gene gmd 6406 7476 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_21990 <8468 7829 gene locus_tag LOCUS_22000 <8468 7829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058257.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN >Feature sequence183 600 34 gene locus_tag LOCUS_22010 600 34 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009627764.1 protein_id gnl|my_center|LOCUS_22010 1065 640 gene locus_tag LOCUS_22020 1065 640 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_22020 1315 1509 gene locus_tag LOCUS_22030 gene psbH 1315 1509 CDS product photosystem II reaction center protein PsbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057226.1 protein_id gnl|my_center|LOCUS_22030 1636 1938 gene locus_tag LOCUS_22040 1636 1938 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057225.1 protein_id gnl|my_center|LOCUS_22040 1931 2575 gene locus_tag LOCUS_22050 gene pth 1931 2575 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_22050 2733 3875 gene locus_tag LOCUS_22060 2733 3875 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_22060 5396 3933 gene locus_tag LOCUS_22070 5396 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 6622 5477 gene locus_tag LOCUS_22080 6622 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 7530 6700 gene locus_tag LOCUS_22090 gene murI 7530 6700 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056314.1 protein_id gnl|my_center|LOCUS_22090 7720 8238 gene locus_tag LOCUS_22100 7720 8238 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921201.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence184 <1 600 gene locus_tag LOCUS_22110 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125013.1:phosphoribulokinase 1257 625 gene locus_tag LOCUS_22120 gene hisG 1257 625 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056035.1 protein_id gnl|my_center|LOCUS_22120 1488 2087 gene locus_tag LOCUS_22130 1488 2087 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_22130 2181 2966 gene locus_tag LOCUS_22140 2181 2966 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920882.1 protein_id gnl|my_center|LOCUS_22140 4073 3009 gene locus_tag LOCUS_22150 4073 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 6520 4292 gene locus_tag LOCUS_22160 gene psaB 6520 4292 CDS product photosystem I core protein PsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056579.1 protein_id gnl|my_center|LOCUS_22160 <8436 6546 gene locus_tag LOCUS_22170 <8436 6546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920748.1:photosystem I core protein PsaA >Feature sequence185 177 1499 gene locus_tag LOCUS_22180 177 1499 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_22180 1671 2036 gene locus_tag LOCUS_22190 1671 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2041 2322 gene locus_tag LOCUS_22200 2041 2322 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125139.1 protein_id gnl|my_center|LOCUS_22200 2469 3803 gene locus_tag LOCUS_22210 2469 3803 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_22210 3884 5320 gene locus_tag LOCUS_22220 3884 5320 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190570100.1 protein_id gnl|my_center|LOCUS_22220 5614 6162 gene locus_tag LOCUS_22230 5614 6162 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056062.1 protein_id gnl|my_center|LOCUS_22230 6646 7095 gene locus_tag LOCUS_22240 6646 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 8417 7269 gene locus_tag LOCUS_22250 8417 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence186 <1 978 gene locus_tag LOCUS_22260 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535402.1:8-oxoguanine deaminase 1273 1345 gene locus_tag LOCUS_t00290 1273 1345 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1435 2523 gene locus_tag LOCUS_22270 1435 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2803 2612 gene locus_tag LOCUS_22280 2803 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3736 2828 gene locus_tag LOCUS_22290 3736 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 5847 3877 gene locus_tag LOCUS_22300 5847 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 6203 5889 gene locus_tag LOCUS_22310 6203 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 6458 6288 gene locus_tag LOCUS_22320 6458 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 6827 7150 gene locus_tag LOCUS_22330 6827 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 7224 7628 gene locus_tag LOCUS_22340 7224 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 7706 8062 gene locus_tag LOCUS_22350 7706 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence187 357 1961 gene locus_tag LOCUS_22360 gene gpmI 357 1961 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056006.1 protein_id gnl|my_center|LOCUS_22360 2197 3030 gene locus_tag LOCUS_22370 2197 3030 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_22370 3240 3956 gene locus_tag LOCUS_22380 3240 3956 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056362.1 protein_id gnl|my_center|LOCUS_22380 4182 6539 gene locus_tag LOCUS_22390 4182 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 7223 8368 gene locus_tag LOCUS_22400 7223 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence188 1446 313 gene locus_tag LOCUS_22410 1446 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2848 1883 gene locus_tag LOCUS_22420 2848 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3868 2906 gene locus_tag LOCUS_22430 gene gshB 3868 2906 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_22430 7028 4182 gene locus_tag LOCUS_22440 7028 4182 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524115.1 protein_id gnl|my_center|LOCUS_22440 7371 8003 gene locus_tag LOCUS_22450 7371 8003 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence189 542 2005 gene locus_tag LOCUS_22460 542 2005 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_22460 2206 2589 gene locus_tag LOCUS_22470 2206 2589 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_22470 2590 3864 gene locus_tag LOCUS_22480 2590 3864 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_22480 3972 4769 gene locus_tag LOCUS_22490 3972 4769 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057328.1 protein_id gnl|my_center|LOCUS_22490 6096 4828 gene locus_tag LOCUS_22500 6096 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 6693 6142 gene locus_tag LOCUS_22510 6693 6142 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057324.1 protein_id gnl|my_center|LOCUS_22510 8354 6690 gene locus_tag LOCUS_22520 8354 6690 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141648.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence190 2400 313 gene locus_tag LOCUS_22530 2400 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 6827 2406 gene locus_tag LOCUS_22540 6827 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 <8342 6827 gene locus_tag LOCUS_22550 <8342 6827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968589.1:DUF11 domain-containing protein >Feature sequence191 2011 1190 gene locus_tag LOCUS_22560 2011 1190 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_22560 2324 2016 gene locus_tag LOCUS_22570 2324 2016 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_22570 2994 2311 gene locus_tag LOCUS_22580 2994 2311 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328512.1 protein_id gnl|my_center|LOCUS_22580 3289 2984 gene locus_tag LOCUS_22590 3289 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3596 4294 gene locus_tag LOCUS_22600 3596 4294 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 protein_id gnl|my_center|LOCUS_22600 4355 6790 gene locus_tag LOCUS_22610 4355 6790 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120163.1 protein_id gnl|my_center|LOCUS_22610 6790 7263 gene locus_tag LOCUS_22620 6790 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 7260 8288 gene locus_tag LOCUS_22630 7260 8288 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038292.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence192 <1 635 gene locus_tag LOCUS_22640 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081403079.1:formylglycine-generating enzyme family protein 828 1118 gene locus_tag LOCUS_22650 828 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1102 1428 gene locus_tag LOCUS_22660 1102 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1455 2171 gene locus_tag LOCUS_22670 1455 2171 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_22670 2247 3026 gene locus_tag LOCUS_22680 2247 3026 CDS product DUF3120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190832035.1 protein_id gnl|my_center|LOCUS_22680 4574 3213 gene locus_tag LOCUS_22690 4574 3213 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_22690 5016 5345 gene locus_tag LOCUS_22700 gene trxA 5016 5345 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_22700 5674 6222 gene locus_tag LOCUS_22710 gene pyrR 5674 6222 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921232.1 protein_id gnl|my_center|LOCUS_22710 7024 6266 gene locus_tag LOCUS_22720 gene cobM 7024 6266 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141377.1 protein_id gnl|my_center|LOCUS_22720 8170 7124 gene locus_tag LOCUS_22730 gene cbiD 8170 7124 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048868466.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence193 812 1333 gene locus_tag LOCUS_22740 812 1333 CDS product phycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057792.1 protein_id gnl|my_center|LOCUS_22740 1505 1993 gene locus_tag LOCUS_22750 gene cpcA 1505 1993 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_22750 2174 2992 gene locus_tag LOCUS_22760 2174 2992 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057794.1 protein_id gnl|my_center|LOCUS_22760 3105 3971 gene locus_tag LOCUS_22770 3105 3971 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057794.1 protein_id gnl|my_center|LOCUS_22770 4041 4268 gene locus_tag LOCUS_22780 4041 4268 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057795.1 protein_id gnl|my_center|LOCUS_22780 5716 4523 gene locus_tag LOCUS_22790 5716 4523 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_22790 5830 6990 gene locus_tag LOCUS_22800 5830 6990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406250.1 protein_id gnl|my_center|LOCUS_22800 7137 7355 gene locus_tag LOCUS_22810 7137 7355 CDS product DUF2839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_22810 7359 8042 gene locus_tag LOCUS_22820 gene ispD 7359 8042 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056453.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence194 1426 194 gene locus_tag LOCUS_22830 1426 194 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_22830 2054 1566 gene locus_tag LOCUS_22840 2054 1566 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057944.1 protein_id gnl|my_center|LOCUS_22840 2732 2073 gene locus_tag LOCUS_22850 2732 2073 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_22850 3394 3837 gene locus_tag LOCUS_22860 3394 3837 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_22860 4367 3879 gene locus_tag LOCUS_22870 gene ribH 4367 3879 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141044.1 protein_id gnl|my_center|LOCUS_22870 4633 4445 gene locus_tag LOCUS_22880 gene psbZ 4633 4445 CDS product photosystem II reaction center protein PsbZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057802.1 protein_id gnl|my_center|LOCUS_22880 6012 4759 gene locus_tag LOCUS_22890 6012 4759 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140773.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence195 253 591 gene locus_tag LOCUS_22900 253 591 CDS product type II toxin-antitoxin system ChpB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266694.1 protein_id gnl|my_center|LOCUS_22900 636 896 gene locus_tag LOCUS_22910 636 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 958 2064 gene locus_tag LOCUS_22920 958 2064 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524107.1 protein_id gnl|my_center|LOCUS_22920 2570 2130 gene locus_tag LOCUS_22930 2570 2130 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015159351.1 protein_id gnl|my_center|LOCUS_22930 2818 3132 gene locus_tag LOCUS_22940 2818 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3261 3857 gene locus_tag LOCUS_22950 gene clpP 3261 3857 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_22950 3928 5334 gene locus_tag LOCUS_22960 gene glmM 3928 5334 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013191710.1 protein_id gnl|my_center|LOCUS_22960 5451 8135 gene locus_tag LOCUS_22970 5451 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence196 218 1555 gene locus_tag LOCUS_22980 218 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2579 1764 gene locus_tag LOCUS_22990 2579 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 3357 2569 gene locus_tag LOCUS_23000 3357 2569 CDS product AhpC/TSA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 protein_id gnl|my_center|LOCUS_23000 4361 3897 gene locus_tag LOCUS_23010 4361 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 4783 5502 gene locus_tag LOCUS_23020 4783 5502 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_23020 6768 5917 gene locus_tag LOCUS_23030 gene blaOXA 6768 5917 CDS product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 protein_id gnl|my_center|LOCUS_23030 7245 6772 gene locus_tag LOCUS_23040 7245 6772 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545799.1 protein_id gnl|my_center|LOCUS_23040 8182 7277 gene locus_tag LOCUS_23050 8182 7277 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence197 143 2332 gene locus_tag LOCUS_23060 143 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2377 6348 gene locus_tag LOCUS_23070 2377 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 6390 7460 gene locus_tag LOCUS_23080 6390 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 7466 8170 gene locus_tag LOCUS_23090 7466 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence198 1 156 gene locus_tag LOCUS_23100 1 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 2946 535 gene locus_tag LOCUS_23110 2946 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 3140 4021 gene locus_tag LOCUS_23120 3140 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3985 4428 gene locus_tag LOCUS_23130 3985 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 4421 5992 gene locus_tag LOCUS_23140 gene kaiC 4421 5992 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056334.1 protein_id gnl|my_center|LOCUS_23140 6464 6027 gene locus_tag LOCUS_23150 6464 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 7523 6615 gene locus_tag LOCUS_23160 7523 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 7906 7706 gene locus_tag LOCUS_23170 7906 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence199 209 424 gene locus_tag LOCUS_23180 209 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 716 2587 gene locus_tag LOCUS_23190 gene ftsH3 716 2587 CDS product ATP-dependent zinc metalloprotease FtsH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055986.1 protein_id gnl|my_center|LOCUS_23190 2753 2672 gene locus_tag LOCUS_t00300 2753 2672 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3010 3651 gene locus_tag LOCUS_23200 3010 3651 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_23200 4039 3728 gene locus_tag LOCUS_23210 4039 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 4169 4492 gene locus_tag LOCUS_23220 4169 4492 CDS product O-6-alkylguanine-DNA--cysteine-protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174014.1 protein_id gnl|my_center|LOCUS_23220 4550 5422 gene locus_tag LOCUS_23230 gene purU 4550 5422 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_23230 6306 5662 gene locus_tag LOCUS_23240 6306 5662 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 protein_id gnl|my_center|LOCUS_23240 7174 7719 gene locus_tag LOCUS_23250 7174 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence200 1023 445 gene locus_tag LOCUS_23260 1023 445 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_23260 1851 1144 gene locus_tag LOCUS_23270 gene bchM 1851 1144 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 protein_id gnl|my_center|LOCUS_23270 1971 2981 gene locus_tag LOCUS_23280 1971 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3153 4151 gene locus_tag LOCUS_23290 3153 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 4420 4181 gene locus_tag LOCUS_23300 4420 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 4963 5445 gene locus_tag LOCUS_23310 4963 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920753.1 protein_id gnl|my_center|LOCUS_23310 5681 5956 gene locus_tag LOCUS_23320 5681 5956 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_23320 6362 6048 gene locus_tag LOCUS_23330 6362 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 6490 7128 gene locus_tag LOCUS_23340 6490 7128 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957443.1 protein_id gnl|my_center|LOCUS_23340 8002 7256 gene locus_tag LOCUS_23350 gene larB 8002 7256 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057031.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence201 1554 883 gene locus_tag LOCUS_23360 1554 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 3236 1731 gene locus_tag LOCUS_23370 3236 1731 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256890.1 protein_id gnl|my_center|LOCUS_23370 3982 4761 gene locus_tag LOCUS_23380 3982 4761 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_23380 7979 4968 gene locus_tag LOCUS_23390 7979 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence202 470 207 gene locus_tag LOCUS_23400 470 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 958 602 gene locus_tag LOCUS_23410 958 602 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_23410 4163 1134 gene locus_tag LOCUS_23420 4163 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 4509 4177 gene locus_tag LOCUS_23430 4509 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 5127 4726 gene locus_tag LOCUS_23440 5127 4726 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_23440 5381 5130 gene locus_tag LOCUS_23450 5381 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 7736 5493 gene locus_tag LOCUS_23460 7736 5493 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525365.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence203 1304 57 gene locus_tag LOCUS_23470 1304 57 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088243667.1 protein_id gnl|my_center|LOCUS_23470 2407 1382 gene locus_tag LOCUS_23480 2407 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2908 2486 gene locus_tag LOCUS_23490 2908 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 3543 2989 gene locus_tag LOCUS_23500 3543 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 3667 4482 gene locus_tag LOCUS_23510 3667 4482 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140939.1 protein_id gnl|my_center|LOCUS_23510 4947 4615 gene locus_tag LOCUS_23520 4947 4615 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074374.1 protein_id gnl|my_center|LOCUS_23520 5203 4931 gene locus_tag LOCUS_23530 5203 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 6048 5359 gene locus_tag LOCUS_23540 gene rpe 6048 5359 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_23540 6620 6375 gene locus_tag LOCUS_23550 6620 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 6942 6769 gene locus_tag LOCUS_23560 6942 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 7752 7919 gene locus_tag LOCUS_23570 7752 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence204 166 1260 gene locus_tag LOCUS_23580 166 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1393 2031 gene locus_tag LOCUS_23590 1393 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_23590 3746 2382 gene locus_tag LOCUS_23600 3746 2382 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_23600 3912 4850 gene locus_tag LOCUS_23610 3912 4850 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_23610 5989 4997 gene locus_tag LOCUS_23620 gene arsS 5989 4997 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_23620 6584 6018 gene locus_tag LOCUS_23630 6584 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 7842 6685 gene locus_tag LOCUS_23640 7842 6685 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence205 1059 268 gene locus_tag LOCUS_23650 1059 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1907 1341 gene locus_tag LOCUS_23660 1907 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2270 2827 gene locus_tag LOCUS_23670 2270 2827 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057228.1 protein_id gnl|my_center|LOCUS_23670 3095 3847 gene locus_tag LOCUS_23680 3095 3847 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055992.1 protein_id gnl|my_center|LOCUS_23680 4275 3946 gene locus_tag LOCUS_23690 4275 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 4866 4378 gene locus_tag LOCUS_23700 gene coaD 4866 4378 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140849.1 protein_id gnl|my_center|LOCUS_23700 5609 4965 gene locus_tag LOCUS_23710 5609 4965 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157768333.1 protein_id gnl|my_center|LOCUS_23710 6531 5692 gene locus_tag LOCUS_23720 6531 5692 CDS product YaaW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920905.1 protein_id gnl|my_center|LOCUS_23720 7377 6679 gene locus_tag LOCUS_23730 7377 6679 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence206 144 1301 gene locus_tag LOCUS_23740 144 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1298 1720 gene locus_tag LOCUS_23750 1298 1720 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_23750 1753 5910 gene locus_tag LOCUS_23760 1753 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 6843 5953 gene locus_tag LOCUS_23770 6843 5953 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_23770 6900 7652 gene locus_tag LOCUS_23780 gene sfsA 6900 7652 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057534.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence207 256 429 gene locus_tag LOCUS_23790 256 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 1278 592 gene locus_tag LOCUS_23800 1278 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1687 1412 gene locus_tag LOCUS_23810 1687 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920941.1 protein_id gnl|my_center|LOCUS_23810 2000 1680 gene locus_tag LOCUS_23820 2000 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2842 2216 gene locus_tag LOCUS_23830 2842 2216 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057242.1 protein_id gnl|my_center|LOCUS_23830 3805 2954 gene locus_tag LOCUS_23840 gene lgt 3805 2954 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171692.1 protein_id gnl|my_center|LOCUS_23840 5003 3822 gene locus_tag LOCUS_23850 5003 3822 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_23850 5394 7004 gene locus_tag LOCUS_23860 5394 7004 CDS product NAD(P)H-quinone oxidoreductase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057656.1 protein_id gnl|my_center|LOCUS_23860 7360 6932 gene locus_tag LOCUS_23870 7360 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence208 1425 2897 gene locus_tag LOCUS_23880 1425 2897 CDS product folate/biopterin family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 protein_id gnl|my_center|LOCUS_23880 3001 3402 gene locus_tag LOCUS_23890 3001 3402 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816710.1 protein_id gnl|my_center|LOCUS_23890 3627 4535 gene locus_tag LOCUS_23900 3627 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 4561 5283 gene locus_tag LOCUS_23910 4561 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 protein_id gnl|my_center|LOCUS_23910 6321 5317 gene locus_tag LOCUS_23920 6321 5317 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142928.1 protein_id gnl|my_center|LOCUS_23920 6964 6392 gene locus_tag LOCUS_23930 6964 6392 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533494.1 protein_id gnl|my_center|LOCUS_23930 7451 7882 gene locus_tag LOCUS_23940 7451 7882 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence209 1347 514 gene locus_tag LOCUS_23950 1347 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2242 1406 gene locus_tag LOCUS_23960 2242 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 5155 2372 gene locus_tag LOCUS_23970 5155 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 6475 5423 gene locus_tag LOCUS_23980 6475 5423 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 protein_id gnl|my_center|LOCUS_23980 7752 6472 gene locus_tag LOCUS_23990 7752 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence210 1830 7025 gene locus_tag LOCUS_24000 1830 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence211 619 317 gene locus_tag LOCUS_24010 619 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 1145 711 gene locus_tag LOCUS_24020 1145 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 1577 1272 gene locus_tag LOCUS_24030 1577 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2206 2015 gene locus_tag LOCUS_24040 2206 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3015 3692 gene locus_tag LOCUS_24050 3015 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 3604 3840 gene locus_tag LOCUS_24060 3604 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 6747 4153 gene locus_tag LOCUS_24070 6747 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence212 207 1199 gene locus_tag LOCUS_24080 207 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 1642 2625 gene locus_tag LOCUS_24090 1642 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2977 5676 gene locus_tag LOCUS_24100 gene gyrA 2977 5676 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057209.1 protein_id gnl|my_center|LOCUS_24100 6280 5930 gene locus_tag LOCUS_24110 6280 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence213 3 1514 gene locus_tag LOCUS_24120 3 1514 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889437.1 protein_id gnl|my_center|LOCUS_24120 1568 3913 gene locus_tag LOCUS_24130 gene xdhB 1568 3913 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974005.1 protein_id gnl|my_center|LOCUS_24130 3917 4891 gene locus_tag LOCUS_24140 3917 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 5745 4969 gene locus_tag LOCUS_24150 5745 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 6710 5751 gene locus_tag LOCUS_24160 6710 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 7033 7752 gene locus_tag LOCUS_24170 7033 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence214 161 1144 gene locus_tag LOCUS_24180 161 1144 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056689.1 protein_id gnl|my_center|LOCUS_24180 2194 1181 gene locus_tag LOCUS_24190 2194 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 3303 2428 gene locus_tag LOCUS_24200 3303 2428 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 protein_id gnl|my_center|LOCUS_24200 4107 3373 gene locus_tag LOCUS_24210 4107 3373 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_24210 4349 5263 gene locus_tag LOCUS_24220 4349 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 6540 5947 gene locus_tag LOCUS_24230 6540 5947 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 protein_id gnl|my_center|LOCUS_24230 6799 7401 gene locus_tag LOCUS_24240 6799 7401 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence215 4018 644 gene locus_tag LOCUS_24250 4018 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 4152 4502 gene locus_tag LOCUS_24260 4152 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 5176 4571 gene locus_tag LOCUS_24270 5176 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 5261 6586 gene locus_tag LOCUS_24280 5261 6586 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928915.1 protein_id gnl|my_center|LOCUS_24280 6615 7724 gene locus_tag LOCUS_24290 6615 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence216 521 132 gene locus_tag LOCUS_24300 521 132 CDS product nuclease A inhibitor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142296.1 protein_id gnl|my_center|LOCUS_24300 714 1295 gene locus_tag LOCUS_24310 714 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 1602 2867 gene locus_tag LOCUS_24320 1602 2867 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440033.1 protein_id gnl|my_center|LOCUS_24320 2919 4208 gene locus_tag LOCUS_24330 2919 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 4541 5080 gene locus_tag LOCUS_24340 4541 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 5777 5214 gene locus_tag LOCUS_24350 5777 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 6178 6450 gene locus_tag LOCUS_24360 6178 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 6537 7100 gene locus_tag LOCUS_24370 6537 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 7138 7524 gene locus_tag LOCUS_24380 7138 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence217 189 52 gene locus_tag LOCUS_24390 189 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 1303 245 gene locus_tag LOCUS_24400 1303 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1437 1303 gene locus_tag LOCUS_24410 1437 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 3529 1442 gene locus_tag LOCUS_24420 3529 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 6345 3541 gene locus_tag LOCUS_24430 6345 3541 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057320.1 protein_id gnl|my_center|LOCUS_24430 6776 6351 gene locus_tag LOCUS_24440 6776 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 7580 7170 gene locus_tag LOCUS_24450 7580 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence218 <1 889 gene locus_tag LOCUS_24460 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144225.1:B12-binding domain-containing radical SAM protein 1044 2672 gene locus_tag LOCUS_24470 1044 2672 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_24470 2874 2716 gene locus_tag LOCUS_24480 2874 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 3407 3165 gene locus_tag LOCUS_24490 3407 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24490 3654 3905 gene locus_tag LOCUS_24500 3654 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 4329 3916 gene locus_tag LOCUS_24510 4329 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 4736 6145 gene locus_tag LOCUS_24520 4736 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 6259 7581 gene locus_tag LOCUS_24530 6259 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence219 208 663 gene locus_tag LOCUS_24540 gene ybiA 208 663 CDS product N-glycosidase YbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145128.1 protein_id gnl|my_center|LOCUS_24540 1776 1012 gene locus_tag LOCUS_24550 1776 1012 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_24550 2029 3078 gene locus_tag LOCUS_24560 gene gap 2029 3078 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055898.1 protein_id gnl|my_center|LOCUS_24560 3348 4496 gene locus_tag LOCUS_24570 3348 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 5520 4669 gene locus_tag LOCUS_24580 5520 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 6387 5653 gene locus_tag LOCUS_24590 6387 5653 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_24590 6950 6360 gene locus_tag LOCUS_24600 6950 6360 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_24600 7398 6958 gene locus_tag LOCUS_24610 7398 6958 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140553.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence220 <1 760 gene locus_tag LOCUS_24620 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140638.1:DNA polymerase I 1853 846 gene locus_tag LOCUS_24630 1853 846 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_24630 3010 1916 gene locus_tag LOCUS_24640 3010 1916 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106290870.1 protein_id gnl|my_center|LOCUS_24640 4195 3068 gene locus_tag LOCUS_24650 4195 3068 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057244.1 protein_id gnl|my_center|LOCUS_24650 6547 4565 gene locus_tag LOCUS_24660 6547 4565 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920876.1 protein_id gnl|my_center|LOCUS_24660 <7653 6596 gene locus_tag LOCUS_24670 <7653 6596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057517.1:Ppx/GppA phosphatase family protein >Feature sequence221 <1 1299 gene locus_tag LOCUS_24680 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140250.1:aminomethyl-transferring glycine dehydrogenase 1878 1366 gene locus_tag LOCUS_24690 1878 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 3334 1898 gene locus_tag LOCUS_24700 3334 1898 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_24700 4702 3353 gene locus_tag LOCUS_24710 4702 3353 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_24710 6289 4778 gene locus_tag LOCUS_24720 6289 4778 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_24720 7433 6687 gene locus_tag LOCUS_24730 7433 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence222 513 109 gene locus_tag LOCUS_24740 513 109 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080552.1 protein_id gnl|my_center|LOCUS_24740 839 510 gene locus_tag LOCUS_24750 839 510 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140979.1 protein_id gnl|my_center|LOCUS_24750 3235 836 gene locus_tag LOCUS_24760 3235 836 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027844565.1 protein_id gnl|my_center|LOCUS_24760 3557 3225 gene locus_tag LOCUS_24770 3557 3225 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228510.1 protein_id gnl|my_center|LOCUS_24770 3784 4863 gene locus_tag LOCUS_24780 3784 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 4938 5522 gene locus_tag LOCUS_24790 4938 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 7013 5751 gene locus_tag LOCUS_24800 7013 5751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_24800 <7624 7109 gene locus_tag LOCUS_24810 <7624 7109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265996.1:HlyD family secretion protein >Feature sequence223 814 404 gene locus_tag LOCUS_24820 814 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24820 1038 3788 gene locus_tag LOCUS_24830 1038 3788 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_24830 4145 5005 gene locus_tag LOCUS_24840 4145 5005 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140533.1 protein_id gnl|my_center|LOCUS_24840 5564 7549 gene locus_tag LOCUS_24850 5564 7549 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798165.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence224 650 2614 gene locus_tag LOCUS_24860 650 2614 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_24860 3792 2611 gene locus_tag LOCUS_24870 3792 2611 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230594.1 protein_id gnl|my_center|LOCUS_24870 4657 3899 gene locus_tag LOCUS_24880 4657 3899 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 protein_id gnl|my_center|LOCUS_24880 4941 6701 gene locus_tag LOCUS_24890 4941 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 6718 7152 gene locus_tag LOCUS_24900 6718 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 7122 7439 gene locus_tag LOCUS_24910 7122 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence225 1077 298 gene locus_tag LOCUS_24920 1077 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 1696 1526 gene locus_tag LOCUS_24930 1696 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 2066 1815 gene locus_tag LOCUS_24940 2066 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 2426 4156 gene locus_tag LOCUS_24950 2426 4156 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065280.1 protein_id gnl|my_center|LOCUS_24950 4463 4990 gene locus_tag LOCUS_24960 4463 4990 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529073.1 protein_id gnl|my_center|LOCUS_24960 5128 6036 gene locus_tag LOCUS_24970 gene thrB 5128 6036 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057602.1 protein_id gnl|my_center|LOCUS_24970 6081 6368 gene locus_tag LOCUS_24980 6081 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 6397 7389 gene locus_tag LOCUS_24990 6397 7389 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928617.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence226 474 1259 gene locus_tag LOCUS_25000 474 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 3180 1396 gene locus_tag LOCUS_25010 3180 1396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence227 141 590 gene locus_tag LOCUS_25020 141 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 1864 1292 gene locus_tag LOCUS_25030 1864 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2601 1864 gene locus_tag LOCUS_25040 2601 1864 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223216.1 protein_id gnl|my_center|LOCUS_25040 2742 3695 gene locus_tag LOCUS_25050 2742 3695 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530002.1 protein_id gnl|my_center|LOCUS_25050 5515 3761 gene locus_tag LOCUS_25060 5515 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 5763 6494 gene locus_tag LOCUS_25070 5763 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 6510 7190 gene locus_tag LOCUS_25080 6510 7190 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_25080 7488 7258 gene locus_tag LOCUS_25090 7488 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence228 <1 963 gene locus_tag LOCUS_25100 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058123.1:class I SAM-dependent methyltransferase 1002 2585 gene locus_tag LOCUS_25110 1002 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2633 3604 gene locus_tag LOCUS_25120 2633 3604 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056735.1 protein_id gnl|my_center|LOCUS_25120 5471 3645 gene locus_tag LOCUS_25130 5471 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 <7576 5464 gene locus_tag LOCUS_25140 <7576 5464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056852.1:glycosyltransferase >Feature sequence229 1516 476 gene locus_tag LOCUS_25150 gene cobW 1516 476 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 protein_id gnl|my_center|LOCUS_25150 2482 1619 gene locus_tag LOCUS_25160 2482 1619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166908820.1 protein_id gnl|my_center|LOCUS_25160 3272 2475 gene locus_tag LOCUS_25170 gene cbiQ 3272 2475 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058272.1 protein_id gnl|my_center|LOCUS_25170 3613 3269 gene locus_tag LOCUS_25180 3613 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 4335 3616 gene locus_tag LOCUS_25190 4335 3616 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235551391.1 protein_id gnl|my_center|LOCUS_25190 4637 5860 gene locus_tag LOCUS_25200 4637 5860 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269017.1 protein_id gnl|my_center|LOCUS_25200 6637 5894 gene locus_tag LOCUS_25210 6637 5894 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228821.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence230 2334 661 gene locus_tag LOCUS_25220 gene guaA 2334 661 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058250.1 protein_id gnl|my_center|LOCUS_25220 2426 3073 gene locus_tag LOCUS_25230 2426 3073 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143972.1 protein_id gnl|my_center|LOCUS_25230 3274 3729 gene locus_tag LOCUS_25240 3274 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 4302 3757 gene locus_tag LOCUS_25250 4302 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25250 5122 4232 gene locus_tag LOCUS_25260 5122 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25260 6379 5270 gene locus_tag LOCUS_25270 6379 5270 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_25270 7494 6526 gene locus_tag LOCUS_25280 gene queG 7494 6526 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence231 362 568 gene locus_tag LOCUS_25290 362 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 1184 798 gene locus_tag LOCUS_25300 1184 798 CDS product DUF1818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057286.1 protein_id gnl|my_center|LOCUS_25300 1457 1233 gene locus_tag LOCUS_25310 1457 1233 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141619.1 protein_id gnl|my_center|LOCUS_25310 1605 2306 gene locus_tag LOCUS_25320 1605 2306 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058037.1 protein_id gnl|my_center|LOCUS_25320 3278 2370 gene locus_tag LOCUS_25330 3278 2370 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_25330 3667 4052 gene locus_tag LOCUS_tm00010 3667 4052 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4963 5448 gene locus_tag LOCUS_25340 4963 5448 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_25340 5595 5870 gene locus_tag LOCUS_25350 5595 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 6146 6379 gene locus_tag LOCUS_25360 6146 6379 CDS product DUF2997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987300.1 protein_id gnl|my_center|LOCUS_25360 6484 6870 gene locus_tag LOCUS_25370 6484 6870 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_25370 6863 7261 gene locus_tag LOCUS_25380 6863 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 7525 7340 gene locus_tag LOCUS_25390 7525 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence232 1260 847 gene locus_tag LOCUS_25400 1260 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 1456 1803 gene locus_tag LOCUS_25410 1456 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2270 2608 gene locus_tag LOCUS_25420 2270 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2718 3680 gene locus_tag LOCUS_25430 2718 3680 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024691572.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence233 3705 5414 gene locus_tag LOCUS_25440 gene kaiC 3705 5414 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390295.1 protein_id gnl|my_center|LOCUS_25440 5457 5771 gene locus_tag LOCUS_25450 5457 5771 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390296.1 protein_id gnl|my_center|LOCUS_25450 7469 5775 gene locus_tag LOCUS_25460 7469 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence234 <1 1429 gene locus_tag LOCUS_25470 <1 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921027.1:isoleucine--tRNA ligase 4393 1442 gene locus_tag LOCUS_25480 4393 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25480 6523 4394 gene locus_tag LOCUS_25490 6523 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25490 6755 6964 gene locus_tag LOCUS_25500 6755 6964 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058042.1 protein_id gnl|my_center|LOCUS_25500 7032 7241 gene locus_tag LOCUS_25510 7032 7241 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058042.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence235 2029 1772 gene locus_tag LOCUS_25520 2029 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2927 3586 gene locus_tag LOCUS_25530 2927 3586 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_25530 3689 4720 gene locus_tag LOCUS_25540 gene thiO 3689 4720 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921239.1 protein_id gnl|my_center|LOCUS_25540 5323 4754 gene locus_tag LOCUS_25550 5323 4754 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_25550 6519 5392 gene locus_tag LOCUS_25560 6519 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25560 7182 6550 gene locus_tag LOCUS_25570 7182 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25570 >Feature sequence236 1607 4249 gene locus_tag LOCUS_25580 1607 4249 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_25580 4434 5471 gene locus_tag LOCUS_25590 4434 5471 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207677.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence237 106 1641 gene locus_tag LOCUS_25600 106 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 1837 2493 gene locus_tag LOCUS_25610 1837 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2632 3567 gene locus_tag LOCUS_25620 2632 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 4321 3629 gene locus_tag LOCUS_25630 4321 3629 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_25630 4363 5346 gene locus_tag LOCUS_25640 gene holA 4363 5346 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920898.1 protein_id gnl|my_center|LOCUS_25640 5424 6554 gene locus_tag LOCUS_25650 gene aroB 5424 6554 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056627.1 protein_id gnl|my_center|LOCUS_25650 6734 7258 gene locus_tag LOCUS_25660 gene infC 6734 7258 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106456574.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence238 123 995 gene locus_tag LOCUS_25670 123 995 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_25670 1464 2501 gene locus_tag LOCUS_25680 gene hpxD 1464 2501 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097237.1 protein_id gnl|my_center|LOCUS_25680 2527 3552 gene locus_tag LOCUS_25690 gene hpxD 2527 3552 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_25690 5719 3860 gene locus_tag LOCUS_25700 5719 3860 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_25700 6316 5957 gene locus_tag LOCUS_25710 gene uraH 6316 5957 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521222.1 protein_id gnl|my_center|LOCUS_25710 6564 6968 gene locus_tag LOCUS_25720 6564 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence239 1672 743 gene locus_tag LOCUS_25730 gene ntrB 1672 743 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973416.1 protein_id gnl|my_center|LOCUS_25730 3081 1750 gene locus_tag LOCUS_25740 3081 1750 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057190.1 protein_id gnl|my_center|LOCUS_25740 4749 3190 gene locus_tag LOCUS_25750 4749 3190 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_25750 5140 5889 gene locus_tag LOCUS_25760 5140 5889 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056503.1 protein_id gnl|my_center|LOCUS_25760 5993 7156 gene locus_tag LOCUS_25770 5993 7156 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence240 365 859 gene locus_tag LOCUS_25780 365 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 873 1286 gene locus_tag LOCUS_25790 873 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1274 1618 gene locus_tag LOCUS_25800 1274 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1829 2080 gene locus_tag LOCUS_25810 1829 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2077 2334 gene locus_tag LOCUS_25820 2077 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 3861 2563 gene locus_tag LOCUS_25830 3861 2563 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057961.1 protein_id gnl|my_center|LOCUS_25830 3919 4644 gene locus_tag LOCUS_25840 3919 4644 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_25840 5511 4747 gene locus_tag LOCUS_25850 gene panB 5511 4747 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921085.1 protein_id gnl|my_center|LOCUS_25850 5647 5841 gene locus_tag LOCUS_25860 5647 5841 CDS product DUF2862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 protein_id gnl|my_center|LOCUS_25860 5898 6203 gene locus_tag LOCUS_25870 5898 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 6200 7264 gene locus_tag LOCUS_25880 6200 7264 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence241 77 1804 gene locus_tag LOCUS_25890 77 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 6365 2235 gene locus_tag LOCUS_25900 6365 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence242 1568 1765 gene locus_tag LOCUS_25910 1568 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 3393 2563 gene locus_tag LOCUS_25920 gene menB 3393 2563 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_25920 4017 4286 gene locus_tag LOCUS_25930 4017 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 4220 5137 gene locus_tag LOCUS_25940 4220 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 6147 5503 gene locus_tag LOCUS_25950 gene plsY 6147 5503 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056950.1 protein_id gnl|my_center|LOCUS_25950 6366 7151 gene locus_tag LOCUS_25960 gene cobA 6366 7151 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055999.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence243 1343 63 gene locus_tag LOCUS_25970 1343 63 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_25970 2489 1533 gene locus_tag LOCUS_25980 gene pip 2489 1533 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_25980 3369 2590 gene locus_tag LOCUS_25990 3369 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 3470 4537 gene locus_tag LOCUS_26000 3470 4537 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704251.1 protein_id gnl|my_center|LOCUS_26000 5078 4797 gene locus_tag LOCUS_26010 5078 4797 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056004.1 protein_id gnl|my_center|LOCUS_26010 5377 5204 gene locus_tag LOCUS_26020 5377 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 5901 6854 gene locus_tag LOCUS_26030 5901 6854 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 protein_id gnl|my_center|LOCUS_26030 6993 7292 gene locus_tag LOCUS_26040 6993 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144163.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence244 1330 176 gene locus_tag LOCUS_26050 1330 176 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_26050 2137 1577 gene locus_tag LOCUS_26060 gene psbP 2137 1577 CDS product photosystem II reaction center PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_26060 2471 2677 gene locus_tag LOCUS_26070 2471 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057624.1 protein_id gnl|my_center|LOCUS_26070 2845 4893 gene locus_tag LOCUS_26080 2845 4893 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921058.1 protein_id gnl|my_center|LOCUS_26080 4964 5416 gene locus_tag LOCUS_26090 4964 5416 CDS product nitrate reductase associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_26090 6194 5517 gene locus_tag LOCUS_26100 6194 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence245 1449 2051 gene locus_tag LOCUS_26110 gene aat 1449 2051 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920768.1 protein_id gnl|my_center|LOCUS_26110 3535 2171 gene locus_tag LOCUS_26120 gene rlmD 3535 2171 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_26120 3564 4754 gene locus_tag LOCUS_26130 3564 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 5700 4930 gene locus_tag LOCUS_26140 5700 4930 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142610.1 protein_id gnl|my_center|LOCUS_26140 6576 5764 gene locus_tag LOCUS_26150 6576 5764 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence246 5801 4143 gene locus_tag LOCUS_26160 5801 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 6928 5798 gene locus_tag LOCUS_26170 6928 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence247 736 185 gene locus_tag LOCUS_26180 736 185 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920655.1 protein_id gnl|my_center|LOCUS_26180 1374 1150 gene locus_tag LOCUS_26190 1374 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1970 1638 gene locus_tag LOCUS_26200 1970 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 3081 2134 gene locus_tag LOCUS_26210 3081 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 5042 3246 gene locus_tag LOCUS_26220 5042 3246 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056388.1 protein_id gnl|my_center|LOCUS_26220 5749 5822 gene locus_tag LOCUS_t00310 5749 5822 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6933 5857 gene locus_tag LOCUS_26230 6933 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence248 <1 501 gene locus_tag LOCUS_26240 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055948.1:50S ribosomal protein L5 526 927 gene locus_tag LOCUS_26250 gene rpsH 526 927 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055949.1 protein_id gnl|my_center|LOCUS_26250 1006 1569 gene locus_tag LOCUS_26260 gene rplF 1006 1569 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_26260 1636 2001 gene locus_tag LOCUS_26270 gene rplR 1636 2001 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143899.1 protein_id gnl|my_center|LOCUS_26270 2045 2659 gene locus_tag LOCUS_26280 gene rpsE 2045 2659 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055952.1 protein_id gnl|my_center|LOCUS_26280 2721 3167 gene locus_tag LOCUS_26290 gene rplO 2721 3167 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055953.1 protein_id gnl|my_center|LOCUS_26290 3357 4697 gene locus_tag LOCUS_26300 gene secY 3357 4697 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055954.1 protein_id gnl|my_center|LOCUS_26300 4697 5254 gene locus_tag LOCUS_26310 4697 5254 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789400.1 protein_id gnl|my_center|LOCUS_26310 5336 5575 gene locus_tag LOCUS_26320 gene infA 5336 5575 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055956.1 protein_id gnl|my_center|LOCUS_26320 6528 5680 gene locus_tag LOCUS_26330 6528 5680 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_26330 6783 6562 gene locus_tag LOCUS_26340 6783 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence249 520 131 gene locus_tag LOCUS_26350 520 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1400 852 gene locus_tag LOCUS_26360 gene frr 1400 852 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_26360 2148 1387 gene locus_tag LOCUS_26370 gene pyrH 2148 1387 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_26370 3188 2292 gene locus_tag LOCUS_26380 3188 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 4711 3374 gene locus_tag LOCUS_26390 4711 3374 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_26390 5013 6695 gene locus_tag LOCUS_26400 5013 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142439.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence250 312 1856 gene locus_tag LOCUS_26410 312 1856 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057582.1 protein_id gnl|my_center|LOCUS_26410 1936 6201 gene locus_tag LOCUS_26420 1936 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 6585 6355 gene locus_tag LOCUS_26430 6585 6355 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_26430 6769 7134 gene locus_tag LOCUS_26440 6769 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence251 <1 987 gene locus_tag LOCUS_26450 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928586.1:ATP-binding protein 2008 1532 gene locus_tag LOCUS_26460 2008 1532 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142174.1 protein_id gnl|my_center|LOCUS_26460 2091 3002 gene locus_tag LOCUS_26470 2091 3002 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_26470 3135 6107 gene locus_tag LOCUS_26480 3135 6107 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153164114.1 protein_id gnl|my_center|LOCUS_26480 6251 7156 gene locus_tag LOCUS_26490 6251 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence252 1605 262 gene locus_tag LOCUS_26500 1605 262 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174384.1 protein_id gnl|my_center|LOCUS_26500 1850 1599 gene locus_tag LOCUS_26510 1850 1599 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008278.1 protein_id gnl|my_center|LOCUS_26510 2669 2403 gene locus_tag LOCUS_26520 2669 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 3034 3486 gene locus_tag LOCUS_26530 3034 3486 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142723.1 protein_id gnl|my_center|LOCUS_26530 4140 3475 gene locus_tag LOCUS_26540 4140 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 4285 4686 gene locus_tag LOCUS_26550 4285 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 4774 5565 gene locus_tag LOCUS_26560 4774 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 5754 5551 gene locus_tag LOCUS_26570 5754 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence253 <1 801 gene locus_tag LOCUS_26580 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943746.1:NAD(P)-dependent alcohol dehydrogenase 1134 2429 gene locus_tag LOCUS_26590 1134 2429 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041958803.1 protein_id gnl|my_center|LOCUS_26590 3162 2815 gene locus_tag LOCUS_26600 3162 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 3880 3371 gene locus_tag LOCUS_26610 3880 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 4257 3967 gene locus_tag LOCUS_26620 4257 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 4795 4295 gene locus_tag LOCUS_26630 4795 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 5147 4779 gene locus_tag LOCUS_26640 5147 4779 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 protein_id gnl|my_center|LOCUS_26640 5416 5237 gene locus_tag LOCUS_26650 5416 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 6213 5455 gene locus_tag LOCUS_26660 6213 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 7071 6652 gene locus_tag LOCUS_26670 7071 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence254 804 100 gene locus_tag LOCUS_26680 804 100 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141264.1 protein_id gnl|my_center|LOCUS_26680 1612 866 gene locus_tag LOCUS_26690 1612 866 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141264.1 protein_id gnl|my_center|LOCUS_26690 2673 1807 gene locus_tag LOCUS_26700 2673 1807 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175909.1 protein_id gnl|my_center|LOCUS_26700 3783 3037 gene locus_tag LOCUS_26710 3783 3037 CDS product phycoerythrobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141261.1 protein_id gnl|my_center|LOCUS_26710 4522 3785 gene locus_tag LOCUS_26720 4522 3785 CDS product 15,16-dihydrobiliverdin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141260.1 protein_id gnl|my_center|LOCUS_26720 5428 4865 gene locus_tag LOCUS_26730 5428 4865 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530136.1 protein_id gnl|my_center|LOCUS_26730 5545 6348 gene locus_tag LOCUS_26740 5545 6348 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141258.1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence255 <1 863 gene locus_tag LOCUS_26750 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057731.1:heme A synthase 902 1903 gene locus_tag LOCUS_26760 902 1903 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920945.1 protein_id gnl|my_center|LOCUS_26760 2275 1958 gene locus_tag LOCUS_26770 2275 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26770 2715 2320 gene locus_tag LOCUS_26780 2715 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26780 4887 3058 gene locus_tag LOCUS_26790 4887 3058 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928942.1 protein_id gnl|my_center|LOCUS_26790 5835 5197 gene locus_tag LOCUS_26800 5835 5197 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence256 129 2939 gene locus_tag LOCUS_26810 129 2939 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_26810 3066 3335 gene locus_tag LOCUS_26820 3066 3335 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189463936.1 protein_id gnl|my_center|LOCUS_26820 3340 3771 gene locus_tag LOCUS_26830 3340 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3972 4211 gene locus_tag LOCUS_26840 3972 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 4208 4678 gene locus_tag LOCUS_26850 4208 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 4722 5972 gene locus_tag LOCUS_26860 4722 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 6253 5969 gene locus_tag LOCUS_26870 6253 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 6486 6250 gene locus_tag LOCUS_26880 6486 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence257 <1 648 gene locus_tag LOCUS_26890 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142981.1:succinate dehydrogenase/fumarate reductase flavoprotein subunit 707 1567 gene locus_tag LOCUS_26900 707 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 2787 1672 gene locus_tag LOCUS_26910 2787 1672 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057686.1 protein_id gnl|my_center|LOCUS_26910 3946 4851 gene locus_tag LOCUS_26920 3946 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence258 243 4337 gene locus_tag LOCUS_26930 243 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 4762 4340 gene locus_tag LOCUS_26940 4762 4340 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_26940 4815 5951 gene locus_tag LOCUS_26950 4815 5951 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_26950 6258 5938 gene locus_tag LOCUS_26960 6258 5938 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057408.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence259 <1 1608 gene locus_tag LOCUS_26970 <1 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256785.1:SUMF1/EgtB/PvdO family nonheme iron enzyme 2802 1648 gene locus_tag LOCUS_26980 gene leuB 2802 1648 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057439.1 protein_id gnl|my_center|LOCUS_26980 4202 2913 gene locus_tag LOCUS_26990 4202 2913 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057902.1 protein_id gnl|my_center|LOCUS_26990 4622 5131 gene locus_tag LOCUS_27000 4622 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 5294 6568 gene locus_tag LOCUS_27010 5294 6568 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141585.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence260 1544 174 gene locus_tag LOCUS_27020 1544 174 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920668.1 protein_id gnl|my_center|LOCUS_27020 2493 2155 gene locus_tag LOCUS_27030 2493 2155 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 protein_id gnl|my_center|LOCUS_27030 2545 3012 gene locus_tag LOCUS_27040 2545 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 3569 4093 gene locus_tag LOCUS_27050 3569 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 5465 4191 gene locus_tag LOCUS_27060 gene purD 5465 4191 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920939.1 protein_id gnl|my_center|LOCUS_27060 6312 5695 gene locus_tag LOCUS_27070 6312 5695 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057990.1 protein_id gnl|my_center|LOCUS_27070 >Feature sequence261 1290 2960 gene locus_tag LOCUS_27080 1290 2960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_27080 3126 3356 gene locus_tag LOCUS_27090 3126 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 4428 4862 gene locus_tag LOCUS_27100 4428 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 4976 5185 gene locus_tag LOCUS_27110 4976 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27110 5313 5783 gene locus_tag LOCUS_27120 5313 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 6045 5770 gene locus_tag LOCUS_27130 6045 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence262 1298 1564 gene locus_tag LOCUS_27140 1298 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2077 1676 gene locus_tag LOCUS_27150 2077 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 2313 2074 gene locus_tag LOCUS_27160 2313 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 5800 2357 gene locus_tag LOCUS_27170 5800 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 6022 5837 gene locus_tag LOCUS_27180 6022 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 <7005 6009 gene locus_tag LOCUS_27190 <7005 6009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140248.1:response regulator transcription factor >Feature sequence263 67 2994 gene locus_tag LOCUS_27200 gene ppc 67 2994 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057749.1 protein_id gnl|my_center|LOCUS_27200 3200 4186 gene locus_tag LOCUS_27210 3200 4186 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920924.1 protein_id gnl|my_center|LOCUS_27210 4365 4925 gene locus_tag LOCUS_27220 4365 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 5450 5100 gene locus_tag LOCUS_27230 5450 5100 CDS product DUF6464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057913.1 protein_id gnl|my_center|LOCUS_27230 5999 6853 gene locus_tag LOCUS_27240 5999 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence264 843 418 gene locus_tag LOCUS_27250 843 418 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477591.1 protein_id gnl|my_center|LOCUS_27250 1974 1015 gene locus_tag LOCUS_27260 1974 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2211 2753 gene locus_tag LOCUS_27270 2211 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 2828 3571 gene locus_tag LOCUS_27280 2828 3571 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_27280 3586 4509 gene locus_tag LOCUS_27290 3586 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 4546 5052 gene locus_tag LOCUS_27300 4546 5052 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_27300 6028 5507 gene locus_tag LOCUS_27310 6028 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 6836 6252 gene locus_tag LOCUS_27320 6836 6252 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679904.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence265 153 527 gene locus_tag LOCUS_27330 153 527 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038703.1 protein_id gnl|my_center|LOCUS_27330 784 2097 gene locus_tag LOCUS_27340 gene gatB 784 2097 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_27340 3059 2142 gene locus_tag LOCUS_27350 3059 2142 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929219.1 protein_id gnl|my_center|LOCUS_27350 3197 3277 gene locus_tag LOCUS_t00320 3197 3277 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4431 3622 gene locus_tag LOCUS_27360 4431 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 4544 4861 gene locus_tag LOCUS_27370 4544 4861 CDS product DUF2605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 protein_id gnl|my_center|LOCUS_27370 5043 5321 gene locus_tag LOCUS_27380 5043 5321 CDS product DUF2973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_27380 5398 5781 gene locus_tag LOCUS_27390 5398 5781 CDS product DUF1636 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562166.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence266 4 1263 gene locus_tag LOCUS_27400 4 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1256 1885 gene locus_tag LOCUS_27410 1256 1885 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521551.1 protein_id gnl|my_center|LOCUS_27410 1882 2634 gene locus_tag LOCUS_27420 1882 2634 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390738.1 protein_id gnl|my_center|LOCUS_27420 3419 2649 gene locus_tag LOCUS_27430 gene surE 3419 2649 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_27430 4001 3486 gene locus_tag LOCUS_27440 4001 3486 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_27440 4663 4040 gene locus_tag LOCUS_27450 gene hisH 4663 4040 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057376.1 protein_id gnl|my_center|LOCUS_27450 4784 5233 gene locus_tag LOCUS_27460 4784 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 6850 5369 gene locus_tag LOCUS_27470 6850 5369 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056673.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence267 500 1693 gene locus_tag LOCUS_27480 500 1693 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_27480 1877 4027 gene locus_tag LOCUS_27490 1877 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 4029 5243 gene locus_tag LOCUS_27500 4029 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 5427 5639 gene locus_tag LOCUS_27510 5427 5639 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_27510 5636 5824 gene locus_tag LOCUS_27520 5636 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 6009 6236 gene locus_tag LOCUS_27530 6009 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 6220 6612 gene locus_tag LOCUS_27540 6220 6612 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence268 393 806 gene locus_tag LOCUS_27550 393 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1686 865 gene locus_tag LOCUS_27560 1686 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2122 1835 gene locus_tag LOCUS_27570 2122 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 2771 2115 gene locus_tag LOCUS_27580 2771 2115 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903837.1 protein_id gnl|my_center|LOCUS_27580 3048 2794 gene locus_tag LOCUS_27590 3048 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 6286 3353 gene locus_tag LOCUS_27600 6286 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence269 1568 678 gene locus_tag LOCUS_27610 1568 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1779 2471 gene locus_tag LOCUS_27620 1779 2471 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_27620 2657 3367 gene locus_tag LOCUS_27630 2657 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 3474 4400 gene locus_tag LOCUS_27640 3474 4400 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143278.1 protein_id gnl|my_center|LOCUS_27640 4726 4502 gene locus_tag LOCUS_27650 4726 4502 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020810.1 protein_id gnl|my_center|LOCUS_27650 4938 4723 gene locus_tag LOCUS_27660 4938 4723 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_27660 5863 5084 gene locus_tag LOCUS_27670 5863 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 6234 5902 gene locus_tag LOCUS_27680 6234 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 6502 6242 gene locus_tag LOCUS_27690 6502 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence270 <1 1078 gene locus_tag LOCUS_27700 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140772.1:PrsW family glutamic-type intramembrane protease 1997 1080 gene locus_tag LOCUS_27710 1997 1080 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_27710 3449 2046 gene locus_tag LOCUS_27720 gene zds 3449 2046 CDS product 9,9'-di-cis-zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056192.1 protein_id gnl|my_center|LOCUS_27720 3623 4054 gene locus_tag LOCUS_27730 3623 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 4306 5952 gene locus_tag LOCUS_27740 4306 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 5963 6277 gene locus_tag LOCUS_27750 5963 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 6280 6504 gene locus_tag LOCUS_27760 6280 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence271 4941 2587 gene locus_tag LOCUS_27770 4941 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 5600 5073 gene locus_tag LOCUS_27780 5600 5073 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 protein_id gnl|my_center|LOCUS_27780 6121 5753 gene locus_tag LOCUS_27790 6121 5753 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_27790 <6896 6393 gene locus_tag LOCUS_27800 <6896 6393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056442.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence272 246 1070 gene locus_tag LOCUS_27810 246 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2602 1142 gene locus_tag LOCUS_27820 2602 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2906 4090 gene locus_tag LOCUS_27830 2906 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 5523 4270 gene locus_tag LOCUS_27840 5523 4270 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143008.1 protein_id gnl|my_center|LOCUS_27840 5908 6621 gene locus_tag LOCUS_27850 5908 6621 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence273 699 3464 gene locus_tag LOCUS_27860 699 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 4775 3762 gene locus_tag LOCUS_27870 gene hemH 4775 3762 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140841.1 protein_id gnl|my_center|LOCUS_27870 5389 5003 gene locus_tag LOCUS_27880 5389 5003 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141683.1 protein_id gnl|my_center|LOCUS_27880 6341 5376 gene locus_tag LOCUS_27890 6341 5376 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920773.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence274 1310 1951 gene locus_tag LOCUS_27900 1310 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 1967 2905 gene locus_tag LOCUS_27910 1967 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 2926 3723 gene locus_tag LOCUS_27920 2926 3723 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_27920 3723 4262 gene locus_tag LOCUS_27930 3723 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 4380 4306 gene locus_tag LOCUS_t00330 4380 4306 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5830 4502 gene locus_tag LOCUS_27940 5830 4502 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 protein_id gnl|my_center|LOCUS_27940 6151 5867 gene locus_tag LOCUS_27950 6151 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921006.1 protein_id gnl|my_center|LOCUS_27950 <6852 6284 gene locus_tag LOCUS_27960 <6852 6284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057920.1:CHAT domain-containing protein >Feature sequence275 <1 1991 gene locus_tag LOCUS_27970 <1 1991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056271.1:L-glutamate gamma-semialdehyde dehydrogenase 2070 2528 gene locus_tag LOCUS_27980 2070 2528 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_27980 2696 3529 gene locus_tag LOCUS_27990 2696 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 3553 5100 gene locus_tag LOCUS_28000 3553 5100 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688809.1 protein_id gnl|my_center|LOCUS_28000 5128 5325 gene locus_tag LOCUS_28010 5128 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 5386 5628 gene locus_tag LOCUS_28020 5386 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 6144 6731 gene locus_tag LOCUS_28030 6144 6731 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence276 287 997 gene locus_tag LOCUS_28040 287 997 CDS product DUF1995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_28040 1121 1765 gene locus_tag LOCUS_28050 gene mtnX 1121 1765 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027474.1 protein_id gnl|my_center|LOCUS_28050 3139 1907 gene locus_tag LOCUS_28060 3139 1907 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_28060 3491 4303 gene locus_tag LOCUS_28070 3491 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 4708 5166 gene locus_tag LOCUS_28080 4708 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 5374 5832 gene locus_tag LOCUS_28090 5374 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 6262 5948 gene locus_tag LOCUS_28100 6262 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28100 6696 6226 gene locus_tag LOCUS_28110 6696 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence277 <1 770 gene locus_tag LOCUS_28120 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963667.1:ATP-binding protein note possible pseudo, internal stop codon 792 1151 gene locus_tag LOCUS_28130 792 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1503 1207 gene locus_tag LOCUS_28140 1503 1207 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920900.1 protein_id gnl|my_center|LOCUS_28140 1711 4347 gene locus_tag LOCUS_28150 gene alaS 1711 4347 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057938.1 protein_id gnl|my_center|LOCUS_28150 4418 5254 gene locus_tag LOCUS_28160 4418 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 5451 5305 gene locus_tag LOCUS_28170 5451 5305 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_28170 6280 5765 gene locus_tag LOCUS_28180 6280 5765 CDS product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057561.1 protein_id gnl|my_center|LOCUS_28180 6770 6369 gene locus_tag LOCUS_28190 6770 6369 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142305.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence278 987 43 gene locus_tag LOCUS_28200 987 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1165 995 gene locus_tag LOCUS_28210 1165 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1331 2323 gene locus_tag LOCUS_28220 1331 2323 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142938.1 protein_id gnl|my_center|LOCUS_28220 2943 2284 gene locus_tag LOCUS_28230 2943 2284 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_28230 4373 2988 gene locus_tag LOCUS_28240 4373 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 4746 5192 gene locus_tag LOCUS_28250 4746 5192 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_28250 5340 6092 gene locus_tag LOCUS_28260 5340 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 6271 6185 gene locus_tag LOCUS_t00340 6271 6185 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence279 395 2131 gene locus_tag LOCUS_28270 395 2131 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_28270 2324 3268 gene locus_tag LOCUS_28280 2324 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 3404 4087 gene locus_tag LOCUS_28290 gene rnc 3404 4087 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583311.1 protein_id gnl|my_center|LOCUS_28290 4137 4682 gene locus_tag LOCUS_28300 gene rimM 4137 4682 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056908.1 protein_id gnl|my_center|LOCUS_28300 4952 4812 gene locus_tag LOCUS_28310 4952 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 5126 6400 gene locus_tag LOCUS_28320 5126 6400 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence280 150 725 gene locus_tag LOCUS_28330 150 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 737 2137 gene locus_tag LOCUS_28340 737 2137 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_28340 2158 2943 gene locus_tag LOCUS_28350 2158 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3240 4160 gene locus_tag LOCUS_28360 3240 4160 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_28360 4157 5374 gene locus_tag LOCUS_28370 4157 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 5371 6309 gene locus_tag LOCUS_28380 5371 6309 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798562.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence281 136 324 gene locus_tag LOCUS_28390 136 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 354 617 gene locus_tag LOCUS_28400 354 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 988 1917 gene locus_tag LOCUS_28410 988 1917 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 protein_id gnl|my_center|LOCUS_28410 1993 3036 gene locus_tag LOCUS_28420 1993 3036 CDS product anthranilate phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 protein_id gnl|my_center|LOCUS_28420 3102 3812 gene locus_tag LOCUS_28430 3102 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 3923 5047 gene locus_tag LOCUS_28440 3923 5047 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence282 74 850 gene locus_tag LOCUS_28450 74 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 2634 928 gene locus_tag LOCUS_28460 2634 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 3871 3020 gene locus_tag LOCUS_28470 3871 3020 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_28470 4201 3983 gene locus_tag LOCUS_28480 4201 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 4644 5399 gene locus_tag LOCUS_28490 4644 5399 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_28490 5588 6664 gene locus_tag LOCUS_28500 gene mnmA 5588 6664 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140554.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence283 574 1221 gene locus_tag LOCUS_28510 574 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28510 1576 1304 gene locus_tag LOCUS_28520 1576 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 1850 1569 gene locus_tag LOCUS_28530 1850 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_28530 2397 2014 gene locus_tag LOCUS_28540 2397 2014 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142157.1 protein_id gnl|my_center|LOCUS_28540 2728 2390 gene locus_tag LOCUS_28550 2728 2390 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142158.1 protein_id gnl|my_center|LOCUS_28550 4657 2915 gene locus_tag LOCUS_28560 4657 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 5252 5073 gene locus_tag LOCUS_28570 5252 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 6565 5342 gene locus_tag LOCUS_28580 6565 5342 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence284 664 74 gene locus_tag LOCUS_28590 664 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 742 2784 gene locus_tag LOCUS_28600 742 2784 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_28600 3735 2776 gene locus_tag LOCUS_28610 3735 2776 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550332.1 protein_id gnl|my_center|LOCUS_28610 3826 4722 gene locus_tag LOCUS_28620 3826 4722 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_28620 4808 5170 gene locus_tag LOCUS_28630 4808 5170 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056500.1 protein_id gnl|my_center|LOCUS_28630 5451 5738 gene locus_tag LOCUS_28640 5451 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 6250 6438 gene locus_tag LOCUS_28650 6250 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence285 732 448 gene locus_tag LOCUS_28660 732 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 2232 781 gene locus_tag LOCUS_28670 2232 781 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892504.1 protein_id gnl|my_center|LOCUS_28670 2715 2963 gene locus_tag LOCUS_28680 2715 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 3009 3272 gene locus_tag LOCUS_28690 3009 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 3422 4402 gene locus_tag LOCUS_28700 3422 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 4926 4525 gene locus_tag LOCUS_28710 4926 4525 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_28710 5168 4923 gene locus_tag LOCUS_28720 5168 4923 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 protein_id gnl|my_center|LOCUS_28720 6247 5546 gene locus_tag LOCUS_28730 6247 5546 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083767.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence286 918 67 gene locus_tag LOCUS_28740 918 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 1295 1942 gene locus_tag LOCUS_28750 1295 1942 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_28750 2234 2443 gene locus_tag LOCUS_28760 2234 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 2526 2735 gene locus_tag LOCUS_28770 2526 2735 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_28770 2760 4700 gene locus_tag LOCUS_28780 2760 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 4724 5419 gene locus_tag LOCUS_28790 4724 5419 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142915.1 protein_id gnl|my_center|LOCUS_28790 5479 5766 gene locus_tag LOCUS_28800 5479 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 6059 6565 gene locus_tag LOCUS_28810 6059 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence287 481 1683 gene locus_tag LOCUS_28820 481 1683 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259703.1 protein_id gnl|my_center|LOCUS_28820 1723 3237 gene locus_tag LOCUS_28830 1723 3237 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259702.1 protein_id gnl|my_center|LOCUS_28830 3230 4297 gene locus_tag LOCUS_28840 3230 4297 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259701.1 protein_id gnl|my_center|LOCUS_28840 4389 5354 gene locus_tag LOCUS_28850 4389 5354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259700.1 protein_id gnl|my_center|LOCUS_28850 6546 5563 gene locus_tag LOCUS_28860 6546 5563 CDS product saccharopine dehydrogenase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928537.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence288 525 2078 gene locus_tag LOCUS_28870 525 2078 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055900.1 protein_id gnl|my_center|LOCUS_28870 2536 2129 gene locus_tag LOCUS_28880 2536 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 3141 2539 gene locus_tag LOCUS_28890 3141 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 3284 3490 gene locus_tag LOCUS_28900 3284 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 3576 3755 gene locus_tag LOCUS_28910 3576 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 4950 4264 gene locus_tag LOCUS_28920 4950 4264 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_28920 5169 6560 gene locus_tag LOCUS_28930 gene murA 5169 6560 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143118.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence289 391 1221 gene locus_tag LOCUS_28940 391 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 1124 2821 gene locus_tag LOCUS_28950 1124 2821 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141608.1 protein_id gnl|my_center|LOCUS_28950 4013 2847 gene locus_tag LOCUS_28960 4013 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 5355 4006 gene locus_tag LOCUS_28970 5355 4006 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_28970 5580 6380 gene locus_tag LOCUS_28980 gene sppA 5580 6380 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence290 <1 817 gene locus_tag LOCUS_28990 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057483.1:hydroxymethylbilane synthase 948 1364 gene locus_tag LOCUS_29000 948 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 1513 1755 gene locus_tag LOCUS_29010 1513 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 1748 2017 gene locus_tag LOCUS_29020 1748 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 2017 5772 gene locus_tag LOCUS_29030 2017 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 5796 6014 gene locus_tag LOCUS_29040 5796 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 6004 6348 gene locus_tag LOCUS_29050 6004 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence291 1163 81 gene locus_tag LOCUS_29060 gene psbA 1163 81 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_29060 2253 1321 gene locus_tag LOCUS_29070 gene murB 2253 1321 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056225.1 protein_id gnl|my_center|LOCUS_29070 3668 2274 gene locus_tag LOCUS_29080 gene murC 3668 2274 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056226.1 protein_id gnl|my_center|LOCUS_29080 4436 3744 gene locus_tag LOCUS_29090 4436 3744 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987297.1 protein_id gnl|my_center|LOCUS_29090 5025 4540 gene locus_tag LOCUS_29100 5025 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 5759 5235 gene locus_tag LOCUS_29110 5759 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 5837 6037 gene locus_tag LOCUS_29120 5837 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence292 54 2624 gene locus_tag LOCUS_29130 54 2624 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 protein_id gnl|my_center|LOCUS_29130 4105 2723 gene locus_tag LOCUS_29140 4105 2723 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143468.1 protein_id gnl|my_center|LOCUS_29140 5961 4312 gene locus_tag LOCUS_29150 5961 4312 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057237.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence293 <1 1853 gene locus_tag LOCUS_29160 <1 1853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056069.1:ABC transporter ATP-binding protein 1895 3250 gene locus_tag LOCUS_29170 1895 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3405 4376 gene locus_tag LOCUS_29180 3405 4376 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_29180 4384 5148 gene locus_tag LOCUS_29190 4384 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 5175 6020 gene locus_tag LOCUS_29200 5175 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence294 1531 245 gene locus_tag LOCUS_29210 1531 245 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968693.1 protein_id gnl|my_center|LOCUS_29210 3095 1536 gene locus_tag LOCUS_29220 3095 1536 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_29220 4071 4358 gene locus_tag LOCUS_29230 4071 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29230 5681 5442 gene locus_tag LOCUS_29240 5681 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 5804 6328 gene locus_tag LOCUS_29250 5804 6328 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144323.1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence295 194 745 gene locus_tag LOCUS_29260 194 745 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 protein_id gnl|my_center|LOCUS_29260 1807 872 gene locus_tag LOCUS_29270 1807 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 2255 3757 gene locus_tag LOCUS_29280 2255 3757 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_29280 3906 4781 gene locus_tag LOCUS_29290 3906 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057850.1 protein_id gnl|my_center|LOCUS_29290 5460 4894 gene locus_tag LOCUS_29300 5460 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 <6448 5492 gene locus_tag LOCUS_29310 <6448 5492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142095.1:trypsin-like peptidase domain-containing protein >Feature sequence296 1319 2137 gene locus_tag LOCUS_29320 1319 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 2134 2829 gene locus_tag LOCUS_29330 2134 2829 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928988.1 protein_id gnl|my_center|LOCUS_29330 2924 3550 gene locus_tag LOCUS_29340 2924 3550 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_29340 3949 3542 gene locus_tag LOCUS_29350 3949 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 4209 3946 gene locus_tag LOCUS_29360 4209 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence297 877 1158 gene locus_tag LOCUS_29370 877 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 2405 1251 gene locus_tag LOCUS_29380 2405 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 2508 2942 gene locus_tag LOCUS_29390 2508 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3127 5859 gene locus_tag LOCUS_29400 gene topA 3127 5859 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence298 <1 831 gene locus_tag LOCUS_29410 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058177.1:AMIN domain-containing protein 1342 899 gene locus_tag LOCUS_29420 1342 899 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_29420 1458 1529 gene locus_tag LOCUS_t00350 1458 1529 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1636 2757 gene locus_tag LOCUS_29430 1636 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 4641 2917 gene locus_tag LOCUS_29440 4641 2917 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108554.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence299 623 1879 gene locus_tag LOCUS_29450 623 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 2823 1876 gene locus_tag LOCUS_29460 2823 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 3844 2705 gene locus_tag LOCUS_29470 3844 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 4865 3726 gene locus_tag LOCUS_29480 4865 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 5068 4853 gene locus_tag LOCUS_29490 5068 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 5961 5131 gene locus_tag LOCUS_29500 5961 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 6286 5963 gene locus_tag LOCUS_29510 6286 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 >Feature sequence300 1028 273 gene locus_tag LOCUS_29520 1028 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1592 2524 gene locus_tag LOCUS_29530 1592 2524 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_29530 2521 2856 gene locus_tag LOCUS_29540 2521 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2853 3692 gene locus_tag LOCUS_29550 2853 3692 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054642.1 protein_id gnl|my_center|LOCUS_29550 3947 4633 gene locus_tag LOCUS_29560 3947 4633 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140230840.1 protein_id gnl|my_center|LOCUS_29560 4784 5203 gene locus_tag LOCUS_29570 4784 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 5244 5615 gene locus_tag LOCUS_29580 5244 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 >Feature sequence301 <1 806 gene locus_tag LOCUS_29590 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257124.1:ATP-binding protein 2002 1427 gene locus_tag LOCUS_29600 2002 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29600 2415 2011 gene locus_tag LOCUS_29610 2415 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29610 2858 3031 gene locus_tag LOCUS_29620 2858 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 3237 5930 gene locus_tag LOCUS_29630 3237 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence302 490 1518 gene locus_tag LOCUS_29640 490 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3372 1834 gene locus_tag LOCUS_29650 3372 1834 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_29650 6238 3377 gene locus_tag LOCUS_29660 6238 3377 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence303 <1 986 gene locus_tag LOCUS_29670 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476096.1:glycosyltransferase family 1 protein 944 2257 gene locus_tag LOCUS_29680 944 2257 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_29680 3053 2352 gene locus_tag LOCUS_29690 3053 2352 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_29690 5069 3258 gene locus_tag LOCUS_29700 5069 3258 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057687.1 protein_id gnl|my_center|LOCUS_29700 6151 5159 gene locus_tag LOCUS_29710 6151 5159 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192786.1 protein_id gnl|my_center|LOCUS_29710 >Feature sequence304 1749 130 gene locus_tag LOCUS_29720 gene hflX 1749 130 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144128.1 protein_id gnl|my_center|LOCUS_29720 1947 2669 gene locus_tag LOCUS_29730 1947 2669 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929052.1 protein_id gnl|my_center|LOCUS_29730 2826 5363 gene locus_tag LOCUS_29740 2826 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 5560 5895 gene locus_tag LOCUS_29750 5560 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence305 1 930 gene locus_tag LOCUS_29760 1 930 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920956.1 protein_id gnl|my_center|LOCUS_29760 1663 1064 gene locus_tag LOCUS_29770 1663 1064 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140673.1 protein_id gnl|my_center|LOCUS_29770 1662 2198 gene locus_tag LOCUS_29780 1662 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140674.1 protein_id gnl|my_center|LOCUS_29780 3035 3292 gene locus_tag LOCUS_29790 3035 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 3700 5064 gene locus_tag LOCUS_29800 gene accC 3700 5064 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_29800 5333 5097 gene locus_tag LOCUS_29810 5333 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 5635 5441 gene locus_tag LOCUS_29820 5635 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 >Feature sequence306 1289 144 gene locus_tag LOCUS_29830 1289 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 1500 1961 gene locus_tag LOCUS_29840 gene rplI 1500 1961 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058245.1 protein_id gnl|my_center|LOCUS_29840 3107 2037 gene locus_tag LOCUS_29850 gene pdxA 3107 2037 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124183.1 protein_id gnl|my_center|LOCUS_29850 3331 4791 gene locus_tag LOCUS_29860 gene dnaA 3331 4791 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056451.1 protein_id gnl|my_center|LOCUS_29860 4918 5442 gene locus_tag LOCUS_29870 4918 5442 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144323.1 protein_id gnl|my_center|LOCUS_29870 5800 5450 gene locus_tag LOCUS_29880 5800 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence307 257 1369 gene locus_tag LOCUS_29890 gene wecB 257 1369 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_29890 1660 2967 gene locus_tag LOCUS_29900 1660 2967 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057835.1 protein_id gnl|my_center|LOCUS_29900 3247 3690 gene locus_tag LOCUS_29910 3247 3690 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_29910 3773 4228 gene locus_tag LOCUS_29920 3773 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 4240 4875 gene locus_tag LOCUS_29930 4240 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 protein_id gnl|my_center|LOCUS_29930 6022 5060 gene locus_tag LOCUS_29940 6022 5060 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_29940 >Feature sequence308 364 1254 gene locus_tag LOCUS_29950 364 1254 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838432.1 protein_id gnl|my_center|LOCUS_29950 2123 1359 gene locus_tag LOCUS_29960 2123 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 3859 2963 gene locus_tag LOCUS_29970 3859 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 <6297 3984 gene locus_tag LOCUS_29980 <6297 3984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259371.1:EAL domain-containing protein >Feature sequence309 329 1243 gene locus_tag LOCUS_29990 gene glyQ 329 1243 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141446.1 protein_id gnl|my_center|LOCUS_29990 1891 2412 gene locus_tag LOCUS_30000 1891 2412 CDS product phycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057792.1 protein_id gnl|my_center|LOCUS_30000 2462 2953 gene locus_tag LOCUS_30010 gene cpcA 2462 2953 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_30010 3312 4127 gene locus_tag LOCUS_30020 3312 4127 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009454959.1 protein_id gnl|my_center|LOCUS_30020 4146 4970 gene locus_tag LOCUS_30030 4146 4970 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057797.1 protein_id gnl|my_center|LOCUS_30030 5441 5025 gene locus_tag LOCUS_30040 5441 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 <6296 5576 gene locus_tag LOCUS_30050 <6296 5576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142768.1:carotenoid oxygenase family protein >Feature sequence310 4299 5069 gene locus_tag LOCUS_30060 gene hisF 4299 5069 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799407.1 protein_id gnl|my_center|LOCUS_30060 >Feature sequence311 383 631 gene locus_tag LOCUS_30070 383 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 628 1914 gene locus_tag LOCUS_30080 628 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 1911 2138 gene locus_tag LOCUS_30090 1911 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 2147 2374 gene locus_tag LOCUS_30100 2147 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 2367 2543 gene locus_tag LOCUS_30110 2367 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 2742 3137 gene locus_tag LOCUS_30120 2742 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3127 3519 gene locus_tag LOCUS_30130 3127 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 4060 4557 gene locus_tag LOCUS_30140 4060 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 4878 5537 gene locus_tag LOCUS_30150 4878 5537 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_30150 5731 6144 gene locus_tag LOCUS_30160 5731 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence312 1492 62 gene locus_tag LOCUS_30170 1492 62 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_30170 1607 2995 gene locus_tag LOCUS_30180 1607 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3004 4515 gene locus_tag LOCUS_30190 3004 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 4627 5118 gene locus_tag LOCUS_30200 4627 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 <6197 5412 gene locus_tag LOCUS_30210 <6197 5412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920675.1:sulfite reductase, ferredoxin dependent >Feature sequence313 697 1494 gene locus_tag LOCUS_30220 697 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3913 1580 gene locus_tag LOCUS_30230 3913 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 4202 3972 gene locus_tag LOCUS_30240 4202 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 4492 4190 gene locus_tag LOCUS_30250 4492 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083794109.1 protein_id gnl|my_center|LOCUS_30250 <6189 4553 gene locus_tag LOCUS_30260 <6189 4553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056385.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG >Feature sequence314 1906 194 gene locus_tag LOCUS_30270 gene ribBA 1906 194 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920923.1 protein_id gnl|my_center|LOCUS_30270 3105 2341 gene locus_tag LOCUS_30280 3105 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 3612 4841 gene locus_tag LOCUS_30290 3612 4841 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057279.1 protein_id gnl|my_center|LOCUS_30290 4940 5575 gene locus_tag LOCUS_30300 4940 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence315 131 1039 gene locus_tag LOCUS_30310 131 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 1083 1376 gene locus_tag LOCUS_30320 1083 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 1603 4533 gene locus_tag LOCUS_30330 1603 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 4538 5857 gene locus_tag LOCUS_30340 4538 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence316 <1 3113 gene locus_tag LOCUS_30350 <1 3113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_115892361.1:ATP-binding protein 3186 3641 gene locus_tag LOCUS_30360 3186 3641 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_30360 5316 3733 gene locus_tag LOCUS_30370 5316 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 <6134 5402 gene locus_tag LOCUS_30380 <6134 5402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143057.1:cytochrome P450 >Feature sequence317 346 182 gene locus_tag LOCUS_30390 346 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 815 5326 gene locus_tag LOCUS_30400 815 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 5528 5298 gene locus_tag LOCUS_30410 5528 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 5721 6068 gene locus_tag LOCUS_30420 5721 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence318 1073 99 gene locus_tag LOCUS_30430 1073 99 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_30430 2442 1348 gene locus_tag LOCUS_30440 2442 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 2875 2630 gene locus_tag LOCUS_30450 2875 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 3189 3578 gene locus_tag LOCUS_30460 3189 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 4278 3820 gene locus_tag LOCUS_30470 4278 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 4880 4446 gene locus_tag LOCUS_30480 4880 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 5261 4962 gene locus_tag LOCUS_30490 5261 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 5644 5853 gene locus_tag LOCUS_30500 5644 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence319 613 71 gene locus_tag LOCUS_30510 613 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 967 1725 gene locus_tag LOCUS_30520 967 1725 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547542.1 protein_id gnl|my_center|LOCUS_30520 1903 2118 gene locus_tag LOCUS_30530 1903 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 2547 2173 gene locus_tag LOCUS_30540 2547 2173 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143794.1 protein_id gnl|my_center|LOCUS_30540 4139 2583 gene locus_tag LOCUS_30550 4139 2583 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143795.1 protein_id gnl|my_center|LOCUS_30550 5330 4314 gene locus_tag LOCUS_30560 5330 4314 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056320.1 protein_id gnl|my_center|LOCUS_30560 >Feature sequence320 967 137 gene locus_tag LOCUS_30570 gene lpxA 967 137 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941664.1 protein_id gnl|my_center|LOCUS_30570 1540 1274 gene locus_tag LOCUS_30580 1540 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 4627 1727 gene locus_tag LOCUS_30590 4627 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 4801 5721 gene locus_tag LOCUS_30600 4801 5721 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence321 1851 142 gene locus_tag LOCUS_30610 gene kdpA 1851 142 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208340514.1 protein_id gnl|my_center|LOCUS_30610 2229 1984 gene locus_tag LOCUS_30620 2229 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 4193 2256 gene locus_tag LOCUS_30630 gene kdpB 4193 2256 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140577.1 protein_id gnl|my_center|LOCUS_30630 4812 5882 gene locus_tag LOCUS_30640 4812 5882 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928544.1 protein_id gnl|my_center|LOCUS_30640 >Feature sequence322 393 118 gene locus_tag LOCUS_30650 393 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 920 1171 gene locus_tag LOCUS_30660 920 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 1459 1710 gene locus_tag LOCUS_30670 1459 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 1714 1983 gene locus_tag LOCUS_30680 1714 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 2743 2186 gene locus_tag LOCUS_30690 2743 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 2929 3522 gene locus_tag LOCUS_30700 2929 3522 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_30700 3736 4014 gene locus_tag LOCUS_30710 3736 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 3995 4228 gene locus_tag LOCUS_30720 3995 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 4425 4760 gene locus_tag LOCUS_30730 4425 4760 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141424.1 protein_id gnl|my_center|LOCUS_30730 4757 5128 gene locus_tag LOCUS_30740 4757 5128 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250023.1 protein_id gnl|my_center|LOCUS_30740 5320 5589 gene locus_tag LOCUS_30750 5320 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 5558 5815 gene locus_tag LOCUS_30760 5558 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence323 833 489 gene locus_tag LOCUS_30770 833 489 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670505.1 protein_id gnl|my_center|LOCUS_30770 1773 913 gene locus_tag LOCUS_30780 1773 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3245 1842 gene locus_tag LOCUS_30790 gene lpdA 3245 1842 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920772.1 protein_id gnl|my_center|LOCUS_30790 4170 3430 gene locus_tag LOCUS_30800 4170 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 5291 4167 gene locus_tag LOCUS_30810 5291 4167 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088620334.1 protein_id gnl|my_center|LOCUS_30810 >Feature sequence324 644 937 gene locus_tag LOCUS_30820 644 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 903 1370 gene locus_tag LOCUS_30830 903 1370 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975642.1 protein_id gnl|my_center|LOCUS_30830 1779 1399 gene locus_tag LOCUS_30840 1779 1399 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250023.1 protein_id gnl|my_center|LOCUS_30840 2114 1776 gene locus_tag LOCUS_30850 2114 1776 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_30850 <5959 2127 gene locus_tag LOCUS_30860 <5959 2127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022345.1:BREX-1 system adenine-specific DNA-methyltransferase PglX >Feature sequence325 250 999 gene locus_tag LOCUS_30870 250 999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124630.1 protein_id gnl|my_center|LOCUS_30870 1011 1871 gene locus_tag LOCUS_30880 1011 1871 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057473.1 protein_id gnl|my_center|LOCUS_30880 2272 2862 gene locus_tag LOCUS_30890 2272 2862 CDS product DUF3177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166278063.1 protein_id gnl|my_center|LOCUS_30890 3827 2895 gene locus_tag LOCUS_30900 3827 2895 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056335.1 protein_id gnl|my_center|LOCUS_30900 4258 5319 gene locus_tag LOCUS_30910 4258 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence326 1556 255 gene locus_tag LOCUS_30920 1556 255 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037141.1 protein_id gnl|my_center|LOCUS_30920 1946 2836 gene locus_tag LOCUS_30930 1946 2836 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_30930 3435 5843 gene locus_tag LOCUS_30940 3435 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence327 172 1386 gene locus_tag LOCUS_30950 172 1386 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_30950 4044 1507 gene locus_tag LOCUS_30960 4044 1507 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057936.1 protein_id gnl|my_center|LOCUS_30960 4436 5620 gene locus_tag LOCUS_30970 4436 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 >Feature sequence328 <1 959 gene locus_tag LOCUS_30980 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036891794.1:carotene isomerase 1019 1249 gene locus_tag LOCUS_30990 1019 1249 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_30990 1331 3082 gene locus_tag LOCUS_31000 1331 3082 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296385.1 protein_id gnl|my_center|LOCUS_31000 3955 3410 gene locus_tag LOCUS_31010 gene cobU 3955 3410 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_31010 4007 4633 gene locus_tag LOCUS_31020 4007 4633 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140313.1 protein_id gnl|my_center|LOCUS_31020 4684 5184 gene locus_tag LOCUS_31030 4684 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 5191 5766 gene locus_tag LOCUS_31040 5191 5766 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142575.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence329 334 984 gene locus_tag LOCUS_31050 334 984 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_31050 1194 2537 gene locus_tag LOCUS_31060 1194 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 2550 4538 gene locus_tag LOCUS_31070 2550 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 4549 4788 gene locus_tag LOCUS_31080 4549 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 4935 5273 gene locus_tag LOCUS_31090 4935 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 5279 5629 gene locus_tag LOCUS_31100 5279 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 >Feature sequence330 716 102 gene locus_tag LOCUS_31110 716 102 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056907.1 protein_id gnl|my_center|LOCUS_31110 2034 1006 gene locus_tag LOCUS_31120 2034 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 5452 2213 gene locus_tag LOCUS_31130 5452 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence331 1316 108 gene locus_tag LOCUS_31140 gene tyrS 1316 108 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055905.1 protein_id gnl|my_center|LOCUS_31140 3123 1414 gene locus_tag LOCUS_31150 3123 1414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056806.1 protein_id gnl|my_center|LOCUS_31150 3418 5769 gene locus_tag LOCUS_31160 3418 5769 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence332 2737 65 gene locus_tag LOCUS_31170 2737 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 4142 3081 gene locus_tag LOCUS_31180 4142 3081 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_31180 4894 4139 gene locus_tag LOCUS_31190 4894 4139 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_31190 5748 5074 gene locus_tag LOCUS_31200 5748 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence333 1878 4 gene locus_tag LOCUS_31210 1878 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 4868 1932 gene locus_tag LOCUS_31220 4868 1932 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077210409.1 protein_id gnl|my_center|LOCUS_31220 5168 5812 gene locus_tag LOCUS_31230 5168 5812 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074405.1 protein_id gnl|my_center|LOCUS_31230 >Feature sequence334 394 203 gene locus_tag LOCUS_31240 394 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 746 2005 gene locus_tag LOCUS_31250 746 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 2030 2710 gene locus_tag LOCUS_31260 2030 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 4133 3186 gene locus_tag LOCUS_31270 4133 3186 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_31270 4927 4133 gene locus_tag LOCUS_31280 4927 4133 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562943.1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence335 1946 399 gene locus_tag LOCUS_31290 1946 399 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053221433.1 protein_id gnl|my_center|LOCUS_31290 2657 2094 gene locus_tag LOCUS_31300 2657 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3301 2654 gene locus_tag LOCUS_31310 3301 2654 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 protein_id gnl|my_center|LOCUS_31310 3901 5484 gene locus_tag LOCUS_31320 3901 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 5429 5722 gene locus_tag LOCUS_31330 5429 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence336 <1 569 gene locus_tag LOCUS_31340 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921807.1:alternate F1F0 ATPase, F1 subunit alpha 572 1477 gene locus_tag LOCUS_31350 572 1477 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_31350 1608 3035 gene locus_tag LOCUS_31360 gene atpD 1608 3035 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_31360 3032 3436 gene locus_tag LOCUS_31370 3032 3436 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120166.1 protein_id gnl|my_center|LOCUS_31370 3438 3863 gene locus_tag LOCUS_31380 3438 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 4562 4750 gene locus_tag LOCUS_31390 4562 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 4796 5242 gene locus_tag LOCUS_31400 4796 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 5185 5508 gene locus_tag LOCUS_31410 5185 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence337 <1 900 gene locus_tag LOCUS_31420 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141692.1:metal ABC transporter permease 1248 943 gene locus_tag LOCUS_31430 1248 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 1372 1617 gene locus_tag LOCUS_31440 1372 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 1663 2955 gene locus_tag LOCUS_31450 1663 2955 CDS product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_31450 3238 3720 gene locus_tag LOCUS_31460 3238 3720 CDS product MSMEG_0572 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891993.1 protein_id gnl|my_center|LOCUS_31460 3746 4747 gene locus_tag LOCUS_31470 3746 4747 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 protein_id gnl|my_center|LOCUS_31470 >Feature sequence338 1922 579 gene locus_tag LOCUS_31480 1922 579 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_31480 2579 3028 gene locus_tag LOCUS_31490 2579 3028 CDS product DUF3531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_31490 3082 3465 gene locus_tag LOCUS_31500 gene gloA 3082 3465 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814410.1 protein_id gnl|my_center|LOCUS_31500 3756 5216 gene locus_tag LOCUS_31510 3756 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence339 <1 558 gene locus_tag LOCUS_31520 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921008.1:ketol-acid reductoisomerase 2561 732 gene locus_tag LOCUS_31530 gene mrdA 2561 732 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 protein_id gnl|my_center|LOCUS_31530 2729 3166 gene locus_tag LOCUS_31540 2729 3166 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083625306.1 protein_id gnl|my_center|LOCUS_31540 3324 5597 gene locus_tag LOCUS_31550 3324 5597 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920718.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence340 2743 947 gene locus_tag LOCUS_31560 gene aspS 2743 947 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056986.1 protein_id gnl|my_center|LOCUS_31560 3371 2976 gene locus_tag LOCUS_31570 gene arsC 3371 2976 CDS product arsenate reductase, glutathione/glutaredoxin type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 protein_id gnl|my_center|LOCUS_31570 3782 3387 gene locus_tag LOCUS_31580 3782 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 4109 5065 gene locus_tag LOCUS_31590 4109 5065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_31590 5743 5144 gene locus_tag LOCUS_31600 5743 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 >Feature sequence341 1222 899 gene locus_tag LOCUS_31610 1222 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 3326 2865 gene locus_tag LOCUS_31620 3326 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3930 3724 gene locus_tag LOCUS_31630 3930 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 4290 4042 gene locus_tag LOCUS_31640 4290 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence342 592 912 gene locus_tag LOCUS_31650 592 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 979 1449 gene locus_tag LOCUS_31660 979 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 1481 3568 gene locus_tag LOCUS_31670 1481 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31670 3578 3952 gene locus_tag LOCUS_31680 3578 3952 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_31680 4129 4512 gene locus_tag LOCUS_31690 4129 4512 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_31690 4885 5268 gene locus_tag LOCUS_31700 4885 5268 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence343 758 1222 gene locus_tag LOCUS_31710 758 1222 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087117.1 protein_id gnl|my_center|LOCUS_31710 1401 3656 gene locus_tag LOCUS_31720 1401 3656 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_31720 3731 4255 gene locus_tag LOCUS_31730 3731 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 4691 4338 gene locus_tag LOCUS_31740 4691 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 5070 4822 gene locus_tag LOCUS_31750 5070 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence344 <1 576 gene locus_tag LOCUS_31760 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140835.1:Cof-type HAD-IIB family hydrolase 620 1588 gene locus_tag LOCUS_31770 620 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 2304 1699 gene locus_tag LOCUS_31780 2304 1699 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140612.1 protein_id gnl|my_center|LOCUS_31780 3260 2412 gene locus_tag LOCUS_31790 3260 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3952 4437 gene locus_tag LOCUS_31800 3952 4437 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125616.1 protein_id gnl|my_center|LOCUS_31800 4434 4907 gene locus_tag LOCUS_31810 4434 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence345 206 1030 gene locus_tag LOCUS_31820 206 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 1487 1759 gene locus_tag LOCUS_31830 1487 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1756 2166 gene locus_tag LOCUS_31840 1756 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 2262 2477 gene locus_tag LOCUS_31850 2262 2477 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_31850 2814 3080 gene locus_tag LOCUS_31860 2814 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 3067 3468 gene locus_tag LOCUS_31870 3067 3468 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_31870 4417 3749 gene locus_tag LOCUS_31880 4417 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence346 <1 1530 gene locus_tag LOCUS_31890 <1 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057762.1:chromosome segregation protein SMC note possible pseudo, internal stop codon 1582 2235 gene locus_tag LOCUS_31900 1582 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31900 2741 2340 gene locus_tag LOCUS_31910 2741 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 3643 2972 gene locus_tag LOCUS_31920 3643 2972 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_31920 4995 3697 gene locus_tag LOCUS_31930 gene serS 4995 3697 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057392.1 protein_id gnl|my_center|LOCUS_31930 5078 5431 gene locus_tag LOCUS_31940 5078 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 >Feature sequence347 <1 2709 gene locus_tag LOCUS_31950 <1 2709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888895.1:class I SAM-dependent DNA methyltransferase 2807 3052 gene locus_tag LOCUS_31960 2807 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 3049 3306 gene locus_tag LOCUS_31970 gene yoeB 3049 3306 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_31970 3382 3627 gene locus_tag LOCUS_31980 3382 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 3788 4618 gene locus_tag LOCUS_31990 3788 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 4965 5387 gene locus_tag LOCUS_32000 4965 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence348 329 646 gene locus_tag LOCUS_32010 329 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 1271 771 gene locus_tag LOCUS_32020 1271 771 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 protein_id gnl|my_center|LOCUS_32020 1396 3195 gene locus_tag LOCUS_32030 1396 3195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_32030 3224 3802 gene locus_tag LOCUS_32040 3224 3802 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_32040 3808 4257 gene locus_tag LOCUS_32050 3808 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 5427 4282 gene locus_tag LOCUS_32060 gene gshA 5427 4282 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence349 1596 1805 gene locus_tag LOCUS_32070 1596 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 1837 2391 gene locus_tag LOCUS_32080 1837 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 2394 3329 gene locus_tag LOCUS_32090 2394 3329 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224412629.1 protein_id gnl|my_center|LOCUS_32090 3852 3346 gene locus_tag LOCUS_32100 3852 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 5255 4155 gene locus_tag LOCUS_32110 5255 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence350 1814 555 gene locus_tag LOCUS_32120 1814 555 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594983.1 protein_id gnl|my_center|LOCUS_32120 2246 1875 gene locus_tag LOCUS_32130 2246 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 2522 2274 gene locus_tag LOCUS_32140 2522 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 3139 4041 gene locus_tag LOCUS_32150 3139 4041 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_32150 4054 5202 gene locus_tag LOCUS_32160 4054 5202 CDS product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence351 3284 318 gene locus_tag LOCUS_32170 3284 318 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153164114.1 protein_id gnl|my_center|LOCUS_32170 4330 3422 gene locus_tag LOCUS_32180 4330 3422 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_32180 4413 4892 gene locus_tag LOCUS_32190 4413 4892 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142174.1 protein_id gnl|my_center|LOCUS_32190 5134 4919 gene locus_tag LOCUS_32200 5134 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence352 987 151 gene locus_tag LOCUS_32210 987 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 1573 1166 gene locus_tag LOCUS_32220 1573 1166 CDS product heme utilization protein HuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920696.1 protein_id gnl|my_center|LOCUS_32220 1794 2747 gene locus_tag LOCUS_32230 gene cysK 1794 2747 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_32230 4056 2785 gene locus_tag LOCUS_32240 4056 2785 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_32240 4207 4959 gene locus_tag LOCUS_32250 gene cobS 4207 4959 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057177.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence353 499 1002 gene locus_tag LOCUS_32260 499 1002 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040531169.1 protein_id gnl|my_center|LOCUS_32260 1909 1073 gene locus_tag LOCUS_32270 gene thiD 1909 1073 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_32270 2035 2682 gene locus_tag LOCUS_32280 2035 2682 CDS product Mo-dependent nitrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920896.1 protein_id gnl|my_center|LOCUS_32280 2799 3410 gene locus_tag LOCUS_32290 2799 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 3496 4257 gene locus_tag LOCUS_32300 3496 4257 CDS product DUF1350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058307.1 protein_id gnl|my_center|LOCUS_32300 >Feature sequence354 337 2649 gene locus_tag LOCUS_32310 337 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 2744 3802 gene locus_tag LOCUS_32320 2744 3802 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057700.1 protein_id gnl|my_center|LOCUS_32320 4157 5479 gene locus_tag LOCUS_32330 4157 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence355 77 2 gene locus_tag LOCUS_t00360 77 2 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 707 1363 gene locus_tag LOCUS_32340 707 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 2458 1397 gene locus_tag LOCUS_32350 gene ccsB 2458 1397 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057454.1 protein_id gnl|my_center|LOCUS_32350 2666 3295 gene locus_tag LOCUS_32360 2666 3295 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_32360 3647 4231 gene locus_tag LOCUS_32370 3647 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 5024 4257 gene locus_tag LOCUS_32380 5024 4257 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963744.1 protein_id gnl|my_center|LOCUS_32380 5507 5052 gene locus_tag LOCUS_32390 5507 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 >Feature sequence356 2097 256 gene locus_tag LOCUS_32400 gene recN 2097 256 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140275.1 protein_id gnl|my_center|LOCUS_32400 <5555 2110 gene locus_tag LOCUS_32410 <5555 2110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056204.1:response regulator >Feature sequence357 54 362 gene locus_tag LOCUS_32420 54 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 759 367 gene locus_tag LOCUS_32430 759 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 1698 1531 gene locus_tag LOCUS_32440 1698 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 1871 4690 gene locus_tag LOCUS_32450 1871 4690 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268475.1 protein_id gnl|my_center|LOCUS_32450 >Feature sequence358 2048 738 gene locus_tag LOCUS_32460 2048 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 2890 2138 gene locus_tag LOCUS_32470 2890 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 5217 2956 gene locus_tag LOCUS_32480 5217 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence359 1132 41 gene locus_tag LOCUS_32490 gene ychF 1132 41 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_32490 3887 1350 gene locus_tag LOCUS_32500 3887 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 4553 3987 gene locus_tag LOCUS_32510 4553 3987 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_32510 >Feature sequence360 384 118 gene locus_tag LOCUS_32520 384 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_32520 578 381 gene locus_tag LOCUS_32530 578 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 825 628 gene locus_tag LOCUS_32540 825 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 967 839 gene locus_tag LOCUS_32550 967 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 1311 964 gene locus_tag LOCUS_32560 1311 964 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_32560 1433 1663 gene locus_tag LOCUS_32570 1433 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 1653 2105 gene locus_tag LOCUS_32580 1653 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 2150 2725 gene locus_tag LOCUS_32590 2150 2725 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_32590 4092 2770 gene locus_tag LOCUS_32600 4092 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 <5517 4083 gene locus_tag LOCUS_32610 <5517 4083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_095509668.1:ATP-binding protein >Feature sequence361 1796 753 gene locus_tag LOCUS_32620 1796 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 1894 2685 gene locus_tag LOCUS_32630 1894 2685 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_32630 3422 2682 gene locus_tag LOCUS_32640 3422 2682 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_32640 3849 3607 gene locus_tag LOCUS_32650 3849 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 5105 3933 gene locus_tag LOCUS_32660 gene devC 5105 3933 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence362 668 1756 gene locus_tag LOCUS_32670 gene rseP 668 1756 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057479.1 protein_id gnl|my_center|LOCUS_32670 1896 3689 gene locus_tag LOCUS_32680 gene typA 1896 3689 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_32680 3803 3970 gene locus_tag LOCUS_32690 3803 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 4013 4678 gene locus_tag LOCUS_32700 4013 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 5004 4657 gene locus_tag LOCUS_32710 5004 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 >Feature sequence363 611 84 gene locus_tag LOCUS_32720 611 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 1771 617 gene locus_tag LOCUS_32730 1771 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 2290 3288 gene locus_tag LOCUS_32740 gene tilS 2290 3288 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057455.1 protein_id gnl|my_center|LOCUS_32740 4971 3370 gene locus_tag LOCUS_32750 4971 3370 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057727.1 protein_id gnl|my_center|LOCUS_32750 5338 5018 gene locus_tag LOCUS_32760 gene sugE 5338 5018 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence364 <1 957 gene locus_tag LOCUS_32770 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022102.1:class I SAM-dependent DNA methyltransferase 1464 994 gene locus_tag LOCUS_32780 1464 994 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_32780 2783 1488 gene locus_tag LOCUS_32790 2783 1488 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921083.1 protein_id gnl|my_center|LOCUS_32790 3395 3054 gene locus_tag LOCUS_32800 3395 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 4355 3675 gene locus_tag LOCUS_32810 4355 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 <5420 4451 gene locus_tag LOCUS_32820 <5420 4451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920846.1:FGGY-family carbohydrate kinase >Feature sequence365 1469 1170 gene locus_tag LOCUS_32830 1469 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 2440 1466 gene locus_tag LOCUS_32840 2440 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 2786 2526 gene locus_tag LOCUS_32850 2786 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3259 2951 gene locus_tag LOCUS_32860 3259 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3853 3524 gene locus_tag LOCUS_32870 3853 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 4144 3932 gene locus_tag LOCUS_32880 4144 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 5232 4156 gene locus_tag LOCUS_32890 5232 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence366 1001 1237 gene locus_tag LOCUS_32900 1001 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 1677 1270 gene locus_tag LOCUS_32910 1677 1270 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_32910 1916 1674 gene locus_tag LOCUS_32920 1916 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 4553 2010 gene locus_tag LOCUS_32930 4553 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 4975 4664 gene locus_tag LOCUS_32940 4975 4664 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 protein_id gnl|my_center|LOCUS_32940 5212 4991 gene locus_tag LOCUS_32950 5212 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence367 3397 428 gene locus_tag LOCUS_32960 3397 428 CDS product Tn3-like element TnAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138014.1 protein_id gnl|my_center|LOCUS_32960 3546 4142 gene locus_tag LOCUS_32970 3546 4142 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_32970 4600 4244 gene locus_tag LOCUS_32980 4600 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence368 778 581 gene locus_tag LOCUS_32990 778 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 1283 5359 gene locus_tag LOCUS_33000 1283 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence369 1187 162 gene locus_tag LOCUS_33010 1187 162 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_33010 1584 3149 gene locus_tag LOCUS_33020 1584 3149 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_33020 4169 3159 gene locus_tag LOCUS_33030 4169 3159 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142171.1 protein_id gnl|my_center|LOCUS_33030 4472 4230 gene locus_tag LOCUS_33040 4472 4230 CDS product ferredoxin-thioredoxin reductase variable chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_33040 5017 4571 gene locus_tag LOCUS_33050 gene rsfS 5017 4571 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172029.1 protein_id gnl|my_center|LOCUS_33050 >Feature sequence370 1834 2529 gene locus_tag LOCUS_33060 1834 2529 CDS product aldehyde oxygenase (deformylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057153.1 protein_id gnl|my_center|LOCUS_33060 2690 3709 gene locus_tag LOCUS_33070 2690 3709 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 protein_id gnl|my_center|LOCUS_33070 4243 3743 gene locus_tag LOCUS_33080 4243 3743 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_33080 5304 4336 gene locus_tag LOCUS_33090 gene arsJ 5304 4336 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_33090 >Feature sequence371 1495 1292 gene locus_tag LOCUS_33100 1495 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 1760 1524 gene locus_tag LOCUS_33110 1760 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_33110 3193 1793 gene locus_tag LOCUS_33120 3193 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 3732 3196 gene locus_tag LOCUS_33130 3732 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 4625 3990 gene locus_tag LOCUS_33140 gene kdpC 4625 3990 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883955.1 protein_id gnl|my_center|LOCUS_33140 <5382 4708 gene locus_tag LOCUS_33150 <5382 4708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208340514.1:potassium-transporting ATPase subunit KdpA >Feature sequence372 1228 302 gene locus_tag LOCUS_33160 1228 302 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_33160 1273 1734 gene locus_tag LOCUS_33170 1273 1734 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142174.1 protein_id gnl|my_center|LOCUS_33170 1760 4804 gene locus_tag LOCUS_33180 1760 4804 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153164114.1 protein_id gnl|my_center|LOCUS_33180 >Feature sequence373 1097 2080 gene locus_tag LOCUS_33190 1097 2080 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259671.1 protein_id gnl|my_center|LOCUS_33190 2980 2072 gene locus_tag LOCUS_33200 gene miaA 2980 2072 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056495.1 protein_id gnl|my_center|LOCUS_33200 3570 2983 gene locus_tag LOCUS_33210 3570 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 4045 3674 gene locus_tag LOCUS_33220 4045 3674 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_33220 4598 4050 gene locus_tag LOCUS_33230 4598 4050 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_33230 5187 4684 gene locus_tag LOCUS_33240 5187 4684 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920769.1 protein_id gnl|my_center|LOCUS_33240 >Feature sequence374 1487 1041 gene locus_tag LOCUS_33250 1487 1041 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_33250 2193 1543 gene locus_tag LOCUS_33260 2193 1543 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920927.1 protein_id gnl|my_center|LOCUS_33260 3552 2398 gene locus_tag LOCUS_33270 gene corA 3552 2398 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_33270 >Feature sequence375 353 3637 gene locus_tag LOCUS_33280 353 3637 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391010.1 protein_id gnl|my_center|LOCUS_33280 3986 4390 gene locus_tag LOCUS_33290 3986 4390 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence376 480 175 gene locus_tag LOCUS_33300 gene rpsN 480 175 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057663.1 protein_id gnl|my_center|LOCUS_33300 1001 3457 gene locus_tag LOCUS_33310 gene recG 1001 3457 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_33310 3557 3910 gene locus_tag LOCUS_33320 3557 3910 CDS product DUF565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_33320 4555 3956 gene locus_tag LOCUS_33330 4555 3956 CDS product P-loop NTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056761.1 protein_id gnl|my_center|LOCUS_33330 4854 5156 gene locus_tag LOCUS_33340 4854 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 >Feature sequence377 57 302 gene locus_tag LOCUS_33350 57 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 467 991 gene locus_tag LOCUS_33360 467 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 1018 1506 gene locus_tag LOCUS_33370 1018 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 3007 1649 gene locus_tag LOCUS_33380 3007 1649 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_33380 4482 3082 gene locus_tag LOCUS_33390 4482 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 >Feature sequence378 459 1439 gene locus_tag LOCUS_33400 459 1439 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891713.1 protein_id gnl|my_center|LOCUS_33400 1548 3203 gene locus_tag LOCUS_33410 gene ctaD 1548 3203 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057845.1 protein_id gnl|my_center|LOCUS_33410 3300 3926 gene locus_tag LOCUS_33420 3300 3926 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_33420 4027 4914 gene locus_tag LOCUS_33430 4027 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 >Feature sequence379 902 318 gene locus_tag LOCUS_33440 902 318 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142559.1 protein_id gnl|my_center|LOCUS_33440 1178 936 gene locus_tag LOCUS_33450 1178 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 1517 2062 gene locus_tag LOCUS_33460 1517 2062 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056462.1 protein_id gnl|my_center|LOCUS_33460 3157 2282 gene locus_tag LOCUS_33470 3157 2282 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172344.1 protein_id gnl|my_center|LOCUS_33470 3781 4026 gene locus_tag LOCUS_33480 3781 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 4932 4357 gene locus_tag LOCUS_33490 4932 4357 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058243.1 protein_id gnl|my_center|LOCUS_33490 >Feature sequence380 217 555 gene locus_tag LOCUS_33500 217 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 537 956 gene locus_tag LOCUS_33510 gene vapC26 537 956 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_33510 2898 1159 gene locus_tag LOCUS_33520 2898 1159 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_33520 3913 2891 gene locus_tag LOCUS_33530 3913 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 <5300 3910 gene locus_tag LOCUS_33540 <5300 3910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383504.1:Z1 domain-containing protein >Feature sequence381 795 34 gene locus_tag LOCUS_33550 795 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 1607 804 gene locus_tag LOCUS_33560 gene minD 1607 804 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057852.1 protein_id gnl|my_center|LOCUS_33560 2672 1617 gene locus_tag LOCUS_33570 2672 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 <5297 2777 gene locus_tag LOCUS_33580 <5297 2777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056163.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence382 5139 34 gene locus_tag LOCUS_33590 5139 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence383 277 657 gene locus_tag LOCUS_33600 277 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 1497 688 gene locus_tag LOCUS_33610 1497 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 2878 1499 gene locus_tag LOCUS_33620 2878 1499 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 protein_id gnl|my_center|LOCUS_33620 3182 4168 gene locus_tag LOCUS_33630 3182 4168 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532086.1 protein_id gnl|my_center|LOCUS_33630 4928 4182 gene locus_tag LOCUS_33640 gene ytaF 4928 4182 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100738.1 protein_id gnl|my_center|LOCUS_33640 >Feature sequence384 1062 1709 gene locus_tag LOCUS_33650 1062 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 1721 2428 gene locus_tag LOCUS_33660 1721 2428 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143609.1 protein_id gnl|my_center|LOCUS_33660 2447 3031 gene locus_tag LOCUS_33670 2447 3031 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141154.1 protein_id gnl|my_center|LOCUS_33670 3089 3850 gene locus_tag LOCUS_33680 3089 3850 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141153.1 protein_id gnl|my_center|LOCUS_33680 4058 5155 gene locus_tag LOCUS_33690 4058 5155 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681105.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence385 822 49 gene locus_tag LOCUS_33700 822 49 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_33700 1338 2921 gene locus_tag LOCUS_33710 gene serA 1338 2921 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_33710 2977 3126 gene locus_tag LOCUS_33720 2977 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 3203 4072 gene locus_tag LOCUS_33730 gene prmC 3203 4072 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187304.1 protein_id gnl|my_center|LOCUS_33730 4563 4060 gene locus_tag LOCUS_33740 4563 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143287.1 protein_id gnl|my_center|LOCUS_33740 5132 4623 gene locus_tag LOCUS_33750 5132 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056916.1 protein_id gnl|my_center|LOCUS_33750 >Feature sequence386 634 1782 gene locus_tag LOCUS_33760 634 1782 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33760 1844 3484 gene locus_tag LOCUS_33770 1844 3484 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 protein_id gnl|my_center|LOCUS_33770 4079 3648 gene locus_tag LOCUS_33780 4079 3648 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141959.1 protein_id gnl|my_center|LOCUS_33780 4130 4525 gene locus_tag LOCUS_33790 4130 4525 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence387 469 1617 gene locus_tag LOCUS_33800 469 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 1614 2120 gene locus_tag LOCUS_33810 1614 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 2141 2692 gene locus_tag LOCUS_33820 2141 2692 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524131.1 protein_id gnl|my_center|LOCUS_33820 2900 3211 gene locus_tag LOCUS_33830 gene groES 2900 3211 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142890.1 protein_id gnl|my_center|LOCUS_33830 3345 5009 gene locus_tag LOCUS_33840 gene groL 3345 5009 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142891.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence388 <1 1134 gene locus_tag LOCUS_33850 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141853.1:excinuclease ABC subunit UvrB 1292 2002 gene locus_tag LOCUS_33860 1292 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 2086 3408 gene locus_tag LOCUS_33870 2086 3408 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_33870 3405 4160 gene locus_tag LOCUS_33880 3405 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 <5228 4266 gene locus_tag LOCUS_33890 <5228 4266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226213.1:DUF2235 domain-containing protein >Feature sequence389 193 120 gene locus_tag LOCUS_t00370 193 120 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1344 604 gene locus_tag LOCUS_33900 1344 604 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228262.1 protein_id gnl|my_center|LOCUS_33900 1737 3032 gene locus_tag LOCUS_33910 1737 3032 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388381.1 protein_id gnl|my_center|LOCUS_33910 3114 4799 gene locus_tag LOCUS_33920 3114 4799 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124699.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence390 68 298 gene locus_tag LOCUS_33930 68 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 288 554 gene locus_tag LOCUS_33940 288 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 2452 551 gene locus_tag LOCUS_33950 2452 551 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 protein_id gnl|my_center|LOCUS_33950 2606 4180 gene locus_tag LOCUS_33960 2606 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 4292 5026 gene locus_tag LOCUS_33970 gene radC 4292 5026 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920920.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence391 1865 324 gene locus_tag LOCUS_33980 1865 324 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544966.1 protein_id gnl|my_center|LOCUS_33980 1865 2914 gene locus_tag LOCUS_33990 gene cbiB 1865 2914 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058209.1 protein_id gnl|my_center|LOCUS_33990 4062 2929 gene locus_tag LOCUS_34000 4062 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 5015 4248 gene locus_tag LOCUS_34010 5015 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 >Feature sequence392 2034 124 gene locus_tag LOCUS_34020 2034 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 2929 2075 gene locus_tag LOCUS_34030 2929 2075 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_34030 3160 3492 gene locus_tag LOCUS_34040 3160 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 3506 3820 gene locus_tag LOCUS_34050 3506 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 3932 4225 gene locus_tag LOCUS_34060 3932 4225 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_34060 4212 4427 gene locus_tag LOCUS_34070 4212 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 4445 4681 gene locus_tag LOCUS_34080 4445 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence393 233 1579 gene locus_tag LOCUS_34090 233 1579 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965184.1 protein_id gnl|my_center|LOCUS_34090 3352 1724 gene locus_tag LOCUS_34100 3352 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 4839 3703 gene locus_tag LOCUS_34110 4839 3703 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929667.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence394 1032 82 gene locus_tag LOCUS_34120 1032 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 1401 1177 gene locus_tag LOCUS_34130 1401 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 1684 1418 gene locus_tag LOCUS_34140 1684 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 2746 1979 gene locus_tag LOCUS_34150 2746 1979 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 protein_id gnl|my_center|LOCUS_34150 2953 2880 gene locus_tag LOCUS_t00380 2953 2880 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3518 3027 gene locus_tag LOCUS_34160 3518 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 >Feature sequence395 323 1591 gene locus_tag LOCUS_34170 gene efeB 323 1591 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403825.1 protein_id gnl|my_center|LOCUS_34170 2700 1945 gene locus_tag LOCUS_34180 2700 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 2954 2766 gene locus_tag LOCUS_34190 2954 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 3432 3022 gene locus_tag LOCUS_34200 3432 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 4172 3429 gene locus_tag LOCUS_34210 4172 3429 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942220.1 protein_id gnl|my_center|LOCUS_34210 <5140 4179 gene locus_tag LOCUS_34220 <5140 4179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267092.1:AAA family ATPase >Feature sequence396 1661 1993 gene locus_tag LOCUS_34230 1661 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 2150 3892 gene locus_tag LOCUS_34240 2150 3892 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144388.1 protein_id gnl|my_center|LOCUS_34240 4239 4661 gene locus_tag LOCUS_34250 4239 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence397 2 1387 gene locus_tag LOCUS_34260 2 1387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142862.1 protein_id gnl|my_center|LOCUS_34260 1873 1415 gene locus_tag LOCUS_34270 gene smpB 1873 1415 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_34270 2243 1893 gene locus_tag LOCUS_34280 2243 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057889.1 protein_id gnl|my_center|LOCUS_34280 2560 4344 gene locus_tag LOCUS_34290 2560 4344 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141551.1 protein_id gnl|my_center|LOCUS_34290 4514 4786 gene locus_tag LOCUS_34300 4514 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530057.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence398 <5110 836 gene locus_tag LOCUS_34310 <5110 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence399 447 1028 gene locus_tag LOCUS_34320 447 1028 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 protein_id gnl|my_center|LOCUS_34320 1114 4710 gene locus_tag LOCUS_34330 gene brxC 1114 4710 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_34330 >Feature sequence400 67 1236 gene locus_tag LOCUS_34340 67 1236 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_34340 1358 2560 gene locus_tag LOCUS_34350 gene devC 1358 2560 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140489.1 protein_id gnl|my_center|LOCUS_34350 2620 3306 gene locus_tag LOCUS_34360 2620 3306 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_34360 3311 4153 gene locus_tag LOCUS_34370 3311 4153 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207243.1 protein_id gnl|my_center|LOCUS_34370 4227 4991 gene locus_tag LOCUS_34380 4227 4991 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246488.1 protein_id gnl|my_center|LOCUS_34380 >Feature sequence401 441 1220 gene locus_tag LOCUS_34390 441 1220 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_34390 1254 1583 gene locus_tag LOCUS_34400 1254 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 3504 1795 gene locus_tag LOCUS_34410 gene murJ 3504 1795 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058183.1 protein_id gnl|my_center|LOCUS_34410 4016 3717 gene locus_tag LOCUS_34420 4016 3717 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_34420 <5100 4483 gene locus_tag LOCUS_34430 <5100 4483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198128218.1:glycine--tRNA ligase subunit beta >Feature sequence402 1 675 gene locus_tag LOCUS_34440 1 675 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090825.1 protein_id gnl|my_center|LOCUS_34440 889 1962 gene locus_tag LOCUS_34450 889 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 2112 3020 gene locus_tag LOCUS_34460 2112 3020 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640518.1 protein_id gnl|my_center|LOCUS_34460 3951 3268 gene locus_tag LOCUS_34470 3951 3268 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530096.1 protein_id gnl|my_center|LOCUS_34470 4053 4739 gene locus_tag LOCUS_34480 4053 4739 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202239.1 protein_id gnl|my_center|LOCUS_34480 >Feature sequence403 2812 188 gene locus_tag LOCUS_34490 2812 188 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056205.1 protein_id gnl|my_center|LOCUS_34490 3803 3027 gene locus_tag LOCUS_34500 3803 3027 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057754.1 protein_id gnl|my_center|LOCUS_34500 4237 3815 gene locus_tag LOCUS_34510 4237 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 <5090 4549 gene locus_tag LOCUS_34520 <5090 4549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976409.1:NADP-dependent oxidoreductase >Feature sequence404 <1 2463 gene locus_tag LOCUS_34530 <1 2463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057028.1:phosphoketolase family protein 2552 3190 gene locus_tag LOCUS_34540 2552 3190 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 protein_id gnl|my_center|LOCUS_34540 3197 4414 gene locus_tag LOCUS_34550 3197 4414 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141002.1 protein_id gnl|my_center|LOCUS_34550 >Feature sequence405 563 1327 gene locus_tag LOCUS_34560 563 1327 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_34560 1406 2308 gene locus_tag LOCUS_34570 1406 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 3344 2874 gene locus_tag LOCUS_34580 3344 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 3769 3341 gene locus_tag LOCUS_34590 3769 3341 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081150.1 protein_id gnl|my_center|LOCUS_34590 3903 4274 gene locus_tag LOCUS_34600 3903 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence406 879 1970 gene locus_tag LOCUS_34610 879 1970 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_34610 2222 3304 gene locus_tag LOCUS_34620 2222 3304 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_34620 3619 4815 gene locus_tag LOCUS_34630 3619 4815 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986860.1 protein_id gnl|my_center|LOCUS_34630 >Feature sequence407 4027 3134 gene locus_tag LOCUS_34640 4027 3134 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550718.1 protein_id gnl|my_center|LOCUS_34640 <5057 4468 gene locus_tag LOCUS_34650 <5057 4468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056847.1:DUF697 domain-containing protein >Feature sequence408 584 378 gene locus_tag LOCUS_34660 584 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 1268 3328 gene locus_tag LOCUS_34670 1268 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 3411 3641 gene locus_tag LOCUS_34680 3411 3641 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_34680 3645 4010 gene locus_tag LOCUS_34690 3645 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 4147 4755 gene locus_tag LOCUS_34700 4147 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence409 1083 862 gene locus_tag LOCUS_34710 1083 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 2397 1441 gene locus_tag LOCUS_34720 2397 1441 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_34720 2398 3138 gene locus_tag LOCUS_34730 2398 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 4101 3268 gene locus_tag LOCUS_34740 gene rsmA 4101 3268 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056506.1 protein_id gnl|my_center|LOCUS_34740 4462 4292 gene locus_tag LOCUS_34750 4462 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 4397 4828 gene locus_tag LOCUS_34760 4397 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 >Feature sequence410 2098 2310 gene locus_tag LOCUS_34770 2098 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 2317 2736 gene locus_tag LOCUS_34780 2317 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 2757 2909 gene locus_tag LOCUS_34790 2757 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 3031 3285 gene locus_tag LOCUS_34800 3031 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 3282 3719 gene locus_tag LOCUS_34810 3282 3719 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141048.1 protein_id gnl|my_center|LOCUS_34810 <5046 4004 gene locus_tag LOCUS_34820 <5046 4004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071202.1:dicarboxylate/amino acid:cation symporter >Feature sequence411 663 1352 gene locus_tag LOCUS_34830 663 1352 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_34830 1569 3446 gene locus_tag LOCUS_34840 1569 3446 CDS product arachidonate 15-lipoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895542.1 protein_id gnl|my_center|LOCUS_34840 3511 4761 gene locus_tag LOCUS_34850 3511 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 >Feature sequence412 3888 4520 gene locus_tag LOCUS_34860 3888 4520 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_34860 >Feature sequence413 44 493 gene locus_tag LOCUS_34870 44 493 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_34870 1029 616 gene locus_tag LOCUS_34880 1029 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 1801 1148 gene locus_tag LOCUS_34890 1801 1148 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929078.1 protein_id gnl|my_center|LOCUS_34890 3869 1794 gene locus_tag LOCUS_34900 gene dndD 3869 1794 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_34900 4039 3866 gene locus_tag LOCUS_34910 4039 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 <5028 4142 gene locus_tag LOCUS_34920 <5028 4142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021779460.1:DEAD/DEAH box helicase family protein >Feature sequence414 727 41 gene locus_tag LOCUS_34930 727 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 1165 863 gene locus_tag LOCUS_34940 1165 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 1131 1283 gene locus_tag LOCUS_34950 1131 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 2137 1535 gene locus_tag LOCUS_34960 2137 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 3011 2508 gene locus_tag LOCUS_34970 3011 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 3533 3309 gene locus_tag LOCUS_34980 3533 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 4569 3739 gene locus_tag LOCUS_34990 4569 3739 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929080.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence415 1669 149 gene locus_tag LOCUS_35000 1669 149 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142503.1 protein_id gnl|my_center|LOCUS_35000 2243 2004 gene locus_tag LOCUS_35010 2243 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056628.1 protein_id gnl|my_center|LOCUS_35010 2805 2512 gene locus_tag LOCUS_35020 gene rpsT 2805 2512 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057030.1 protein_id gnl|my_center|LOCUS_35020 3131 4777 gene locus_tag LOCUS_35030 3131 4777 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_35030 >Feature sequence416 397 957 gene locus_tag LOCUS_35040 397 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 2203 1064 gene locus_tag LOCUS_35050 2203 1064 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755904.1 protein_id gnl|my_center|LOCUS_35050 2367 2981 gene locus_tag LOCUS_35060 2367 2981 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 protein_id gnl|my_center|LOCUS_35060 4024 3335 gene locus_tag LOCUS_35070 4024 3335 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530096.1 protein_id gnl|my_center|LOCUS_35070 4108 4497 gene locus_tag LOCUS_35080 4108 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 4521 4952 gene locus_tag LOCUS_35090 4521 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 >Feature sequence417 812 471 gene locus_tag LOCUS_35100 812 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144090.1 protein_id gnl|my_center|LOCUS_35100 1322 819 gene locus_tag LOCUS_35110 1322 819 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144089.1 protein_id gnl|my_center|LOCUS_35110 1894 1421 gene locus_tag LOCUS_35120 1894 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 2435 1962 gene locus_tag LOCUS_35130 2435 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 4367 2658 gene locus_tag LOCUS_35140 4367 2658 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144086.1 protein_id gnl|my_center|LOCUS_35140 >Feature sequence418 1499 1212 gene locus_tag LOCUS_35150 1499 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 1658 3076 gene locus_tag LOCUS_35160 1658 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 3092 3823 gene locus_tag LOCUS_35170 3092 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205180329.1 protein_id gnl|my_center|LOCUS_35170 >Feature sequence419 239 1960 gene locus_tag LOCUS_35180 239 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 3981 2011 gene locus_tag LOCUS_35190 gene acs 3981 2011 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056731.1 protein_id gnl|my_center|LOCUS_35190 <4940 4257 gene locus_tag LOCUS_35200 <4940 4257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544954.1:efflux RND transporter permease subunit >Feature sequence420 529 125 gene locus_tag LOCUS_35210 529 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 1385 693 gene locus_tag LOCUS_35220 1385 693 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_35220 2016 2198 gene locus_tag LOCUS_35230 2016 2198 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056299.1 protein_id gnl|my_center|LOCUS_35230 2313 2798 gene locus_tag LOCUS_35240 2313 2798 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057492.1 protein_id gnl|my_center|LOCUS_35240 2984 3448 gene locus_tag LOCUS_35250 2984 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143509.1 protein_id gnl|my_center|LOCUS_35250 3698 4234 gene locus_tag LOCUS_35260 3698 4234 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_35260 >Feature sequence421 <1 543 gene locus_tag LOCUS_35270 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141113.1:glucosidase 2412 790 gene locus_tag LOCUS_35280 2412 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 3120 2692 gene locus_tag LOCUS_35290 3120 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 3335 3123 gene locus_tag LOCUS_35300 3335 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 4065 3451 gene locus_tag LOCUS_35310 4065 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 4666 4905 gene locus_tag LOCUS_35320 4666 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 >Feature sequence422 1326 196 gene locus_tag LOCUS_35330 1326 196 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 protein_id gnl|my_center|LOCUS_35330 1530 2105 gene locus_tag LOCUS_35340 1530 2105 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973934.1 protein_id gnl|my_center|LOCUS_35340 2308 2931 gene locus_tag LOCUS_35350 gene azoR1 2308 2931 CDS product FMN-dependent NADH-azoreductase AzoR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114189.1 protein_id gnl|my_center|LOCUS_35350 2935 3789 gene locus_tag LOCUS_35360 2935 3789 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 protein_id gnl|my_center|LOCUS_35360 3983 4495 gene locus_tag LOCUS_35370 3983 4495 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942129.1 protein_id gnl|my_center|LOCUS_35370 4588 4821 gene locus_tag LOCUS_35380 4588 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 >Feature sequence423 1408 1785 gene locus_tag LOCUS_35390 1408 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 2690 1839 gene locus_tag LOCUS_35400 2690 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 3921 2749 gene locus_tag LOCUS_35410 3921 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 >Feature sequence424 145 582 gene locus_tag LOCUS_35420 145 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 818 1459 gene locus_tag LOCUS_35430 818 1459 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_35430 1548 3857 gene locus_tag LOCUS_35440 1548 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 >Feature sequence425 1688 513 gene locus_tag LOCUS_35450 gene hemW 1688 513 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143078.1 protein_id gnl|my_center|LOCUS_35450 2273 1896 gene locus_tag LOCUS_35460 2273 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 2721 2329 gene locus_tag LOCUS_35470 2721 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142930.1 protein_id gnl|my_center|LOCUS_35470 3519 2800 gene locus_tag LOCUS_35480 3519 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 4453 3590 gene locus_tag LOCUS_35490 4453 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence426 937 710 gene locus_tag LOCUS_35500 937 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 1226 4090 gene locus_tag LOCUS_35510 1226 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 4264 4569 gene locus_tag LOCUS_35520 4264 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 >Feature sequence427 <4866 2850 gene locus_tag LOCUS_35530 <4866 2850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence428 926 1438 gene locus_tag LOCUS_35540 926 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 1519 2232 gene locus_tag LOCUS_35550 1519 2232 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206013.1 protein_id gnl|my_center|LOCUS_35550 2270 3214 gene locus_tag LOCUS_35560 2270 3214 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_35560 3342 4844 gene locus_tag LOCUS_35570 3342 4844 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_35570 >Feature sequence429 164 9 gene locus_tag LOCUS_35580 164 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 148 783 gene locus_tag LOCUS_35590 148 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 2285 924 gene locus_tag LOCUS_35600 2285 924 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 protein_id gnl|my_center|LOCUS_35600 3033 2386 gene locus_tag LOCUS_35610 3033 2386 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057843.1 protein_id gnl|my_center|LOCUS_35610 3514 3131 gene locus_tag LOCUS_35620 3514 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 3834 4694 gene locus_tag LOCUS_35630 3834 4694 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928708.1 protein_id gnl|my_center|LOCUS_35630 >Feature sequence430 400 861 gene locus_tag LOCUS_35640 400 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 1558 1824 gene locus_tag LOCUS_35650 1558 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 2169 2765 gene locus_tag LOCUS_35660 2169 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 3247 3609 gene locus_tag LOCUS_35670 3247 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 3650 4339 gene locus_tag LOCUS_35680 3650 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 4484 4777 gene locus_tag LOCUS_35690 4484 4777 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence431 242 27 gene locus_tag LOCUS_35700 242 27 CDS product Nif11-like leader peptide family natural product precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125335.1 protein_id gnl|my_center|LOCUS_35700 2140 467 gene locus_tag LOCUS_35710 2140 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 >Feature sequence432 433 1074 gene locus_tag LOCUS_35720 433 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 1161 3347 gene locus_tag LOCUS_35730 1161 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence433 802 239 gene locus_tag LOCUS_35740 802 239 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_35740 979 824 gene locus_tag LOCUS_35750 979 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 1203 1544 gene locus_tag LOCUS_35760 1203 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 1761 4031 gene locus_tag LOCUS_35770 1761 4031 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181512.1 protein_id gnl|my_center|LOCUS_35770 4127 4345 gene locus_tag LOCUS_35780 4127 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 4363 4605 gene locus_tag LOCUS_35790 4363 4605 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305108.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence434 212 703 gene locus_tag LOCUS_35800 212 703 CDS product thylakoid membrane photosystem I accumulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798220.1 protein_id gnl|my_center|LOCUS_35800 944 1354 gene locus_tag LOCUS_35810 944 1354 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_35810 2804 1446 gene locus_tag LOCUS_35820 2804 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 3542 3069 gene locus_tag LOCUS_35830 3542 3069 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_35830 >Feature sequence435 1897 2376 gene locus_tag LOCUS_35840 1897 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 2395 3033 gene locus_tag LOCUS_35850 gene pdxH 2395 3033 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 protein_id gnl|my_center|LOCUS_35850 3109 3546 gene locus_tag LOCUS_35860 3109 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 4588 3539 gene locus_tag LOCUS_35870 4588 3539 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_35870 >Feature sequence436 907 2328 gene locus_tag LOCUS_35880 gene mnmE 907 2328 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056805.1 protein_id gnl|my_center|LOCUS_35880 2337 4568 gene locus_tag LOCUS_35890 gene recQ 2337 4568 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence437 <1 840 gene locus_tag LOCUS_35900 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807931.1:glutamate synthase large subunit 1277 876 gene locus_tag LOCUS_35910 1277 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 1513 1280 gene locus_tag LOCUS_35920 1513 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 1568 1801 gene locus_tag LOCUS_35930 1568 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_35930 1903 2385 gene locus_tag LOCUS_35940 1903 2385 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_35940 2623 3717 gene locus_tag LOCUS_35950 2623 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 4134 3907 gene locus_tag LOCUS_35960 4134 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 4432 4154 gene locus_tag LOCUS_35970 4432 4154 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence438 233 796 gene locus_tag LOCUS_35980 233 796 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_35980 893 1015 gene locus_tag LOCUS_35990 893 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 2280 1012 gene locus_tag LOCUS_36000 2280 1012 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_36000 2668 3822 gene locus_tag LOCUS_36010 gene alr 2668 3822 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056313.1 protein_id gnl|my_center|LOCUS_36010 >Feature sequence439 <1 1618 gene locus_tag LOCUS_36020 <1 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294594.1:histidine kinase dimerization/phosphoacceptor domain -containing protein 1734 4334 gene locus_tag LOCUS_36030 gene acnB 1734 4334 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797887.1 protein_id gnl|my_center|LOCUS_36030 >Feature sequence440 2897 36 gene locus_tag LOCUS_36040 gene uvrA 2897 36 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524117.1 protein_id gnl|my_center|LOCUS_36040 3212 4096 gene locus_tag LOCUS_36050 3212 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 >Feature sequence441 550 849 gene locus_tag LOCUS_36060 550 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 1828 1250 gene locus_tag LOCUS_36070 gene lepB 1828 1250 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_36070 2592 1894 gene locus_tag LOCUS_36080 gene lepB 2592 1894 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_36080 4503 2674 gene locus_tag LOCUS_36090 4503 2674 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 protein_id gnl|my_center|LOCUS_36090 >Feature sequence442 <1 627 gene locus_tag LOCUS_36100 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057620.1:calcium/proton exchanger 818 1093 gene locus_tag LOCUS_36110 818 1093 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_36110 1083 1298 gene locus_tag LOCUS_36120 1083 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 1759 1508 gene locus_tag LOCUS_36130 1759 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 2716 2021 gene locus_tag LOCUS_36140 2716 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 3349 2816 gene locus_tag LOCUS_36150 3349 2816 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_36150 3636 3349 gene locus_tag LOCUS_36160 3636 3349 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141200.1 protein_id gnl|my_center|LOCUS_36160 >Feature sequence443 734 1483 gene locus_tag LOCUS_36170 734 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 1622 2845 gene locus_tag LOCUS_36180 1622 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 <4737 3375 gene locus_tag LOCUS_36190 <4737 3375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393193.1:SpoIIE family protein phosphatase >Feature sequence444 639 64 gene locus_tag LOCUS_36200 639 64 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_36200 2023 695 gene locus_tag LOCUS_36210 2023 695 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 protein_id gnl|my_center|LOCUS_36210 2210 4585 gene locus_tag LOCUS_36220 gene pcrA 2210 4585 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058290.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence445 1317 400 gene locus_tag LOCUS_36230 1317 400 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391987.1 protein_id gnl|my_center|LOCUS_36230 1405 2154 gene locus_tag LOCUS_36240 1405 2154 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_36240 2464 4563 gene locus_tag LOCUS_36250 2464 4563 CDS product Piwi domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880937.1 protein_id gnl|my_center|LOCUS_36250 >Feature sequence446 <1 580 gene locus_tag LOCUS_36260 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086596.1:HAD-IC family P-type ATPase 827 1516 gene locus_tag LOCUS_36270 827 1516 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285911.1 protein_id gnl|my_center|LOCUS_36270 1996 2190 gene locus_tag LOCUS_36280 1996 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 2681 2457 gene locus_tag LOCUS_36290 2681 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 2930 2730 gene locus_tag LOCUS_36300 2930 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 3162 2995 gene locus_tag LOCUS_36310 3162 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 3669 3442 gene locus_tag LOCUS_36320 3669 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 4081 3635 gene locus_tag LOCUS_36330 4081 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36330 >Feature sequence447 1817 1200 gene locus_tag LOCUS_36340 1817 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 2201 1971 gene locus_tag LOCUS_36350 2201 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36350 3262 2159 gene locus_tag LOCUS_36360 3262 2159 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36360 4133 3516 gene locus_tag LOCUS_36370 4133 3516 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057508.1 protein_id gnl|my_center|LOCUS_36370 4705 4214 gene locus_tag LOCUS_36380 4705 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence448 147 425 gene locus_tag LOCUS_36390 147 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 435 842 gene locus_tag LOCUS_36400 435 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 1097 897 gene locus_tag LOCUS_36410 1097 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 1143 2189 gene locus_tag LOCUS_36420 1143 2189 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 protein_id gnl|my_center|LOCUS_36420 2281 2730 gene locus_tag LOCUS_36430 2281 2730 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_36430 2783 2977 gene locus_tag LOCUS_36440 gene rpmG 2783 2977 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057895.1 protein_id gnl|my_center|LOCUS_36440 3016 3243 gene locus_tag LOCUS_36450 gene rpsR 3016 3243 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125120.1 protein_id gnl|my_center|LOCUS_36450 4300 3329 gene locus_tag LOCUS_36460 4300 3329 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_36460 >Feature sequence449 <1 801 gene locus_tag LOCUS_36470 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087474.1:cytochrome D1 domain-containing protein 1747 821 gene locus_tag LOCUS_36480 1747 821 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085800.1 protein_id gnl|my_center|LOCUS_36480 2222 1758 gene locus_tag LOCUS_36490 2222 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 2652 3236 gene locus_tag LOCUS_36500 2652 3236 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141762.1 protein_id gnl|my_center|LOCUS_36500 3270 3998 gene locus_tag LOCUS_36510 3270 3998 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140555.1 protein_id gnl|my_center|LOCUS_36510 >Feature sequence450 <1 1159 gene locus_tag LOCUS_36520 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141365.1:DUF790 family protein 1431 1994 gene locus_tag LOCUS_36530 1431 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 2116 3318 gene locus_tag LOCUS_36540 2116 3318 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143013.1 protein_id gnl|my_center|LOCUS_36540 <4649 3417 gene locus_tag LOCUS_36550 <4649 3417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140923.1:GspE/PulE family protein >Feature sequence451 153 560 gene locus_tag LOCUS_36560 153 560 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_36560 746 2029 gene locus_tag LOCUS_36570 746 2029 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682315.1 protein_id gnl|my_center|LOCUS_36570 2186 4444 gene locus_tag LOCUS_36580 2186 4444 CDS product DUF1796 family putative cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929267.1 protein_id gnl|my_center|LOCUS_36580 >Feature sequence452 67 426 gene locus_tag LOCUS_36590 67 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 615 1211 gene locus_tag LOCUS_36600 615 1211 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_36600 2008 1415 gene locus_tag LOCUS_36610 2008 1415 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_36610 2144 2344 gene locus_tag LOCUS_36620 2144 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 3339 2644 gene locus_tag LOCUS_36630 3339 2644 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140298.1 protein_id gnl|my_center|LOCUS_36630 3507 4139 gene locus_tag LOCUS_36640 3507 4139 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530096.1 protein_id gnl|my_center|LOCUS_36640 >Feature sequence453 165 1031 gene locus_tag LOCUS_36650 165 1031 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_36650 1998 1063 gene locus_tag LOCUS_36660 gene fmt 1998 1063 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141829.1 protein_id gnl|my_center|LOCUS_36660 2400 3218 gene locus_tag LOCUS_36670 2400 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 3294 3764 gene locus_tag LOCUS_36680 3294 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 3761 4012 gene locus_tag LOCUS_36690 3761 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 4185 4319 gene locus_tag LOCUS_36700 4185 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence454 2754 1405 gene locus_tag LOCUS_36710 2754 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 2855 4306 gene locus_tag LOCUS_36720 2855 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 >Feature sequence455 500 1426 gene locus_tag LOCUS_36730 500 1426 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142139.1 protein_id gnl|my_center|LOCUS_36730 1539 2528 gene locus_tag LOCUS_36740 1539 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 2824 2982 gene locus_tag LOCUS_36750 2824 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 3111 3608 gene locus_tag LOCUS_36760 3111 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 >Feature sequence456 1772 33 gene locus_tag LOCUS_36770 1772 33 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_36770 4225 1994 gene locus_tag LOCUS_36780 4225 1994 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104510.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence457 1925 843 gene locus_tag LOCUS_36790 1925 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 2473 2009 gene locus_tag LOCUS_36800 2473 2009 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084078882.1 protein_id gnl|my_center|LOCUS_36800 2867 2466 gene locus_tag LOCUS_36810 2867 2466 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 protein_id gnl|my_center|LOCUS_36810 4058 3036 gene locus_tag LOCUS_36820 4058 3036 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_36820 >Feature sequence458 446 1762 gene locus_tag LOCUS_36830 446 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 1825 2052 gene locus_tag LOCUS_36840 1825 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 2039 2419 gene locus_tag LOCUS_36850 2039 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 2421 4043 gene locus_tag LOCUS_36860 2421 4043 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035719.1 protein_id gnl|my_center|LOCUS_36860 4555 4127 gene locus_tag LOCUS_36870 4555 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 >Feature sequence459 <1 2963 gene locus_tag LOCUS_36880 <1 2963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071149.1:PAS domain S-box protein 4458 3124 gene locus_tag LOCUS_36890 4458 3124 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_36890 >Feature sequence460 1181 93 gene locus_tag LOCUS_36900 1181 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36900 1879 1196 gene locus_tag LOCUS_36910 1879 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 2358 2933 gene locus_tag LOCUS_36920 2358 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 3049 4476 gene locus_tag LOCUS_36930 3049 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence461 1848 361 gene locus_tag LOCUS_36940 1848 361 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449553.1 protein_id gnl|my_center|LOCUS_36940 1932 2297 gene locus_tag LOCUS_36950 1932 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 3945 2329 gene locus_tag LOCUS_36960 3945 2329 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_36960 4120 4191 gene locus_tag LOCUS_t00390 4120 4191 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence462 1329 1820 gene locus_tag LOCUS_36970 1329 1820 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 protein_id gnl|my_center|LOCUS_36970 1952 2434 gene locus_tag LOCUS_36980 1952 2434 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 protein_id gnl|my_center|LOCUS_36980 2968 2477 gene locus_tag LOCUS_36990 2968 2477 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056636.1 protein_id gnl|my_center|LOCUS_36990 4137 3070 gene locus_tag LOCUS_37000 4137 3070 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_37000 >Feature sequence463 <1 802 gene locus_tag LOCUS_37010 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056965.1:urea ABC transporter ATP-binding protein UrtD 792 1490 gene locus_tag LOCUS_37020 gene urtE 792 1490 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_37020 1798 2559 gene locus_tag LOCUS_37030 1798 2559 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 protein_id gnl|my_center|LOCUS_37030 2597 3421 gene locus_tag LOCUS_37040 2597 3421 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056386.1 protein_id gnl|my_center|LOCUS_37040 3491 3793 gene locus_tag LOCUS_37050 gene ureA 3491 3793 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_37050 3825 4136 gene locus_tag LOCUS_37060 3825 4136 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720474.1 protein_id gnl|my_center|LOCUS_37060 >Feature sequence464 505 831 gene locus_tag LOCUS_37070 505 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 2378 879 gene locus_tag LOCUS_37080 2378 879 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_37080 2719 3027 gene locus_tag LOCUS_37090 gene clpS 2719 3027 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056930.1 protein_id gnl|my_center|LOCUS_37090 >Feature sequence465 1864 764 gene locus_tag LOCUS_37100 gene mraY 1864 764 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799153.1 protein_id gnl|my_center|LOCUS_37100 2084 3445 gene locus_tag LOCUS_37110 2084 3445 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056064.1 protein_id gnl|my_center|LOCUS_37110 3878 3564 gene locus_tag LOCUS_37120 3878 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 3989 4306 gene locus_tag LOCUS_37130 3989 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 >Feature sequence466 1394 9 gene locus_tag LOCUS_37140 1394 9 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141145.1 protein_id gnl|my_center|LOCUS_37140 1539 2459 gene locus_tag LOCUS_37150 1539 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 3675 2497 gene locus_tag LOCUS_37160 3675 2497 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141357.1 protein_id gnl|my_center|LOCUS_37160 <4560 3852 gene locus_tag LOCUS_37170 <4560 3852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086103.1:Dps family protein >Feature sequence467 503 105 gene locus_tag LOCUS_37180 503 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37180 1264 500 gene locus_tag LOCUS_37190 gene hisF 1264 500 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921564.1 protein_id gnl|my_center|LOCUS_37190 1881 1258 gene locus_tag LOCUS_37200 gene hisH 1881 1258 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856473.1 protein_id gnl|my_center|LOCUS_37200 3064 1916 gene locus_tag LOCUS_37210 gene pseA 3064 1916 CDS product pseudaminic acid biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_37210 3692 3057 gene locus_tag LOCUS_37220 3692 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 4431 3694 gene locus_tag LOCUS_37230 4431 3694 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_37230 >Feature sequence468 1982 1818 gene locus_tag LOCUS_37240 1982 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 2096 3004 gene locus_tag LOCUS_37250 gene era 2096 3004 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055911.1 protein_id gnl|my_center|LOCUS_37250 3986 3063 gene locus_tag LOCUS_37260 3986 3063 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_37260 4096 4461 gene locus_tag LOCUS_37270 4096 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 >Feature sequence469 988 629 gene locus_tag LOCUS_37280 988 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 1506 1345 gene locus_tag LOCUS_37290 1506 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 3823 1577 gene locus_tag LOCUS_37300 3823 1577 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142384.1 protein_id gnl|my_center|LOCUS_37300 4151 >4544 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaacccacacatttctggaagagagattgcaac >Feature sequence470 163 1044 gene locus_tag LOCUS_37310 163 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 1111 2502 gene locus_tag LOCUS_37320 1111 2502 CDS product DUF2330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072721720.1 protein_id gnl|my_center|LOCUS_37320 3938 2574 gene locus_tag LOCUS_37330 gene glmU 3938 2574 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920683.1 protein_id gnl|my_center|LOCUS_37330 >Feature sequence471 2335 908 gene locus_tag LOCUS_37340 2335 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 2498 2827 gene locus_tag LOCUS_37350 2498 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 2873 3445 gene locus_tag LOCUS_37360 2873 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 3474 4460 gene locus_tag LOCUS_37370 3474 4460 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_37370 >Feature sequence472 1505 702 gene locus_tag LOCUS_37380 gene recO 1505 702 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140088.1 protein_id gnl|my_center|LOCUS_37380 1892 2395 gene locus_tag LOCUS_37390 1892 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 2449 3243 gene locus_tag LOCUS_37400 2449 3243 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143432.1 protein_id gnl|my_center|LOCUS_37400 3500 4378 gene locus_tag LOCUS_37410 3500 4378 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928448.1 protein_id gnl|my_center|LOCUS_37410 >Feature sequence473 1982 2650 gene locus_tag LOCUS_37420 1982 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37420 2647 3069 gene locus_tag LOCUS_37430 2647 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 3074 3508 gene locus_tag LOCUS_37440 3074 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37440 3512 4285 gene locus_tag LOCUS_37450 3512 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37450 4292 4465 gene locus_tag LOCUS_37460 4292 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 >Feature sequence474 558 1910 gene locus_tag LOCUS_37470 558 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 1969 2463 gene locus_tag LOCUS_37480 1969 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 2490 2834 gene locus_tag LOCUS_37490 2490 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37490 2958 3896 gene locus_tag LOCUS_37500 2958 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37500 >Feature sequence475 957 508 gene locus_tag LOCUS_37510 957 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 1547 2296 gene locus_tag LOCUS_37520 1547 2296 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_37520 2315 2728 gene locus_tag LOCUS_37530 gene arfB 2315 2728 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 protein_id gnl|my_center|LOCUS_37530 <4505 2811 gene locus_tag LOCUS_37540 <4505 2811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057830.1:M1 family metallopeptidase >Feature sequence476 <1 1032 gene locus_tag LOCUS_37550 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269279.1:sulfonate ABC transporter substrate-binding protein 1197 2531 gene locus_tag LOCUS_37560 1197 2531 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_37560 2580 4298 gene locus_tag LOCUS_37570 2580 4298 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206683.1 protein_id gnl|my_center|LOCUS_37570 >Feature sequence477 1423 971 gene locus_tag LOCUS_37580 1423 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 2081 4372 gene locus_tag LOCUS_37590 2081 4372 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798165.1 protein_id gnl|my_center|LOCUS_37590 >Feature sequence478 3068 2370 gene locus_tag LOCUS_37600 3068 2370 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_37600 3968 3444 gene locus_tag LOCUS_37610 3968 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 >Feature sequence479 826 137 gene locus_tag LOCUS_37620 826 137 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243178.1 protein_id gnl|my_center|LOCUS_37620 1253 894 gene locus_tag LOCUS_37630 1253 894 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243177.1 protein_id gnl|my_center|LOCUS_37630 2954 1314 gene locus_tag LOCUS_37640 2954 1314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088893.1 protein_id gnl|my_center|LOCUS_37640 3683 3000 gene locus_tag LOCUS_37650 3683 3000 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088892.1 protein_id gnl|my_center|LOCUS_37650 >Feature sequence480 2629 1421 gene locus_tag LOCUS_37660 2629 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 2738 3541 gene locus_tag LOCUS_37670 2738 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 >Feature sequence481 326 2290 gene locus_tag LOCUS_37680 326 2290 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence482 435 1121 gene locus_tag LOCUS_37690 435 1121 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140230840.1 protein_id gnl|my_center|LOCUS_37690 1314 1730 gene locus_tag LOCUS_37700 1314 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 1986 2675 gene locus_tag LOCUS_37710 1986 2675 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183858629.1 protein_id gnl|my_center|LOCUS_37710 2764 3324 gene locus_tag LOCUS_37720 2764 3324 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087162.1 protein_id gnl|my_center|LOCUS_37720 3451 3990 gene locus_tag LOCUS_37730 3451 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140662.1 protein_id gnl|my_center|LOCUS_37730 4237 4368 gene locus_tag LOCUS_37740 4237 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 >Feature sequence483 239 1471 gene locus_tag LOCUS_37750 239 1471 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140286.1 protein_id gnl|my_center|LOCUS_37750 2163 1540 gene locus_tag LOCUS_37760 2163 1540 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204183.1 protein_id gnl|my_center|LOCUS_37760 2560 3672 gene locus_tag LOCUS_37770 2560 3672 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_37770 3894 4232 gene locus_tag LOCUS_37780 3894 4232 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_37780 >Feature sequence484 1787 789 gene locus_tag LOCUS_37790 1787 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 2040 3143 gene locus_tag LOCUS_37800 2040 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 >Feature sequence485 2125 3834 gene locus_tag LOCUS_37810 gene kaiC 2125 3834 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390295.1 protein_id gnl|my_center|LOCUS_37810 3877 4212 gene locus_tag LOCUS_37820 3877 4212 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390296.1 protein_id gnl|my_center|LOCUS_37820 >Feature sequence486 <1 1784 gene locus_tag LOCUS_37830 <1 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081403079.1:formylglycine-generating enzyme family protein 1855 3504 gene locus_tag LOCUS_37840 1855 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 3648 3851 gene locus_tag LOCUS_37850 3648 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 3889 4116 gene locus_tag LOCUS_37860 3889 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 >Feature sequence487 528 1268 gene locus_tag LOCUS_37870 528 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 2164 1298 gene locus_tag LOCUS_37880 gene pheA 2164 1298 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594784.1 protein_id gnl|my_center|LOCUS_37880 4101 2212 gene locus_tag LOCUS_37890 gene ftsH 4101 2212 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225914010.1 protein_id gnl|my_center|LOCUS_37890 >Feature sequence488 117 347 gene locus_tag LOCUS_37900 117 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 1396 389 gene locus_tag LOCUS_37910 1396 389 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_37910 1526 2422 gene locus_tag LOCUS_37920 1526 2422 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_37920 2769 2593 gene locus_tag LOCUS_37930 2769 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 2966 2823 gene locus_tag LOCUS_37940 2966 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 3118 3585 gene locus_tag LOCUS_37950 3118 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 3582 4376 gene locus_tag LOCUS_37960 3582 4376 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223173767.1 protein_id gnl|my_center|LOCUS_37960 >Feature sequence489 609 809 gene locus_tag LOCUS_37970 609 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 946 1185 gene locus_tag LOCUS_37980 946 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 <4395 1356 gene locus_tag LOCUS_37990 <4395 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968692.1:type I restriction endonuclease subunit R >Feature sequence490 576 127 gene locus_tag LOCUS_38000 576 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920813.1 protein_id gnl|my_center|LOCUS_38000 854 2146 gene locus_tag LOCUS_38010 854 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 >Feature sequence491 <1 1428 gene locus_tag LOCUS_38020 <1 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229077.1:CRISPR-associated helicase Cas3' 1431 1682 gene locus_tag LOCUS_38030 1431 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 1804 2358 gene locus_tag LOCUS_38040 1804 2358 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926060.1 protein_id gnl|my_center|LOCUS_38040 2362 3279 gene locus_tag LOCUS_38050 2362 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 3286 3645 gene locus_tag LOCUS_38060 3286 3645 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_38060 3710 4294 gene locus_tag LOCUS_38070 gene cas4 3710 4294 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_38070 >Feature sequence492 <1 873 gene locus_tag LOCUS_38080 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056369.1:DNA polymerase III subunit delta' 1378 956 gene locus_tag LOCUS_38090 1378 956 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142976.1 protein_id gnl|my_center|LOCUS_38090 1641 1381 gene locus_tag LOCUS_38100 1641 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 2237 1812 gene locus_tag LOCUS_38110 2237 1812 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_38110 2648 2241 gene locus_tag LOCUS_38120 2648 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 3982 2741 gene locus_tag LOCUS_38130 3982 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 >Feature sequence493 1016 834 gene locus_tag LOCUS_38140 1016 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 1682 1275 gene locus_tag LOCUS_38150 1682 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 1921 2190 gene locus_tag LOCUS_38160 1921 2190 CDS product PipX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 protein_id gnl|my_center|LOCUS_38160 2187 3107 gene locus_tag LOCUS_38170 gene ispE 2187 3107 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056351.1 protein_id gnl|my_center|LOCUS_38170 4172 3210 gene locus_tag LOCUS_38180 4172 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 >Feature sequence494 976 1179 gene locus_tag LOCUS_38190 976 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 1272 2672 gene locus_tag LOCUS_38200 1272 2672 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056513.1 protein_id gnl|my_center|LOCUS_38200 2767 3471 gene locus_tag LOCUS_38210 2767 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 3507 4208 gene locus_tag LOCUS_38220 3507 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 >Feature sequence495 1478 921 gene locus_tag LOCUS_38230 1478 921 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926875.1 protein_id gnl|my_center|LOCUS_38230 1644 2330 gene locus_tag LOCUS_38240 1644 2330 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058105.1 protein_id gnl|my_center|LOCUS_38240 2452 3051 gene locus_tag LOCUS_38250 2452 3051 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141191.1 protein_id gnl|my_center|LOCUS_38250 4229 3096 gene locus_tag LOCUS_38260 4229 3096 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_38260 >Feature sequence496 307 924 gene locus_tag LOCUS_38270 307 924 CDS product CPP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_38270 931 2643 gene locus_tag LOCUS_38280 931 2643 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_38280 3334 2702 gene locus_tag LOCUS_38290 3334 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 3781 4245 gene locus_tag LOCUS_38300 3781 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 >Feature sequence497 <1 1085 gene locus_tag LOCUS_38310 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein 1174 1434 gene locus_tag LOCUS_38320 1174 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 1421 1831 gene locus_tag LOCUS_38330 1421 1831 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_38330 1874 2413 gene locus_tag LOCUS_38340 1874 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 2616 4103 gene locus_tag LOCUS_38350 2616 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 >Feature sequence498 3295 35 gene locus_tag LOCUS_38360 3295 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 4108 3713 gene locus_tag LOCUS_38370 4108 3713 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_38370 >Feature sequence499 1482 2447 gene locus_tag LOCUS_38380 1482 2447 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057151.1 protein_id gnl|my_center|LOCUS_38380 2667 2497 gene locus_tag LOCUS_38390 2667 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 >Feature sequence500 1761 688 gene locus_tag LOCUS_38400 1761 688 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214433169.1 protein_id gnl|my_center|LOCUS_38400 2723 1776 gene locus_tag LOCUS_38410 2723 1776 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 protein_id gnl|my_center|LOCUS_38410 3382 3681 gene locus_tag LOCUS_38420 3382 3681 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921010.1 protein_id gnl|my_center|LOCUS_38420 >Feature sequence501 173 2323 gene locus_tag LOCUS_38430 173 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 2692 3738 gene locus_tag LOCUS_38440 gene trpD 2692 3738 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057551.1 protein_id gnl|my_center|LOCUS_38440 >Feature sequence502 157 309 gene locus_tag LOCUS_38450 157 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 302 970 gene locus_tag LOCUS_38460 302 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 1287 2297 gene locus_tag LOCUS_38470 1287 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence503 594 109 gene locus_tag LOCUS_38480 594 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 978 754 gene locus_tag LOCUS_38490 978 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 1853 3331 gene locus_tag LOCUS_38500 gene amyS 1853 3331 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 protein_id gnl|my_center|LOCUS_38500 3438 3875 gene locus_tag LOCUS_38510 3438 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 >Feature sequence504 94 1404 gene locus_tag LOCUS_38520 94 1404 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_38520 1479 3911 gene locus_tag LOCUS_38530 1479 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 >Feature sequence505 673 1131 gene locus_tag LOCUS_38540 673 1131 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525368.1 protein_id gnl|my_center|LOCUS_38540 1553 3085 gene locus_tag LOCUS_38550 gene wspA 1553 3085 CDS product Wsp signal transduction system chemoreceptor WspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113844.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence506 1461 304 gene locus_tag LOCUS_38560 1461 304 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_38560 3053 1551 gene locus_tag LOCUS_38570 3053 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 3372 4190 gene locus_tag LOCUS_38580 3372 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 >Feature sequence507 196 462 gene locus_tag LOCUS_38590 196 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 449 799 gene locus_tag LOCUS_38600 449 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 3218 1029 gene locus_tag LOCUS_38610 3218 1029 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_38610 <4253 3233 gene locus_tag LOCUS_38620 <4253 3233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142087.1:nitrate ABC transporter ATP-binding protein >Feature sequence508 591 2447 gene locus_tag LOCUS_38630 591 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 3580 2627 gene locus_tag LOCUS_38640 3580 2627 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence509 359 45 gene locus_tag LOCUS_38650 359 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 721 930 gene locus_tag LOCUS_38660 721 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 927 1316 gene locus_tag LOCUS_38670 927 1316 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_38670 1720 1923 gene locus_tag LOCUS_38680 1720 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 >Feature sequence510 828 1571 gene locus_tag LOCUS_38690 828 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 1633 2988 gene locus_tag LOCUS_38700 1633 2988 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056219.1 protein_id gnl|my_center|LOCUS_38700 3263 3475 gene locus_tag LOCUS_38710 3263 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 3697 4152 gene locus_tag LOCUS_38720 3697 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38720 >Feature sequence511 908 1231 gene locus_tag LOCUS_38730 908 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 1209 1679 gene locus_tag LOCUS_38740 1209 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 2298 1735 gene locus_tag LOCUS_38750 2298 1735 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_38750 2446 3549 gene locus_tag LOCUS_38760 gene mtnA 2446 3549 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083782.1 protein_id gnl|my_center|LOCUS_38760 4113 3589 gene locus_tag LOCUS_38770 4113 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 >Feature sequence512 321 2657 gene locus_tag LOCUS_38780 321 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 2671 4020 gene locus_tag LOCUS_38790 2671 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 >Feature sequence513 132 644 gene locus_tag LOCUS_38800 132 644 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142733.1 protein_id gnl|my_center|LOCUS_38800 641 1771 gene locus_tag LOCUS_38810 641 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142732.1 protein_id gnl|my_center|LOCUS_38810 1809 1955 gene locus_tag LOCUS_38820 1809 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 1973 2380 gene locus_tag LOCUS_38830 1973 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 2386 3045 gene locus_tag LOCUS_38840 2386 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 3224 3412 gene locus_tag LOCUS_38850 3224 3412 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_38850 3416 3637 gene locus_tag LOCUS_38860 3416 3637 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_38860 3656 3976 gene locus_tag LOCUS_38870 3656 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence514 <1 533 gene locus_tag LOCUS_38880 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142968.1:2-phosphosulfolactate phosphatase family protein 706 1557 gene locus_tag LOCUS_38890 706 1557 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097406.1 protein_id gnl|my_center|LOCUS_38890 1554 1973 gene locus_tag LOCUS_38900 1554 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 2535 1978 gene locus_tag LOCUS_38910 2535 1978 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_38910 4014 2668 gene locus_tag LOCUS_38920 4014 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 >Feature sequence515 429 1232 gene locus_tag LOCUS_38930 gene phnE 429 1232 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246946.1 protein_id gnl|my_center|LOCUS_38930 1805 1260 gene locus_tag LOCUS_38940 1805 1260 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928679.1 protein_id gnl|my_center|LOCUS_38940 2232 1831 gene locus_tag LOCUS_38950 2232 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928469.1 protein_id gnl|my_center|LOCUS_38950 2643 2431 gene locus_tag LOCUS_38960 2643 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 4165 2882 gene locus_tag LOCUS_38970 4165 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 >Feature sequence516 844 491 gene locus_tag LOCUS_38980 844 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 1278 883 gene locus_tag LOCUS_38990 1278 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 1853 1326 gene locus_tag LOCUS_39000 1853 1326 CDS product DUF3122 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056141.1 protein_id gnl|my_center|LOCUS_39000 2211 1915 gene locus_tag LOCUS_39010 2211 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 3559 2255 gene locus_tag LOCUS_39020 3559 2255 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056143.1 protein_id gnl|my_center|LOCUS_39020 3863 3639 gene locus_tag LOCUS_39030 3863 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence517 691 2067 gene locus_tag LOCUS_39040 691 2067 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_39040 3148 2099 gene locus_tag LOCUS_39050 3148 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39050 3707 3153 gene locus_tag LOCUS_39060 3707 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 >Feature sequence518 3012 211 gene locus_tag LOCUS_39070 3012 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 3170 3454 gene locus_tag LOCUS_39080 3170 3454 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_39080 3429 3683 gene locus_tag LOCUS_39090 3429 3683 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678786.1 protein_id gnl|my_center|LOCUS_39090 >Feature sequence519 146 487 gene locus_tag LOCUS_39100 146 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 1427 624 gene locus_tag LOCUS_39110 1427 624 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_39110 1471 1821 gene locus_tag LOCUS_39120 1471 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 2305 1823 gene locus_tag LOCUS_39130 2305 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 3120 2362 gene locus_tag LOCUS_39140 gene fabG 3120 2362 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_39140 <4146 3315 gene locus_tag LOCUS_39150 <4146 3315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein >Feature sequence520 2221 113 gene locus_tag LOCUS_39160 2221 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 3096 2209 gene locus_tag LOCUS_39170 3096 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 <4124 3364 gene locus_tag LOCUS_39180 <4124 3364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928586.1:ATP-binding protein >Feature sequence521 535 194 gene locus_tag LOCUS_39190 535 194 CDS product DUF2488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_39190 1408 593 gene locus_tag LOCUS_39200 1408 593 CDS product TIGR01548 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920669.1 protein_id gnl|my_center|LOCUS_39200 1457 1756 gene locus_tag LOCUS_39210 1457 1756 CDS product 30S ribosomal protein PSRP-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056156.1 protein_id gnl|my_center|LOCUS_39210 3220 1829 gene locus_tag LOCUS_39220 gene psbC 3220 1829 CDS product photosystem II reaction center protein CP43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124637.1 protein_id gnl|my_center|LOCUS_39220 <4116 3439 gene locus_tag LOCUS_39230 <4116 3439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056308.1:photosystem II D2 protein (photosystem q(a) protein) >Feature sequence522 1023 235 gene locus_tag LOCUS_39240 1023 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 1574 1029 gene locus_tag LOCUS_39250 1574 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 1953 3710 gene locus_tag LOCUS_39260 gene argS 1953 3710 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056669.1 protein_id gnl|my_center|LOCUS_39260 >Feature sequence523 119 1219 gene locus_tag LOCUS_39270 119 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 1492 3369 gene locus_tag LOCUS_39280 1492 3369 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_39280 3432 3896 gene locus_tag LOCUS_39290 3432 3896 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166277356.1 protein_id gnl|my_center|LOCUS_39290 >Feature sequence524 529 47 gene locus_tag LOCUS_39300 529 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 1153 611 gene locus_tag LOCUS_39310 gene idi 1153 611 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_39310 1311 1733 gene locus_tag LOCUS_39320 1311 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 2879 1767 gene locus_tag LOCUS_39330 2879 1767 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143073.1 protein_id gnl|my_center|LOCUS_39330 2959 3192 gene locus_tag LOCUS_39340 2959 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 3267 3968 gene locus_tag LOCUS_39350 3267 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 >Feature sequence525 777 145 gene locus_tag LOCUS_39360 777 145 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044436927.1 protein_id gnl|my_center|LOCUS_39360 931 3903 gene locus_tag LOCUS_39370 931 3903 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077210409.1 protein_id gnl|my_center|LOCUS_39370 >Feature sequence526 140 1609 gene locus_tag LOCUS_39380 140 1609 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056379.1 protein_id gnl|my_center|LOCUS_39380 >Feature sequence527 652 807 gene locus_tag LOCUS_39390 652 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 1414 983 gene locus_tag LOCUS_39400 1414 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 1605 1414 gene locus_tag LOCUS_39410 1605 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 1807 1586 gene locus_tag LOCUS_39420 1807 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 2797 1817 gene locus_tag LOCUS_39430 2797 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 3427 3299 gene locus_tag LOCUS_39440 3427 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence528 2425 131 gene locus_tag LOCUS_39450 2425 131 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 protein_id gnl|my_center|LOCUS_39450 2987 3877 gene locus_tag LOCUS_39460 2987 3877 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_39460 >Feature sequence529 <1 1040 gene locus_tag LOCUS_39470 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056391.1:class 1 fructose-bisphosphatase 1169 2488 gene locus_tag LOCUS_39480 1169 2488 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_39480 2795 3463 gene locus_tag LOCUS_39490 2795 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 >Feature sequence530 3938 2673 gene locus_tag LOCUS_39500 3938 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 >Feature sequence531 542 174 gene locus_tag LOCUS_39510 542 174 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142285.1 protein_id gnl|my_center|LOCUS_39510 759 535 gene locus_tag LOCUS_39520 759 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 1365 1012 gene locus_tag LOCUS_39530 1365 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 1694 1362 gene locus_tag LOCUS_39540 1694 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 2975 1971 gene locus_tag LOCUS_39550 2975 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 3798 3061 gene locus_tag LOCUS_39560 3798 3061 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141905.1 protein_id gnl|my_center|LOCUS_39560 >Feature sequence532 485 2191 gene locus_tag LOCUS_39570 485 2191 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_39570 2327 3445 gene locus_tag LOCUS_39580 2327 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 >Feature sequence533 1469 1098 gene locus_tag LOCUS_39590 1469 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 1742 1524 gene locus_tag LOCUS_39600 1742 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 1908 2390 gene locus_tag LOCUS_39610 1908 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 3007 2693 gene locus_tag LOCUS_39620 3007 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 3208 3065 gene locus_tag LOCUS_39630 3208 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 3657 3274 gene locus_tag LOCUS_39640 3657 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 3844 3644 gene locus_tag LOCUS_39650 3844 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 >Feature sequence534 616 80 gene locus_tag LOCUS_39660 616 80 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_39660 963 760 gene locus_tag LOCUS_39670 963 760 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_39670 2575 1061 gene locus_tag LOCUS_39680 2575 1061 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048142299.1 protein_id gnl|my_center|LOCUS_39680 3849 3643 gene locus_tag LOCUS_39690 3849 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 >Feature sequence535 <1 3805 gene locus_tag LOCUS_39700 <1 3805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889426.1:DUF4132 domain-containing protein >Feature sequence536 <1 622 gene locus_tag LOCUS_39710 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057952.1:glutamate 5-kinase <3925 738 gene locus_tag LOCUS_39720 <3925 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230035.1:DEAD/DEAH box helicase >Feature sequence537 2506 605 gene locus_tag LOCUS_39730 gene dnaK 2506 605 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057570.1 protein_id gnl|my_center|LOCUS_39730 3397 2690 gene locus_tag LOCUS_39740 3397 2690 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 protein_id gnl|my_center|LOCUS_39740 3655 3727 gene locus_tag LOCUS_t00400 3655 3727 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence538 81 311 gene locus_tag LOCUS_39750 81 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 289 573 gene locus_tag LOCUS_39760 289 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 652 1884 gene locus_tag LOCUS_39770 652 1884 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_39770 1960 2538 gene locus_tag LOCUS_39780 1960 2538 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_39780 >Feature sequence539 81 791 gene locus_tag LOCUS_39790 81 791 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_39790 803 1798 gene locus_tag LOCUS_39800 803 1798 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799574.1 protein_id gnl|my_center|LOCUS_39800 3654 1993 gene locus_tag LOCUS_39810 3654 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 >Feature sequence540 1918 206 gene locus_tag LOCUS_39820 1918 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 2135 3004 gene locus_tag LOCUS_39830 gene trpC 2135 3004 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056545.1 protein_id gnl|my_center|LOCUS_39830 3040 3693 gene locus_tag LOCUS_39840 3040 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 protein_id gnl|my_center|LOCUS_39840 >Feature sequence541 256 963 gene locus_tag LOCUS_39850 256 963 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141701.1 protein_id gnl|my_center|LOCUS_39850 3001 1112 gene locus_tag LOCUS_39860 3001 1112 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 protein_id gnl|my_center|LOCUS_39860 3496 3023 gene locus_tag LOCUS_39870 3496 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 >Feature sequence542 66 139 gene locus_tag LOCUS_t00410 66 139 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 628 164 gene locus_tag LOCUS_39880 628 164 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267849.1 protein_id gnl|my_center|LOCUS_39880 790 1035 gene locus_tag LOCUS_39890 790 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 1747 1061 gene locus_tag LOCUS_39900 gene queC 1747 1061 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126004.1 protein_id gnl|my_center|LOCUS_39900 2367 1753 gene locus_tag LOCUS_39910 2367 1753 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_39910 3672 2611 gene locus_tag LOCUS_39920 3672 2611 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_39920 >Feature sequence543 376 717 gene locus_tag LOCUS_39930 376 717 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530816.1 protein_id gnl|my_center|LOCUS_39930 807 2012 gene locus_tag LOCUS_39940 807 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 2069 2932 gene locus_tag LOCUS_39950 2069 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 >Feature sequence544 352 1410 gene locus_tag LOCUS_39960 gene argC 352 1410 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058053.1 protein_id gnl|my_center|LOCUS_39960 1810 2823 gene locus_tag LOCUS_39970 gene thiL 1810 2823 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921033.1 protein_id gnl|my_center|LOCUS_39970 <3844 2857 gene locus_tag LOCUS_39980 <3844 2857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920887.1:magnesium chelatase ATPase subunit I >Feature sequence545 2593 1007 gene locus_tag LOCUS_39990 2593 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 3052 2729 gene locus_tag LOCUS_40000 gene trxA 3052 2729 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966364.1 protein_id gnl|my_center|LOCUS_40000 3215 3610 gene locus_tag LOCUS_40010 3215 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 >Feature sequence546 2571 1522 gene locus_tag LOCUS_40020 2571 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 >Feature sequence547 3444 130 gene locus_tag LOCUS_40030 3444 130 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053708.1 protein_id gnl|my_center|LOCUS_40030 >Feature sequence548 650 1513 gene locus_tag LOCUS_40040 650 1513 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 protein_id gnl|my_center|LOCUS_40040 2574 1576 gene locus_tag LOCUS_40050 2574 1576 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_40050 3788 2625 gene locus_tag LOCUS_40060 gene dxr 3788 2625 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_40060 >Feature sequence549 85 2388 gene locus_tag LOCUS_40070 gene recJ 85 2388 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056029.1 protein_id gnl|my_center|LOCUS_40070 <3766 2554 gene locus_tag LOCUS_40080 <3766 2554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027998716.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence550 1668 457 gene locus_tag LOCUS_40090 1668 457 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258404.1 protein_id gnl|my_center|LOCUS_40090 1867 2154 gene locus_tag LOCUS_40100 1867 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 2386 3648 gene locus_tag LOCUS_40110 2386 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 >Feature sequence551 197 1360 gene locus_tag LOCUS_40120 gene purT 197 1360 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932738.1 protein_id gnl|my_center|LOCUS_40120 1661 3217 gene locus_tag LOCUS_40130 1661 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 3327 3743 gene locus_tag LOCUS_40140 3327 3743 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088400.1 protein_id gnl|my_center|LOCUS_40140 >Feature sequence552 748 1488 gene locus_tag LOCUS_40150 748 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 2235 3623 gene locus_tag LOCUS_40160 2235 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 >Feature sequence553 1449 349 gene locus_tag LOCUS_40170 1449 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193991055.1 protein_id gnl|my_center|LOCUS_40170 1675 2457 gene locus_tag LOCUS_40180 1675 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 3062 2547 gene locus_tag LOCUS_40190 3062 2547 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256302.1 protein_id gnl|my_center|LOCUS_40190 >Feature sequence554 264 1019 gene locus_tag LOCUS_40200 264 1019 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_40200 1000 2244 gene locus_tag LOCUS_40210 gene ruvB 1000 2244 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143112.1 protein_id gnl|my_center|LOCUS_40210 2599 3522 gene locus_tag LOCUS_40220 2599 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 >Feature sequence555 399 2471 gene locus_tag LOCUS_40230 399 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 2731 3228 gene locus_tag LOCUS_40240 2731 3228 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_40240 >Feature sequence556 <1 678 gene locus_tag LOCUS_40250 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140075.1:glutamate-1-semialdehyde 2,1-aminomutase 869 1495 gene locus_tag LOCUS_40260 869 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 1640 3526 gene locus_tag LOCUS_40270 gene ftsH2 1640 3526 CDS product ATP-dependent zinc metalloprotease FtsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056581.1 protein_id gnl|my_center|LOCUS_40270 >Feature sequence557 985 23 gene locus_tag LOCUS_40280 985 23 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_40280 1708 1154 gene locus_tag LOCUS_40290 1708 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 2437 1763 gene locus_tag LOCUS_40300 2437 1763 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056485.1 protein_id gnl|my_center|LOCUS_40300 2586 2771 gene locus_tag LOCUS_40310 2586 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence558 797 1318 gene locus_tag LOCUS_40320 797 1318 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920747.1 protein_id gnl|my_center|LOCUS_40320 1377 3122 gene locus_tag LOCUS_40330 1377 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 3190 3627 gene locus_tag LOCUS_40340 gene dut 3190 3627 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454700.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence559 478 44 gene locus_tag LOCUS_40350 478 44 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056354.1 protein_id gnl|my_center|LOCUS_40350 1455 487 gene locus_tag LOCUS_40360 gene cysK 1455 487 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_40360 2789 1596 gene locus_tag LOCUS_40370 2789 1596 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_40370 2995 3564 gene locus_tag LOCUS_40380 2995 3564 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_40380 >Feature sequence560 <1 1696 gene locus_tag LOCUS_40390 <1 1696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140029.1:primosomal protein N' 2137 1871 gene locus_tag LOCUS_40400 2137 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 2732 2232 gene locus_tag LOCUS_40410 2732 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 3302 2814 gene locus_tag LOCUS_40420 3302 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 >Feature sequence561 <1 1050 gene locus_tag LOCUS_40430 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928500.1:sensor histidine kinase 1047 1703 gene locus_tag LOCUS_40440 1047 1703 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_40440 2762 1707 gene locus_tag LOCUS_40450 2762 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 2991 3560 gene locus_tag LOCUS_40460 2991 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 >Feature sequence562 <1 859 gene locus_tag LOCUS_40470 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005461998.1:AraC family transcriptional regulator 920 1687 gene locus_tag LOCUS_40480 920 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 2678 1752 gene locus_tag LOCUS_40490 2678 1752 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 protein_id gnl|my_center|LOCUS_40490 2809 2690 gene locus_tag LOCUS_40500 2809 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 >Feature sequence563 1495 749 gene locus_tag LOCUS_40510 gene ftsE 1495 749 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140651.1 protein_id gnl|my_center|LOCUS_40510 2299 2874 gene locus_tag LOCUS_40520 2299 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 <3610 2953 gene locus_tag LOCUS_40530 <3610 2953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058003.1:cyanophycinase >Feature sequence564 1029 229 gene locus_tag LOCUS_40540 1029 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 2328 1336 gene locus_tag LOCUS_40550 2328 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 3465 2407 gene locus_tag LOCUS_40560 3465 2407 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266950.1 protein_id gnl|my_center|LOCUS_40560 >Feature sequence565 353 1189 gene locus_tag LOCUS_40570 353 1189 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886674.1 protein_id gnl|my_center|LOCUS_40570 1519 1809 gene locus_tag LOCUS_40580 1519 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 1870 2514 gene locus_tag LOCUS_40590 1870 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 2576 3247 gene locus_tag LOCUS_40600 2576 3247 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055897.1 protein_id gnl|my_center|LOCUS_40600 >Feature sequence566 <1 540 gene locus_tag LOCUS_40610 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056114.1:ribosome recycling factor 1678 650 gene locus_tag LOCUS_40620 1678 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 3038 1683 gene locus_tag LOCUS_40630 3038 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 >Feature sequence567 154 984 gene locus_tag LOCUS_40640 154 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 <3591 1034 gene locus_tag LOCUS_40650 <3591 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122252.1:DEAD/DEAH box helicase >Feature sequence568 425 2035 gene locus_tag LOCUS_40660 gene dndC 425 2035 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_40660 >Feature sequence569 82 2559 gene locus_tag LOCUS_40670 82 2559 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211616.1 protein_id gnl|my_center|LOCUS_40670 <3566 2801 gene locus_tag LOCUS_40680 <3566 2801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057679.1:TRC40/GET3/ArsA family transport-energizing ATPase >Feature sequence570 254 108 gene locus_tag LOCUS_40690 254 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 1946 288 gene locus_tag LOCUS_40700 1946 288 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113858178.1 protein_id gnl|my_center|LOCUS_40700 2245 2820 gene locus_tag LOCUS_40710 2245 2820 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_40710 <3548 2879 gene locus_tag LOCUS_40720 <3548 2879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056214.1:peptidoglycan recognition family protein >Feature sequence571 2043 3254 gene locus_tag LOCUS_40730 2043 3254 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140337.1 protein_id gnl|my_center|LOCUS_40730 >Feature sequence572 770 192 gene locus_tag LOCUS_40740 770 192 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140228.1 protein_id gnl|my_center|LOCUS_40740 922 1521 gene locus_tag LOCUS_40750 922 1521 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_40750 1782 1597 gene locus_tag LOCUS_40760 1782 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 2146 1796 gene locus_tag LOCUS_40770 2146 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 2494 2153 gene locus_tag LOCUS_40780 2494 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 >Feature sequence573 405 2057 gene locus_tag LOCUS_40790 405 2057 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057086.1 protein_id gnl|my_center|LOCUS_40790 2749 2090 gene locus_tag LOCUS_40800 2749 2090 CDS product Coq4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_40800 <3522 2761 gene locus_tag LOCUS_40810 <3522 2761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058039.1:peptide chain release factor 3 >Feature sequence574 172 330 gene locus_tag LOCUS_40820 172 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 405 629 gene locus_tag LOCUS_40830 405 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 694 912 gene locus_tag LOCUS_40840 694 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 912 1151 gene locus_tag LOCUS_40850 912 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 1267 2187 gene locus_tag LOCUS_40860 1267 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 <3522 2531 gene locus_tag LOCUS_40870 <3522 2531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053221433.1:serine/threonine-protein kinase >Feature sequence575 <1 3381 gene locus_tag LOCUS_40880 <1 3381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057338.1:AAA-like domain-containing protein >Feature sequence576 952 1236 gene locus_tag LOCUS_40890 952 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 1399 3051 gene locus_tag LOCUS_40900 1399 3051 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_40900 >Feature sequence577 332 985 gene locus_tag LOCUS_40910 332 985 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_40910 1647 997 gene locus_tag LOCUS_40920 1647 997 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_40920 1940 2599 gene locus_tag LOCUS_40930 1940 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 2630 3193 gene locus_tag LOCUS_40940 2630 3193 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141674.1 protein_id gnl|my_center|LOCUS_40940 3391 3197 gene locus_tag LOCUS_40950 3391 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 >Feature sequence578 430 963 gene locus_tag LOCUS_40960 430 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 1057 2136 gene locus_tag LOCUS_40970 1057 2136 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_40970 2371 2841 gene locus_tag LOCUS_40980 2371 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 3150 3464 gene locus_tag LOCUS_40990 3150 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 >Feature sequence579 <1 672 gene locus_tag LOCUS_41000 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141716.1:anthranilate synthase component I 744 950 gene locus_tag LOCUS_41010 744 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 962 1192 gene locus_tag LOCUS_41020 962 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 1281 1868 gene locus_tag LOCUS_41030 1281 1868 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141208.1 protein_id gnl|my_center|LOCUS_41030 1868 2560 gene locus_tag LOCUS_41040 gene bioD 1868 2560 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406219.1 protein_id gnl|my_center|LOCUS_41040 >Feature sequence580 154 795 gene locus_tag LOCUS_41050 154 795 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227434.1 protein_id gnl|my_center|LOCUS_41050 829 1788 gene locus_tag LOCUS_41060 829 1788 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644043.1 protein_id gnl|my_center|LOCUS_41060 1843 2553 gene locus_tag LOCUS_41070 1843 2553 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337347.1 protein_id gnl|my_center|LOCUS_41070 2600 2779 gene locus_tag LOCUS_41080 2600 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 2795 3184 gene locus_tag LOCUS_41090 2795 3184 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_41090 >Feature sequence581 1905 1111 gene locus_tag LOCUS_41100 1905 1111 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142363.1 protein_id gnl|my_center|LOCUS_41100 2502 2110 gene locus_tag LOCUS_41110 2502 2110 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 protein_id gnl|my_center|LOCUS_41110 >Feature sequence582 <1 1044 gene locus_tag LOCUS_41120 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920716.1:iron uptake porin 1482 1168 gene locus_tag LOCUS_41130 1482 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 >Feature sequence583 339 1304 gene locus_tag LOCUS_41140 339 1304 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 protein_id gnl|my_center|LOCUS_41140 1361 1753 gene locus_tag LOCUS_41150 1361 1753 CDS product nuclease A inhibitor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142296.1 protein_id gnl|my_center|LOCUS_41150 2544 1750 gene locus_tag LOCUS_41160 2544 1750 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140079.1 protein_id gnl|my_center|LOCUS_41160 >Feature sequence584 128 493 gene locus_tag LOCUS_41170 128 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 1179 736 gene locus_tag LOCUS_41180 1179 736 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056354.1 protein_id gnl|my_center|LOCUS_41180 1831 1469 gene locus_tag LOCUS_41190 1831 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 1912 3114 gene locus_tag LOCUS_41200 gene xseA 1912 3114 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838345.1 protein_id gnl|my_center|LOCUS_41200 3098 3319 gene locus_tag LOCUS_41210 3098 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 >Feature sequence585 475 2067 gene locus_tag LOCUS_41220 475 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 >Feature sequence586 333 800 gene locus_tag LOCUS_41230 333 800 CDS product DUF2214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920775.1 protein_id gnl|my_center|LOCUS_41230 1156 827 gene locus_tag LOCUS_41240 1156 827 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031215.1 protein_id gnl|my_center|LOCUS_41240 1244 2314 gene locus_tag LOCUS_41250 gene arsB 1244 2314 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_41250 >Feature sequence587 <1 790 gene locus_tag LOCUS_41260 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583508.1:pitrilysin family protein 885 2132 gene locus_tag LOCUS_41270 885 2132 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_41270 >Feature sequence588 <1 811 gene locus_tag LOCUS_41280 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228806.1:metallophosphoesterase 817 1569 gene locus_tag LOCUS_41290 817 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 2657 1572 gene locus_tag LOCUS_41300 2657 1572 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_41300 <3402 2660 gene locus_tag LOCUS_41310 <3402 2660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020404386.1:glycosyltransferase >Feature sequence589 961 227 gene locus_tag LOCUS_41320 961 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 2132 1287 gene locus_tag LOCUS_41330 2132 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 2653 2892 gene locus_tag LOCUS_41340 2653 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 >Feature sequence590 453 1190 gene locus_tag LOCUS_41350 453 1190 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 protein_id gnl|my_center|LOCUS_41350 1273 1833 gene locus_tag LOCUS_41360 1273 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 2057 2485 gene locus_tag LOCUS_41370 2057 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 3122 2763 gene locus_tag LOCUS_41380 3122 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 >Feature sequence591 334 1098 gene locus_tag LOCUS_41390 334 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 1302 2981 gene locus_tag LOCUS_41400 1302 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 >Feature sequence592 108 698 gene locus_tag LOCUS_41410 108 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 860 1705 gene locus_tag LOCUS_41420 860 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 >Feature sequence593 1454 987 gene locus_tag LOCUS_41430 1454 987 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920944.1 protein_id gnl|my_center|LOCUS_41430 2447 1851 gene locus_tag LOCUS_41440 2447 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 >Feature sequence594 1235 120 gene locus_tag LOCUS_41450 1235 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 <3323 1489 gene locus_tag LOCUS_41460 <3323 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876085.1:response regulator >Feature sequence595 775 560 gene locus_tag LOCUS_41470 775 560 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_41470 1243 995 gene locus_tag LOCUS_41480 1243 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 1575 1240 gene locus_tag LOCUS_41490 1575 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 2352 1672 gene locus_tag LOCUS_41500 2352 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 3055 2507 gene locus_tag LOCUS_41510 3055 2507 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081403079.1 protein_id gnl|my_center|LOCUS_41510 >Feature sequence596 236 1387 gene locus_tag LOCUS_41520 236 1387 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_41520 1541 1918 gene locus_tag LOCUS_41530 1541 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 2580 1960 gene locus_tag LOCUS_41540 2580 1960 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_41540 2861 2703 gene locus_tag LOCUS_41550 2861 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 >Feature sequence597 1230 349 gene locus_tag LOCUS_41560 1230 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 1968 1330 gene locus_tag LOCUS_41570 1968 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 2044 2286 gene locus_tag LOCUS_41580 2044 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 2352 2960 gene locus_tag LOCUS_41590 2352 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 >Feature sequence598 1694 318 gene locus_tag LOCUS_41600 1694 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 2233 1697 gene locus_tag LOCUS_41610 2233 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 3054 2515 gene locus_tag LOCUS_41620 gene kdpC 3054 2515 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883955.1 protein_id gnl|my_center|LOCUS_41620 >Feature sequence599 491 1324 gene locus_tag LOCUS_41630 491 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 <3263 1517 gene locus_tag LOCUS_41640 <3263 1517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase >Feature sequence600 743 2416 gene locus_tag LOCUS_41650 743 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222614.1 protein_id gnl|my_center|LOCUS_41650 2690 2899 gene locus_tag LOCUS_41660 2690 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 2942 3070 gene locus_tag LOCUS_41670 2942 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 >Feature sequence601 347 207 gene locus_tag LOCUS_41680 347 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 1004 351 gene locus_tag LOCUS_41690 1004 351 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_41690 1472 2224 gene locus_tag LOCUS_41700 1472 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 2221 2580 gene locus_tag LOCUS_41710 2221 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 2930 2637 gene locus_tag LOCUS_41720 2930 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140152.1 protein_id gnl|my_center|LOCUS_41720 >Feature sequence602 580 768 gene locus_tag LOCUS_41730 580 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 816 2222 gene locus_tag LOCUS_41740 816 2222 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887539.1 protein_id gnl|my_center|LOCUS_41740 2502 2708 gene locus_tag LOCUS_41750 2502 2708 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056299.1 protein_id gnl|my_center|LOCUS_41750 2759 2959 gene locus_tag LOCUS_41760 2759 2959 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_41760 >Feature sequence603 2143 656 gene locus_tag LOCUS_41770 2143 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 3103 2516 gene locus_tag LOCUS_41780 3103 2516 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679904.1 protein_id gnl|my_center|LOCUS_41780 >Feature sequence604 376 146 gene locus_tag LOCUS_41790 376 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 657 373 gene locus_tag LOCUS_41800 657 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 1268 1104 gene locus_tag LOCUS_41810 1268 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 1612 1914 gene locus_tag LOCUS_41820 1612 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 1907 2848 gene locus_tag LOCUS_41830 1907 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 >Feature sequence605 96 2120 gene locus_tag LOCUS_41840 gene brxL 96 2120 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_41840 2758 2072 gene locus_tag LOCUS_41850 2758 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 >Feature sequence606 <1 3147 gene locus_tag LOCUS_41860 <1 3147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256308.1:response regulator >Feature sequence607 693 481 gene locus_tag LOCUS_41870 693 481 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_41870 1028 756 gene locus_tag LOCUS_41880 1028 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 1432 1097 gene locus_tag LOCUS_41890 1432 1097 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057344.1 protein_id gnl|my_center|LOCUS_41890 1932 1468 gene locus_tag LOCUS_41900 1932 1468 CDS product chaperonin family protein RbcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142154.1 protein_id gnl|my_center|LOCUS_41900 <3226 2006 gene locus_tag LOCUS_41910 <3226 2006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057346.1:form I ribulose bisphosphate carboxylase large subunit >Feature sequence608 482 1717 gene locus_tag LOCUS_41920 482 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 1727 2326 gene locus_tag LOCUS_41930 1727 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 >Feature sequence609 113 649 gene locus_tag LOCUS_41940 gene pgsA 113 649 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_41940 734 2701 gene locus_tag LOCUS_41950 734 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 >Feature sequence610 133 450 gene locus_tag LOCUS_41960 133 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 860 2809 gene locus_tag LOCUS_41970 860 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 >Feature sequence611 100 642 gene locus_tag LOCUS_41980 100 642 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_41980 1910 690 gene locus_tag LOCUS_41990 1910 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 2064 2711 gene locus_tag LOCUS_42000 2064 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 >Feature sequence612 65 814 gene locus_tag LOCUS_42010 65 814 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057150.1 protein_id gnl|my_center|LOCUS_42010 1420 2184 gene locus_tag LOCUS_42020 1420 2184 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011128594.1 protein_id gnl|my_center|LOCUS_42020 2449 2940 gene locus_tag LOCUS_42030 2449 2940 CDS product thylakoid membrane photosystem I accumulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798220.1 protein_id gnl|my_center|LOCUS_42030 >Feature sequence613 517 1419 gene locus_tag LOCUS_42040 517 1419 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_42040 1787 3091 gene locus_tag LOCUS_42050 1787 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540305.1 protein_id gnl|my_center|LOCUS_42050 >Feature sequence614 <3191 844 gene locus_tag LOCUS_42060 <3191 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence615 >Feature sequence616 2091 709 gene locus_tag LOCUS_42070 2091 709 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_42070 2191 2988 gene locus_tag LOCUS_42080 2191 2988 CDS product E3 ubiquitin ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056507.1 protein_id gnl|my_center|LOCUS_42080 >Feature sequence617 2747 2241 gene locus_tag LOCUS_42090 2747 2241 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140431.1 protein_id gnl|my_center|LOCUS_42090 2920 2744 gene locus_tag LOCUS_42100 2920 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 >Feature sequence618 1863 1039 gene locus_tag LOCUS_42110 1863 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 2014 2724 gene locus_tag LOCUS_42120 2014 2724 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056991.1 protein_id gnl|my_center|LOCUS_42120 >Feature sequence619 534 112 gene locus_tag LOCUS_42130 534 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 1809 1102 gene locus_tag LOCUS_42140 1809 1102 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174178.1 protein_id gnl|my_center|LOCUS_42140 2899 1829 gene locus_tag LOCUS_42150 2899 1829 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928544.1 protein_id gnl|my_center|LOCUS_42150 >Feature sequence620 251 1081 gene locus_tag LOCUS_42160 gene larE 251 1081 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_42160 1848 2972 gene locus_tag LOCUS_42170 1848 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 >Feature sequence621 1227 745 gene locus_tag LOCUS_42180 1227 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_42180 2609 1230 gene locus_tag LOCUS_42190 2609 1230 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_42190 <3165 2643 gene locus_tag LOCUS_42200 <3165 2643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142965.1:Uma2 family endonuclease >Feature sequence622 638 117 gene locus_tag LOCUS_42210 638 117 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_42210 815 1984 gene locus_tag LOCUS_42220 gene hpxO 815 1984 CDS product FAD-dependent urate hydroxylase HpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207945.1 protein_id gnl|my_center|LOCUS_42220 1981 2478 gene locus_tag LOCUS_42230 gene uraD 1981 2478 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552526.1 protein_id gnl|my_center|LOCUS_42230 >Feature sequence623 209 1558 gene locus_tag LOCUS_42240 209 1558 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_42240 2066 1617 gene locus_tag LOCUS_42250 gene ndhN 2066 1617 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056972.1 protein_id gnl|my_center|LOCUS_42250 2677 2294 gene locus_tag LOCUS_42260 2677 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057511.1 protein_id gnl|my_center|LOCUS_42260 >Feature sequence624 1126 545 gene locus_tag LOCUS_42270 1126 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 1698 1429 gene locus_tag LOCUS_42280 1698 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 <3154 2012 gene locus_tag LOCUS_42290 <3154 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263035.1:nuclease-related domain-containing DEAD/DEAH box helicase >Feature sequence625 623 2248 gene locus_tag LOCUS_42300 623 2248 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530815.1 protein_id gnl|my_center|LOCUS_42300 >Feature sequence626 546 241 gene locus_tag LOCUS_42310 gene nuoK 546 241 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_42310 1227 613 gene locus_tag LOCUS_42320 1227 613 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_42320 1832 1242 gene locus_tag LOCUS_42330 gene ndhI 1832 1242 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056515.1 protein_id gnl|my_center|LOCUS_42330 2984 1866 gene locus_tag LOCUS_42340 gene nuoH 2984 1866 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126985484.1 protein_id gnl|my_center|LOCUS_42340 >Feature sequence627 247 393 gene locus_tag LOCUS_42350 247 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 930 2144 gene locus_tag LOCUS_42360 930 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 >Feature sequence628 468 31 gene locus_tag LOCUS_42370 gene aroQ 468 31 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142437.1 protein_id gnl|my_center|LOCUS_42370 857 531 gene locus_tag LOCUS_42380 857 531 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125880.1 protein_id gnl|my_center|LOCUS_42380 1571 1050 gene locus_tag LOCUS_42390 1571 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 2178 1771 gene locus_tag LOCUS_42400 2178 1771 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096828425.1 protein_id gnl|my_center|LOCUS_42400 2138 3115 gene locus_tag LOCUS_42410 2138 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 >Feature sequence629 349 942 gene locus_tag LOCUS_42420 349 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 1492 995 gene locus_tag LOCUS_42430 1492 995 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219860.1 protein_id gnl|my_center|LOCUS_42430 1823 2905 gene locus_tag LOCUS_42440 1823 2905 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530028.1 protein_id gnl|my_center|LOCUS_42440 >Feature sequence630 1279 119 gene locus_tag LOCUS_42450 1279 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 1771 1319 gene locus_tag LOCUS_42460 1771 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 1967 3010 gene locus_tag LOCUS_42470 gene plsX 1967 3010 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056688.1 protein_id gnl|my_center|LOCUS_42470 >Feature sequence631 320 392 gene locus_tag LOCUS_t00420 320 392 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 525 1043 gene locus_tag LOCUS_42480 525 1043 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140843.1 protein_id gnl|my_center|LOCUS_42480 >Feature sequence632 671 75 gene locus_tag LOCUS_42490 gene gmk 671 75 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055909.1 protein_id gnl|my_center|LOCUS_42490 992 732 gene locus_tag LOCUS_42500 992 732 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_42500 2402 1158 gene locus_tag LOCUS_42510 gene trpB 2402 1158 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058306.1 protein_id gnl|my_center|LOCUS_42510 >Feature sequence633 <1 2758 gene locus_tag LOCUS_42520 <1 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257888.1:glycoside hydrolase family 65 protein >Feature sequence634 524 177 gene locus_tag LOCUS_42530 524 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 1309 1695 gene locus_tag LOCUS_42540 1309 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 >Feature sequence635 610 107 gene locus_tag LOCUS_42550 610 107 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920989.1 protein_id gnl|my_center|LOCUS_42550 1964 660 gene locus_tag LOCUS_42560 1964 660 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058239.1 protein_id gnl|my_center|LOCUS_42560 2797 1961 gene locus_tag LOCUS_42570 2797 1961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144100.1 protein_id gnl|my_center|LOCUS_42570 >Feature sequence636 <1 1841 gene locus_tag LOCUS_42580 <1 1841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057167.1:ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent 2039 1896 gene locus_tag LOCUS_42590 2039 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 2321 2049 gene locus_tag LOCUS_42600 2321 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 2569 2321 gene locus_tag LOCUS_42610 2569 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 2737 2928 gene locus_tag LOCUS_42620 2737 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 >Feature sequence637 265 1527 gene locus_tag LOCUS_42630 265 1527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_42630 >Feature sequence638 967 1674 gene locus_tag LOCUS_42640 967 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 1656 2045 gene locus_tag LOCUS_42650 1656 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 2814 2993 gene locus_tag LOCUS_42660 2814 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 >Feature sequence639 1163 2815 gene locus_tag LOCUS_42670 1163 2815 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085439.1 protein_id gnl|my_center|LOCUS_42670 >Feature sequence640 685 2967 gene locus_tag LOCUS_42680 685 2967 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141880.1 protein_id gnl|my_center|LOCUS_42680 >Feature sequence641 >Feature sequence642 758 192 gene locus_tag LOCUS_42690 758 192 CDS product allophycocyanin subunit alpha-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920894.1 protein_id gnl|my_center|LOCUS_42690 3038 816 gene locus_tag LOCUS_42700 3038 816 CDS product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056828.1 protein_id gnl|my_center|LOCUS_42700 >Feature sequence643 <1 750 gene locus_tag LOCUS_42710 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266740.1:FAD-dependent oxidoreductase 1361 1642 gene locus_tag LOCUS_42720 1361 1642 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970501.1 protein_id gnl|my_center|LOCUS_42720 1704 1853 gene locus_tag LOCUS_42730 1704 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 >Feature sequence644 540 1067 gene locus_tag LOCUS_42740 540 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 1320 1721 gene locus_tag LOCUS_42750 1320 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 1746 2195 gene locus_tag LOCUS_42760 1746 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 2323 2967 gene locus_tag LOCUS_42770 2323 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 >Feature sequence645 1430 2311 gene locus_tag LOCUS_42780 1430 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 <3007 2398 gene locus_tag LOCUS_42790 <3007 2398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057011.1:pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha >Feature sequence646 1403 165 gene locus_tag LOCUS_42800 1403 165 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797661.1 protein_id gnl|my_center|LOCUS_42800 >Feature sequence647 718 443 gene locus_tag LOCUS_42810 718 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 882 2573 gene locus_tag LOCUS_42820 882 2573 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088894694.1 protein_id gnl|my_center|LOCUS_42820 >Feature sequence648 68 1381 gene locus_tag LOCUS_42830 68 1381 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140777.1 protein_id gnl|my_center|LOCUS_42830 1383 2684 gene locus_tag LOCUS_42840 1383 2684 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530116.1 protein_id gnl|my_center|LOCUS_42840 >Feature sequence649 2156 909 gene locus_tag LOCUS_42850 2156 909 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057903.1 protein_id gnl|my_center|LOCUS_42850 2427 2774 gene locus_tag LOCUS_42860 2427 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 >Feature sequence650 205 1095 gene locus_tag LOCUS_42870 205 1095 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_42870 1234 1353 gene locus_tag LOCUS_42880 1234 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 2646 1426 gene locus_tag LOCUS_42890 gene chlP 2646 1426 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 protein_id gnl|my_center|LOCUS_42890 >Feature sequence651 1091 141 gene locus_tag LOCUS_42900 1091 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 2181 2570 gene locus_tag LOCUS_42910 2181 2570 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_42910 >Feature sequence652 117 572 gene locus_tag LOCUS_42920 gene bcp 117 572 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124248.1 protein_id gnl|my_center|LOCUS_42920 681 1568 gene locus_tag LOCUS_42930 gene folP 681 1568 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_42930 1843 2949 gene locus_tag LOCUS_42940 1843 2949 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 protein_id gnl|my_center|LOCUS_42940 >Feature sequence653 <1 1606 gene locus_tag LOCUS_42950 <1 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057893.1:NFACT RNA binding domain-containing protein 2826 1672 gene locus_tag LOCUS_42960 2826 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 >Feature sequence654 937 818 gene locus_tag LOCUS_42970 937 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 1172 1044 gene locus_tag LOCUS_42980 1172 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 1998 1792 gene locus_tag LOCUS_42990 1998 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 2445 2041 gene locus_tag LOCUS_43000 2445 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 2848 2657 gene locus_tag LOCUS_43010 2848 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 >Feature sequence655 >Feature sequence656 9 218 gene locus_tag LOCUS_43020 9 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 242 1183 gene locus_tag LOCUS_43030 242 1183 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_43030 2234 1842 gene locus_tag LOCUS_43040 2234 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 >Feature sequence657 1289 297 gene locus_tag LOCUS_43050 1289 297 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057700.1 protein_id gnl|my_center|LOCUS_43050 2679 1348 gene locus_tag LOCUS_43060 2679 1348 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 protein_id gnl|my_center|LOCUS_43060 >Feature sequence658 1672 104 gene locus_tag LOCUS_43070 1672 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 >Feature sequence659 285 19 gene locus_tag LOCUS_43080 285 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 752 354 gene locus_tag LOCUS_43090 752 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 990 763 gene locus_tag LOCUS_43100 990 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 <2932 1139 gene locus_tag LOCUS_43110 <2932 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056610.1:phosphoenolpyruvate synthase >Feature sequence660 364 1800 gene locus_tag LOCUS_43120 364 1800 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_43120 >Feature sequence661 <1 996 gene locus_tag LOCUS_43130 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266948.1:protein-glutamate O-methyltransferase CheR 998 2668 gene locus_tag LOCUS_43140 gene wspA 998 2668 CDS product Wsp signal transduction system chemoreceptor WspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113844.1 protein_id gnl|my_center|LOCUS_43140 >Feature sequence662 840 343 gene locus_tag LOCUS_43150 840 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 1643 1939 gene locus_tag LOCUS_43160 1643 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 <2899 2364 gene locus_tag LOCUS_43170 <2899 2364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920921.1:alpha/beta hydrolase >Feature sequence663 1312 245 gene locus_tag LOCUS_43180 1312 245 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_43180 <2894 1398 gene locus_tag LOCUS_43190 <2894 1398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057891.1:trans-splicing intein-formed DNA polymerase III subunit alpha N-terminal partner DnaE-N >Feature sequence664 1799 222 gene locus_tag LOCUS_43200 1799 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 >Feature sequence665 <1 1353 gene locus_tag LOCUS_43210 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966619.1:ABC transporter substrate-binding protein 1692 1492 gene locus_tag LOCUS_43220 1692 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 2392 1958 gene locus_tag LOCUS_43230 2392 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 2675 2373 gene locus_tag LOCUS_43240 2675 2373 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_43240 >Feature sequence666 >Feature sequence667 1261 152 gene locus_tag LOCUS_43250 1261 152 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552050.1 protein_id gnl|my_center|LOCUS_43250 2667 1561 gene locus_tag LOCUS_43260 2667 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 >Feature sequence668 460 1503 gene locus_tag LOCUS_43270 460 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 2538 1645 gene locus_tag LOCUS_43280 2538 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 >Feature sequence669 1300 170 gene locus_tag LOCUS_43290 1300 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 1517 2668 gene locus_tag LOCUS_43300 1517 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 >Feature sequence670 55 1734 gene locus_tag LOCUS_43310 55 1734 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_43310 2276 1845 gene locus_tag LOCUS_43320 2276 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 >Feature sequence671 284 1732 gene locus_tag LOCUS_43330 284 1732 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013323452.1 protein_id gnl|my_center|LOCUS_43330 1821 2852 gene locus_tag LOCUS_43340 1821 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 >Feature sequence672 726 151 gene locus_tag LOCUS_43350 gene umuD 726 151 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946663.1 protein_id gnl|my_center|LOCUS_43350 1328 2443 gene locus_tag LOCUS_43360 1328 2443 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_43360 2692 2471 gene locus_tag LOCUS_43370 2692 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 >Feature sequence673 <1 871 gene locus_tag LOCUS_43380 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057983.1:J domain-containing protein 928 1410 gene locus_tag LOCUS_43390 928 1410 CDS product CRR6 family NdhI maturation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143485.1 protein_id gnl|my_center|LOCUS_43390 1418 2785 gene locus_tag LOCUS_43400 1418 2785 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_43400 >Feature sequence674 348 1394 gene locus_tag LOCUS_43410 348 1394 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266508.1 protein_id gnl|my_center|LOCUS_43410 1391 2638 gene locus_tag LOCUS_43420 1391 2638 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187233.1 protein_id gnl|my_center|LOCUS_43420 >Feature sequence675 893 69 gene locus_tag LOCUS_43430 893 69 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920196.1 protein_id gnl|my_center|LOCUS_43430 1010 1558 gene locus_tag LOCUS_43440 1010 1558 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 protein_id gnl|my_center|LOCUS_43440 2710 1580 gene locus_tag LOCUS_43450 2710 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 >Feature sequence676 61 666 gene locus_tag LOCUS_43460 gene def 61 666 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814412.1 protein_id gnl|my_center|LOCUS_43460 672 1034 gene locus_tag LOCUS_43470 672 1034 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_43470 1522 1079 gene locus_tag LOCUS_43480 1522 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 2394 1681 gene locus_tag LOCUS_43490 gene pyrF 2394 1681 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920684.1 protein_id gnl|my_center|LOCUS_43490 >Feature sequence677 376 146 gene locus_tag LOCUS_43500 376 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 865 2325 gene locus_tag LOCUS_43510 865 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 2406 2660 gene locus_tag LOCUS_43520 gene relJ 2406 2660 CDS product type II toxin-antitoxin system antitoxin RelJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417757.1 protein_id gnl|my_center|LOCUS_43520 >Feature sequence678 209 394 gene locus_tag LOCUS_43530 209 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 677 2287 gene locus_tag LOCUS_43540 677 2287 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140923.1 protein_id gnl|my_center|LOCUS_43540 2603 2319 gene locus_tag LOCUS_43550 2603 2319 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141965.1 protein_id gnl|my_center|LOCUS_43550 >Feature sequence679 140 880 gene locus_tag LOCUS_43560 140 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 987 1190 gene locus_tag LOCUS_43570 987 1190 CDS product DUF751 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057323.1 protein_id gnl|my_center|LOCUS_43570 1246 1536 gene locus_tag LOCUS_43580 1246 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 1609 1992 gene locus_tag LOCUS_43590 gene rbfA 1609 1992 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_43590 1985 2620 gene locus_tag LOCUS_43600 1985 2620 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920671.1 protein_id gnl|my_center|LOCUS_43600 >Feature sequence680 267 49 gene locus_tag LOCUS_43610 267 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 619 410 gene locus_tag LOCUS_43620 619 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 2829 1066 gene locus_tag LOCUS_43630 2829 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 >Feature sequence681 152 529 gene locus_tag LOCUS_43640 152 529 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_43640 709 948 gene locus_tag LOCUS_43650 709 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 941 1282 gene locus_tag LOCUS_43660 941 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 1375 1707 gene locus_tag LOCUS_43670 1375 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 1713 2042 gene locus_tag LOCUS_43680 1713 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 <2825 2270 gene locus_tag LOCUS_43690 <2825 2270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141130.1:endolytic transglycosylase MltG >Feature sequence682 270 1727 gene locus_tag LOCUS_43700 270 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 >Feature sequence683 350 1897 gene locus_tag LOCUS_43710 350 1897 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_43710 <2821 1907 gene locus_tag LOCUS_43720 <2821 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144027.1:DNA double-strand break repair nuclease NurA >Feature sequence684 408 746 gene locus_tag LOCUS_43730 408 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43730 824 1030 gene locus_tag LOCUS_43740 824 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 1191 1118 gene locus_tag LOCUS_t00430 1191 1118 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2686 1382 gene locus_tag LOCUS_43750 2686 1382 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_43750 >Feature sequence685 766 353 gene locus_tag LOCUS_43760 766 353 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_43760 1119 763 gene locus_tag LOCUS_43770 1119 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 2217 1924 gene locus_tag LOCUS_43780 2217 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140152.1 protein_id gnl|my_center|LOCUS_43780 >Feature sequence686 >Feature sequence687 <1 573 gene locus_tag LOCUS_43790 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_088429091.1:L-histidine N(alpha)-methyltransferase 733 1965 gene locus_tag LOCUS_43800 733 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 2039 2533 gene locus_tag LOCUS_43810 2039 2533 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_43810 >Feature sequence688 69 2756 gene locus_tag LOCUS_43820 69 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 >Feature sequence689 >Feature sequence690 <1 1138 gene locus_tag LOCUS_43830 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056445.1:Rne/Rng family ribonuclease 2627 1218 gene locus_tag LOCUS_43840 2627 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 >Feature sequence691 >Feature sequence692 153 1103 gene locus_tag LOCUS_43850 gene mdh 153 1103 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142537.1 protein_id gnl|my_center|LOCUS_43850 >Feature sequence693 <1 856 gene locus_tag LOCUS_43860 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143469.1:NDP-sugar synthase 2518 923 gene locus_tag LOCUS_43870 2518 923 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 protein_id gnl|my_center|LOCUS_43870 >Feature sequence694 1661 579 gene locus_tag LOCUS_43880 1661 579 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920982.1 protein_id gnl|my_center|LOCUS_43880 >Feature sequence695 <1 942 gene locus_tag LOCUS_43890 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein <2772 1189 gene locus_tag LOCUS_43900 <2772 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022778.1:tetratricopeptide repeat protein >Feature sequence696 924 193 gene locus_tag LOCUS_43910 924 193 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007353051.1 protein_id gnl|my_center|LOCUS_43910 2215 1085 gene locus_tag LOCUS_43920 2215 1085 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 protein_id gnl|my_center|LOCUS_43920 >Feature sequence697 <1 1274 gene locus_tag LOCUS_43930 <1 1274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393804.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence698 1357 803 gene locus_tag LOCUS_43940 1357 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 1941 1507 gene locus_tag LOCUS_43950 gene ruvX 1941 1507 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058162.1 protein_id gnl|my_center|LOCUS_43950 2597 1944 gene locus_tag LOCUS_43960 2597 1944 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_43960 >Feature sequence699 267 935 gene locus_tag LOCUS_43970 267 935 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397315.1 protein_id gnl|my_center|LOCUS_43970 1065 2423 gene locus_tag LOCUS_43980 1065 2423 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969840.1 protein_id gnl|my_center|LOCUS_43980 >Feature sequence700 <1 1004 gene locus_tag LOCUS_43990 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144015.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence701 2548 2111 gene locus_tag LOCUS_44000 2548 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 >Feature sequence702 21 1313 gene locus_tag LOCUS_44010 21 1313 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141171.1 protein_id gnl|my_center|LOCUS_44010 1406 1597 gene locus_tag LOCUS_44020 1406 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 >Feature sequence703 <2721 1378 gene locus_tag LOCUS_44030 <2721 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140275.1:DNA repair protein RecN >Feature sequence704 364 110 gene locus_tag LOCUS_44040 gene relJ 364 110 CDS product type II toxin-antitoxin system antitoxin RelJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417757.1 protein_id gnl|my_center|LOCUS_44040 850 392 gene locus_tag LOCUS_44050 850 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 1842 901 gene locus_tag LOCUS_44060 1842 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 2538 2179 gene locus_tag LOCUS_44070 2538 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 >Feature sequence705 849 2603 gene locus_tag LOCUS_44080 849 2603 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799342.1 protein_id gnl|my_center|LOCUS_44080 >Feature sequence706 >Feature sequence707 811 71 gene locus_tag LOCUS_44090 811 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 2107 1064 gene locus_tag LOCUS_44100 2107 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 >Feature sequence708 2295 664 gene locus_tag LOCUS_44110 2295 664 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920921.1 protein_id gnl|my_center|LOCUS_44110 >Feature sequence709 1933 143 gene locus_tag LOCUS_44120 gene ltrA 1933 143 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_44120 >Feature sequence710 568 816 gene locus_tag LOCUS_44130 568 816 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141676.1 protein_id gnl|my_center|LOCUS_44130 823 1242 gene locus_tag LOCUS_44140 823 1242 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_44140 1514 1756 gene locus_tag LOCUS_44150 1514 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 1759 1926 gene locus_tag LOCUS_44160 1759 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 1914 2246 gene locus_tag LOCUS_44170 1914 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 2403 2612 gene locus_tag LOCUS_44180 2403 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 >Feature sequence711 1101 610 gene locus_tag LOCUS_44190 1101 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44190 <2646 1117 gene locus_tag LOCUS_44200 <2646 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941062.1:efflux RND transporter permease subunit note possible pseudo, internal stop codon >Feature sequence712 231 2282 gene locus_tag LOCUS_44210 gene ligA 231 2282 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056701.1 protein_id gnl|my_center|LOCUS_44210 >Feature sequence713 1221 157 gene locus_tag LOCUS_44220 1221 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 1315 2133 gene locus_tag LOCUS_44230 1315 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 >Feature sequence714 <1 702 gene locus_tag LOCUS_44240 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055875.1:polyprenyl synthetase family protein 709 1200 gene locus_tag LOCUS_44250 709 1200 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_44250 >Feature sequence715 2186 786 gene locus_tag LOCUS_44260 2186 786 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_44260 >Feature sequence716 128 358 gene locus_tag LOCUS_44270 128 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 310 495 gene locus_tag LOCUS_44280 310 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 510 740 gene locus_tag LOCUS_44290 510 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258616.1 protein_id gnl|my_center|LOCUS_44290 1137 763 gene locus_tag LOCUS_44300 1137 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 1367 1134 gene locus_tag LOCUS_44310 1367 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 2401 1448 gene locus_tag LOCUS_44320 2401 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 >Feature sequence717 1214 204 gene locus_tag LOCUS_44330 gene pseB 1214 204 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_44330 1388 1227 gene locus_tag LOCUS_44340 1388 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 <2602 1598 gene locus_tag LOCUS_44350 <2602 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799067.1:TIGR00303 family protein >Feature sequence718 1037 144 gene locus_tag LOCUS_44360 1037 144 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928785.1 protein_id gnl|my_center|LOCUS_44360 >Feature sequence719 343 1638 gene locus_tag LOCUS_44370 gene purB 343 1638 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057666.1 protein_id gnl|my_center|LOCUS_44370 >Feature sequence720 <2596 543 gene locus_tag LOCUS_44380 <2596 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141852.1:chemotaxis protein CheB >Feature sequence721 1352 411 gene locus_tag LOCUS_44390 1352 411 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124827.1 protein_id gnl|my_center|LOCUS_44390 1552 2502 gene locus_tag LOCUS_44400 1552 2502 CDS product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 protein_id gnl|my_center|LOCUS_44400 >Feature sequence722 2487 331 gene locus_tag LOCUS_44410 2487 331 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_44410 >Feature sequence723 1625 285 gene locus_tag LOCUS_44420 1625 285 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_44420 2564 1812 gene locus_tag LOCUS_44430 2564 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 >Feature sequence724 >Feature sequence725 398 853 gene locus_tag LOCUS_44440 398 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 1073 1360 gene locus_tag LOCUS_44450 1073 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 1353 1511 gene locus_tag LOCUS_44460 1353 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 2405 1539 gene locus_tag LOCUS_44470 2405 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 >Feature sequence726 2332 170 gene locus_tag LOCUS_44480 2332 170 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_44480 >Feature sequence727 1296 238 gene locus_tag LOCUS_44490 1296 238 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920127.1 protein_id gnl|my_center|LOCUS_44490 1851 1399 gene locus_tag LOCUS_44500 1851 1399 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_44500 2490 2185 gene locus_tag LOCUS_44510 2490 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 >Feature sequence728 2153 684 gene locus_tag LOCUS_44520 2153 684 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540814.1 protein_id gnl|my_center|LOCUS_44520 2221 2478 gene locus_tag LOCUS_44530 2221 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 >Feature sequence729 72 332 gene locus_tag LOCUS_44540 72 332 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_44540 427 308 gene locus_tag LOCUS_44550 427 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 645 517 gene locus_tag LOCUS_44560 645 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 >Feature sequence730 544 885 gene locus_tag LOCUS_44570 544 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 891 1202 gene locus_tag LOCUS_44580 891 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 1624 1319 gene locus_tag LOCUS_44590 1624 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 1955 1614 gene locus_tag LOCUS_44600 1955 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 2142 2477 gene locus_tag LOCUS_44610 2142 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 >Feature sequence731 70 336 gene locus_tag LOCUS_44620 gene relE3 70 336 CDS product type II toxin-antitoxin system toxin RelE3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870615.1 protein_id gnl|my_center|LOCUS_44620 1371 613 gene locus_tag LOCUS_44630 1371 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203296.1 protein_id gnl|my_center|LOCUS_44630 <2544 1531 gene locus_tag LOCUS_44640 <2544 1531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141163.1:GMC family oxidoreductase >Feature sequence732 84 1007 gene locus_tag LOCUS_44650 84 1007 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986764.1 protein_id gnl|my_center|LOCUS_44650 1088 1606 gene locus_tag LOCUS_44660 1088 1606 CDS product DUF3172 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920879.1 protein_id gnl|my_center|LOCUS_44660 1916 1683 gene locus_tag LOCUS_44670 1916 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 2033 1940 gene locus_tag LOCUS_t00440 2033 1940 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2367 2080 gene locus_tag LOCUS_44680 2367 2080 CDS product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_44680 >Feature sequence733 821 2071 gene locus_tag LOCUS_44690 821 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 >Feature sequence734 2 676 gene locus_tag LOCUS_44700 2 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 691 1320 gene locus_tag LOCUS_44710 gene azoR3 691 1320 CDS product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 protein_id gnl|my_center|LOCUS_44710 1461 1763 gene locus_tag LOCUS_44720 1461 1763 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_44720 >Feature sequence735 <1 607 gene locus_tag LOCUS_44730 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860792.1:DEAD/DEAH box helicase family protein 1352 783 gene locus_tag LOCUS_44740 1352 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015462938.1 protein_id gnl|my_center|LOCUS_44740 1848 1345 gene locus_tag LOCUS_44750 1848 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_44750 >Feature sequence736 <1 833 gene locus_tag LOCUS_44760 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012972453.1:DEAD/DEAH box helicase 886 2487 gene locus_tag LOCUS_44770 886 2487 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125969.1 protein_id gnl|my_center|LOCUS_44770 >Feature sequence737 1058 306 gene locus_tag LOCUS_44780 1058 306 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_44780 1639 1103 gene locus_tag LOCUS_44790 gene pyrE 1639 1103 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 protein_id gnl|my_center|LOCUS_44790 2401 1745 gene locus_tag LOCUS_44800 2401 1745 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_44800 >Feature sequence738 264 1268 gene locus_tag LOCUS_44810 264 1268 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057751.1 protein_id gnl|my_center|LOCUS_44810 >Feature sequence739 1047 676 gene locus_tag LOCUS_44820 1047 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 1342 1040 gene locus_tag LOCUS_44830 1342 1040 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870896.1 protein_id gnl|my_center|LOCUS_44830 1987 1790 gene locus_tag LOCUS_44840 1987 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 >Feature sequence740 26 433 gene locus_tag LOCUS_44850 26 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 546 983 gene locus_tag LOCUS_44860 546 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 1672 1091 gene locus_tag LOCUS_44870 1672 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 2120 1665 gene locus_tag LOCUS_44880 2120 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 >Feature sequence741 2054 114 gene locus_tag LOCUS_44890 2054 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 >Feature sequence742 348 1586 gene locus_tag LOCUS_44900 gene metK 348 1586 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056822.1 protein_id gnl|my_center|LOCUS_44900 1913 2347 gene locus_tag LOCUS_44910 1913 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 >Feature sequence743 876 205 gene locus_tag LOCUS_44920 876 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230948.1 protein_id gnl|my_center|LOCUS_44920 1457 891 gene locus_tag LOCUS_44930 1457 891 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142811.1 protein_id gnl|my_center|LOCUS_44930 2167 1568 gene locus_tag LOCUS_44940 2167 1568 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784111.1 protein_id gnl|my_center|LOCUS_44940 >Feature sequence744 436 894 gene locus_tag LOCUS_44950 436 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 891 1862 gene locus_tag LOCUS_44960 891 1862 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098061990.1 protein_id gnl|my_center|LOCUS_44960 2080 1859 gene locus_tag LOCUS_44970 2080 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 >Feature sequence745 453 689 gene locus_tag LOCUS_44980 453 689 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798862.1 protein_id gnl|my_center|LOCUS_44980 2461 890 gene locus_tag LOCUS_44990 2461 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 >Feature sequence746 408 1706 gene locus_tag LOCUS_45000 408 1706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530116.1 protein_id gnl|my_center|LOCUS_45000 1740 2399 gene locus_tag LOCUS_45010 1740 2399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_45010 >Feature sequence747 592 1440 gene locus_tag LOCUS_45020 592 1440 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_45020 >Feature sequence748 403 200 gene locus_tag LOCUS_45030 403 200 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056799.1 protein_id gnl|my_center|LOCUS_45030 1064 576 gene locus_tag LOCUS_45040 gene apcB 1064 576 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056800.1 protein_id gnl|my_center|LOCUS_45040 1661 1176 gene locus_tag LOCUS_45050 gene apcA 1661 1176 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_45050 2228 1920 gene locus_tag LOCUS_45060 2228 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 >Feature sequence749 1087 113 gene locus_tag LOCUS_45070 1087 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 <2438 1091 gene locus_tag LOCUS_45080 <2438 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974005.1:xanthine dehydrogenase molybdopterin binding subunit >Feature sequence750 400 1593 gene locus_tag LOCUS_45090 400 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 1832 1635 gene locus_tag LOCUS_45100 1832 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 >Feature sequence751 295 1401 gene locus_tag LOCUS_45110 295 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 1554 2129 gene locus_tag LOCUS_45120 1554 2129 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_45120 >Feature sequence752 573 1565 gene locus_tag LOCUS_45130 573 1565 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_45130 >Feature sequence753 289 612 gene locus_tag LOCUS_45140 289 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 658 1605 gene locus_tag LOCUS_45150 658 1605 CDS product protein rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222005.1 protein_id gnl|my_center|LOCUS_45150 1631 2020 gene locus_tag LOCUS_45160 1631 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 2020 2199 gene locus_tag LOCUS_45170 2020 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 >Feature sequence754 <2411 1096 gene locus_tag LOCUS_45180 <2411 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140923.1:GspE/PulE family protein >Feature sequence755 885 139 gene locus_tag LOCUS_45190 885 139 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_45190 1922 897 gene locus_tag LOCUS_45200 1922 897 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_45200 >Feature sequence756 90 320 gene locus_tag LOCUS_45210 90 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 1153 401 gene locus_tag LOCUS_45220 1153 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 2330 1305 gene locus_tag LOCUS_45230 2330 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 >Feature sequence757 1159 80 gene locus_tag LOCUS_45240 1159 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 2177 1401 gene locus_tag LOCUS_45250 2177 1401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920815.1 protein_id gnl|my_center|LOCUS_45250 >Feature sequence758 656 1822 gene locus_tag LOCUS_45260 656 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 >Feature sequence759 919 1143 gene locus_tag LOCUS_45270 919 1143 CDS product DUF2811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056228.1 protein_id gnl|my_center|LOCUS_45270 >Feature sequence760 <1 662 gene locus_tag LOCUS_45280 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142967.1:DUF2993 domain-containing protein >Feature sequence761 1548 151 gene locus_tag LOCUS_45290 1548 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 2226 1600 gene locus_tag LOCUS_45300 2226 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 >Feature sequence762 1677 172 gene locus_tag LOCUS_45310 1677 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 2150 1758 gene locus_tag LOCUS_45320 2150 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 >Feature sequence763 2024 297 gene locus_tag LOCUS_45330 2024 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 >Feature sequence764 228 668 gene locus_tag LOCUS_45340 228 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 1702 860 gene locus_tag LOCUS_45350 1702 860 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056297.1 protein_id gnl|my_center|LOCUS_45350 1927 2259 gene locus_tag LOCUS_45360 1927 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056902.1 protein_id gnl|my_center|LOCUS_45360 >Feature sequence765 >Feature sequence766 >Feature sequence767 1610 171 gene locus_tag LOCUS_45370 gene gltX 1610 171 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056357.1 protein_id gnl|my_center|LOCUS_45370 2007 2297 gene locus_tag LOCUS_45380 2007 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 >Feature sequence768 364 65 gene locus_tag LOCUS_45390 gene petE 364 65 CDS product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 protein_id gnl|my_center|LOCUS_45390 1084 587 gene locus_tag LOCUS_45400 gene psbV 1084 587 CDS product photosystem II cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057125.1 protein_id gnl|my_center|LOCUS_45400 1382 1188 gene locus_tag LOCUS_45410 1382 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057126.1 protein_id gnl|my_center|LOCUS_45410 2272 1508 gene locus_tag LOCUS_45420 gene hisA 2272 1508 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056071.1 protein_id gnl|my_center|LOCUS_45420 >Feature sequence769 593 45 gene locus_tag LOCUS_45430 593 45 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 protein_id gnl|my_center|LOCUS_45430 730 903 gene locus_tag LOCUS_45440 730 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 985 1449 gene locus_tag LOCUS_45450 985 1449 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 protein_id gnl|my_center|LOCUS_45450 >Feature sequence770 252 103 gene locus_tag LOCUS_45460 252 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 1553 342 gene locus_tag LOCUS_45470 1553 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 1932 1624 gene locus_tag LOCUS_45480 1932 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 >Feature sequence771 1340 1753 gene locus_tag LOCUS_45490 1340 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 >Feature sequence772 399 474 gene locus_tag LOCUS_t00450 399 474 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 562 990 gene locus_tag LOCUS_45500 562 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_45500 1279 1839 gene locus_tag LOCUS_45510 1279 1839 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929422.1 protein_id gnl|my_center|LOCUS_45510 >Feature sequence773 620 168 gene locus_tag LOCUS_45520 620 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 1258 617 gene locus_tag LOCUS_45530 1258 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 1944 1336 gene locus_tag LOCUS_45540 1944 1336 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040689791.1 protein_id gnl|my_center|LOCUS_45540 >Feature sequence774 941 36 gene locus_tag LOCUS_45550 941 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 >Feature sequence775 696 1109 gene locus_tag LOCUS_45560 696 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 >Feature sequence776 1034 231 gene locus_tag LOCUS_45570 1034 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 2013 1018 gene locus_tag LOCUS_45580 2013 1018 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035321.1 protein_id gnl|my_center|LOCUS_45580 >Feature sequence777 <1 1017 gene locus_tag LOCUS_45590 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058085.1:histidinol dehydrogenase 2149 1049 gene locus_tag LOCUS_45600 gene thrC 2149 1049 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406172.1 protein_id gnl|my_center|LOCUS_45600 >Feature sequence778 943 1245 gene locus_tag LOCUS_45610 943 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 1242 1586 gene locus_tag LOCUS_45620 1242 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 2125 1613 gene locus_tag LOCUS_45630 2125 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 >Feature sequence779 990 331 gene locus_tag LOCUS_45640 990 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 1734 1174 gene locus_tag LOCUS_45650 1734 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 2311 1781 gene locus_tag LOCUS_45660 2311 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 >Feature sequence780 <1 2289 gene locus_tag LOCUS_45670 <1 2289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence781 <1 1052 gene locus_tag LOCUS_45680 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962866.1:SPFH domain-containing protein 1376 2293 gene locus_tag LOCUS_45690 1376 2293 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056702.1 protein_id gnl|my_center|LOCUS_45690 >Feature sequence782 223 56 gene locus_tag LOCUS_45700 223 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 1602 220 gene locus_tag LOCUS_45710 1602 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 <2298 1678 gene locus_tag LOCUS_45720 <2298 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391010.1:CHAT domain-containing protein >Feature sequence783 578 766 gene locus_tag LOCUS_45730 578 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 941 1138 gene locus_tag LOCUS_45740 941 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 2105 1296 gene locus_tag LOCUS_45750 2105 1296 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 protein_id gnl|my_center|LOCUS_45750 >Feature sequence784 34 159 gene locus_tag LOCUS_45760 34 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 942 250 gene locus_tag LOCUS_45770 942 250 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921118.1 protein_id gnl|my_center|LOCUS_45770 1173 943 gene locus_tag LOCUS_45780 1173 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 1352 1753 gene locus_tag LOCUS_45790 1352 1753 CDS product DUF3119 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056952.1 protein_id gnl|my_center|LOCUS_45790 >Feature sequence785 1981 164 gene locus_tag LOCUS_45800 1981 164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142666.1 protein_id gnl|my_center|LOCUS_45800 >Feature sequence786 >Feature sequence787 <1 728 gene locus_tag LOCUS_45810 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920870.1:magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase 1109 2107 gene locus_tag LOCUS_45820 1109 2107 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088885.1 protein_id gnl|my_center|LOCUS_45820 >Feature sequence788 <1 582 gene locus_tag LOCUS_45830 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533489.1:nitrogenase molybdenum-iron protein subunit beta 756 1886 gene locus_tag LOCUS_45840 gene nifV 756 1886 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941605.1 protein_id gnl|my_center|LOCUS_45840 1876 2133 gene locus_tag LOCUS_45850 1876 2133 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153326.1 protein_id gnl|my_center|LOCUS_45850 >Feature sequence789 654 178 gene locus_tag LOCUS_45860 654 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 1466 651 gene locus_tag LOCUS_45870 1466 651 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920913.1 protein_id gnl|my_center|LOCUS_45870 1963 1568 gene locus_tag LOCUS_45880 1963 1568 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920916.1 protein_id gnl|my_center|LOCUS_45880 >Feature sequence790 1195 356 gene locus_tag LOCUS_45890 1195 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 2020 1265 gene locus_tag LOCUS_45900 2020 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 >Feature sequence791 <2276 1327 gene locus_tag LOCUS_45910 <2276 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204925.1:class I SAM-dependent DNA methyltransferase >Feature sequence792 241 480 gene locus_tag LOCUS_45920 241 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 477 863 gene locus_tag LOCUS_45930 477 863 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_45930 1356 928 gene locus_tag LOCUS_45940 1356 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 1601 1359 gene locus_tag LOCUS_45950 1601 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 <2272 1769 gene locus_tag LOCUS_45960 <2272 1769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889236.1:DedA family protein >Feature sequence793 254 376 gene locus_tag LOCUS_45970 254 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 1285 359 gene locus_tag LOCUS_45980 1285 359 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143656.1 protein_id gnl|my_center|LOCUS_45980 1582 2079 gene locus_tag LOCUS_45990 1582 2079 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_45990 >Feature sequence794 1005 1457 gene locus_tag LOCUS_46000 1005 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 1511 2137 gene locus_tag LOCUS_46010 1511 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 protein_id gnl|my_center|LOCUS_46010 >Feature sequence795 >Feature sequence796 >Feature sequence797 476 2026 gene locus_tag LOCUS_46020 476 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 >Feature sequence798 <1 1935 gene locus_tag LOCUS_46030 <1 1935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057933.1:leucine--tRNA ligase >Feature sequence799 1 180 gene locus_tag LOCUS_46040 1 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 >Feature sequence800 >Feature sequence801 294 1406 gene locus_tag LOCUS_46050 294 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 1977 1672 gene locus_tag LOCUS_46060 1977 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 >Feature sequence802 703 407 gene locus_tag LOCUS_46070 703 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 1987 797 gene locus_tag LOCUS_46080 1987 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 >Feature sequence803 2039 1068 gene locus_tag LOCUS_46090 2039 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 >Feature sequence804 859 1185 gene locus_tag LOCUS_46100 859 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 1540 1995 gene locus_tag LOCUS_46110 1540 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 >Feature sequence805 >Feature sequence806 230 799 gene locus_tag LOCUS_46120 230 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 1406 864 gene locus_tag LOCUS_46130 1406 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 1599 2051 gene locus_tag LOCUS_46140 1599 2051 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140509.1 protein_id gnl|my_center|LOCUS_46140 >Feature sequence807 543 52 gene locus_tag LOCUS_46150 543 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_46150 1898 546 gene locus_tag LOCUS_46160 1898 546 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_46160 >Feature sequence808 855 277 gene locus_tag LOCUS_46170 855 277 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 protein_id gnl|my_center|LOCUS_46170 1278 1487 gene locus_tag LOCUS_46180 1278 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46180 1469 2158 gene locus_tag LOCUS_46190 1469 2158 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532086.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46190 >Feature sequence809 1522 1184 gene locus_tag LOCUS_46200 1522 1184 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_46200 1743 1519 gene locus_tag LOCUS_46210 1743 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 >Feature sequence810 203 496 gene locus_tag LOCUS_46220 203 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 970 1431 gene locus_tag LOCUS_46230 970 1431 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143294.1 protein_id gnl|my_center|LOCUS_46230 1897 1454 gene locus_tag LOCUS_46240 1897 1454 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_46240 >Feature sequence811 <1 761 gene locus_tag LOCUS_46250 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein 963 1208 gene locus_tag LOCUS_46260 963 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 >Feature sequence812 1249 1010 gene locus_tag LOCUS_46270 1249 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 1402 2007 gene locus_tag LOCUS_46280 1402 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 >Feature sequence813 1027 230 gene locus_tag LOCUS_46290 1027 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 <2133 1112 gene locus_tag LOCUS_46300 <2133 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003529494.1:LLM class flavin-dependent oxidoreductase >Feature sequence814 157 570 gene locus_tag LOCUS_46310 157 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 929 597 gene locus_tag LOCUS_46320 929 597 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_46320 1150 926 gene locus_tag LOCUS_46330 1150 926 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_46330 1293 1499 gene locus_tag LOCUS_46340 1293 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 <2130 1564 gene locus_tag LOCUS_46350 <2130 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057907.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH >Feature sequence815 1273 701 gene locus_tag LOCUS_46360 1273 701 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140824.1 protein_id gnl|my_center|LOCUS_46360 >Feature sequence816 >Feature sequence817 >Feature sequence818 1477 2037 gene locus_tag LOCUS_46370 1477 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 >Feature sequence819 810 301 gene locus_tag LOCUS_46380 810 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 1872 814 gene locus_tag LOCUS_46390 1872 814 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_46390 >Feature sequence820 941 132 gene locus_tag LOCUS_46400 941 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 1896 1048 gene locus_tag LOCUS_46410 1896 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 >Feature sequence821 343 1890 gene locus_tag LOCUS_46420 gene lnt 343 1890 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057504.1 protein_id gnl|my_center|LOCUS_46420 >Feature sequence822 <1 1594 gene locus_tag LOCUS_46430 <1 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058064.1:type I restriction endonuclease subunit R >Feature sequence823 <1 624 gene locus_tag LOCUS_46440 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058228.1:anhydro-N-acetylmuramic acid kinase 1447 668 gene locus_tag LOCUS_46450 gene rpsB 1447 668 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057525.1 protein_id gnl|my_center|LOCUS_46450 >Feature sequence824 1139 720 gene locus_tag LOCUS_46460 1139 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 1474 1659 gene locus_tag LOCUS_46470 1474 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 >Feature sequence825 109 714 gene locus_tag LOCUS_46480 109 714 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_46480 1350 670 gene locus_tag LOCUS_46490 1350 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 1927 1463 gene locus_tag LOCUS_46500 1927 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 >Feature sequence826 152 607 gene locus_tag LOCUS_46510 152 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 789 1709 gene locus_tag LOCUS_46520 789 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 >Feature sequence827 1283 744 gene locus_tag LOCUS_46530 1283 744 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056803.1 protein_id gnl|my_center|LOCUS_46530 >Feature sequence828 >Feature sequence829 972 433 gene locus_tag LOCUS_46540 972 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140662.1 protein_id gnl|my_center|LOCUS_46540 1644 1084 gene locus_tag LOCUS_46550 1644 1084 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974768.1 protein_id gnl|my_center|LOCUS_46550 >Feature sequence830 288 13 gene locus_tag LOCUS_46560 gene cas2 288 13 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256456.1 protein_id gnl|my_center|LOCUS_46560 972 289 gene locus_tag LOCUS_46570 972 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46570 1284 1150 gene locus_tag LOCUS_46580 1284 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 1571 1281 gene locus_tag LOCUS_46590 1571 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 1967 1626 gene locus_tag LOCUS_46600 1967 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 >Feature sequence831 >Feature sequence832 1653 628 gene locus_tag LOCUS_46610 1653 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 >Feature sequence833 468 31 gene locus_tag LOCUS_46620 468 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 1245 469 gene locus_tag LOCUS_46630 1245 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 1462 1313 gene locus_tag LOCUS_46640 1462 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 >Feature sequence834 <1 1607 gene locus_tag LOCUS_46650 <1 1607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123080.1:PAS domain S-box protein 1882 1694 gene locus_tag LOCUS_46660 1882 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 >Feature sequence835 803 1714 gene locus_tag LOCUS_46670 803 1714 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143980.1 protein_id gnl|my_center|LOCUS_46670 >Feature sequence836 <2032 1523 gene locus_tag LOCUS_46680 <2032 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166277356.1:YlqD family protein >Feature sequence837 881 36 gene locus_tag LOCUS_46690 881 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 1013 891 gene locus_tag LOCUS_46700 1013 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 1319 1708 gene locus_tag LOCUS_46710 1319 1708 CDS product nuclease A inhibitor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142296.1 protein_id gnl|my_center|LOCUS_46710 1848 1705 gene locus_tag LOCUS_46720 1848 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 >Feature sequence838 >Feature sequence839 915 1361 gene locus_tag LOCUS_46730 915 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 1578 1904 gene locus_tag LOCUS_46740 1578 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 >Feature sequence840 >Feature sequence841 931 137 gene locus_tag LOCUS_46750 931 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 <2018 1023 gene locus_tag LOCUS_46760 <2018 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530039.1:M24 family metallopeptidase >Feature sequence842 340 486 gene locus_tag LOCUS_46770 340 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 762 1397 gene locus_tag LOCUS_46780 762 1397 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144231.1 protein_id gnl|my_center|LOCUS_46780 >Feature sequence843 >Feature sequence844 1656 760 gene locus_tag LOCUS_46790 1656 760 CDS product Sll0314/Alr1548 family TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524124.1 protein_id gnl|my_center|LOCUS_46790 >Feature sequence845 <1 1677 gene locus_tag LOCUS_46800 <1 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891828.1:class I SAM-dependent DNA methyltransferase 1769 1990 gene locus_tag LOCUS_46810 1769 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 >Feature sequence846 231 632 gene locus_tag LOCUS_46820 231 632 CDS product DUF4346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056206.1 protein_id gnl|my_center|LOCUS_46820 682 1605 gene locus_tag LOCUS_46830 gene prmA 682 1605 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056181.1 protein_id gnl|my_center|LOCUS_46830 >Feature sequence847 >Feature sequence848 842 153 gene locus_tag LOCUS_46840 842 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 854 1456 gene locus_tag LOCUS_46850 gene hisB 854 1456 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055988.1 protein_id gnl|my_center|LOCUS_46850 >Feature sequence849 >Feature sequence850 >Feature sequence851 132 278 gene locus_tag LOCUS_46860 132 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 739 1890 gene locus_tag LOCUS_46870 739 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 >Feature sequence852 <1 732 gene locus_tag LOCUS_46880 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057812.1:exonuclease subunit SbcD 1356 694 gene locus_tag LOCUS_46890 1356 694 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_46890 1724 1407 gene locus_tag LOCUS_46900 1724 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 >Feature sequence853 264 1259 gene locus_tag LOCUS_46910 264 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 >Feature sequence854 >Feature sequence855 291 935 gene locus_tag LOCUS_46920 291 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 1096 1923 gene locus_tag LOCUS_46930 1096 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 >Feature sequence856 759 595 gene locus_tag LOCUS_46940 759 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 1170 763 gene locus_tag LOCUS_46950 1170 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 1677 1183 gene locus_tag LOCUS_46960 1677 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 >Feature sequence857 290 1420 gene locus_tag LOCUS_46970 gene recF 290 1420 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142400.1 protein_id gnl|my_center|LOCUS_46970 1867 1487 gene locus_tag LOCUS_46980 1867 1487 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_46980 >Feature sequence858 742 80 gene locus_tag LOCUS_46990 742 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 1281 790 gene locus_tag LOCUS_47000 1281 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 1588 1274 gene locus_tag LOCUS_47010 1588 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 >Feature sequence859 <1 1239 gene locus_tag LOCUS_47020 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799131.1:EAL domain-containing protein >Feature sequence860 999 619 gene locus_tag LOCUS_47030 999 619 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140980.1 protein_id gnl|my_center|LOCUS_47030 1331 996 gene locus_tag LOCUS_47040 1331 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 1929 1363 gene locus_tag LOCUS_47050 1929 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 >Feature sequence861 611 1810 gene locus_tag LOCUS_47060 611 1810 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056559.1 protein_id gnl|my_center|LOCUS_47060 >Feature sequence862 1235 180 gene locus_tag LOCUS_47070 1235 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 >Feature sequence863 >Feature sequence864 >Feature sequence865 1585 23 gene locus_tag LOCUS_47080 1585 23 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056367.1 protein_id gnl|my_center|LOCUS_47080 >Feature sequence866 >Feature sequence867 <1 958 gene locus_tag LOCUS_47090 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057163.1:caspase family protein >Feature sequence868 84 1361 gene locus_tag LOCUS_47100 84 1361 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440033.1 protein_id gnl|my_center|LOCUS_47100 >Feature sequence869 90 581 gene locus_tag LOCUS_47110 90 581 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_47110 700 1866 gene locus_tag LOCUS_47120 700 1866 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 protein_id gnl|my_center|LOCUS_47120 >Feature sequence870 >Feature sequence871 1566 283 gene locus_tag LOCUS_47130 gene eno 1566 283 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056505.1 protein_id gnl|my_center|LOCUS_47130 >Feature sequence872 >Feature sequence873 1138 122 gene locus_tag LOCUS_47140 1138 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 <1893 1328 gene locus_tag LOCUS_47150 <1893 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928792.1:Mrp/NBP35 family ATP-binding protein >Feature sequence874 204 974 gene locus_tag LOCUS_47160 204 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 1146 1847 gene locus_tag LOCUS_47170 1146 1847 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094941.1 protein_id gnl|my_center|LOCUS_47170 >Feature sequence875 1298 999 gene locus_tag LOCUS_47180 1298 999 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_47180 >Feature sequence876 639 1 gene locus_tag LOCUS_47190 gene nusB 639 1 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141336.1 protein_id gnl|my_center|LOCUS_47190 768 1097 gene locus_tag LOCUS_47200 768 1097 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_47200 1197 1427 gene locus_tag LOCUS_47210 1197 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 >Feature sequence877 914 174 gene locus_tag LOCUS_47220 914 174 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058141.1 protein_id gnl|my_center|LOCUS_47220 1397 1134 gene locus_tag LOCUS_47230 gene yoeB 1397 1134 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_47230 1618 1394 gene locus_tag LOCUS_47240 1618 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 >Feature sequence878 431 1156 gene locus_tag LOCUS_47250 431 1156 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_47250 >Feature sequence879 382 173 gene locus_tag LOCUS_47260 382 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 756 379 gene locus_tag LOCUS_47270 756 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 839 1168 gene locus_tag LOCUS_47280 839 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 1158 1544 gene locus_tag LOCUS_47290 1158 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 1843 1646 gene locus_tag LOCUS_47300 1843 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 >Feature sequence880 408 1760 gene locus_tag LOCUS_47310 408 1760 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222955.1 protein_id gnl|my_center|LOCUS_47310 >Feature sequence881 1737 1318 gene locus_tag LOCUS_47320 1737 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 >Feature sequence882 >Feature sequence883 >Feature sequence884 >Feature sequence885 158 694 gene locus_tag LOCUS_47330 158 694 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_47330 906 1052 gene locus_tag LOCUS_47340 906 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 1064 1216 gene locus_tag LOCUS_47350 1064 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 >Feature sequence886 267 422 gene locus_tag LOCUS_47360 267 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 1272 430 gene locus_tag LOCUS_47370 gene dinD 1272 430 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_47370 >Feature sequence887 1425 517 gene locus_tag LOCUS_47380 1425 517 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_47380 >Feature sequence888 <1811 1236 gene locus_tag LOCUS_47390 <1811 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142212.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence889 >Feature sequence890 864 61 gene locus_tag LOCUS_47400 864 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 1734 949 gene locus_tag LOCUS_47410 1734 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 >Feature sequence891 266 1582 gene locus_tag LOCUS_47420 266 1582 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190570100.1 protein_id gnl|my_center|LOCUS_47420 >Feature sequence892 202 1299 gene locus_tag LOCUS_47430 202 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 >Feature sequence893 912 325 gene locus_tag LOCUS_47440 912 325 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057324.1 protein_id gnl|my_center|LOCUS_47440 1634 1026 gene locus_tag LOCUS_47450 gene rpsD 1634 1026 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056002.1 protein_id gnl|my_center|LOCUS_47450 >Feature sequence894 40 1734 gene locus_tag LOCUS_47460 40 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 >Feature sequence895 >Feature sequence896 516 364 gene locus_tag LOCUS_47470 516 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 568 690 gene locus_tag LOCUS_47480 568 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 >Feature sequence897 223 1626 gene locus_tag LOCUS_47490 223 1626 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_47490 >Feature sequence898 1558 125 gene locus_tag LOCUS_47500 1558 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 >Feature sequence899 >Feature sequence900 >Feature sequence901 1532 168 gene locus_tag LOCUS_47510 1532 168 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920812.1 protein_id gnl|my_center|LOCUS_47510 >Feature sequence902 389 1231 gene locus_tag LOCUS_47520 gene dapF 389 1231 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058127.1 protein_id gnl|my_center|LOCUS_47520 1339 1677 gene locus_tag LOCUS_47530 1339 1677 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_47530 >Feature sequence903 1200 502 gene locus_tag LOCUS_47540 1200 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 1597 1187 gene locus_tag LOCUS_47550 1597 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 >Feature sequence904 >Feature sequence905 327 1412 gene locus_tag LOCUS_47560 327 1412 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083793.1 protein_id gnl|my_center|LOCUS_47560 >Feature sequence906 1396 1554 gene locus_tag LOCUS_47570 1396 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 >Feature sequence907 1573 422 gene locus_tag LOCUS_47580 1573 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 >Feature sequence908 343 1065 gene locus_tag LOCUS_47590 343 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 >Feature sequence909 <1724 85 gene locus_tag LOCUS_47600 <1724 85 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058103.1:DUF3536 domain-containing protein >Feature sequence910 1121 606 gene locus_tag LOCUS_47610 1121 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 >Feature sequence911 1111 170 gene locus_tag LOCUS_47620 1111 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 >Feature sequence912 <1 1353 gene locus_tag LOCUS_47630 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966619.1:ABC transporter substrate-binding protein >Feature sequence913 1371 289 gene locus_tag LOCUS_47640 1371 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 >Feature sequence914 978 1586 gene locus_tag LOCUS_47650 gene cobO 978 1586 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 protein_id gnl|my_center|LOCUS_47650 >Feature sequence915 224 1375 gene locus_tag LOCUS_47660 224 1375 CDS product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 protein_id gnl|my_center|LOCUS_47660 >Feature sequence916 1031 387 gene locus_tag LOCUS_47670 1031 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 >Feature sequence917 1062 115 gene locus_tag LOCUS_47680 1062 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47680 >Feature sequence918 1263 910 gene locus_tag LOCUS_47690 1263 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 >Feature sequence919 388 636 gene locus_tag LOCUS_47700 388 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 779 1231 gene locus_tag LOCUS_47710 779 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 1224 1670 gene locus_tag LOCUS_47720 1224 1670 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876102.1 protein_id gnl|my_center|LOCUS_47720 >Feature sequence920 431 156 gene locus_tag LOCUS_47730 431 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_47730 1291 629 gene locus_tag LOCUS_47740 1291 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 1604 1344 gene locus_tag LOCUS_47750 1604 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 >Feature sequence921 1365 154 gene locus_tag LOCUS_47760 1365 154 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140337.1 protein_id gnl|my_center|LOCUS_47760 >Feature sequence922 <1682 204 gene locus_tag LOCUS_47770 <1682 204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368424.1:DEAD/DEAH box helicase family protein >Feature sequence923 181 582 gene locus_tag LOCUS_47780 181 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 711 1634 gene locus_tag LOCUS_47790 711 1634 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057532.1 protein_id gnl|my_center|LOCUS_47790 >Feature sequence924 >Feature sequence925 385 1620 gene locus_tag LOCUS_47800 385 1620 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039725284.1 protein_id gnl|my_center|LOCUS_47800 >Feature sequence926 >Feature sequence927 <1 1083 gene locus_tag LOCUS_47810 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144195.1:response regulator >Feature sequence928 919 74 gene locus_tag LOCUS_47820 919 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 1322 1155 gene locus_tag LOCUS_47830 1322 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 >Feature sequence929 476 844 gene locus_tag LOCUS_47840 476 844 CDS product oxidation-sensing regulator MosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405595.1 protein_id gnl|my_center|LOCUS_47840 >Feature sequence930 <1 1249 gene locus_tag LOCUS_47850 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057288.1:ferrous iron transport protein B >Feature sequence931 587 1249 gene locus_tag LOCUS_47860 587 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 >Feature sequence932 <1 1536 gene locus_tag LOCUS_47870 <1 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889379.1:class I SAM-dependent DNA methyltransferase >Feature sequence933 >Feature sequence934 378 67 gene locus_tag LOCUS_47880 378 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058283.1 protein_id gnl|my_center|LOCUS_47880 573 1442 gene locus_tag LOCUS_47890 573 1442 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_47890 >Feature sequence935 <1647 352 gene locus_tag LOCUS_47900 <1647 352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058009.1:SMC family ATPase >Feature sequence936 511 110 gene locus_tag LOCUS_47910 511 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 1508 486 gene locus_tag LOCUS_47920 1508 486 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166117.1 protein_id gnl|my_center|LOCUS_47920 >Feature sequence937 1408 26 gene locus_tag LOCUS_47930 gene dnaB 1408 26 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058246.1 protein_id gnl|my_center|LOCUS_47930 >Feature sequence938 >Feature sequence939 >Feature sequence940 815 1546 gene locus_tag LOCUS_47940 gene sufR 815 1546 CDS product iron-sulfur cluster biosynthesis transcriptional regulator SufR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 protein_id gnl|my_center|LOCUS_47940 >Feature sequence941 1118 1525 gene locus_tag LOCUS_47950 1118 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 >Feature sequence942 >Feature sequence943 1525 653 gene locus_tag LOCUS_47960 gene trpC 1525 653 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056545.1 protein_id gnl|my_center|LOCUS_47960 >Feature sequence944 >Feature sequence945 84 824 gene locus_tag LOCUS_47970 84 824 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258788.1 protein_id gnl|my_center|LOCUS_47970 >Feature sequence946 <1582 1050 gene locus_tag LOCUS_47980 <1582 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056082.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase >Feature sequence947 803 372 gene locus_tag LOCUS_47990 803 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 1301 807 gene locus_tag LOCUS_48000 1301 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 >Feature sequence948 <1 1394 gene locus_tag LOCUS_48010 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799131.1:EAL domain-containing protein >Feature sequence949 <1 517 gene locus_tag LOCUS_48020 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein 567 1385 gene locus_tag LOCUS_48030 567 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 >Feature sequence950 <1 1023 gene locus_tag LOCUS_48040 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142717.1:tetratricopeptide repeat protein note possible pseudo, internal stop codon >Feature sequence951 1 1518 gene locus_tag LOCUS_48050 1 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 >Feature sequence952 >Feature sequence953 351 1004 gene locus_tag LOCUS_48060 351 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 1039 1329 gene locus_tag LOCUS_48070 1039 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 1330 1551 gene locus_tag LOCUS_48080 1330 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 >Feature sequence954 >Feature sequence955 469 1119 gene locus_tag LOCUS_48090 469 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 >Feature sequence956 394 789 gene locus_tag LOCUS_48100 394 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 793 1053 gene locus_tag LOCUS_48110 793 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 >Feature sequence957 463 227 gene locus_tag LOCUS_48120 463 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 711 466 gene locus_tag LOCUS_48130 711 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 963 718 gene locus_tag LOCUS_48140 963 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 1202 1453 gene locus_tag LOCUS_48150 1202 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 >Feature sequence958 597 82 gene locus_tag LOCUS_48160 597 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 <1532 808 gene locus_tag LOCUS_48170 <1532 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058076.1:Stp1/IreP family PP2C-type Ser/Thr phosphatase >Feature sequence959 1249 497 gene locus_tag LOCUS_48180 1249 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 >Feature sequence960 248 1396 gene locus_tag LOCUS_48190 248 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 >Feature sequence961 1260 766 gene locus_tag LOCUS_48200 1260 766 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_48200 >Feature sequence962 <1 522 gene locus_tag LOCUS_48210 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920758.1:molecular chaperone DnaJ 587 820 gene locus_tag LOCUS_48220 587 820 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 protein_id gnl|my_center|LOCUS_48220 >Feature sequence963 1382 621 gene locus_tag LOCUS_48230 1382 621 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928794.1 protein_id gnl|my_center|LOCUS_48230 >Feature sequence964 <1508 571 gene locus_tag LOCUS_48240 <1508 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057316.1:chloride channel protein >Feature sequence965