>Feature sequence0001 <1 808 gene locus_tag LOCUS_00010 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791107.1:sulfatase 805 2580 gene locus_tag LOCUS_00020 805 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2660 5632 gene locus_tag LOCUS_00030 2660 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5636 7108 gene locus_tag LOCUS_00040 5636 7108 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_00040 7118 8380 gene locus_tag LOCUS_00050 7118 8380 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_00050 9626 8526 gene locus_tag LOCUS_00060 9626 8526 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_00060 9812 10435 gene locus_tag LOCUS_00070 9812 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10443 11510 gene locus_tag LOCUS_00080 10443 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11588 13264 gene locus_tag LOCUS_00090 11588 13264 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_00090 13281 14762 gene locus_tag LOCUS_00100 13281 14762 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921686.1 protein_id gnl|my_center|LOCUS_00100 16569 14941 gene locus_tag LOCUS_00110 16569 14941 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_00110 17930 16566 gene locus_tag LOCUS_00120 17930 16566 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804122.1 protein_id gnl|my_center|LOCUS_00120 17992 19044 gene locus_tag LOCUS_00130 17992 19044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 19724 20281 gene locus_tag LOCUS_00140 19724 20281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 20358 20585 gene locus_tag LOCUS_00150 20358 20585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20926 22071 gene locus_tag LOCUS_00160 20926 22071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22192 23148 gene locus_tag LOCUS_00170 22192 23148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23767 30798 gene locus_tag LOCUS_00180 23767 30798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 30791 31678 gene locus_tag LOCUS_00190 30791 31678 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226597.1 protein_id gnl|my_center|LOCUS_00190 31730 31984 gene locus_tag LOCUS_00200 31730 31984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 31989 33101 gene locus_tag LOCUS_00210 31989 33101 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947657.1 protein_id gnl|my_center|LOCUS_00210 33130 34155 gene locus_tag LOCUS_00220 33130 34155 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425603.1 protein_id gnl|my_center|LOCUS_00220 34148 46732 gene locus_tag LOCUS_00230 34148 46732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 46732 59202 gene locus_tag LOCUS_00240 46732 59202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00240 >Feature sequence0002 <1 509 gene locus_tag LOCUS_00250 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921645.1:ThuA domain-containing protein 879 1958 gene locus_tag LOCUS_00260 879 1958 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 protein_id gnl|my_center|LOCUS_00260 3337 2150 gene locus_tag LOCUS_00270 3337 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 4949 3723 gene locus_tag LOCUS_00280 gene zigA 4949 3723 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446171.1 protein_id gnl|my_center|LOCUS_00280 5419 5183 gene locus_tag LOCUS_00290 5419 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 8645 5511 gene locus_tag LOCUS_00300 8645 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 8967 8662 gene locus_tag LOCUS_00310 8967 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 8920 9375 gene locus_tag LOCUS_00320 8920 9375 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_00320 9466 9966 gene locus_tag LOCUS_00330 9466 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00330 9963 10703 gene locus_tag LOCUS_00340 9963 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00340 11077 11286 gene locus_tag LOCUS_00350 11077 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 11531 13615 gene locus_tag LOCUS_00360 11531 13615 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_00360 14420 14229 gene locus_tag LOCUS_00370 14420 14229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 14328 15371 gene locus_tag LOCUS_00380 14328 15371 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073077526.1 protein_id gnl|my_center|LOCUS_00380 16437 15589 gene locus_tag LOCUS_00390 16437 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 17416 16448 gene locus_tag LOCUS_00400 17416 16448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 19803 17500 gene locus_tag LOCUS_00410 19803 17500 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038151.1 protein_id gnl|my_center|LOCUS_00410 20587 22149 gene locus_tag LOCUS_00420 20587 22149 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_00420 22200 23480 gene locus_tag LOCUS_00430 22200 23480 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143746.1 protein_id gnl|my_center|LOCUS_00430 23547 24887 gene locus_tag LOCUS_00440 23547 24887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 25099 25710 gene locus_tag LOCUS_00450 25099 25710 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202253.1 protein_id gnl|my_center|LOCUS_00450 25976 27205 gene locus_tag LOCUS_00460 gene rodA 25976 27205 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_00460 27302 29047 gene locus_tag LOCUS_00470 gene rng 27302 29047 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_00470 29536 29790 gene locus_tag LOCUS_00480 29536 29790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 29794 31101 gene locus_tag LOCUS_00490 29794 31101 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174384.1 protein_id gnl|my_center|LOCUS_00490 31253 32170 gene locus_tag LOCUS_00500 31253 32170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 35330 32193 gene locus_tag LOCUS_00510 35330 32193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 36787 35642 gene locus_tag LOCUS_00520 36787 35642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 37187 37903 gene locus_tag LOCUS_00530 37187 37903 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_00530 37900 39303 gene locus_tag LOCUS_00540 37900 39303 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_00540 41560 39347 gene locus_tag LOCUS_00550 41560 39347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 >Feature sequence0003 <1 2539 gene locus_tag LOCUS_00560 <1 2539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_153406462.1:HK97 family phage prohead protease 2742 3131 gene locus_tag LOCUS_00570 2742 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 3131 3409 gene locus_tag LOCUS_00580 3131 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 3406 4044 gene locus_tag LOCUS_00590 3406 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 4048 4476 gene locus_tag LOCUS_00600 4048 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 4476 4643 gene locus_tag LOCUS_00610 4476 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 4600 5532 gene locus_tag LOCUS_00620 4600 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 5548 5907 gene locus_tag LOCUS_00630 5548 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 5940 6224 gene locus_tag LOCUS_00640 5940 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 6226 8448 gene locus_tag LOCUS_00650 6226 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 8452 8787 gene locus_tag LOCUS_00660 8452 8787 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440566.1 protein_id gnl|my_center|LOCUS_00660 8787 10178 gene locus_tag LOCUS_00670 8787 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 10175 10882 gene locus_tag LOCUS_00680 10175 10882 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816462.1 protein_id gnl|my_center|LOCUS_00680 10866 11447 gene locus_tag LOCUS_00690 10866 11447 CDS product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014072014.1 protein_id gnl|my_center|LOCUS_00690 11444 14707 gene locus_tag LOCUS_00700 11444 14707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 14711 16078 gene locus_tag LOCUS_00710 14711 16078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 16082 16336 gene locus_tag LOCUS_00720 16082 16336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 16609 16866 gene locus_tag LOCUS_00730 16609 16866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 16882 17034 gene locus_tag LOCUS_00740 16882 17034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 17038 18120 gene locus_tag LOCUS_00750 17038 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 18443 18111 gene locus_tag LOCUS_00760 18443 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 18647 19162 gene locus_tag LOCUS_00770 gene dcd 18647 19162 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776509.1 protein_id gnl|my_center|LOCUS_00770 19387 19214 gene locus_tag LOCUS_00780 19387 19214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 19574 19395 gene locus_tag LOCUS_00790 19574 19395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 19879 19613 gene locus_tag LOCUS_00800 19879 19613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 20015 20200 gene locus_tag LOCUS_00810 20015 20200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 20181 20552 gene locus_tag LOCUS_00820 20181 20552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 20728 20555 gene locus_tag LOCUS_00830 20728 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 21060 20710 gene locus_tag LOCUS_00840 21060 20710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 21293 21057 gene locus_tag LOCUS_00850 21293 21057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 21496 21293 gene locus_tag LOCUS_00860 21496 21293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 21666 21493 gene locus_tag LOCUS_00870 21666 21493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 21983 21717 gene locus_tag LOCUS_00880 21983 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 22183 21980 gene locus_tag LOCUS_00890 22183 21980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 22358 22176 gene locus_tag LOCUS_00900 22358 22176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 22876 22355 gene locus_tag LOCUS_00910 22876 22355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 23282 22869 gene locus_tag LOCUS_00920 23282 22869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 23518 23282 gene locus_tag LOCUS_00930 23518 23282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 23696 23511 gene locus_tag LOCUS_00940 23696 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 23836 23693 gene locus_tag LOCUS_00950 23836 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 24197 23874 gene locus_tag LOCUS_00960 24197 23874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 24471 24232 gene locus_tag LOCUS_00970 24471 24232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 24592 24771 gene locus_tag LOCUS_00980 24592 24771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 25150 24773 gene locus_tag LOCUS_00990 25150 24773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 25344 25153 gene locus_tag LOCUS_01000 25344 25153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 25999 25325 gene locus_tag LOCUS_01010 25999 25325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 26847 25999 gene locus_tag LOCUS_01020 26847 25999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 26901 28259 gene locus_tag LOCUS_01030 26901 28259 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109154434.1 protein_id gnl|my_center|LOCUS_01030 28231 28614 gene locus_tag LOCUS_01040 28231 28614 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834374.1 protein_id gnl|my_center|LOCUS_01040 29338 28586 gene locus_tag LOCUS_01050 29338 28586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 29337 29552 gene locus_tag LOCUS_01060 29337 29552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 29552 32053 gene locus_tag LOCUS_01070 29552 32053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 32365 33033 gene locus_tag LOCUS_01080 32365 33033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975805.1 protein_id gnl|my_center|LOCUS_01080 33238 33771 gene locus_tag LOCUS_01090 33238 33771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 33764 35632 gene locus_tag LOCUS_01100 33764 35632 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_01100 35636 36205 gene locus_tag LOCUS_01110 35636 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 36205 37764 gene locus_tag LOCUS_01120 36205 37764 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 protein_id gnl|my_center|LOCUS_01120 >Feature sequence0004 622 206 gene locus_tag LOCUS_01130 622 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 875 627 gene locus_tag LOCUS_01140 875 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 987 2495 gene locus_tag LOCUS_01150 987 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_01150 4032 2683 gene locus_tag LOCUS_01160 4032 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 6563 4002 gene locus_tag LOCUS_01170 6563 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 7007 6750 gene locus_tag LOCUS_01180 7007 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 7206 7009 gene locus_tag LOCUS_01190 7206 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 7634 7290 gene locus_tag LOCUS_01200 7634 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 7972 8988 gene locus_tag LOCUS_01210 7972 8988 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967104.1 protein_id gnl|my_center|LOCUS_01210 9023 9979 gene locus_tag LOCUS_01220 9023 9979 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_01220 10225 10809 gene locus_tag LOCUS_01230 10225 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 11378 12772 gene locus_tag LOCUS_01240 11378 12772 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_01240 13085 13291 gene locus_tag LOCUS_01250 13085 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 14501 13632 gene locus_tag LOCUS_01260 14501 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 15703 14510 gene locus_tag LOCUS_01270 15703 14510 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_01270 17594 15657 gene locus_tag LOCUS_01280 17594 15657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 18859 17609 gene locus_tag LOCUS_01290 18859 17609 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_01290 20230 19313 gene locus_tag LOCUS_01300 20230 19313 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_01300 22021 20306 gene locus_tag LOCUS_01310 22021 20306 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727478.1 protein_id gnl|my_center|LOCUS_01310 23987 22245 gene locus_tag LOCUS_01320 23987 22245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 25629 24085 gene locus_tag LOCUS_01330 25629 24085 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_01330 26724 25696 gene locus_tag LOCUS_01340 26724 25696 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_01340 27848 26805 gene locus_tag LOCUS_01350 27848 26805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 28053 28961 gene locus_tag LOCUS_01360 28053 28961 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_01360 29426 28968 gene locus_tag LOCUS_01370 29426 28968 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224535.1 protein_id gnl|my_center|LOCUS_01370 29883 29719 gene locus_tag LOCUS_01380 29883 29719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 29876 30604 gene locus_tag LOCUS_01390 29876 30604 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804151.1 protein_id gnl|my_center|LOCUS_01390 30720 31631 gene locus_tag LOCUS_01400 30720 31631 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876587.1 protein_id gnl|my_center|LOCUS_01400 31722 32651 gene locus_tag LOCUS_01410 31722 32651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 32701 33183 gene locus_tag LOCUS_01420 32701 33183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 33504 34526 gene locus_tag LOCUS_01430 33504 34526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775889.1 protein_id gnl|my_center|LOCUS_01430 34951 34436 gene locus_tag LOCUS_01440 34951 34436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 35866 35021 gene locus_tag LOCUS_01450 35866 35021 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839609.1 protein_id gnl|my_center|LOCUS_01450 >Feature sequence0005 1325 4438 gene locus_tag LOCUS_01460 1325 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5024 7768 gene locus_tag LOCUS_01470 5024 7768 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_01470 8490 8137 gene locus_tag LOCUS_01480 8490 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8536 10938 gene locus_tag LOCUS_01490 8536 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 10973 11977 gene locus_tag LOCUS_01500 10973 11977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 12823 14982 gene locus_tag LOCUS_01510 12823 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 15065 15694 gene locus_tag LOCUS_01520 15065 15694 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_01520 15823 19182 gene locus_tag LOCUS_01530 15823 19182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 19201 22416 gene locus_tag LOCUS_01540 19201 22416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 22416 24068 gene locus_tag LOCUS_01550 22416 24068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 25296 24313 gene locus_tag LOCUS_01560 25296 24313 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088661.1 protein_id gnl|my_center|LOCUS_01560 25591 25926 gene locus_tag LOCUS_01570 25591 25926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 25996 30711 gene locus_tag LOCUS_01580 gene gltB 25996 30711 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_01580 30761 32245 gene locus_tag LOCUS_01590 30761 32245 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence0006 813 55 gene locus_tag LOCUS_01600 813 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 2638 950 gene locus_tag LOCUS_01610 2638 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 2823 2635 gene locus_tag LOCUS_01620 2823 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 4600 2834 gene locus_tag LOCUS_01630 4600 2834 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257769.1 protein_id gnl|my_center|LOCUS_01630 6050 4635 gene locus_tag LOCUS_01640 6050 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 7132 6047 gene locus_tag LOCUS_01650 7132 6047 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_01650 7752 7207 gene locus_tag LOCUS_01660 7752 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 8345 7749 gene locus_tag LOCUS_01670 8345 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 8886 10271 gene locus_tag LOCUS_01680 8886 10271 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_01680 10335 11870 gene locus_tag LOCUS_01690 10335 11870 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261223.1 protein_id gnl|my_center|LOCUS_01690 12210 11848 gene locus_tag LOCUS_01700 12210 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 12311 12841 gene locus_tag LOCUS_01710 12311 12841 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_01710 12838 14187 gene locus_tag LOCUS_01720 12838 14187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 14218 16485 gene locus_tag LOCUS_01730 14218 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 16488 17108 gene locus_tag LOCUS_01740 16488 17108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 17105 19363 gene locus_tag LOCUS_01750 17105 19363 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928493.1 protein_id gnl|my_center|LOCUS_01750 19377 20081 gene locus_tag LOCUS_01760 19377 20081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 20318 21007 gene locus_tag LOCUS_01770 20318 21007 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672317.1 protein_id gnl|my_center|LOCUS_01770 21091 22569 gene locus_tag LOCUS_01780 21091 22569 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_01780 22952 22725 gene locus_tag LOCUS_01790 22952 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 23356 22949 gene locus_tag LOCUS_01800 23356 22949 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393562.1 protein_id gnl|my_center|LOCUS_01800 23603 23358 gene locus_tag LOCUS_01810 23603 23358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 23999 23715 gene locus_tag LOCUS_01820 23999 23715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 23908 25293 gene locus_tag LOCUS_01830 23908 25293 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120117.1 protein_id gnl|my_center|LOCUS_01830 25411 25725 gene locus_tag LOCUS_01840 25411 25725 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124153900.1 protein_id gnl|my_center|LOCUS_01840 25722 26945 gene locus_tag LOCUS_01850 25722 26945 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187394984.1 protein_id gnl|my_center|LOCUS_01850 27025 28374 gene locus_tag LOCUS_01860 27025 28374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 29094 28384 gene locus_tag LOCUS_01870 29094 28384 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_01870 29629 30576 gene locus_tag LOCUS_01880 29629 30576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 30692 31261 gene locus_tag LOCUS_01890 30692 31261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 >Feature sequence0007 172 1203 gene locus_tag LOCUS_01900 172 1203 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_01900 1200 2150 gene locus_tag LOCUS_01910 1200 2150 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_01910 2147 4024 gene locus_tag LOCUS_01920 2147 4024 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_01920 4252 6576 gene locus_tag LOCUS_01930 4252 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 6750 7409 gene locus_tag LOCUS_01940 6750 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 7406 8344 gene locus_tag LOCUS_01950 7406 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 8277 8552 gene locus_tag LOCUS_01960 8277 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8768 12205 gene locus_tag LOCUS_01970 8768 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 12241 12411 gene locus_tag LOCUS_01980 12241 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 12438 13955 gene locus_tag LOCUS_01990 12438 13955 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922615.1 protein_id gnl|my_center|LOCUS_01990 14058 15413 gene locus_tag LOCUS_02000 14058 15413 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_02000 15401 18169 gene locus_tag LOCUS_02010 15401 18169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 18166 20457 gene locus_tag LOCUS_02020 18166 20457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 20905 22305 gene locus_tag LOCUS_02030 20905 22305 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922613.1 protein_id gnl|my_center|LOCUS_02030 22450 23577 gene locus_tag LOCUS_02040 22450 23577 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_02040 23665 26514 gene locus_tag LOCUS_02050 23665 26514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 26526 28016 gene locus_tag LOCUS_02060 26526 28016 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_02060 28020 29192 gene locus_tag LOCUS_02070 28020 29192 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_02070 29745 29272 gene locus_tag LOCUS_02080 29745 29272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 29813 30337 gene locus_tag LOCUS_02090 29813 30337 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 protein_id gnl|my_center|LOCUS_02090 >Feature sequence0008 260 1018 gene locus_tag LOCUS_02100 gene urtD 260 1018 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 protein_id gnl|my_center|LOCUS_02100 1173 1967 gene locus_tag LOCUS_02110 gene urtE 1173 1967 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223523.1 protein_id gnl|my_center|LOCUS_02110 2019 2321 gene locus_tag LOCUS_02120 2019 2321 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857708.1 protein_id gnl|my_center|LOCUS_02120 2324 2701 gene locus_tag LOCUS_02130 2324 2701 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186466.1 protein_id gnl|my_center|LOCUS_02130 2698 4536 gene locus_tag LOCUS_02140 gene ureC 2698 4536 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205201.1 protein_id gnl|my_center|LOCUS_02140 4966 4580 gene locus_tag LOCUS_02150 4966 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6615 4963 gene locus_tag LOCUS_02160 6615 4963 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339547.1 protein_id gnl|my_center|LOCUS_02160 8834 6612 gene locus_tag LOCUS_02170 8834 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 9026 9556 gene locus_tag LOCUS_02180 9026 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 9528 10241 gene locus_tag LOCUS_02190 9528 10241 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565254.1 protein_id gnl|my_center|LOCUS_02190 10352 11017 gene locus_tag LOCUS_02200 gene ureG 10352 11017 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_02200 11010 11834 gene locus_tag LOCUS_02210 11010 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 12692 12288 gene locus_tag LOCUS_02220 gene rpsI 12692 12288 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_02220 13137 12709 gene locus_tag LOCUS_02230 gene rplM 13137 12709 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_02230 13293 13697 gene locus_tag LOCUS_02240 13293 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 13694 15106 gene locus_tag LOCUS_02250 13694 15106 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_02250 15697 15197 gene locus_tag LOCUS_02260 15697 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 15868 16176 gene locus_tag LOCUS_02270 15868 16176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 16585 19494 gene locus_tag LOCUS_02280 16585 19494 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_02280 19606 22317 gene locus_tag LOCUS_02290 19606 22317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 23571 22348 gene locus_tag LOCUS_02300 23571 22348 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_02300 23865 24219 gene locus_tag LOCUS_tm00010 23865 24219 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 25894 24593 gene locus_tag LOCUS_02310 25894 24593 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533330.1 protein_id gnl|my_center|LOCUS_02310 26223 25891 gene locus_tag LOCUS_02320 26223 25891 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533331.1 protein_id gnl|my_center|LOCUS_02320 26467 26682 gene locus_tag LOCUS_02330 26467 26682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 26679 27404 gene locus_tag LOCUS_02340 26679 27404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 27401 28537 gene locus_tag LOCUS_02350 27401 28537 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809527.1 protein_id gnl|my_center|LOCUS_02350 29324 28698 gene locus_tag LOCUS_02360 29324 28698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 >Feature sequence0009 1647 283 gene locus_tag LOCUS_02370 1647 283 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155658642.1 protein_id gnl|my_center|LOCUS_02370 3071 1848 gene locus_tag LOCUS_02380 3071 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 3470 3853 gene locus_tag LOCUS_02390 3470 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 5067 4315 gene locus_tag LOCUS_02400 5067 4315 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112092.1 protein_id gnl|my_center|LOCUS_02400 6558 5236 gene locus_tag LOCUS_02410 6558 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6777 8183 gene locus_tag LOCUS_02420 6777 8183 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657362.1 protein_id gnl|my_center|LOCUS_02420 8180 8806 gene locus_tag LOCUS_02430 8180 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 10237 8936 gene locus_tag LOCUS_02440 10237 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10465 11337 gene locus_tag LOCUS_02450 gene mmsB 10465 11337 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114168.1 protein_id gnl|my_center|LOCUS_02450 11370 12794 gene locus_tag LOCUS_02460 11370 12794 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_02460 14513 13065 gene locus_tag LOCUS_02470 14513 13065 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_02470 15093 14590 gene locus_tag LOCUS_02480 15093 14590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02480 16279 15110 gene locus_tag LOCUS_02490 16279 15110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02490 16492 16917 gene locus_tag LOCUS_02500 16492 16917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 17550 20786 gene locus_tag LOCUS_02510 17550 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 21894 21388 gene locus_tag LOCUS_02520 21894 21388 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809464.1 protein_id gnl|my_center|LOCUS_02520 22541 21921 gene locus_tag LOCUS_02530 gene kynB 22541 21921 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858074.1 protein_id gnl|my_center|LOCUS_02530 24008 22596 gene locus_tag LOCUS_02540 gene kynU 24008 22596 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 protein_id gnl|my_center|LOCUS_02540 24214 26958 gene locus_tag LOCUS_02550 24214 26958 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_02550 26974 28026 gene locus_tag LOCUS_02560 26974 28026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence0010 <1 1566 gene locus_tag LOCUS_02570 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615881.1:c-type cytochrome 2548 1598 gene locus_tag LOCUS_02580 2548 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 2532 2750 gene locus_tag LOCUS_02590 2532 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3006 4082 gene locus_tag LOCUS_02600 3006 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 4411 5220 gene locus_tag LOCUS_02610 4411 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812972.1 protein_id gnl|my_center|LOCUS_02610 7172 5769 gene locus_tag LOCUS_02620 7172 5769 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087814.1 protein_id gnl|my_center|LOCUS_02620 7278 8546 gene locus_tag LOCUS_02630 7278 8546 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_02630 8564 9592 gene locus_tag LOCUS_02640 8564 9592 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401180.1 protein_id gnl|my_center|LOCUS_02640 9669 10739 gene locus_tag LOCUS_02650 9669 10739 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_02650 10757 11512 gene locus_tag LOCUS_02660 10757 11512 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327171.1 protein_id gnl|my_center|LOCUS_02660 11518 12588 gene locus_tag LOCUS_02670 11518 12588 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_02670 13649 12708 gene locus_tag LOCUS_02680 gene menB 13649 12708 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_02680 13672 15567 gene locus_tag LOCUS_02690 13672 15567 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927144.1 protein_id gnl|my_center|LOCUS_02690 17358 15613 gene locus_tag LOCUS_02700 gene menD 17358 15613 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_02700 18779 17355 gene locus_tag LOCUS_02710 18779 17355 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_02710 20397 18844 gene locus_tag LOCUS_02720 gene metG 20397 18844 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545288.1 protein_id gnl|my_center|LOCUS_02720 21166 20564 gene locus_tag LOCUS_02730 gene rdgB 21166 20564 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_02730 22274 21141 gene locus_tag LOCUS_02740 gene ribD 22274 21141 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943609.1 protein_id gnl|my_center|LOCUS_02740 23103 22288 gene locus_tag LOCUS_02750 23103 22288 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396738.1 protein_id gnl|my_center|LOCUS_02750 24666 23284 gene locus_tag LOCUS_02760 24666 23284 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118042.1 protein_id gnl|my_center|LOCUS_02760 26246 24795 gene locus_tag LOCUS_02770 26246 24795 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119342.1 protein_id gnl|my_center|LOCUS_02770 27711 26263 gene locus_tag LOCUS_02780 27711 26263 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442740.1 protein_id gnl|my_center|LOCUS_02780 >Feature sequence0011 <1 577 gene locus_tag LOCUS_02790 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120859.1:SGNH/GDSL hydrolase family protein 2018 651 gene locus_tag LOCUS_02800 2018 651 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_02800 2040 3446 gene locus_tag LOCUS_02810 2040 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 4730 3540 gene locus_tag LOCUS_02820 4730 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 4840 5301 gene locus_tag LOCUS_02830 4840 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 6676 5375 gene locus_tag LOCUS_02840 6676 5375 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_02840 7270 6683 gene locus_tag LOCUS_02850 7270 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 7452 7772 gene locus_tag LOCUS_02860 7452 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 7854 9623 gene locus_tag LOCUS_02870 7854 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 9854 10630 gene locus_tag LOCUS_02880 9854 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 11695 10715 gene locus_tag LOCUS_02890 11695 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 13080 11995 gene locus_tag LOCUS_02900 13080 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 13214 13759 gene locus_tag LOCUS_02910 13214 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 15209 14340 gene locus_tag LOCUS_02920 15209 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 15933 15313 gene locus_tag LOCUS_02930 gene upp 15933 15313 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360558.1 protein_id gnl|my_center|LOCUS_02930 16672 15974 gene locus_tag LOCUS_02940 16672 15974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 17564 16914 gene locus_tag LOCUS_02950 17564 16914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 19104 17686 gene locus_tag LOCUS_02960 19104 17686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 19923 19555 gene locus_tag LOCUS_02970 19923 19555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 20147 19920 gene locus_tag LOCUS_02980 20147 19920 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_02980 20201 20374 gene locus_tag LOCUS_02990 20201 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 21072 20500 gene locus_tag LOCUS_03000 21072 20500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 21604 21083 gene locus_tag LOCUS_03010 21604 21083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 24797 21609 gene locus_tag LOCUS_03020 24797 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 25784 24813 gene locus_tag LOCUS_03030 25784 24813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 26797 25814 gene locus_tag LOCUS_03040 26797 25814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 >Feature sequence0012 <1 1116 gene locus_tag LOCUS_03050 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258797.1:WYL domain-containing protein 1496 1936 gene locus_tag LOCUS_03060 1496 1936 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_03060 2340 2023 gene locus_tag LOCUS_03070 2340 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 2339 2776 gene locus_tag LOCUS_03080 2339 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03080 2806 4263 gene locus_tag LOCUS_03090 gene sufB 2806 4263 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118827.1 protein_id gnl|my_center|LOCUS_03090 4453 5790 gene locus_tag LOCUS_03100 gene sufD 4453 5790 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_03100 5923 6477 gene locus_tag LOCUS_03110 gene sufT 5923 6477 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_03110 6776 8098 gene locus_tag LOCUS_03120 6776 8098 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_03120 8102 10498 gene locus_tag LOCUS_03130 8102 10498 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260401.1 protein_id gnl|my_center|LOCUS_03130 10535 13093 gene locus_tag LOCUS_03140 10535 13093 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_03140 13103 15028 gene locus_tag LOCUS_03150 13103 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120678.1 protein_id gnl|my_center|LOCUS_03150 15207 16280 gene locus_tag LOCUS_03160 15207 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 16321 16941 gene locus_tag LOCUS_03170 16321 16941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 16962 19226 gene locus_tag LOCUS_03180 16962 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 23816 19410 gene locus_tag LOCUS_03190 23816 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 25057 23813 gene locus_tag LOCUS_03200 25057 23813 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_03200 25056 25349 gene locus_tag LOCUS_03210 25056 25349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence0013 3100 2660 gene locus_tag LOCUS_03220 3100 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 3351 3100 gene locus_tag LOCUS_03230 3351 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3656 5581 gene locus_tag LOCUS_03240 3656 5581 CDS product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615747.1 protein_id gnl|my_center|LOCUS_03240 5642 6991 gene locus_tag LOCUS_03250 5642 6991 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 protein_id gnl|my_center|LOCUS_03250 8156 7242 gene locus_tag LOCUS_03260 8156 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 8559 8197 gene locus_tag LOCUS_03270 8559 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 10464 9346 gene locus_tag LOCUS_03280 10464 9346 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_03280 11492 10461 gene locus_tag LOCUS_03290 11492 10461 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_03290 11605 12867 gene locus_tag LOCUS_03300 11605 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 12882 13559 gene locus_tag LOCUS_03310 12882 13559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 13556 15397 gene locus_tag LOCUS_03320 13556 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 17531 15507 gene locus_tag LOCUS_03330 17531 15507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 17780 17544 gene locus_tag LOCUS_03340 17780 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 17805 19832 gene locus_tag LOCUS_03350 17805 19832 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_03350 19968 20924 gene locus_tag LOCUS_03360 gene msrP 19968 20924 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257868.1 protein_id gnl|my_center|LOCUS_03360 20989 21657 gene locus_tag LOCUS_03370 20989 21657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 22750 21626 gene locus_tag LOCUS_03380 22750 21626 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084987.1 protein_id gnl|my_center|LOCUS_03380 23438 22773 gene locus_tag LOCUS_03390 23438 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 23698 23435 gene locus_tag LOCUS_03400 23698 23435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 23985 24689 gene locus_tag LOCUS_03410 23985 24689 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640345.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence0014 1232 2605 gene locus_tag LOCUS_03420 1232 2605 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_03420 2642 4282 gene locus_tag LOCUS_03430 2642 4282 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_03430 4285 5808 gene locus_tag LOCUS_03440 4285 5808 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_03440 5832 7667 gene locus_tag LOCUS_03450 5832 7667 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671072.1 protein_id gnl|my_center|LOCUS_03450 7696 9126 gene locus_tag LOCUS_03460 7696 9126 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_03460 9151 10629 gene locus_tag LOCUS_03470 9151 10629 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_03470 10680 12203 gene locus_tag LOCUS_03480 10680 12203 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_03480 12263 13675 gene locus_tag LOCUS_03490 12263 13675 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_03490 13867 15429 gene locus_tag LOCUS_03500 13867 15429 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_03500 16997 15876 gene locus_tag LOCUS_03510 16997 15876 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930574.1 protein_id gnl|my_center|LOCUS_03510 18076 17072 gene locus_tag LOCUS_03520 gene pdxA 18076 17072 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_03520 19699 18140 gene locus_tag LOCUS_03530 19699 18140 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 protein_id gnl|my_center|LOCUS_03530 20035 20790 gene locus_tag LOCUS_03540 20035 20790 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_03540 21336 21001 gene locus_tag LOCUS_03550 21336 21001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 21722 21806 gene locus_tag LOCUS_t00010 21722 21806 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23410 22085 gene locus_tag LOCUS_03560 23410 22085 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 protein_id gnl|my_center|LOCUS_03560 23498 24085 gene locus_tag LOCUS_03570 23498 24085 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817332.1 protein_id gnl|my_center|LOCUS_03570 24839 24189 gene locus_tag LOCUS_03580 24839 24189 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969827.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence0015 <1 860 gene locus_tag LOCUS_03590 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943996.1:phosphoenolpyruvate carboxykinase (GTP) 1063 1776 gene locus_tag LOCUS_03600 1063 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 2316 3860 gene locus_tag LOCUS_03610 2316 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 6702 4177 gene locus_tag LOCUS_03620 6702 4177 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205051.1 protein_id gnl|my_center|LOCUS_03620 7189 6737 gene locus_tag LOCUS_03630 7189 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 7604 7320 gene locus_tag LOCUS_03640 7604 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7729 8811 gene locus_tag LOCUS_03650 7729 8811 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_03650 8887 11265 gene locus_tag LOCUS_03660 8887 11265 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_03660 11351 11857 gene locus_tag LOCUS_03670 11351 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 11995 12330 gene locus_tag LOCUS_03680 11995 12330 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_03680 12359 12772 gene locus_tag LOCUS_03690 gene fadM 12359 12772 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194543.1 protein_id gnl|my_center|LOCUS_03690 12997 13359 gene locus_tag LOCUS_03700 12997 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 13561 14784 gene locus_tag LOCUS_03710 13561 14784 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_03710 15952 14981 gene locus_tag LOCUS_03720 15952 14981 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 protein_id gnl|my_center|LOCUS_03720 15983 16492 gene locus_tag LOCUS_03730 15983 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 16579 19119 gene locus_tag LOCUS_03740 16579 19119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 19549 19950 gene locus_tag LOCUS_03750 19549 19950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 20058 21281 gene locus_tag LOCUS_03760 gene ltrA 20058 21281 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118084.1 protein_id gnl|my_center|LOCUS_03760 21525 21770 gene locus_tag LOCUS_03770 21525 21770 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_03770 22264 22593 gene locus_tag LOCUS_03780 22264 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 22586 23188 gene locus_tag LOCUS_03790 22586 23188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence0016 1988 687 gene locus_tag LOCUS_03800 1988 687 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_03800 3352 1985 gene locus_tag LOCUS_03810 3352 1985 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_03810 4866 3349 gene locus_tag LOCUS_03820 4866 3349 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_03820 6353 4875 gene locus_tag LOCUS_03830 6353 4875 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_03830 7834 6371 gene locus_tag LOCUS_03840 7834 6371 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921686.1 protein_id gnl|my_center|LOCUS_03840 8633 7851 gene locus_tag LOCUS_03850 8633 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 11839 8678 gene locus_tag LOCUS_03860 11839 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 12027 12569 gene locus_tag LOCUS_03870 12027 12569 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_03870 12566 13582 gene locus_tag LOCUS_03880 12566 13582 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 protein_id gnl|my_center|LOCUS_03880 13989 15620 gene locus_tag LOCUS_03890 13989 15620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 15554 17518 gene locus_tag LOCUS_03900 15554 17518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 17551 19020 gene locus_tag LOCUS_03910 17551 19020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 19044 20522 gene locus_tag LOCUS_03920 19044 20522 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_03920 20519 21694 gene locus_tag LOCUS_03930 20519 21694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 21788 22501 gene locus_tag LOCUS_03940 21788 22501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence0017 1201 1010 gene locus_tag LOCUS_03950 1201 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 2165 1209 gene locus_tag LOCUS_03960 2165 1209 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_03960 3424 2258 gene locus_tag LOCUS_03970 3424 2258 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527179.1 protein_id gnl|my_center|LOCUS_03970 5132 3426 gene locus_tag LOCUS_03980 5132 3426 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 protein_id gnl|my_center|LOCUS_03980 5226 6323 gene locus_tag LOCUS_03990 5226 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 6485 7930 gene locus_tag LOCUS_04000 gene purB 6485 7930 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_04000 8266 9522 gene locus_tag LOCUS_04010 8266 9522 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_04010 10859 9705 gene locus_tag LOCUS_04020 gene bshA 10859 9705 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 protein_id gnl|my_center|LOCUS_04020 11601 10861 gene locus_tag LOCUS_04030 11601 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 12346 11570 gene locus_tag LOCUS_04040 12346 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 14067 12343 gene locus_tag LOCUS_04050 14067 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 14252 14064 gene locus_tag LOCUS_04060 14252 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 16777 14249 gene locus_tag LOCUS_04070 16777 14249 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_04070 17658 16777 gene locus_tag LOCUS_04080 17658 16777 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_04080 17905 18948 gene locus_tag LOCUS_04090 17905 18948 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_04090 18945 19451 gene locus_tag LOCUS_04100 18945 19451 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461368.1 protein_id gnl|my_center|LOCUS_04100 19453 20748 gene locus_tag LOCUS_04110 19453 20748 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_04110 21432 20800 gene locus_tag LOCUS_04120 21432 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence0018 932 450 gene locus_tag LOCUS_04130 932 450 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_04130 1342 938 gene locus_tag LOCUS_04140 1342 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 1708 2130 gene locus_tag LOCUS_04150 1708 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2261 2185 gene locus_tag LOCUS_t00020 2261 2185 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2555 3049 gene locus_tag LOCUS_04160 2555 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3130 3723 gene locus_tag LOCUS_04170 3130 3723 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_04170 3725 5029 gene locus_tag LOCUS_04180 3725 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 5347 5138 gene locus_tag LOCUS_04190 5347 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 5237 5962 gene locus_tag LOCUS_04200 5237 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_04200 5975 7894 gene locus_tag LOCUS_04210 5975 7894 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_04210 7915 8724 gene locus_tag LOCUS_04220 7915 8724 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_04220 9162 8959 gene locus_tag LOCUS_04230 9162 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 9307 10611 gene locus_tag LOCUS_04240 gene lysA 9307 10611 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_04240 10874 11872 gene locus_tag LOCUS_04250 10874 11872 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_04250 11901 12596 gene locus_tag LOCUS_04260 gene aat 11901 12596 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_04260 18858 13003 gene locus_tag LOCUS_04270 18858 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 <21270 19644 gene locus_tag LOCUS_04280 <21270 19644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223485.1:cation acetate symporter >Feature sequence0019 3125 132 gene locus_tag LOCUS_04290 3125 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 4210 3122 gene locus_tag LOCUS_04300 4210 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 6756 4207 gene locus_tag LOCUS_04310 6756 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 7381 6776 gene locus_tag LOCUS_04320 7381 6776 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_04320 10070 7431 gene locus_tag LOCUS_04330 10070 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 10848 10159 gene locus_tag LOCUS_04340 10848 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122440.1 protein_id gnl|my_center|LOCUS_04340 12387 10942 gene locus_tag LOCUS_04350 12387 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 13859 12444 gene locus_tag LOCUS_04360 13859 12444 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922251.1 protein_id gnl|my_center|LOCUS_04360 15586 13856 gene locus_tag LOCUS_04370 15586 13856 CDS product YHYH protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122439.1 protein_id gnl|my_center|LOCUS_04370 15695 16396 gene locus_tag LOCUS_04380 15695 16396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_04380 16393 17874 gene locus_tag LOCUS_04390 16393 17874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 17963 20626 gene locus_tag LOCUS_04400 17963 20626 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_04400 20734 21078 gene locus_tag LOCUS_04410 20734 21078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence0020 <1 2139 gene locus_tag LOCUS_04420 <1 2139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114864.1:TonB-dependent receptor 2151 2813 gene locus_tag LOCUS_04430 2151 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 2825 4246 gene locus_tag LOCUS_04440 2825 4246 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_04440 4243 5640 gene locus_tag LOCUS_04450 4243 5640 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928739.1 protein_id gnl|my_center|LOCUS_04450 5756 6664 gene locus_tag LOCUS_04460 5756 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 6699 8042 gene locus_tag LOCUS_04470 6699 8042 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140537.1 protein_id gnl|my_center|LOCUS_04470 8084 8437 gene locus_tag LOCUS_04480 8084 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 9581 8358 gene locus_tag LOCUS_04490 gene zigA 9581 8358 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446171.1 protein_id gnl|my_center|LOCUS_04490 10135 9578 gene locus_tag LOCUS_04500 10135 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 10258 10695 gene locus_tag LOCUS_04510 10258 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 10840 13125 gene locus_tag LOCUS_04520 10840 13125 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064351.1 protein_id gnl|my_center|LOCUS_04520 13131 13859 gene locus_tag LOCUS_04530 13131 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 13844 14653 gene locus_tag LOCUS_04540 13844 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 14719 16269 gene locus_tag LOCUS_04550 14719 16269 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931201.1 protein_id gnl|my_center|LOCUS_04550 16359 17135 gene locus_tag LOCUS_04560 16359 17135 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_04560 17132 18022 gene locus_tag LOCUS_04570 17132 18022 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222859.1 protein_id gnl|my_center|LOCUS_04570 18050 18985 gene locus_tag LOCUS_04580 18050 18985 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931286.1 protein_id gnl|my_center|LOCUS_04580 19169 19645 gene locus_tag LOCUS_04590 19169 19645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 19661 20458 gene locus_tag LOCUS_04600 19661 20458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence0021 855 2204 gene locus_tag LOCUS_04610 855 2204 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 protein_id gnl|my_center|LOCUS_04610 2209 5337 gene locus_tag LOCUS_04620 2209 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 5364 6836 gene locus_tag LOCUS_04630 5364 6836 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_04630 6833 8668 gene locus_tag LOCUS_04640 6833 8668 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118144.1 protein_id gnl|my_center|LOCUS_04640 8821 10122 gene locus_tag LOCUS_04650 8821 10122 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 protein_id gnl|my_center|LOCUS_04650 10561 10283 gene locus_tag LOCUS_04660 10561 10283 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_04660 10844 10536 gene locus_tag LOCUS_04670 10844 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 11807 10890 gene locus_tag LOCUS_04680 11807 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 14348 11931 gene locus_tag LOCUS_04690 14348 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 14537 17602 gene locus_tag LOCUS_04700 14537 17602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 18224 17748 gene locus_tag LOCUS_04710 18224 17748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 18309 19712 gene locus_tag LOCUS_04720 gene argH 18309 19712 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529410.1 protein_id gnl|my_center|LOCUS_04720 20055 19705 gene locus_tag LOCUS_04730 20055 19705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence0022 158 367 gene locus_tag LOCUS_04740 158 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 364 1287 gene locus_tag LOCUS_04750 364 1287 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_04750 1329 2366 gene locus_tag LOCUS_04760 1329 2366 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193921.1 protein_id gnl|my_center|LOCUS_04760 2455 3357 gene locus_tag LOCUS_04770 2455 3357 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539670.1 protein_id gnl|my_center|LOCUS_04770 4618 3428 gene locus_tag LOCUS_04780 gene lptF 4618 3428 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_04780 5354 4635 gene locus_tag LOCUS_04790 5354 4635 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_04790 6557 5457 gene locus_tag LOCUS_04800 6557 5457 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_04800 6677 7462 gene locus_tag LOCUS_04810 gene fdhD 6677 7462 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_04810 7522 8421 gene locus_tag LOCUS_04820 7522 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 8427 9095 gene locus_tag LOCUS_04830 8427 9095 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_04830 9092 10006 gene locus_tag LOCUS_04840 gene prmB 9092 10006 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192731.1 protein_id gnl|my_center|LOCUS_04840 10456 10052 gene locus_tag LOCUS_04850 10456 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 11431 10739 gene locus_tag LOCUS_04860 gene metW 11431 10739 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225324.1 protein_id gnl|my_center|LOCUS_04860 12691 11486 gene locus_tag LOCUS_04870 12691 11486 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_04870 12578 12796 gene locus_tag LOCUS_04880 12578 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 13729 12977 gene locus_tag LOCUS_04890 13729 12977 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014140.1 protein_id gnl|my_center|LOCUS_04890 15645 13831 gene locus_tag LOCUS_04900 15645 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 16068 15760 gene locus_tag LOCUS_04910 16068 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 16454 16065 gene locus_tag LOCUS_04920 16454 16065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 16778 16533 gene locus_tag LOCUS_04930 16778 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 17013 18203 gene locus_tag LOCUS_04940 17013 18203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 18280 18930 gene locus_tag LOCUS_04950 18280 18930 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839974.1 protein_id gnl|my_center|LOCUS_04950 19157 19552 gene locus_tag LOCUS_04960 19157 19552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence0023 425 3658 gene locus_tag LOCUS_04970 425 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5824 4373 gene locus_tag LOCUS_04980 5824 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 7119 5821 gene locus_tag LOCUS_04990 7119 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 8538 7153 gene locus_tag LOCUS_05000 8538 7153 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124070.1 protein_id gnl|my_center|LOCUS_05000 9965 8559 gene locus_tag LOCUS_05010 9965 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 13090 10055 gene locus_tag LOCUS_05020 13090 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 15985 13496 gene locus_tag LOCUS_05030 15985 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 16687 16070 gene locus_tag LOCUS_05040 16687 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 18702 17170 gene locus_tag LOCUS_05050 18702 17170 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence0024 360 653 gene locus_tag LOCUS_05060 360 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2175 745 gene locus_tag LOCUS_05070 2175 745 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_05070 3931 2333 gene locus_tag LOCUS_05080 3931 2333 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921847.1 protein_id gnl|my_center|LOCUS_05080 6243 3943 gene locus_tag LOCUS_05090 6243 3943 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974567.1 protein_id gnl|my_center|LOCUS_05090 9190 6449 gene locus_tag LOCUS_05100 9190 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 11915 9273 gene locus_tag LOCUS_05110 11915 9273 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_05110 13941 11926 gene locus_tag LOCUS_05120 13941 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 15584 13983 gene locus_tag LOCUS_05130 15584 13983 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038013.1 protein_id gnl|my_center|LOCUS_05130 16738 15581 gene locus_tag LOCUS_05140 16738 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 19623 16777 gene locus_tag LOCUS_05150 19623 16777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence0025 1695 865 gene locus_tag LOCUS_05160 1695 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 4323 1753 gene locus_tag LOCUS_05170 4323 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4426 5406 gene locus_tag LOCUS_05180 4426 5406 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_05180 5403 6233 gene locus_tag LOCUS_05190 5403 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 6257 6838 gene locus_tag LOCUS_05200 6257 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 6862 8028 gene locus_tag LOCUS_05210 gene dnaJ 6862 8028 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377482.1 protein_id gnl|my_center|LOCUS_05210 11373 8380 gene locus_tag LOCUS_05220 11373 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 11867 11619 gene locus_tag LOCUS_05230 11867 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 12315 11803 gene locus_tag LOCUS_05240 12315 11803 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842388.1 protein_id gnl|my_center|LOCUS_05240 14984 12312 gene locus_tag LOCUS_05250 14984 12312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_05250 15380 15003 gene locus_tag LOCUS_05260 15380 15003 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_05260 16203 15529 gene locus_tag LOCUS_05270 16203 15529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_05270 16215 16934 gene locus_tag LOCUS_05280 16215 16934 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_05280 18775 17423 gene locus_tag LOCUS_05290 18775 17423 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 protein_id gnl|my_center|LOCUS_05290 19651 18959 gene locus_tag LOCUS_05300 19651 18959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence0026 1 3111 gene locus_tag LOCUS_05310 gene carB 1 3111 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_05310 3130 4098 gene locus_tag LOCUS_05320 3130 4098 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_05320 4138 5031 gene locus_tag LOCUS_05330 gene purU 4138 5031 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_05330 6151 5288 gene locus_tag LOCUS_05340 6151 5288 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_05340 8699 7359 gene locus_tag LOCUS_05350 gene larC 8699 7359 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438754.1 protein_id gnl|my_center|LOCUS_05350 9484 8696 gene locus_tag LOCUS_05360 gene larB 9484 8696 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_05360 10310 9489 gene locus_tag LOCUS_05370 gene larE 10310 9489 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_05370 10385 10606 gene locus_tag LOCUS_05380 10385 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 10671 11945 gene locus_tag LOCUS_05390 10671 11945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 12075 13424 gene locus_tag LOCUS_05400 gene larA 12075 13424 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_05400 13657 13923 gene locus_tag LOCUS_05410 13657 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 14030 16108 gene locus_tag LOCUS_05420 gene cstA 14030 16108 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047792095.1 protein_id gnl|my_center|LOCUS_05420 16739 16206 gene locus_tag LOCUS_05430 gene idi 16739 16206 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890634.1 protein_id gnl|my_center|LOCUS_05430 16880 17251 gene locus_tag LOCUS_05440 16880 17251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 17322 18131 gene locus_tag LOCUS_05450 17322 18131 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_05450 18292 19467 gene locus_tag LOCUS_05460 gene eboE 18292 19467 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence0027 <1 4854 gene locus_tag LOCUS_05470 <1 4854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010774229.1:DEAD/DEAH box helicase family protein 4857 5252 gene locus_tag LOCUS_05480 4857 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5256 7493 gene locus_tag LOCUS_05490 5256 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 8042 7551 gene locus_tag LOCUS_05500 8042 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 8346 8273 gene locus_tag LOCUS_t00030 8346 8273 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11046 8512 gene locus_tag LOCUS_05510 11046 8512 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529009.1 protein_id gnl|my_center|LOCUS_05510 12161 11196 gene locus_tag LOCUS_05520 gene araH 12161 11196 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096046.1 protein_id gnl|my_center|LOCUS_05520 13675 12173 gene locus_tag LOCUS_05530 gene araG 13675 12173 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705779.1 protein_id gnl|my_center|LOCUS_05530 14730 13741 gene locus_tag LOCUS_05540 gene araF 14730 13741 CDS product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027935.1 protein_id gnl|my_center|LOCUS_05540 14969 15268 gene locus_tag LOCUS_05550 14969 15268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 16709 15429 gene locus_tag LOCUS_05560 gene hflX 16709 15429 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_05560 16644 16958 gene locus_tag LOCUS_05570 16644 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 17073 18584 gene locus_tag LOCUS_05580 17073 18584 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence0028 251 36 gene locus_tag LOCUS_05590 251 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 1444 251 gene locus_tag LOCUS_05600 1444 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2482 1772 gene locus_tag LOCUS_05610 2482 1772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_05610 3686 2484 gene locus_tag LOCUS_05620 3686 2484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_05620 4876 3683 gene locus_tag LOCUS_05630 4876 3683 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_05630 5190 4873 gene locus_tag LOCUS_05640 5190 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 5852 5187 gene locus_tag LOCUS_05650 5852 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 6166 5969 gene locus_tag LOCUS_05660 6166 5969 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_05660 6583 6212 gene locus_tag LOCUS_05670 6583 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 8790 6580 gene locus_tag LOCUS_05680 8790 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 8791 9366 gene locus_tag LOCUS_05690 8791 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 9363 9782 gene locus_tag LOCUS_05700 9363 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 10903 9860 gene locus_tag LOCUS_05710 10903 9860 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_05710 12231 10915 gene locus_tag LOCUS_05720 12231 10915 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 protein_id gnl|my_center|LOCUS_05720 12449 12267 gene locus_tag LOCUS_05730 12449 12267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 12741 12511 gene locus_tag LOCUS_05740 12741 12511 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151363.1 protein_id gnl|my_center|LOCUS_05740 12827 13159 gene locus_tag LOCUS_05750 12827 13159 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_05750 13317 15497 gene locus_tag LOCUS_05760 13317 15497 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928493.1 protein_id gnl|my_center|LOCUS_05760 15903 15529 gene locus_tag LOCUS_05770 15903 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 17536 16331 gene locus_tag LOCUS_05780 17536 16331 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_05780 18831 17803 gene locus_tag LOCUS_05790 18831 17803 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence0029 1494 664 gene locus_tag LOCUS_05800 1494 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 2553 1792 gene locus_tag LOCUS_05810 2553 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 2662 4503 gene locus_tag LOCUS_05820 2662 4503 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_05820 4512 4916 gene locus_tag LOCUS_05830 4512 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 5130 4858 gene locus_tag LOCUS_05840 5130 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5366 6775 gene locus_tag LOCUS_05850 gene yjjJ 5366 6775 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035780.1 protein_id gnl|my_center|LOCUS_05850 6772 8010 gene locus_tag LOCUS_05860 6772 8010 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869242.1 protein_id gnl|my_center|LOCUS_05860 8335 8150 gene locus_tag LOCUS_05870 8335 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 8394 10334 gene locus_tag LOCUS_05880 8394 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 10642 12951 gene locus_tag LOCUS_05890 10642 12951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 12970 13737 gene locus_tag LOCUS_05900 12970 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 13750 15084 gene locus_tag LOCUS_05910 13750 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 15081 16331 gene locus_tag LOCUS_05920 15081 16331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 16405 18534 gene locus_tag LOCUS_05930 16405 18534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence0030 <1 2058 gene locus_tag LOCUS_05940 <1 2058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404755.1:TonB-dependent receptor 2107 4923 gene locus_tag LOCUS_05950 2107 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 5099 7852 gene locus_tag LOCUS_05960 5099 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 8420 8073 gene locus_tag LOCUS_05970 8420 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 8596 8417 gene locus_tag LOCUS_05980 8596 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 10165 8903 gene locus_tag LOCUS_05990 10165 8903 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_05990 10489 12156 gene locus_tag LOCUS_06000 10489 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 12262 13497 gene locus_tag LOCUS_06010 12262 13497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 14273 13674 gene locus_tag LOCUS_06020 14273 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 14682 14386 gene locus_tag LOCUS_06030 14682 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 16193 14865 gene locus_tag LOCUS_06040 16193 14865 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_06040 16194 16427 gene locus_tag LOCUS_06050 16194 16427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 17713 16502 gene locus_tag LOCUS_06060 17713 16502 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence0031 387 662 gene locus_tag LOCUS_06070 gene rpsP 387 662 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985074.1 protein_id gnl|my_center|LOCUS_06070 771 1445 gene locus_tag LOCUS_06080 gene trmD 771 1445 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_06080 1453 1893 gene locus_tag LOCUS_06090 1453 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3739 2147 gene locus_tag LOCUS_06100 gene guaB 3739 2147 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_06100 3831 4850 gene locus_tag LOCUS_06110 3831 4850 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057016.1 protein_id gnl|my_center|LOCUS_06110 4832 5998 gene locus_tag LOCUS_06120 4832 5998 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920832.1 protein_id gnl|my_center|LOCUS_06120 6008 7768 gene locus_tag LOCUS_06130 gene polX 6008 7768 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_06130 8189 8485 gene locus_tag LOCUS_06140 8189 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 8507 9934 gene locus_tag LOCUS_06150 8507 9934 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_06150 9951 11900 gene locus_tag LOCUS_06160 9951 11900 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_06160 13116 11980 gene locus_tag LOCUS_06170 13116 11980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 14553 13144 gene locus_tag LOCUS_06180 14553 13144 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119546.1 protein_id gnl|my_center|LOCUS_06180 15662 14913 gene locus_tag LOCUS_06190 15662 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 17269 15944 gene locus_tag LOCUS_06200 17269 15944 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088882.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence0032 <1 515 gene locus_tag LOCUS_06210 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400151.1:thioredoxin-disulfide reductase 577 1194 gene locus_tag LOCUS_06220 577 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 4498 1313 gene locus_tag LOCUS_06230 4498 1313 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_06230 5204 4914 gene locus_tag LOCUS_06240 5204 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5424 7301 gene locus_tag LOCUS_06250 gene recQ 5424 7301 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_06250 7476 10937 gene locus_tag LOCUS_06260 7476 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 12545 10977 gene locus_tag LOCUS_06270 12545 10977 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_06270 12478 12915 gene locus_tag LOCUS_06280 12478 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 13447 14541 gene locus_tag LOCUS_06290 13447 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 14679 17444 gene locus_tag LOCUS_06300 14679 17444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence0033 984 1799 gene locus_tag LOCUS_06310 gene tatC 984 1799 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199900.1 protein_id gnl|my_center|LOCUS_06310 2764 2012 gene locus_tag LOCUS_06320 2764 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 3164 2925 gene locus_tag LOCUS_06330 3164 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4526 3243 gene locus_tag LOCUS_06340 4526 3243 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_06340 4620 5225 gene locus_tag LOCUS_06350 4620 5225 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_06350 8790 5635 gene locus_tag LOCUS_06360 8790 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 9621 12614 gene locus_tag LOCUS_06370 9621 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 12618 14180 gene locus_tag LOCUS_06380 12618 14180 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_06380 14328 14870 gene locus_tag LOCUS_06390 gene pvdS 14328 14870 CDS product pyoverdine signaling pathway sigma factor PvdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113068.1 protein_id gnl|my_center|LOCUS_06390 14867 15883 gene locus_tag LOCUS_06400 14867 15883 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388639.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence0034 492 1055 gene locus_tag LOCUS_06410 492 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1222 2457 gene locus_tag LOCUS_06420 1222 2457 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_06420 2465 3343 gene locus_tag LOCUS_06430 2465 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3340 4092 gene locus_tag LOCUS_06440 3340 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4188 5435 gene locus_tag LOCUS_06450 4188 5435 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 protein_id gnl|my_center|LOCUS_06450 7160 5682 gene locus_tag LOCUS_06460 7160 5682 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_06460 7366 7157 gene locus_tag LOCUS_06470 7366 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 7268 7603 gene locus_tag LOCUS_06480 7268 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 10182 7600 gene locus_tag LOCUS_06490 10182 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 10334 11029 gene locus_tag LOCUS_06500 10334 11029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_06500 11038 13671 gene locus_tag LOCUS_06510 11038 13671 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404082.1 protein_id gnl|my_center|LOCUS_06510 13690 14943 gene locus_tag LOCUS_06520 13690 14943 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_06520 15170 15565 gene locus_tag LOCUS_06530 15170 15565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 16708 15788 gene locus_tag LOCUS_06540 16708 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence0035 1136 456 gene locus_tag LOCUS_06550 1136 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 1889 1209 gene locus_tag LOCUS_06560 1889 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2346 1975 gene locus_tag LOCUS_06570 gene ndhC 2346 1975 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_06570 2993 2514 gene locus_tag LOCUS_06580 2993 2514 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 protein_id gnl|my_center|LOCUS_06580 7360 2990 gene locus_tag LOCUS_06590 7360 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 7692 7450 gene locus_tag LOCUS_06600 7692 7450 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057201.1 protein_id gnl|my_center|LOCUS_06600 8222 7740 gene locus_tag LOCUS_06610 8222 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 9548 8313 gene locus_tag LOCUS_06620 9548 8313 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_06620 9653 10669 gene locus_tag LOCUS_06630 gene moaA 9653 10669 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166466103.1 protein_id gnl|my_center|LOCUS_06630 11966 11061 gene locus_tag LOCUS_06640 11966 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 13152 12028 gene locus_tag LOCUS_06650 gene dnaN 13152 12028 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_06650 14307 13381 gene locus_tag LOCUS_06660 gene pssA 14307 13381 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_06660 14657 14304 gene locus_tag LOCUS_06670 14657 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 15223 15483 gene locus_tag LOCUS_06680 15223 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 16324 16848 gene locus_tag LOCUS_06690 16324 16848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence0036 174 986 gene locus_tag LOCUS_06700 174 986 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_06700 994 2433 gene locus_tag LOCUS_06710 994 2433 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023927.1 protein_id gnl|my_center|LOCUS_06710 2456 4738 gene locus_tag LOCUS_06720 2456 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4740 5357 gene locus_tag LOCUS_06730 4740 5357 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_06730 6950 5397 gene locus_tag LOCUS_06740 6950 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7082 9391 gene locus_tag LOCUS_06750 7082 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9388 9582 gene locus_tag LOCUS_06760 9388 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 9594 11897 gene locus_tag LOCUS_06770 9594 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 12779 12039 gene locus_tag LOCUS_06780 12779 12039 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_06780 12909 14687 gene locus_tag LOCUS_06790 12909 14687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 16331 14709 gene locus_tag LOCUS_06800 16331 14709 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence0037 <1 3047 gene locus_tag LOCUS_06810 <1 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387961.1:DEAD/DEAH box helicase 3111 4352 gene locus_tag LOCUS_06820 3111 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4561 5712 gene locus_tag LOCUS_06830 4561 5712 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986854.1 protein_id gnl|my_center|LOCUS_06830 5737 5919 gene locus_tag LOCUS_06840 5737 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 5930 6598 gene locus_tag LOCUS_06850 5930 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 6703 6954 gene locus_tag LOCUS_06860 6703 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 6948 7343 gene locus_tag LOCUS_06870 6948 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 8758 7517 gene locus_tag LOCUS_06880 8758 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 9279 8947 gene locus_tag LOCUS_06890 9279 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 12279 9406 gene locus_tag LOCUS_06900 12279 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 12498 13082 gene locus_tag LOCUS_06910 12498 13082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 13225 13785 gene locus_tag LOCUS_06920 13225 13785 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230627.1 protein_id gnl|my_center|LOCUS_06920 13796 15628 gene locus_tag LOCUS_06930 13796 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 15639 16187 gene locus_tag LOCUS_06940 15639 16187 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385055.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence0038 1321 392 gene locus_tag LOCUS_06950 1321 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 3001 1547 gene locus_tag LOCUS_06960 3001 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 4539 3211 gene locus_tag LOCUS_06970 4539 3211 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_06970 5910 4597 gene locus_tag LOCUS_06980 5910 4597 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922962.1 protein_id gnl|my_center|LOCUS_06980 8291 5907 gene locus_tag LOCUS_06990 8291 5907 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_06990 11642 8481 gene locus_tag LOCUS_07000 11642 8481 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918997.1 protein_id gnl|my_center|LOCUS_07000 15565 12386 gene locus_tag LOCUS_07010 15565 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 <16433 15686 gene locus_tag LOCUS_07020 <16433 15686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123538.1:DUF1552 domain-containing protein >Feature sequence0039 3273 58 gene locus_tag LOCUS_07030 3273 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3476 4525 gene locus_tag LOCUS_07040 gene nadA 3476 4525 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265876.1 protein_id gnl|my_center|LOCUS_07040 4553 5434 gene locus_tag LOCUS_07050 gene nadC 4553 5434 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_07050 5447 5653 gene locus_tag LOCUS_07060 5447 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 5650 6111 gene locus_tag LOCUS_07070 5650 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 6108 7712 gene locus_tag LOCUS_07080 gene nadB 6108 7712 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_07080 8480 7869 gene locus_tag LOCUS_07090 gene gmk 8480 7869 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053267.1 protein_id gnl|my_center|LOCUS_07090 9039 8500 gene locus_tag LOCUS_07100 9039 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 9535 9083 gene locus_tag LOCUS_07110 9535 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 11005 9650 gene locus_tag LOCUS_07120 gene miaB 11005 9650 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038553.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence0040 889 1887 gene locus_tag LOCUS_07130 889 1887 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_07130 1902 2801 gene locus_tag LOCUS_07140 1902 2801 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_07140 3079 2825 gene locus_tag LOCUS_07150 3079 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 3580 4674 gene locus_tag LOCUS_07160 3580 4674 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_07160 4747 5223 gene locus_tag LOCUS_07170 4747 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 5471 6865 gene locus_tag LOCUS_07180 5471 6865 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 protein_id gnl|my_center|LOCUS_07180 8385 6808 gene locus_tag LOCUS_07190 8385 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 9263 8454 gene locus_tag LOCUS_07200 9263 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 10406 9420 gene locus_tag LOCUS_07210 gene rhaS 10406 9420 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582803.1 protein_id gnl|my_center|LOCUS_07210 11549 10497 gene locus_tag LOCUS_07220 11549 10497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339366.1 protein_id gnl|my_center|LOCUS_07220 12578 11649 gene locus_tag LOCUS_07230 12578 11649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521577.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07230 14086 12575 gene locus_tag LOCUS_07240 14086 12575 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_07240 14556 16250 gene locus_tag LOCUS_07250 14556 16250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence0041 <1 1458 gene locus_tag LOCUS_07260 <1 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324175.1:Gfo/Idh/MocA family oxidoreductase 1572 2981 gene locus_tag LOCUS_07270 1572 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2978 5920 gene locus_tag LOCUS_07280 2978 5920 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_07280 6781 6059 gene locus_tag LOCUS_07290 6781 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 7179 8366 gene locus_tag LOCUS_07300 7179 8366 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_07300 8577 9968 gene locus_tag LOCUS_07310 8577 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 10034 11632 gene locus_tag LOCUS_07320 10034 11632 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_07320 11759 12448 gene locus_tag LOCUS_07330 gene pepE 11759 12448 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995241.1 protein_id gnl|my_center|LOCUS_07330 12771 12577 gene locus_tag LOCUS_07340 12771 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 13856 12987 gene locus_tag LOCUS_07350 13856 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 15115 14009 gene locus_tag LOCUS_07360 15115 14009 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223573.1 protein_id gnl|my_center|LOCUS_07360 16097 15174 gene locus_tag LOCUS_07370 16097 15174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence0042 961 137 gene locus_tag LOCUS_07380 961 137 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_07380 1902 958 gene locus_tag LOCUS_07390 1902 958 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_07390 3089 1899 gene locus_tag LOCUS_07400 3089 1899 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816897.1 protein_id gnl|my_center|LOCUS_07400 4249 3086 gene locus_tag LOCUS_07410 4249 3086 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266767.1 protein_id gnl|my_center|LOCUS_07410 4377 4703 gene locus_tag LOCUS_07420 4377 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 4946 5797 gene locus_tag LOCUS_07430 4946 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 8127 6121 gene locus_tag LOCUS_07440 8127 6121 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 protein_id gnl|my_center|LOCUS_07440 8782 8207 gene locus_tag LOCUS_07450 8782 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 10999 9116 gene locus_tag LOCUS_07460 10999 9116 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530985.1 protein_id gnl|my_center|LOCUS_07460 11242 14100 gene locus_tag LOCUS_07470 11242 14100 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_07470 14154 15950 gene locus_tag LOCUS_07480 14154 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence0043 1459 290 gene locus_tag LOCUS_07490 1459 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2278 1691 gene locus_tag LOCUS_07500 2278 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 2585 2283 gene locus_tag LOCUS_07510 2585 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3175 2582 gene locus_tag LOCUS_07520 3175 2582 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931266.1 protein_id gnl|my_center|LOCUS_07520 3538 5202 gene locus_tag LOCUS_07530 gene leuA 3538 5202 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406457.1 protein_id gnl|my_center|LOCUS_07530 5322 6365 gene locus_tag LOCUS_07540 5322 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 6722 7840 gene locus_tag LOCUS_07550 gene rlmN 6722 7840 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_07550 7951 9123 gene locus_tag LOCUS_07560 7951 9123 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_07560 9310 10032 gene locus_tag LOCUS_07570 9310 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 10127 10849 gene locus_tag LOCUS_07580 10127 10849 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_07580 10903 12810 gene locus_tag LOCUS_07590 10903 12810 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114912.1 protein_id gnl|my_center|LOCUS_07590 12925 14100 gene locus_tag LOCUS_07600 12925 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 14129 14366 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccccgtagccgcgagcgccagcaagcgg <16112 14427 gene locus_tag LOCUS_07610 <16112 14427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein >Feature sequence0044 4567 1451 gene locus_tag LOCUS_07620 4567 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 4829 5674 gene locus_tag LOCUS_07630 4829 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 5713 8136 gene locus_tag LOCUS_07640 5713 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 9102 8188 gene locus_tag LOCUS_07650 9102 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 10025 9135 gene locus_tag LOCUS_07660 10025 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 10267 13287 gene locus_tag LOCUS_07670 10267 13287 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_07670 13305 14738 gene locus_tag LOCUS_07680 13305 14738 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922522.1 protein_id gnl|my_center|LOCUS_07680 14735 15346 gene locus_tag LOCUS_07690 14735 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence0045 1510 1337 gene locus_tag LOCUS_07700 1510 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2989 1553 gene locus_tag LOCUS_07710 2989 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4401 2986 gene locus_tag LOCUS_07720 4401 2986 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_07720 5120 4398 gene locus_tag LOCUS_07730 5120 4398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_07730 7564 5132 gene locus_tag LOCUS_07740 7564 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 8314 7607 gene locus_tag LOCUS_07750 8314 7607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_07750 12067 8357 gene locus_tag LOCUS_07760 12067 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 <16098 12074 gene locus_tag LOCUS_07770 <16098 12074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990725.1:cobaltochelatase subunit CobN >Feature sequence0046 142 891 gene locus_tag LOCUS_07780 142 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 1041 2087 gene locus_tag LOCUS_07790 1041 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3835 2948 gene locus_tag LOCUS_07800 3835 2948 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530857.1 protein_id gnl|my_center|LOCUS_07800 4714 4304 gene locus_tag LOCUS_07810 4714 4304 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031553.1 protein_id gnl|my_center|LOCUS_07810 4881 6020 gene locus_tag LOCUS_07820 4881 6020 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_07820 6168 6503 gene locus_tag LOCUS_07830 6168 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 6535 7941 gene locus_tag LOCUS_07840 6535 7941 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_07840 7959 9458 gene locus_tag LOCUS_07850 7959 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 9455 10888 gene locus_tag LOCUS_07860 9455 10888 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803772.1 protein_id gnl|my_center|LOCUS_07860 10920 14321 gene locus_tag LOCUS_07870 10920 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 14365 14829 gene locus_tag LOCUS_07880 14365 14829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence0047 1690 1307 gene locus_tag LOCUS_07890 1690 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 5263 1721 gene locus_tag LOCUS_07900 5263 1721 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404755.1 protein_id gnl|my_center|LOCUS_07900 6319 5282 gene locus_tag LOCUS_07910 6319 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 6867 6316 gene locus_tag LOCUS_07920 6867 6316 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_07920 8516 6915 gene locus_tag LOCUS_07930 8516 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 8841 11912 gene locus_tag LOCUS_07940 8841 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 14432 11976 gene locus_tag LOCUS_07950 14432 11976 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615881.1 protein_id gnl|my_center|LOCUS_07950 15809 14439 gene locus_tag LOCUS_07960 15809 14439 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121659.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence0048 <1 916 gene locus_tag LOCUS_07970 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889608.1:ABC transporter ATP-binding protein 1113 2210 gene locus_tag LOCUS_07980 1113 2210 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532810.1 protein_id gnl|my_center|LOCUS_07980 3149 2409 gene locus_tag LOCUS_07990 3149 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 3252 4220 gene locus_tag LOCUS_08000 3252 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 4236 5018 gene locus_tag LOCUS_08010 4236 5018 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_08010 5063 5461 gene locus_tag LOCUS_08020 5063 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 5663 5442 gene locus_tag LOCUS_08030 5663 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 5863 5660 gene locus_tag LOCUS_08040 5863 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 6499 6765 gene locus_tag LOCUS_08050 gene rpsO 6499 6765 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546801.1 protein_id gnl|my_center|LOCUS_08050 7113 9335 gene locus_tag LOCUS_08060 gene pnp 7113 9335 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_08060 9292 9546 gene locus_tag LOCUS_08070 9292 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 10567 9599 gene locus_tag LOCUS_08080 10567 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 10637 11434 gene locus_tag LOCUS_08090 gene surE 10637 11434 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939419.1 protein_id gnl|my_center|LOCUS_08090 12047 11475 gene locus_tag LOCUS_08100 12047 11475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 12632 12246 gene locus_tag LOCUS_08110 12632 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 15468 12733 gene locus_tag LOCUS_08120 15468 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence0049 1991 2224 gene locus_tag LOCUS_08130 1991 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2221 3114 gene locus_tag LOCUS_08140 2221 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3216 5888 gene locus_tag LOCUS_08150 3216 5888 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_08150 6064 7740 gene locus_tag LOCUS_08160 6064 7740 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108511.1 protein_id gnl|my_center|LOCUS_08160 7788 8597 gene locus_tag LOCUS_08170 7788 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 8722 9960 gene locus_tag LOCUS_08180 8722 9960 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_08180 10041 12878 gene locus_tag LOCUS_08190 10041 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 12914 14326 gene locus_tag LOCUS_08200 12914 14326 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616190.1 protein_id gnl|my_center|LOCUS_08200 14628 15176 gene locus_tag LOCUS_08210 14628 15176 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120138.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence0050 <1 1421 gene locus_tag LOCUS_08220 <1 1421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616031.1:sulfatase-like hydrolase/transferase 2940 1447 gene locus_tag LOCUS_08230 2940 1447 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 protein_id gnl|my_center|LOCUS_08230 3189 2995 gene locus_tag LOCUS_08240 3189 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3136 4479 gene locus_tag LOCUS_08250 3136 4479 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_08250 4654 4878 gene locus_tag LOCUS_08260 4654 4878 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_08260 4880 5218 gene locus_tag LOCUS_08270 4880 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5559 5245 gene locus_tag LOCUS_08280 5559 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7049 5586 gene locus_tag LOCUS_08290 7049 5586 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_08290 7462 7046 gene locus_tag LOCUS_08300 7462 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 10875 7468 gene locus_tag LOCUS_08310 10875 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 12032 10968 gene locus_tag LOCUS_08320 12032 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 12457 12029 gene locus_tag LOCUS_08330 12457 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 12341 12712 gene locus_tag LOCUS_08340 12341 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 13699 13160 gene locus_tag LOCUS_08350 13699 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 13807 14046 gene locus_tag LOCUS_08360 13807 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 15412 14093 gene locus_tag LOCUS_08370 15412 14093 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402023.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence0051 1815 394 gene locus_tag LOCUS_08380 1815 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 6272 1812 gene locus_tag LOCUS_08390 6272 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 9592 6290 gene locus_tag LOCUS_08400 9592 6290 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_08400 10830 9685 gene locus_tag LOCUS_08410 10830 9685 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082671.1 protein_id gnl|my_center|LOCUS_08410 11471 10827 gene locus_tag LOCUS_08420 11471 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 12584 11724 gene locus_tag LOCUS_08430 12584 11724 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812797.1 protein_id gnl|my_center|LOCUS_08430 13631 12630 gene locus_tag LOCUS_08440 13631 12630 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence0052 1181 108 gene locus_tag LOCUS_08450 1181 108 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086978.1 protein_id gnl|my_center|LOCUS_08450 2222 1224 gene locus_tag LOCUS_08460 2222 1224 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_08460 2462 2377 gene locus_tag LOCUS_t00040 2462 2377 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2571 3158 gene locus_tag LOCUS_08470 gene nadD 2571 3158 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_08470 3155 3595 gene locus_tag LOCUS_08480 3155 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3768 4118 gene locus_tag LOCUS_08490 3768 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4238 6109 gene locus_tag LOCUS_08500 4238 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 6146 7963 gene locus_tag LOCUS_08510 6146 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 8106 8294 gene locus_tag LOCUS_08520 8106 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 10621 8594 gene locus_tag LOCUS_08530 10621 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 10639 11385 gene locus_tag LOCUS_08540 10639 11385 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_08540 13574 11382 gene locus_tag LOCUS_08550 13574 11382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 14521 13571 gene locus_tag LOCUS_08560 14521 13571 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence0053 1086 307 gene locus_tag LOCUS_08570 1086 307 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444218.1 protein_id gnl|my_center|LOCUS_08570 1149 1562 gene locus_tag LOCUS_08580 1149 1562 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947851.1 protein_id gnl|my_center|LOCUS_08580 2336 3343 gene locus_tag LOCUS_08590 2336 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_08590 3340 3873 gene locus_tag LOCUS_08600 3340 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 4230 4006 gene locus_tag LOCUS_08610 4230 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 4683 4273 gene locus_tag LOCUS_08620 4683 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 5488 4811 gene locus_tag LOCUS_08630 5488 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 6051 5680 gene locus_tag LOCUS_08640 6051 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 7856 6048 gene locus_tag LOCUS_08650 7856 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 8619 7888 gene locus_tag LOCUS_08660 8619 7888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118316.1 protein_id gnl|my_center|LOCUS_08660 8784 9152 gene locus_tag LOCUS_08670 8784 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 9277 10515 gene locus_tag LOCUS_08680 9277 10515 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_08680 10630 10842 gene locus_tag LOCUS_08690 10630 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 10829 11098 gene locus_tag LOCUS_08700 10829 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 11158 12105 gene locus_tag LOCUS_08710 11158 12105 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326973.1 protein_id gnl|my_center|LOCUS_08710 12175 12918 gene locus_tag LOCUS_08720 12175 12918 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_08720 14073 13417 gene locus_tag LOCUS_08730 14073 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 13954 14307 gene locus_tag LOCUS_08740 13954 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 <15445 14293 gene locus_tag LOCUS_08750 <15445 14293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024232.1:methyltransferase domain-containing protein >Feature sequence0054 452 8719 gene locus_tag LOCUS_08760 452 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 8723 10357 gene locus_tag LOCUS_08770 8723 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 10375 12636 gene locus_tag LOCUS_08780 10375 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 12725 14122 gene locus_tag LOCUS_08790 12725 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence0055 2435 1485 gene locus_tag LOCUS_08800 2435 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3640 2438 gene locus_tag LOCUS_08810 3640 2438 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880450.1 protein_id gnl|my_center|LOCUS_08810 4451 3642 gene locus_tag LOCUS_08820 4451 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 5440 4448 gene locus_tag LOCUS_08830 5440 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 6225 5437 gene locus_tag LOCUS_08840 6225 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 6887 6228 gene locus_tag LOCUS_08850 6887 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 7938 6898 gene locus_tag LOCUS_08860 7938 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 8192 7938 gene locus_tag LOCUS_08870 8192 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 8998 8189 gene locus_tag LOCUS_08880 8998 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 9264 8995 gene locus_tag LOCUS_08890 9264 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 11869 9239 gene locus_tag LOCUS_08900 11869 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 12189 11866 gene locus_tag LOCUS_08910 12189 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 12485 12192 gene locus_tag LOCUS_08920 12485 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 12553 13020 gene locus_tag LOCUS_08930 12553 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 13007 13912 gene locus_tag LOCUS_08940 13007 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 <15086 14262 gene locus_tag LOCUS_08950 <15086 14262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922487.1:sulfatase >Feature sequence0056 1317 640 gene locus_tag LOCUS_08960 1317 640 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405053.1 protein_id gnl|my_center|LOCUS_08960 1292 1483 gene locus_tag LOCUS_08970 1292 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1926 1687 gene locus_tag LOCUS_08980 1926 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3958 1931 gene locus_tag LOCUS_08990 3958 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4158 3967 gene locus_tag LOCUS_09000 4158 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 4698 4246 gene locus_tag LOCUS_09010 4698 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 5303 4824 gene locus_tag LOCUS_09020 5303 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 8567 5397 gene locus_tag LOCUS_09030 8567 5397 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 protein_id gnl|my_center|LOCUS_09030 9749 8577 gene locus_tag LOCUS_09040 9749 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 11038 9746 gene locus_tag LOCUS_09050 11038 9746 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_09050 11445 11140 gene locus_tag LOCUS_09060 11445 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 12135 11695 gene locus_tag LOCUS_09070 12135 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 <14885 12185 gene locus_tag LOCUS_09080 <14885 12185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920248.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence0057 2402 1074 gene locus_tag LOCUS_09090 2402 1074 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_09090 4511 2805 gene locus_tag LOCUS_09100 4511 2805 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_09100 4673 5425 gene locus_tag LOCUS_09110 4673 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_09110 9197 5919 gene locus_tag LOCUS_09120 9197 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 9622 11055 gene locus_tag LOCUS_09130 9622 11055 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_09130 11058 12434 gene locus_tag LOCUS_09140 11058 12434 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 protein_id gnl|my_center|LOCUS_09140 12813 13541 gene locus_tag LOCUS_09150 12813 13541 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_09150 13670 14020 gene locus_tag LOCUS_09160 13670 14020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 14030 14275 gene locus_tag LOCUS_09170 14030 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence0058 2233 446 gene locus_tag LOCUS_09180 2233 446 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_09180 5181 2464 gene locus_tag LOCUS_09190 5181 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 6657 5443 gene locus_tag LOCUS_09200 6657 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 8089 6722 gene locus_tag LOCUS_09210 8089 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_09210 10997 8091 gene locus_tag LOCUS_09220 10997 8091 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_09220 13948 11063 gene locus_tag LOCUS_09230 13948 11063 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence0059 767 2818 gene locus_tag LOCUS_09240 767 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2815 4236 gene locus_tag LOCUS_09250 2815 4236 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_09250 4233 5492 gene locus_tag LOCUS_09260 4233 5492 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_09260 5682 7226 gene locus_tag LOCUS_09270 5682 7226 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804122.1 protein_id gnl|my_center|LOCUS_09270 7420 7665 gene locus_tag LOCUS_09280 7420 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 8009 8215 gene locus_tag LOCUS_09290 8009 8215 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546765.1 protein_id gnl|my_center|LOCUS_09290 8215 8442 gene locus_tag LOCUS_09300 8215 8442 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_09300 8732 10414 gene locus_tag LOCUS_09310 8732 10414 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669321.1 protein_id gnl|my_center|LOCUS_09310 10543 11787 gene locus_tag LOCUS_09320 10543 11787 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_09320 13222 11819 gene locus_tag LOCUS_09330 13222 11819 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_09330 14158 13490 gene locus_tag LOCUS_09340 14158 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence0060 1668 166 gene locus_tag LOCUS_09350 1668 166 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_09350 2834 1707 gene locus_tag LOCUS_09360 gene deoC 2834 1707 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_09360 2929 3438 gene locus_tag LOCUS_09370 2929 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3808 3479 gene locus_tag LOCUS_09380 3808 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 3897 4058 gene locus_tag LOCUS_09390 3897 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5601 4153 gene locus_tag LOCUS_09400 5601 4153 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_09400 7145 5865 gene locus_tag LOCUS_09410 7145 5865 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_09410 8546 7218 gene locus_tag LOCUS_09420 8546 7218 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_09420 8562 8795 gene locus_tag LOCUS_09430 8562 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 8933 10135 gene locus_tag LOCUS_09440 8933 10135 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937699.1 protein_id gnl|my_center|LOCUS_09440 11243 10149 gene locus_tag LOCUS_09450 11243 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 11606 13402 gene locus_tag LOCUS_09460 11606 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 13458 14210 gene locus_tag LOCUS_09470 13458 14210 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624136.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence0061 2232 172 gene locus_tag LOCUS_09480 gene ligA 2232 172 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_09480 3089 2904 gene locus_tag LOCUS_09490 3089 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 4393 3356 gene locus_tag LOCUS_09500 4393 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09500 7901 4680 gene locus_tag LOCUS_09510 7901 4680 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_09510 8192 9286 gene locus_tag LOCUS_09520 8192 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 9322 10242 gene locus_tag LOCUS_09530 9322 10242 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_09530 10239 11417 gene locus_tag LOCUS_09540 10239 11417 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 protein_id gnl|my_center|LOCUS_09540 11429 12208 gene locus_tag LOCUS_09550 11429 12208 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211232185.1 protein_id gnl|my_center|LOCUS_09550 12286 13152 gene locus_tag LOCUS_09560 gene yfaU 12286 13152 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992981.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence0062 <1 1656 gene locus_tag LOCUS_09570 <1 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123573.1:PSD1 and planctomycete cytochrome C domain-containing protein 1646 3088 gene locus_tag LOCUS_09580 1646 3088 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123574.1 protein_id gnl|my_center|LOCUS_09580 3085 3960 gene locus_tag LOCUS_09590 3085 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3957 5381 gene locus_tag LOCUS_09600 3957 5381 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120435.1 protein_id gnl|my_center|LOCUS_09600 6231 5671 gene locus_tag LOCUS_09610 6231 5671 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_09610 7792 6422 gene locus_tag LOCUS_09620 7792 6422 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 protein_id gnl|my_center|LOCUS_09620 9089 7917 gene locus_tag LOCUS_09630 9089 7917 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_09630 9689 9366 gene locus_tag LOCUS_09640 9689 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 10204 11874 gene locus_tag LOCUS_09650 10204 11874 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926053.1 protein_id gnl|my_center|LOCUS_09650 11871 12335 gene locus_tag LOCUS_09660 11871 12335 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_09660 12344 13342 gene locus_tag LOCUS_09670 gene floA 12344 13342 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327694.1 protein_id gnl|my_center|LOCUS_09670 13413 14054 gene locus_tag LOCUS_09680 13413 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence0063 150 1112 gene locus_tag LOCUS_09690 150 1112 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766467.1 protein_id gnl|my_center|LOCUS_09690 1247 1966 gene locus_tag LOCUS_09700 1247 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2016 2651 gene locus_tag LOCUS_09710 2016 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 2696 3985 gene locus_tag LOCUS_09720 2696 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4025 4444 gene locus_tag LOCUS_09730 4025 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 4550 5386 gene locus_tag LOCUS_09740 4550 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 8071 5564 gene locus_tag LOCUS_09750 8071 5564 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 protein_id gnl|my_center|LOCUS_09750 8215 9543 gene locus_tag LOCUS_09760 8215 9543 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_09760 10011 9712 gene locus_tag LOCUS_09770 10011 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 11676 10198 gene locus_tag LOCUS_09780 11676 10198 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_09780 11713 13056 gene locus_tag LOCUS_09790 11713 13056 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_09790 13179 13625 gene locus_tag LOCUS_09800 13179 13625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 13842 13648 gene locus_tag LOCUS_09810 13842 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence0064 206 568 gene locus_tag LOCUS_09820 206 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1042 2142 gene locus_tag LOCUS_09830 1042 2142 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_09830 2416 5862 gene locus_tag LOCUS_09840 2416 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 6915 6025 gene locus_tag LOCUS_09850 6915 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 8591 7032 gene locus_tag LOCUS_09860 8591 7032 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_09860 10036 8609 gene locus_tag LOCUS_09870 10036 8609 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_09870 13084 10121 gene locus_tag LOCUS_09880 13084 10121 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922097.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence0065 1679 1125 gene locus_tag LOCUS_09890 1679 1125 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_09890 2283 2029 gene locus_tag LOCUS_09900 2283 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 3613 2318 gene locus_tag LOCUS_09910 3613 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4279 3680 gene locus_tag LOCUS_09920 gene lacC 4279 3680 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_09920 6013 4298 gene locus_tag LOCUS_09930 6013 4298 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_09930 6368 7366 gene locus_tag LOCUS_09940 6368 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 8809 7880 gene locus_tag LOCUS_09950 gene xerD 8809 7880 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439987.1 protein_id gnl|my_center|LOCUS_09950 9134 8871 gene locus_tag LOCUS_09960 gene infA 9134 8871 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_09960 9264 9788 gene locus_tag LOCUS_09970 gene tadA 9264 9788 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_09970 9905 10537 gene locus_tag LOCUS_09980 9905 10537 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_09980 11856 10633 gene locus_tag LOCUS_09990 11856 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 11934 13025 gene locus_tag LOCUS_10000 gene apbC 11934 13025 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_10000 13095 13367 gene locus_tag LOCUS_10010 13095 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 13626 13462 gene locus_tag LOCUS_10020 gene rpmG 13626 13462 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence0066 519 595 gene locus_tag LOCUS_t00050 519 595 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 839 2146 gene locus_tag LOCUS_10030 839 2146 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_10030 2635 5034 gene locus_tag LOCUS_10040 2635 5034 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_10040 6507 5086 gene locus_tag LOCUS_10050 6507 5086 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 protein_id gnl|my_center|LOCUS_10050 8930 6504 gene locus_tag LOCUS_10060 8930 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 10382 9114 gene locus_tag LOCUS_10070 10382 9114 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113534.1 protein_id gnl|my_center|LOCUS_10070 10695 11099 gene locus_tag LOCUS_10080 10695 11099 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816436.1 protein_id gnl|my_center|LOCUS_10080 12678 11365 gene locus_tag LOCUS_10090 gene hisS 12678 11365 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_10090 13174 12752 gene locus_tag LOCUS_10100 13174 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence0067 <1 927 gene locus_tag LOCUS_10110 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969478.1:recombinase RecA 1069 1980 gene locus_tag LOCUS_10120 1069 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2121 4487 gene locus_tag LOCUS_10130 2121 4487 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932893.1 protein_id gnl|my_center|LOCUS_10130 4505 5758 gene locus_tag LOCUS_10140 4505 5758 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_10140 5879 7237 gene locus_tag LOCUS_10150 gene mnmE 5879 7237 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_10150 7321 9159 gene locus_tag LOCUS_10160 gene mnmG 7321 9159 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393995.1 protein_id gnl|my_center|LOCUS_10160 9200 9838 gene locus_tag LOCUS_10170 9200 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 9994 10884 gene locus_tag LOCUS_10180 gene atpB 9994 10884 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142904.1 protein_id gnl|my_center|LOCUS_10180 10955 11164 gene locus_tag LOCUS_10190 10955 11164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 11231 11782 gene locus_tag LOCUS_10200 11231 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 11819 12214 gene locus_tag LOCUS_10210 11819 12214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence0068 178 408 gene locus_tag LOCUS_10220 178 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 462 1928 gene locus_tag LOCUS_10230 462 1928 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122596.1 protein_id gnl|my_center|LOCUS_10230 2875 1988 gene locus_tag LOCUS_10240 gene asd 2875 1988 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_10240 2934 4592 gene locus_tag LOCUS_10250 2934 4592 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_10250 5208 4552 gene locus_tag LOCUS_10260 5208 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_10260 6044 5772 gene locus_tag LOCUS_10270 6044 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5935 7644 gene locus_tag LOCUS_10280 5935 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 9092 7779 gene locus_tag LOCUS_10290 9092 7779 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_10290 10232 9375 gene locus_tag LOCUS_10300 10232 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 11044 10232 gene locus_tag LOCUS_10310 11044 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 12672 11305 gene locus_tag LOCUS_10320 12672 11305 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence0069 1582 215 gene locus_tag LOCUS_10330 1582 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 4931 2211 gene locus_tag LOCUS_10340 4931 2211 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122437.1 protein_id gnl|my_center|LOCUS_10340 5673 5035 gene locus_tag LOCUS_10350 5673 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 8677 5888 gene locus_tag LOCUS_10360 8677 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 10741 8711 gene locus_tag LOCUS_10370 10741 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 12330 10852 gene locus_tag LOCUS_10380 12330 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 13180 12461 gene locus_tag LOCUS_10390 13180 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence0070 1089 637 gene locus_tag LOCUS_10400 1089 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1706 1086 gene locus_tag LOCUS_10410 1706 1086 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_10410 4450 1811 gene locus_tag LOCUS_10420 4450 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4632 5231 gene locus_tag LOCUS_10430 4632 5231 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_10430 5566 7557 gene locus_tag LOCUS_10440 5566 7557 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_10440 7707 7877 gene locus_tag LOCUS_10450 7707 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 8868 8146 gene locus_tag LOCUS_10460 8868 8146 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_10460 9890 8916 gene locus_tag LOCUS_10470 gene folE2 9890 8916 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722743.1 protein_id gnl|my_center|LOCUS_10470 10402 9971 gene locus_tag LOCUS_10480 10402 9971 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_10480 10890 11474 gene locus_tag LOCUS_10490 10890 11474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10490 >Feature sequence0071 241 444 gene locus_tag LOCUS_10500 241 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 465 1829 gene locus_tag LOCUS_10510 465 1829 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119397.1 protein_id gnl|my_center|LOCUS_10510 1826 3259 gene locus_tag LOCUS_10520 1826 3259 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922755.1 protein_id gnl|my_center|LOCUS_10520 3278 4336 gene locus_tag LOCUS_10530 3278 4336 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_10530 5723 4773 gene locus_tag LOCUS_10540 5723 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 7615 6020 gene locus_tag LOCUS_10550 7615 6020 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922119.1 protein_id gnl|my_center|LOCUS_10550 8487 7612 gene locus_tag LOCUS_10560 8487 7612 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091620756.1 protein_id gnl|my_center|LOCUS_10560 9155 8496 gene locus_tag LOCUS_10570 9155 8496 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_10570 9960 9493 gene locus_tag LOCUS_10580 9960 9493 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061383.1 protein_id gnl|my_center|LOCUS_10580 10190 10375 gene locus_tag LOCUS_10590 10190 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 10622 11005 gene locus_tag LOCUS_10600 10622 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 11380 11006 gene locus_tag LOCUS_10610 11380 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 11801 12277 gene locus_tag LOCUS_10620 11801 12277 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence0072 321 3758 gene locus_tag LOCUS_10630 321 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 4029 3829 gene locus_tag LOCUS_10640 4029 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 5334 4204 gene locus_tag LOCUS_10650 5334 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10650 6139 5483 gene locus_tag LOCUS_10660 6139 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275369.1 protein_id gnl|my_center|LOCUS_10660 6488 6132 gene locus_tag LOCUS_10670 6488 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 7001 6564 gene locus_tag LOCUS_10680 7001 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 7582 8133 gene locus_tag LOCUS_10690 7582 8133 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_10690 8130 9182 gene locus_tag LOCUS_10700 8130 9182 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920554.1 protein_id gnl|my_center|LOCUS_10700 9349 11967 gene locus_tag LOCUS_10710 9349 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence0073 1659 1138 gene locus_tag LOCUS_10720 1659 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2410 1931 gene locus_tag LOCUS_10730 2410 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3006 2647 gene locus_tag LOCUS_10740 3006 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4929 3109 gene locus_tag LOCUS_10750 4929 3109 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122444.1 protein_id gnl|my_center|LOCUS_10750 6658 5375 gene locus_tag LOCUS_10760 6658 5375 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_10760 7657 6713 gene locus_tag LOCUS_10770 7657 6713 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_10770 9034 7730 gene locus_tag LOCUS_10780 9034 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 9288 9686 gene locus_tag LOCUS_10790 9288 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 9709 12591 gene locus_tag LOCUS_10800 9709 12591 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence0074 385 1230 gene locus_tag LOCUS_10810 gene rfbD 385 1230 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980837.1 protein_id gnl|my_center|LOCUS_10810 1517 2248 gene locus_tag LOCUS_10820 1517 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4807 2588 gene locus_tag LOCUS_10830 4807 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_10830 6064 4871 gene locus_tag LOCUS_10840 6064 4871 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 protein_id gnl|my_center|LOCUS_10840 6737 5970 gene locus_tag LOCUS_10850 6737 5970 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122369.1 protein_id gnl|my_center|LOCUS_10850 8132 6783 gene locus_tag LOCUS_10860 gene rlmD 8132 6783 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090462.1 protein_id gnl|my_center|LOCUS_10860 8304 9023 gene locus_tag LOCUS_10870 8304 9023 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280345.1 protein_id gnl|my_center|LOCUS_10870 9172 9426 gene locus_tag LOCUS_10880 9172 9426 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_10880 9414 9743 gene locus_tag LOCUS_10890 9414 9743 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_10890 10825 9773 gene locus_tag LOCUS_10900 10825 9773 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 protein_id gnl|my_center|LOCUS_10900 12629 10923 gene locus_tag LOCUS_10910 12629 10923 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence0075 1265 153 gene locus_tag LOCUS_10920 1265 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1597 3294 gene locus_tag LOCUS_10930 1597 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 3815 3985 gene locus_tag LOCUS_10940 3815 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 4169 5518 gene locus_tag LOCUS_10950 4169 5518 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_10950 5756 7141 gene locus_tag LOCUS_10960 5756 7141 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_10960 7799 7491 gene locus_tag LOCUS_10970 7799 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 7987 9387 gene locus_tag LOCUS_10980 gene asnS 7987 9387 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_10980 10703 9462 gene locus_tag LOCUS_10990 10703 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 10924 10715 gene locus_tag LOCUS_11000 10924 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 10811 12430 gene locus_tag LOCUS_11010 10811 12430 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140950.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence0076 3132 2122 gene locus_tag LOCUS_11020 gene hpaI 3132 2122 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228326.1 protein_id gnl|my_center|LOCUS_11020 4149 3205 gene locus_tag LOCUS_11030 4149 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4802 4509 gene locus_tag LOCUS_11040 4802 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4872 5624 gene locus_tag LOCUS_11050 4872 5624 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971573.1 protein_id gnl|my_center|LOCUS_11050 5640 6470 gene locus_tag LOCUS_11060 5640 6470 CDS product CDP-archaeol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504834.1 protein_id gnl|my_center|LOCUS_11060 6477 7664 gene locus_tag LOCUS_11070 gene dxr 6477 7664 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_11070 7687 9138 gene locus_tag LOCUS_11080 gene rseP 7687 9138 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_11080 9267 11330 gene locus_tag LOCUS_11090 gene ispG 9267 11330 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011576.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence0077 1823 111 gene locus_tag LOCUS_11100 1823 111 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663784.1 protein_id gnl|my_center|LOCUS_11100 1904 2689 gene locus_tag LOCUS_11110 1904 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2889 2692 gene locus_tag LOCUS_11120 2889 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3340 2900 gene locus_tag LOCUS_11130 3340 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5206 3356 gene locus_tag LOCUS_11140 5206 3356 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_11140 6173 5310 gene locus_tag LOCUS_11150 gene blaBJP 6173 5310 CDS product subclass B3 metallo-beta-lactamase BJP-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088970.1 protein_id gnl|my_center|LOCUS_11150 9340 6197 gene locus_tag LOCUS_11160 9340 6197 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_11160 10536 9532 gene locus_tag LOCUS_11170 10536 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 <12587 10553 gene locus_tag LOCUS_11180 <12587 10553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265653.1:TonB-dependent receptor >Feature sequence0078 1918 2916 gene locus_tag LOCUS_11190 1918 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2920 6204 gene locus_tag LOCUS_11200 2920 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6248 6457 gene locus_tag LOCUS_11210 6248 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6454 6870 gene locus_tag LOCUS_11220 6454 6870 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140846.1 protein_id gnl|my_center|LOCUS_11220 7465 8688 gene locus_tag LOCUS_11230 7465 8688 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_11230 8711 9373 gene locus_tag LOCUS_11240 8711 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 10965 9769 gene locus_tag LOCUS_11250 10965 9769 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_11250 12301 11132 gene locus_tag LOCUS_11260 12301 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence0079 1322 1627 gene locus_tag LOCUS_11270 1322 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3570 2002 gene locus_tag LOCUS_11280 3570 2002 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120298.1 protein_id gnl|my_center|LOCUS_11280 4972 3617 gene locus_tag LOCUS_11290 4972 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 8119 5030 gene locus_tag LOCUS_11300 8119 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 11001 8299 gene locus_tag LOCUS_11310 11001 8299 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122437.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence0080 1665 1402 gene locus_tag LOCUS_11320 1665 1402 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_11320 2919 1681 gene locus_tag LOCUS_11330 2919 1681 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_11330 2982 3974 gene locus_tag LOCUS_11340 gene galE 2982 3974 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_11340 3971 4780 gene locus_tag LOCUS_11350 3971 4780 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972729.1 protein_id gnl|my_center|LOCUS_11350 6206 4869 gene locus_tag LOCUS_11360 6206 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 8016 6220 gene locus_tag LOCUS_11370 gene lepA 8016 6220 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871412.1 protein_id gnl|my_center|LOCUS_11370 8937 8020 gene locus_tag LOCUS_11380 gene fabD 8937 8020 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_11380 9511 9281 gene locus_tag LOCUS_11390 9511 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 9563 9748 gene locus_tag LOCUS_11400 9563 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 11718 9946 gene locus_tag LOCUS_11410 11718 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 12224 11751 gene locus_tag LOCUS_11420 12224 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence0081 1567 2109 gene locus_tag LOCUS_11430 1567 2109 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265652.1 protein_id gnl|my_center|LOCUS_11430 2096 2977 gene locus_tag LOCUS_11440 2096 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3087 6296 gene locus_tag LOCUS_11450 3087 6296 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_11450 6313 7917 gene locus_tag LOCUS_11460 6313 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 7931 9385 gene locus_tag LOCUS_11470 7931 9385 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921851.1 protein_id gnl|my_center|LOCUS_11470 9382 10800 gene locus_tag LOCUS_11480 9382 10800 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_11480 10797 11897 gene locus_tag LOCUS_11490 10797 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence0082 1168 65 gene locus_tag LOCUS_11500 gene mnmA 1168 65 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089522426.1 protein_id gnl|my_center|LOCUS_11500 2555 1263 gene locus_tag LOCUS_11510 2555 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 7377 2668 gene locus_tag LOCUS_11520 7377 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 7616 10090 gene locus_tag LOCUS_11530 7616 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 11376 10678 gene locus_tag LOCUS_11540 11376 10678 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence0083 1609 371 gene locus_tag LOCUS_11550 1609 371 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_11550 2456 1614 gene locus_tag LOCUS_11560 2456 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3723 2461 gene locus_tag LOCUS_11570 gene fabB 3723 2461 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_11570 4914 3916 gene locus_tag LOCUS_11580 4914 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5138 6304 gene locus_tag LOCUS_11590 5138 6304 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_11590 6301 6702 gene locus_tag LOCUS_11600 6301 6702 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_11600 7891 6695 gene locus_tag LOCUS_11610 gene queG 7891 6695 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397385.1 protein_id gnl|my_center|LOCUS_11610 8442 7891 gene locus_tag LOCUS_11620 8442 7891 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_11620 8499 9554 gene locus_tag LOCUS_11630 8499 9554 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 protein_id gnl|my_center|LOCUS_11630 10434 9628 gene locus_tag LOCUS_11640 10434 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence0084 856 1965 gene locus_tag LOCUS_11650 856 1965 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209281.1 protein_id gnl|my_center|LOCUS_11650 1993 2841 gene locus_tag LOCUS_11660 gene iolB 1993 2841 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_11660 2963 4213 gene locus_tag LOCUS_11670 2963 4213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_11670 4220 4999 gene locus_tag LOCUS_11680 4220 4999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027914.1 protein_id gnl|my_center|LOCUS_11680 5550 5179 gene locus_tag LOCUS_11690 5550 5179 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392206.1 protein_id gnl|my_center|LOCUS_11690 5776 5552 gene locus_tag LOCUS_11700 5776 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 5777 6175 gene locus_tag LOCUS_11710 5777 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 6172 6324 gene locus_tag LOCUS_11720 6172 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 9810 6670 gene locus_tag LOCUS_11730 9810 6670 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_11730 10303 10482 gene locus_tag LOCUS_11740 10303 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 10463 10858 gene locus_tag LOCUS_11750 10463 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 11127 12116 gene locus_tag LOCUS_11760 11127 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence0085 6119 369 gene locus_tag LOCUS_11770 6119 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6992 8641 gene locus_tag LOCUS_11780 6992 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 8667 9797 gene locus_tag LOCUS_11790 8667 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence0086 <1 1371 gene locus_tag LOCUS_11800 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073269.1:S41 family peptidase 1687 1517 gene locus_tag LOCUS_11810 1687 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3065 1728 gene locus_tag LOCUS_11820 3065 1728 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_11820 6354 3052 gene locus_tag LOCUS_11830 6354 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 6563 8173 gene locus_tag LOCUS_11840 6563 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 8206 8985 gene locus_tag LOCUS_11850 8206 8985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_11850 8999 10207 gene locus_tag LOCUS_11860 8999 10207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_11860 10322 11596 gene locus_tag LOCUS_11870 10322 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence0087 266 580 gene locus_tag LOCUS_11880 266 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2757 577 gene locus_tag LOCUS_11890 2757 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 4353 3076 gene locus_tag LOCUS_11900 4353 3076 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_11900 8262 4537 gene locus_tag LOCUS_11910 8262 4537 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119561.1 protein_id gnl|my_center|LOCUS_11910 9654 8452 gene locus_tag LOCUS_11920 9654 8452 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_11920 12028 9836 gene locus_tag LOCUS_11930 12028 9836 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258146.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence0088 55 1353 gene locus_tag LOCUS_11940 55 1353 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_11940 2114 1407 gene locus_tag LOCUS_11950 2114 1407 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_11950 2394 2203 gene locus_tag LOCUS_11960 2394 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2293 2961 gene locus_tag LOCUS_11970 gene pdxJ 2293 2961 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482574.1 protein_id gnl|my_center|LOCUS_11970 3069 3476 gene locus_tag LOCUS_11980 gene acpS 3069 3476 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871448.1 protein_id gnl|my_center|LOCUS_11980 3499 4149 gene locus_tag LOCUS_11990 3499 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 4165 5679 gene locus_tag LOCUS_12000 4165 5679 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_12000 5669 6799 gene locus_tag LOCUS_12010 gene dprA 5669 6799 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_12010 10213 7076 gene locus_tag LOCUS_12020 10213 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 11597 10842 gene locus_tag LOCUS_12030 11597 10842 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence0089 74 3778 gene locus_tag LOCUS_12040 74 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3907 4773 gene locus_tag LOCUS_12050 3907 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 4887 4962 gene locus_tag LOCUS_t00060 4887 4962 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4929 6410 gene locus_tag LOCUS_12060 gene hemG 4929 6410 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_12060 7424 6444 gene locus_tag LOCUS_12070 7424 6444 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_12070 8866 7490 gene locus_tag LOCUS_12080 gene hemN 8866 7490 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881391.1 protein_id gnl|my_center|LOCUS_12080 9303 8923 gene locus_tag LOCUS_12090 9303 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 9557 10582 gene locus_tag LOCUS_12100 9557 10582 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_12100 10594 11133 gene locus_tag LOCUS_12110 10594 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 11503 11270 gene locus_tag LOCUS_12120 11503 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 <12011 11500 gene locus_tag LOCUS_12130 <12011 11500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120973.1:galactose mutarotase >Feature sequence0090 <1 1738 gene locus_tag LOCUS_12140 <1 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326733.1:putative manganese-dependent inorganic diphosphatase 3160 1763 gene locus_tag LOCUS_12150 gene lpdA 3160 1763 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_12150 3630 3211 gene locus_tag LOCUS_12160 3630 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 3710 4816 gene locus_tag LOCUS_12170 3710 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 4895 10990 gene locus_tag LOCUS_12180 4895 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 11166 10999 gene locus_tag LOCUS_12190 11166 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence0091 286 828 gene locus_tag LOCUS_12200 286 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 825 1736 gene locus_tag LOCUS_12210 825 1736 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193057.1 protein_id gnl|my_center|LOCUS_12210 3555 2083 gene locus_tag LOCUS_12220 3555 2083 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_12220 3804 4541 gene locus_tag LOCUS_12230 gene flgG 3804 4541 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088571.1 protein_id gnl|my_center|LOCUS_12230 4578 5360 gene locus_tag LOCUS_12240 gene flgG 4578 5360 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546478.1 protein_id gnl|my_center|LOCUS_12240 5363 6040 gene locus_tag LOCUS_12250 5363 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 6047 6658 gene locus_tag LOCUS_12260 6047 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 6668 7756 gene locus_tag LOCUS_12270 6668 7756 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_12270 7759 8121 gene locus_tag LOCUS_12280 7759 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8118 8612 gene locus_tag LOCUS_12290 8118 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 8627 10045 gene locus_tag LOCUS_12300 gene flgK 8627 10045 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_12300 10060 10959 gene locus_tag LOCUS_12310 gene flgL 10060 10959 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_12310 10991 11449 gene locus_tag LOCUS_12320 gene fliW 10991 11449 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 protein_id gnl|my_center|LOCUS_12320 11454 11726 gene locus_tag LOCUS_12330 11454 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence0092 3065 75 gene locus_tag LOCUS_12340 3065 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 3290 3664 gene locus_tag LOCUS_12350 3290 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 3924 3610 gene locus_tag LOCUS_12360 3924 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 5401 4364 gene locus_tag LOCUS_12370 5401 4364 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_12370 5676 7667 gene locus_tag LOCUS_12380 5676 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 8076 7873 gene locus_tag LOCUS_12390 8076 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 8562 8128 gene locus_tag LOCUS_12400 gene tsaE 8562 8128 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_12400 9595 8603 gene locus_tag LOCUS_12410 gene thiL 9595 8603 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_12410 10414 9599 gene locus_tag LOCUS_12420 10414 9599 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393413.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence0093 3458 36 gene locus_tag LOCUS_12430 3458 36 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_12430 4117 3458 gene locus_tag LOCUS_12440 4117 3458 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_12440 5196 4483 gene locus_tag LOCUS_12450 5196 4483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312688.1 protein_id gnl|my_center|LOCUS_12450 6437 5193 gene locus_tag LOCUS_12460 6437 5193 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880143.1 protein_id gnl|my_center|LOCUS_12460 7620 6478 gene locus_tag LOCUS_12470 7620 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 9007 7601 gene locus_tag LOCUS_12480 9007 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 9138 10562 gene locus_tag LOCUS_12490 9138 10562 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_12490 10576 11691 gene locus_tag LOCUS_12500 10576 11691 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence0094 770 342 gene locus_tag LOCUS_12510 gene aroQ 770 342 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932862.1 protein_id gnl|my_center|LOCUS_12510 1602 850 gene locus_tag LOCUS_12520 1602 850 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_12520 2640 1606 gene locus_tag LOCUS_12530 2640 1606 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338084.1 protein_id gnl|my_center|LOCUS_12530 3688 2642 gene locus_tag LOCUS_12540 3688 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4329 3685 gene locus_tag LOCUS_12550 4329 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4390 4860 gene locus_tag LOCUS_12560 4390 4860 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 protein_id gnl|my_center|LOCUS_12560 4875 5429 gene locus_tag LOCUS_12570 4875 5429 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_12570 5465 5659 gene locus_tag LOCUS_12580 5465 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 5678 5932 gene locus_tag LOCUS_12590 5678 5932 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_12590 6065 7282 gene locus_tag LOCUS_12600 6065 7282 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_12600 7453 8871 gene locus_tag LOCUS_12610 7453 8871 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_12610 8990 9931 gene locus_tag LOCUS_12620 8990 9931 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122544.1 protein_id gnl|my_center|LOCUS_12620 10741 9983 gene locus_tag LOCUS_12630 10741 9983 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_12630 11608 10790 gene locus_tag LOCUS_12640 11608 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence0095 1589 141 gene locus_tag LOCUS_12650 1589 141 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_12650 2020 1604 gene locus_tag LOCUS_12660 2020 1604 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_12660 2463 3680 gene locus_tag LOCUS_12670 2463 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3779 5053 gene locus_tag LOCUS_12680 3779 5053 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_12680 7717 5144 gene locus_tag LOCUS_12690 7717 5144 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368537.1 protein_id gnl|my_center|LOCUS_12690 8790 7798 gene locus_tag LOCUS_12700 8790 7798 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_12700 9090 10337 gene locus_tag LOCUS_12710 9090 10337 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_12710 10372 11301 gene locus_tag LOCUS_12720 gene cysK 10372 11301 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_12720 11672 11307 gene locus_tag LOCUS_12730 11672 11307 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence0096 650 1504 gene locus_tag LOCUS_12740 650 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1501 2601 gene locus_tag LOCUS_12750 1501 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3883 2765 gene locus_tag LOCUS_12760 gene lpxB 3883 2765 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_12760 4961 3969 gene locus_tag LOCUS_12770 4961 3969 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_12770 5759 5406 gene locus_tag LOCUS_12780 5759 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12780 6648 5989 gene locus_tag LOCUS_12790 6648 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 6975 6901 gene locus_tag LOCUS_t00070 6975 6901 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7173 8273 gene locus_tag LOCUS_12800 gene leuB 7173 8273 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042351.1 protein_id gnl|my_center|LOCUS_12800 9054 8293 gene locus_tag LOCUS_12810 9054 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 9480 10400 gene locus_tag LOCUS_12820 9480 10400 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615678.1 protein_id gnl|my_center|LOCUS_12820 10414 10623 gene locus_tag LOCUS_12830 10414 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 10620 11204 gene locus_tag LOCUS_12840 10620 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence0097 2168 1503 gene locus_tag LOCUS_12850 2168 1503 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140061.1 protein_id gnl|my_center|LOCUS_12850 2692 2168 gene locus_tag LOCUS_12860 2692 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2828 3082 gene locus_tag LOCUS_12870 2828 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5011 3623 gene locus_tag LOCUS_12880 5011 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 6178 5228 gene locus_tag LOCUS_12890 6178 5228 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_12890 9231 6223 gene locus_tag LOCUS_12900 9231 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 10536 9274 gene locus_tag LOCUS_12910 10536 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 <11718 10730 gene locus_tag LOCUS_12920 <11718 10730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922059.1:sugar phosphate isomerase/epimerase >Feature sequence0098 892 206 gene locus_tag LOCUS_12930 892 206 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_12930 2517 1117 gene locus_tag LOCUS_12940 2517 1117 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_12940 5145 2521 gene locus_tag LOCUS_12950 5145 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 7138 5774 gene locus_tag LOCUS_12960 7138 5774 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_12960 7551 10802 gene locus_tag LOCUS_12970 7551 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence0099 <1 693 gene locus_tag LOCUS_12980 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722743.1:GTP cyclohydrolase FolE2 1004 1438 gene locus_tag LOCUS_12990 1004 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1668 2924 gene locus_tag LOCUS_13000 1668 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3187 5994 gene locus_tag LOCUS_13010 3187 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6018 7469 gene locus_tag LOCUS_13020 6018 7469 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_13020 7476 8444 gene locus_tag LOCUS_13030 7476 8444 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_13030 8501 10423 gene locus_tag LOCUS_13040 8501 10423 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_13040 10579 11259 gene locus_tag LOCUS_13050 10579 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence0100 2785 2060 gene locus_tag LOCUS_13060 2785 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3177 3914 gene locus_tag LOCUS_13070 3177 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 4923 4087 gene locus_tag LOCUS_13080 4923 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 5483 7123 gene locus_tag LOCUS_13090 5483 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 7233 9251 gene locus_tag LOCUS_13100 7233 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 9800 11026 gene locus_tag LOCUS_13110 9800 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 <11580 11016 gene locus_tag LOCUS_13120 <11580 11016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022377.1:ISL3-like element ISMac21 family transposase >Feature sequence0101 743 123 gene locus_tag LOCUS_13130 743 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1048 3186 gene locus_tag LOCUS_13140 1048 3186 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994073.1 protein_id gnl|my_center|LOCUS_13140 3183 4316 gene locus_tag LOCUS_13150 gene rlmN 3183 4316 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 protein_id gnl|my_center|LOCUS_13150 5072 4362 gene locus_tag LOCUS_13160 5072 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 5431 5219 gene locus_tag LOCUS_13170 5431 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 5822 5397 gene locus_tag LOCUS_13180 5822 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 5931 6674 gene locus_tag LOCUS_13190 5931 6674 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037558.1 protein_id gnl|my_center|LOCUS_13190 6916 8184 gene locus_tag LOCUS_13200 6916 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_13200 8359 9396 gene locus_tag LOCUS_13210 8359 9396 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_13210 9529 10674 gene locus_tag LOCUS_13220 9529 10674 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence0102 835 1776 gene locus_tag LOCUS_13230 835 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1936 3351 gene locus_tag LOCUS_13240 1936 3351 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421521.1 protein_id gnl|my_center|LOCUS_13240 3440 4822 gene locus_tag LOCUS_13250 3440 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 6054 5458 gene locus_tag LOCUS_13260 6054 5458 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020479965.1 protein_id gnl|my_center|LOCUS_13260 6347 8665 gene locus_tag LOCUS_13270 6347 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 9552 8908 gene locus_tag LOCUS_13280 9552 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 <11522 9701 gene locus_tag LOCUS_13290 <11522 9701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816920.1:TonB-dependent siderophore receptor >Feature sequence0103 320 1669 gene locus_tag LOCUS_13300 320 1669 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921947.1 protein_id gnl|my_center|LOCUS_13300 3039 1711 gene locus_tag LOCUS_13310 3039 1711 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_13310 3239 4603 gene locus_tag LOCUS_13320 3239 4603 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_13320 4833 5087 gene locus_tag LOCUS_13330 4833 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 7003 5837 gene locus_tag LOCUS_13340 gene mcrC 7003 5837 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437621.1 protein_id gnl|my_center|LOCUS_13340 9485 7020 gene locus_tag LOCUS_13350 9485 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 11106 10039 gene locus_tag LOCUS_13360 11106 10039 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_13360 11441 11181 gene locus_tag LOCUS_13370 11441 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence0104 776 1699 gene locus_tag LOCUS_13380 776 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2956 1790 gene locus_tag LOCUS_13390 2956 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976170.1 protein_id gnl|my_center|LOCUS_13390 4524 3013 gene locus_tag LOCUS_13400 4524 3013 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 protein_id gnl|my_center|LOCUS_13400 4585 5394 gene locus_tag LOCUS_13410 4585 5394 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974586.1 protein_id gnl|my_center|LOCUS_13410 5595 7526 gene locus_tag LOCUS_13420 5595 7526 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_13420 7666 8751 gene locus_tag LOCUS_13430 7666 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 8900 10960 gene locus_tag LOCUS_13440 8900 10960 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence0105 <1 1845 gene locus_tag LOCUS_13450 <1 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008663427.1:GDSL-type esterase/lipase family protein 2079 2963 gene locus_tag LOCUS_13460 2079 2963 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_13460 2988 4625 gene locus_tag LOCUS_13470 2988 4625 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666312.1 protein_id gnl|my_center|LOCUS_13470 4622 6199 gene locus_tag LOCUS_13480 4622 6199 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922615.1 protein_id gnl|my_center|LOCUS_13480 6484 6753 gene locus_tag LOCUS_13490 6484 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 7491 6715 gene locus_tag LOCUS_13500 7491 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 7865 7488 gene locus_tag LOCUS_13510 7865 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 8025 11168 gene locus_tag LOCUS_13520 8025 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence0106 <1 1551 gene locus_tag LOCUS_13530 <1 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037292.1:efflux RND transporter permease subunit 1867 1942 gene locus_tag LOCUS_t00080 1867 1942 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2120 5386 gene locus_tag LOCUS_13540 2120 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 5448 6881 gene locus_tag LOCUS_13550 5448 6881 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_13550 6914 7462 gene locus_tag LOCUS_13560 6914 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 7680 8180 gene locus_tag LOCUS_13570 gene exeG 7680 8180 CDS product GspG family T2SS major pseudopilin variant ExeG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308483.1 protein_id gnl|my_center|LOCUS_13570 8224 8805 gene locus_tag LOCUS_13580 8224 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 8865 9281 gene locus_tag LOCUS_13590 8865 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 9278 10072 gene locus_tag LOCUS_13600 9278 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 10162 11247 gene locus_tag LOCUS_13610 10162 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence0107 6216 3160 gene locus_tag LOCUS_13620 6216 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 6539 7840 gene locus_tag LOCUS_13630 6539 7840 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_13630 7897 10809 gene locus_tag LOCUS_13640 7897 10809 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668648.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence0108 2333 168 gene locus_tag LOCUS_13650 2333 168 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_13650 4304 2904 gene locus_tag LOCUS_13660 4304 2904 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_13660 5559 4399 gene locus_tag LOCUS_13670 5559 4399 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_13670 6929 5652 gene locus_tag LOCUS_13680 6929 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 7884 7006 gene locus_tag LOCUS_13690 7884 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 8811 8017 gene locus_tag LOCUS_13700 8811 8017 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_13700 9493 9062 gene locus_tag LOCUS_13710 9493 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 9447 9635 gene locus_tag LOCUS_13720 9447 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 10609 9710 gene locus_tag LOCUS_13730 10609 9710 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence0109 2329 1478 gene locus_tag LOCUS_13740 2329 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3111 2326 gene locus_tag LOCUS_13750 3111 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3387 4064 gene locus_tag LOCUS_13760 3387 4064 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477371.1 protein_id gnl|my_center|LOCUS_13760 4275 5177 gene locus_tag LOCUS_13770 gene cysD 4275 5177 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_13770 5198 6532 gene locus_tag LOCUS_13780 5198 6532 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_13780 6529 6804 gene locus_tag LOCUS_13790 6529 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 6801 7214 gene locus_tag LOCUS_13800 6801 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 7848 8414 gene locus_tag LOCUS_13810 7848 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 8603 8469 gene locus_tag LOCUS_13820 8603 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 8985 9932 gene locus_tag LOCUS_13830 8985 9932 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_13830 10882 9929 gene locus_tag LOCUS_13840 10882 9929 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence0110 3021 3518 gene locus_tag LOCUS_13850 3021 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 4183 3722 gene locus_tag LOCUS_13860 4183 3722 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_13860 5637 4360 gene locus_tag LOCUS_13870 gene clpX 5637 4360 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_13870 6341 5724 gene locus_tag LOCUS_13880 gene clpP 6341 5724 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_13880 7729 6365 gene locus_tag LOCUS_13890 gene tig 7729 6365 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957768.1 protein_id gnl|my_center|LOCUS_13890 7821 8462 gene locus_tag LOCUS_13900 7821 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 <11203 8520 gene locus_tag LOCUS_13910 <11203 8520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921683.1:FG-GAP-like repeat-containing protein >Feature sequence0111 370 1752 gene locus_tag LOCUS_13920 370 1752 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922251.1 protein_id gnl|my_center|LOCUS_13920 1777 3609 gene locus_tag LOCUS_13930 1777 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 3620 5854 gene locus_tag LOCUS_13940 3620 5854 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921685.1 protein_id gnl|my_center|LOCUS_13940 5851 7329 gene locus_tag LOCUS_13950 5851 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_13950 7355 8458 gene locus_tag LOCUS_13960 7355 8458 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_13960 8455 9987 gene locus_tag LOCUS_13970 8455 9987 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120298.1 protein_id gnl|my_center|LOCUS_13970 9995 10333 gene locus_tag LOCUS_13980 9995 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence0112 2565 304 gene locus_tag LOCUS_13990 2565 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 2899 4371 gene locus_tag LOCUS_14000 gene atoC 2899 4371 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_14000 4936 4598 gene locus_tag LOCUS_14010 4936 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 5422 5054 gene locus_tag LOCUS_14020 5422 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 5307 6011 gene locus_tag LOCUS_14030 5307 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5998 7308 gene locus_tag LOCUS_14040 5998 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 7573 7938 gene locus_tag LOCUS_14050 7573 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 9299 7950 gene locus_tag LOCUS_14060 9299 7950 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102481.1 protein_id gnl|my_center|LOCUS_14060 9499 9882 gene locus_tag LOCUS_14070 gene flgB 9499 9882 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546345.1 protein_id gnl|my_center|LOCUS_14070 9900 10325 gene locus_tag LOCUS_14080 gene flgC 9900 10325 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_14080 10339 10680 gene locus_tag LOCUS_14090 10339 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence0113 <1 828 gene locus_tag LOCUS_14100 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920554.1:FecR family protein 1050 3653 gene locus_tag LOCUS_14110 1050 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 3799 4344 gene locus_tag LOCUS_14120 3799 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4474 5010 gene locus_tag LOCUS_14130 4474 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6260 5022 gene locus_tag LOCUS_14140 6260 5022 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435501.1 protein_id gnl|my_center|LOCUS_14140 6564 6253 gene locus_tag LOCUS_14150 6564 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 7431 6874 gene locus_tag LOCUS_14160 7431 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7622 7428 gene locus_tag LOCUS_14170 7622 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 7991 9436 gene locus_tag LOCUS_14180 7991 9436 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_14180 9767 10999 gene locus_tag LOCUS_14190 9767 10999 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence0114 884 564 gene locus_tag LOCUS_14200 gene mazF9 884 564 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_14200 1126 881 gene locus_tag LOCUS_14210 1126 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1675 1238 gene locus_tag LOCUS_14220 1675 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3316 1862 gene locus_tag LOCUS_14230 3316 1862 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_14230 6146 3384 gene locus_tag LOCUS_14240 6146 3384 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_14240 6039 6236 gene locus_tag LOCUS_14250 6039 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 9467 6345 gene locus_tag LOCUS_14260 9467 6345 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071943.1 protein_id gnl|my_center|LOCUS_14260 <11133 9879 gene locus_tag LOCUS_14270 <11133 9879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120539.1:acetylxylan esterase >Feature sequence0115 <1 1904 gene locus_tag LOCUS_14280 <1 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121692.1:helicase C-terminal domain-containing protein 1937 2659 gene locus_tag LOCUS_14290 1937 2659 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_14290 2664 2972 gene locus_tag LOCUS_14300 2664 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 3038 4867 gene locus_tag LOCUS_14310 3038 4867 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247565.1 protein_id gnl|my_center|LOCUS_14310 4948 5733 gene locus_tag LOCUS_14320 4948 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 5748 6431 gene locus_tag LOCUS_14330 5748 6431 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_14330 6485 7087 gene locus_tag LOCUS_14340 gene thrH 6485 7087 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_14340 8518 7121 gene locus_tag LOCUS_14350 gene gltX 8518 7121 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_14350 8589 9356 gene locus_tag LOCUS_14360 8589 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 10059 9334 gene locus_tag LOCUS_14370 10059 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 10657 11028 gene locus_tag LOCUS_14380 gene raiA 10657 11028 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence0116 481 1431 gene locus_tag LOCUS_14390 481 1431 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_14390 1976 1515 gene locus_tag LOCUS_14400 1976 1515 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921412.1 protein_id gnl|my_center|LOCUS_14400 2182 4875 gene locus_tag LOCUS_14410 2182 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 5135 6289 gene locus_tag LOCUS_14420 5135 6289 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_14420 6377 6889 gene locus_tag LOCUS_14430 6377 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7023 8135 gene locus_tag LOCUS_14440 gene dusB 7023 8135 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942604.1 protein_id gnl|my_center|LOCUS_14440 <11040 8223 gene locus_tag LOCUS_14450 <11040 8223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793715.1:S41 family peptidase >Feature sequence0117 37 837 gene locus_tag LOCUS_14460 37 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 907 1320 gene locus_tag LOCUS_14470 907 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1659 3326 gene locus_tag LOCUS_14480 1659 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3573 3965 gene locus_tag LOCUS_14490 3573 3965 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089312.1 protein_id gnl|my_center|LOCUS_14490 4000 5025 gene locus_tag LOCUS_14500 4000 5025 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_14500 5115 6362 gene locus_tag LOCUS_14510 gene arsJ 5115 6362 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_14510 6479 7192 gene locus_tag LOCUS_14520 6479 7192 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009567369.1 protein_id gnl|my_center|LOCUS_14520 7233 7841 gene locus_tag LOCUS_14530 7233 7841 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_14530 7953 9047 gene locus_tag LOCUS_14540 gene hisC 7953 9047 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_14540 9957 9217 gene locus_tag LOCUS_14550 9957 9217 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_14550 9997 10167 gene locus_tag LOCUS_14560 9997 10167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 10315 10785 gene locus_tag LOCUS_14570 10315 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence0118 5243 2082 gene locus_tag LOCUS_14580 5243 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 8755 5678 gene locus_tag LOCUS_14590 8755 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 8985 10442 gene locus_tag LOCUS_14600 8985 10442 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence0119 1461 4325 gene locus_tag LOCUS_14610 gene glnD 1461 4325 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_14610 4391 6094 gene locus_tag LOCUS_14620 4391 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 6135 6362 gene locus_tag LOCUS_14630 6135 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 7354 6425 gene locus_tag LOCUS_14640 7354 6425 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391113.1 protein_id gnl|my_center|LOCUS_14640 8060 7356 gene locus_tag LOCUS_14650 8060 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 8881 8141 gene locus_tag LOCUS_14660 8881 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 9189 9524 gene locus_tag LOCUS_14670 9189 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 10403 9642 gene locus_tag LOCUS_14680 10403 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence0120 669 1538 gene locus_tag LOCUS_14690 669 1538 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 protein_id gnl|my_center|LOCUS_14690 1535 2911 gene locus_tag LOCUS_14700 gene aroA 1535 2911 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 protein_id gnl|my_center|LOCUS_14700 2908 3588 gene locus_tag LOCUS_14710 gene cmk 2908 3588 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_14710 3585 4247 gene locus_tag LOCUS_14720 3585 4247 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869529.1 protein_id gnl|my_center|LOCUS_14720 5455 4490 gene locus_tag LOCUS_14730 gene trpS 5455 4490 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_14730 6181 5495 gene locus_tag LOCUS_14740 6181 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 7387 6296 gene locus_tag LOCUS_14750 7387 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 7440 8576 gene locus_tag LOCUS_14760 7440 8576 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 protein_id gnl|my_center|LOCUS_14760 8608 9162 gene locus_tag LOCUS_14770 8608 9162 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_14770 9179 9952 gene locus_tag LOCUS_14780 9179 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence0121 <1 1392 gene locus_tag LOCUS_14790 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765248.1:SMP-30/gluconolactonase/LRE family protein 4724 1548 gene locus_tag LOCUS_14800 4724 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5676 4825 gene locus_tag LOCUS_14810 5676 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7811 5697 gene locus_tag LOCUS_14820 7811 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9440 7824 gene locus_tag LOCUS_14830 9440 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence0122 <1 1601 gene locus_tag LOCUS_14840 <1 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530050.1:S9 family peptidase 2887 1937 gene locus_tag LOCUS_14850 2887 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3383 3189 gene locus_tag LOCUS_14860 3383 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4913 3420 gene locus_tag LOCUS_14870 4913 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 7878 4999 gene locus_tag LOCUS_14880 7878 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 9409 7982 gene locus_tag LOCUS_14890 9409 7982 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121659.1 protein_id gnl|my_center|LOCUS_14890 <10848 9415 gene locus_tag LOCUS_14900 <10848 9415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666716.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0123 1294 827 gene locus_tag LOCUS_14910 1294 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1437 3038 gene locus_tag LOCUS_14920 1437 3038 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_14920 3145 4449 gene locus_tag LOCUS_14930 3145 4449 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_14930 6469 4631 gene locus_tag LOCUS_14940 6469 4631 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_14940 6675 6466 gene locus_tag LOCUS_14950 6675 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 8032 7121 gene locus_tag LOCUS_14960 8032 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918996.1 protein_id gnl|my_center|LOCUS_14960 <10799 8039 gene locus_tag LOCUS_14970 <10799 8039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071943.1:TonB-dependent receptor >Feature sequence0124 153 1907 gene locus_tag LOCUS_14980 153 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2545 2111 gene locus_tag LOCUS_14990 2545 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 2704 2546 gene locus_tag LOCUS_15000 2704 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2892 3362 gene locus_tag LOCUS_15010 2892 3362 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 protein_id gnl|my_center|LOCUS_15010 3474 4442 gene locus_tag LOCUS_15020 gene corA 3474 4442 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_15020 4433 4588 gene locus_tag LOCUS_15030 4433 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4799 6442 gene locus_tag LOCUS_15040 4799 6442 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_15040 7888 6578 gene locus_tag LOCUS_15050 7888 6578 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812443.1 protein_id gnl|my_center|LOCUS_15050 8967 7891 gene locus_tag LOCUS_15060 8967 7891 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227985.1 protein_id gnl|my_center|LOCUS_15060 10630 9179 gene locus_tag LOCUS_15070 10630 9179 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence0125 1850 270 gene locus_tag LOCUS_15080 gene rny 1850 270 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870004.1 protein_id gnl|my_center|LOCUS_15080 3212 2061 gene locus_tag LOCUS_15090 3212 2061 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_15090 4121 3216 gene locus_tag LOCUS_15100 4121 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 4197 5186 gene locus_tag LOCUS_15110 4197 5186 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_15110 5183 6436 gene locus_tag LOCUS_15120 5183 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 6541 8181 gene locus_tag LOCUS_15130 gene fumA 6541 8181 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209418.1 protein_id gnl|my_center|LOCUS_15130 8617 8333 gene locus_tag LOCUS_15140 8617 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 8721 8942 gene locus_tag LOCUS_15150 8721 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 9834 9196 gene locus_tag LOCUS_15160 gene rpoE 9834 9196 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 protein_id gnl|my_center|LOCUS_15160 <10774 9901 gene locus_tag LOCUS_15170 <10774 9901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615392.1:polyprenyl synthetase family protein >Feature sequence0126 <1 1259 gene locus_tag LOCUS_15180 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265649.1:TonB-dependent receptor 2889 1417 gene locus_tag LOCUS_15190 2889 1417 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402023.1 protein_id gnl|my_center|LOCUS_15190 3233 3394 gene locus_tag LOCUS_15200 3233 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3630 6608 gene locus_tag LOCUS_15210 3630 6608 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921983.1 protein_id gnl|my_center|LOCUS_15210 6608 8113 gene locus_tag LOCUS_15220 6608 8113 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_15220 9799 8606 gene locus_tag LOCUS_15230 9799 8606 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_15230 10766 9777 gene locus_tag LOCUS_15240 10766 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence0127 2166 604 gene locus_tag LOCUS_15250 2166 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3689 2163 gene locus_tag LOCUS_15260 3689 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3841 5403 gene locus_tag LOCUS_15270 3841 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 5410 6333 gene locus_tag LOCUS_15280 5410 6333 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793191.1 protein_id gnl|my_center|LOCUS_15280 6474 7445 gene locus_tag LOCUS_15290 6474 7445 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_15290 10518 7678 gene locus_tag LOCUS_15300 10518 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence0128 2642 828 gene locus_tag LOCUS_15310 2642 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3742 2735 gene locus_tag LOCUS_15320 3742 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3763 4296 gene locus_tag LOCUS_15330 3763 4296 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_15330 5591 4305 gene locus_tag LOCUS_15340 5591 4305 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_15340 6439 5588 gene locus_tag LOCUS_15350 6439 5588 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226278.1 protein_id gnl|my_center|LOCUS_15350 8952 6436 gene locus_tag LOCUS_15360 8952 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 9060 9908 gene locus_tag LOCUS_15370 9060 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence0129 783 118 gene locus_tag LOCUS_15380 783 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 860 1213 gene locus_tag LOCUS_15390 860 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1221 1496 gene locus_tag LOCUS_15400 1221 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1589 2758 gene locus_tag LOCUS_15410 1589 2758 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_15410 3251 4570 gene locus_tag LOCUS_15420 3251 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 4644 8810 gene locus_tag LOCUS_15430 4644 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence0130 840 247 gene locus_tag LOCUS_15440 840 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1565 837 gene locus_tag LOCUS_15450 1565 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1906 1562 gene locus_tag LOCUS_15460 1906 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2619 2206 gene locus_tag LOCUS_15470 2619 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 5491 2630 gene locus_tag LOCUS_15480 gene mobF 5491 2630 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_15480 6512 5601 gene locus_tag LOCUS_15490 6512 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 8019 8336 gene locus_tag LOCUS_15500 8019 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 8326 9030 gene locus_tag LOCUS_15510 8326 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 9269 9066 gene locus_tag LOCUS_15520 9269 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence0131 1137 208 gene locus_tag LOCUS_15530 1137 208 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_15530 2295 1213 gene locus_tag LOCUS_15540 2295 1213 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_15540 2660 2364 gene locus_tag LOCUS_15550 2660 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2931 2662 gene locus_tag LOCUS_15560 gene eutN 2931 2662 CDS product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762193.1 protein_id gnl|my_center|LOCUS_15560 4413 2935 gene locus_tag LOCUS_15570 4413 2935 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_15570 4740 4429 gene locus_tag LOCUS_15580 4740 4429 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_15580 5043 4744 gene locus_tag LOCUS_15590 gene pduA 5043 4744 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 protein_id gnl|my_center|LOCUS_15590 6346 5102 gene locus_tag LOCUS_15600 6346 5102 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392456.1 protein_id gnl|my_center|LOCUS_15600 6754 6461 gene locus_tag LOCUS_15610 gene pduA 6754 6461 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_15610 7090 6821 gene locus_tag LOCUS_15620 7090 6821 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868831.1 protein_id gnl|my_center|LOCUS_15620 7703 7140 gene locus_tag LOCUS_15630 7703 7140 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_15630 7921 8703 gene locus_tag LOCUS_15640 7921 8703 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_15640 9606 8764 gene locus_tag LOCUS_15650 gene panC 9606 8764 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence0132 1190 81 gene locus_tag LOCUS_15660 gene urtC 1190 81 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105220.1 protein_id gnl|my_center|LOCUS_15660 2940 1222 gene locus_tag LOCUS_15670 gene urtB 2940 1222 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816780.1 protein_id gnl|my_center|LOCUS_15670 4368 3067 gene locus_tag LOCUS_15680 gene urtA 4368 3067 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_15680 5496 4525 gene locus_tag LOCUS_15690 5496 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 5803 6597 gene locus_tag LOCUS_15700 5803 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6723 7751 gene locus_tag LOCUS_15710 gene argC 6723 7751 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390174.1 protein_id gnl|my_center|LOCUS_15710 8280 7819 gene locus_tag LOCUS_15720 8280 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15720 9137 8277 gene locus_tag LOCUS_15730 9137 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15730 9293 10174 gene locus_tag LOCUS_15740 gene argB 9293 10174 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence0133 2510 4651 gene locus_tag LOCUS_15750 2510 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 7792 4760 gene locus_tag LOCUS_15760 7792 4760 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_15760 8174 9805 gene locus_tag LOCUS_15770 gene oppA 8174 9805 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218177.1 protein_id gnl|my_center|LOCUS_15770 <10373 9855 gene locus_tag LOCUS_15780 <10373 9855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706672.1:DEAD/DEAH box helicase >Feature sequence0134 <1 1023 gene locus_tag LOCUS_15790 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421555.1:DUF58 domain-containing protein 1202 2221 gene locus_tag LOCUS_15800 1202 2221 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_15800 2349 4295 gene locus_tag LOCUS_15810 2349 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 4301 6877 gene locus_tag LOCUS_15820 4301 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 7795 7187 gene locus_tag LOCUS_15830 7795 7187 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_15830 8416 7820 gene locus_tag LOCUS_15840 8416 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 8495 9358 gene locus_tag LOCUS_15850 gene gluQRS 8495 9358 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_15850 9487 10017 gene locus_tag LOCUS_15860 gene mog 9487 10017 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140668.1 protein_id gnl|my_center|LOCUS_15860 10341 10177 gene locus_tag LOCUS_15870 10341 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence0135 5685 2833 gene locus_tag LOCUS_15880 5685 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 8901 6010 gene locus_tag LOCUS_15890 8901 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 9090 10109 gene locus_tag LOCUS_15900 9090 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence0136 1813 812 gene locus_tag LOCUS_15910 gene fmt 1813 812 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697690.1 protein_id gnl|my_center|LOCUS_15910 2736 1819 gene locus_tag LOCUS_15920 2736 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_15920 4309 2717 gene locus_tag LOCUS_15930 gene der 4309 2717 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_15930 5533 4346 gene locus_tag LOCUS_15940 5533 4346 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_15940 6037 5549 gene locus_tag LOCUS_15950 6037 5549 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_15950 6150 7547 gene locus_tag LOCUS_15960 gene ffh 6150 7547 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938141.1 protein_id gnl|my_center|LOCUS_15960 7633 9972 gene locus_tag LOCUS_15970 7633 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 10046 10264 gene locus_tag LOCUS_15980 10046 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence0137 1193 351 gene locus_tag LOCUS_15990 1193 351 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_15990 2250 1204 gene locus_tag LOCUS_16000 2250 1204 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_16000 3680 2247 gene locus_tag LOCUS_16010 3680 2247 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_16010 4207 7347 gene locus_tag LOCUS_16020 4207 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 7497 8198 gene locus_tag LOCUS_16030 7497 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 8591 10126 gene locus_tag LOCUS_16040 8591 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence0138 3334 3206 gene locus_tag LOCUS_16050 3334 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4679 3342 gene locus_tag LOCUS_16060 4679 3342 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_16060 7685 4836 gene locus_tag LOCUS_16070 7685 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 8980 7973 gene locus_tag LOCUS_16080 8980 7973 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_16080 9924 8986 gene locus_tag LOCUS_16090 9924 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence0139 4540 1757 gene locus_tag LOCUS_16100 4540 1757 CDS product DUF6250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764390.1 protein_id gnl|my_center|LOCUS_16100 4810 7893 gene locus_tag LOCUS_16110 4810 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence0140 1002 2162 gene locus_tag LOCUS_16120 1002 2162 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_16120 2228 3214 gene locus_tag LOCUS_16130 2228 3214 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388524.1 protein_id gnl|my_center|LOCUS_16130 3211 4260 gene locus_tag LOCUS_16140 3211 4260 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090071.1 protein_id gnl|my_center|LOCUS_16140 6322 4268 gene locus_tag LOCUS_16150 6322 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 7260 6319 gene locus_tag LOCUS_16160 7260 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 8055 7330 gene locus_tag LOCUS_16170 gene rsmI 8055 7330 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948680.1 protein_id gnl|my_center|LOCUS_16170 8329 8165 gene locus_tag LOCUS_16180 8329 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 9102 8326 gene locus_tag LOCUS_16190 9102 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 9727 9197 gene locus_tag LOCUS_16200 9727 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence0141 2154 499 gene locus_tag LOCUS_16210 2154 499 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_16210 3323 2277 gene locus_tag LOCUS_16220 3323 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 4390 3320 gene locus_tag LOCUS_16230 4390 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 7941 4420 gene locus_tag LOCUS_16240 7941 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 8911 7961 gene locus_tag LOCUS_16250 8911 7961 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 protein_id gnl|my_center|LOCUS_16250 9563 9009 gene locus_tag LOCUS_16260 9563 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence0142 1773 235 gene locus_tag LOCUS_16270 1773 235 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_16270 4395 1840 gene locus_tag LOCUS_16280 4395 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 4751 5812 gene locus_tag LOCUS_16290 4751 5812 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 protein_id gnl|my_center|LOCUS_16290 5835 7382 gene locus_tag LOCUS_16300 5835 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 <10061 7449 gene locus_tag LOCUS_16310 <10061 7449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813236.1:ATP-dependent RNA helicase HrpA >Feature sequence0143 2785 2144 gene locus_tag LOCUS_16320 2785 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3762 2782 gene locus_tag LOCUS_16330 3762 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 6977 3963 gene locus_tag LOCUS_16340 6977 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 8430 7093 gene locus_tag LOCUS_16350 8430 7093 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870255.1 protein_id gnl|my_center|LOCUS_16350 <10047 8436 gene locus_tag LOCUS_16360 <10047 8436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943409.1:efflux RND transporter permease subunit >Feature sequence0144 56 1852 gene locus_tag LOCUS_16370 56 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1907 2365 gene locus_tag LOCUS_16380 1907 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2818 3294 gene locus_tag LOCUS_16390 2818 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3718 3473 gene locus_tag LOCUS_16400 3718 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3623 4213 gene locus_tag LOCUS_16410 3623 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 4219 5073 gene locus_tag LOCUS_16420 4219 5073 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_16420 5052 6356 gene locus_tag LOCUS_16430 5052 6356 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713289.1 protein_id gnl|my_center|LOCUS_16430 6376 7053 gene locus_tag LOCUS_16440 6376 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 7047 7865 gene locus_tag LOCUS_16450 7047 7865 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_16450 8014 9138 gene locus_tag LOCUS_16460 8014 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence0145 50 904 gene locus_tag LOCUS_16470 50 904 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220354845.1 protein_id gnl|my_center|LOCUS_16470 1716 1964 gene locus_tag LOCUS_16480 1716 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3488 2049 gene locus_tag LOCUS_16490 3488 2049 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_16490 7569 3478 gene locus_tag LOCUS_16500 7569 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence0146 421 167 gene locus_tag LOCUS_16510 421 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 981 514 gene locus_tag LOCUS_16520 981 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2114 978 gene locus_tag LOCUS_16530 2114 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4665 2773 gene locus_tag LOCUS_16540 4665 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 4993 4727 gene locus_tag LOCUS_16550 4993 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 5536 5000 gene locus_tag LOCUS_16560 5536 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 6818 5733 gene locus_tag LOCUS_16570 6818 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 7972 6812 gene locus_tag LOCUS_16580 7972 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 8697 8155 gene locus_tag LOCUS_16590 8697 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 9878 8694 gene locus_tag LOCUS_16600 9878 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence0147 755 1495 gene locus_tag LOCUS_16610 755 1495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_16610 1492 2703 gene locus_tag LOCUS_16620 1492 2703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864646.1 protein_id gnl|my_center|LOCUS_16620 2770 3330 gene locus_tag LOCUS_16630 2770 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4075 3620 gene locus_tag LOCUS_16640 4075 3620 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_16640 4157 5065 gene locus_tag LOCUS_16650 4157 5065 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409725.1 protein_id gnl|my_center|LOCUS_16650 5152 8244 gene locus_tag LOCUS_16660 5152 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence0148 <1 948 gene locus_tag LOCUS_16670 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037461425.1:TonB-dependent receptor 2164 1310 gene locus_tag LOCUS_16680 gene tcdA 2164 1310 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112469.1 protein_id gnl|my_center|LOCUS_16680 3305 2223 gene locus_tag LOCUS_16690 3305 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 3486 5120 gene locus_tag LOCUS_16700 3486 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6143 5268 gene locus_tag LOCUS_16710 6143 5268 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 protein_id gnl|my_center|LOCUS_16710 6615 7904 gene locus_tag LOCUS_16720 6615 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 <9853 8462 gene locus_tag LOCUS_16730 <9853 8462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194230.1:ribonucleoside-diphosphate reductase subunit alpha >Feature sequence0149 2175 1012 gene locus_tag LOCUS_16740 2175 1012 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_16740 2398 3963 gene locus_tag LOCUS_16750 2398 3963 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_16750 4052 4786 gene locus_tag LOCUS_16760 4052 4786 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_16760 4797 6323 gene locus_tag LOCUS_16770 4797 6323 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939857.1 protein_id gnl|my_center|LOCUS_16770 7582 6680 gene locus_tag LOCUS_16780 7582 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 7581 8345 gene locus_tag LOCUS_16790 7581 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 8500 9117 gene locus_tag LOCUS_16800 8500 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence0150 1531 494 gene locus_tag LOCUS_16810 1531 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1778 3496 gene locus_tag LOCUS_16820 gene ilvD 1778 3496 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_16820 3608 3838 gene locus_tag LOCUS_16830 3608 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 5524 4070 gene locus_tag LOCUS_16840 5524 4070 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_16840 6017 6481 gene locus_tag LOCUS_16850 6017 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6500 9289 gene locus_tag LOCUS_16860 6500 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence0151 473 135 gene locus_tag LOCUS_16870 473 135 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812839.1 protein_id gnl|my_center|LOCUS_16870 1925 483 gene locus_tag LOCUS_16880 1925 483 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_16880 2473 2135 gene locus_tag LOCUS_16890 gene glnB 2473 2135 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_16890 4337 2550 gene locus_tag LOCUS_16900 gene aspS 4337 2550 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_16900 6008 4416 gene locus_tag LOCUS_16910 gene gpmI 6008 4416 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435040.1 protein_id gnl|my_center|LOCUS_16910 6182 7219 gene locus_tag LOCUS_16920 6182 7219 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_16920 7256 8284 gene locus_tag LOCUS_16930 gene hemH 7256 8284 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099324.1 protein_id gnl|my_center|LOCUS_16930 8274 9728 gene locus_tag LOCUS_16940 8274 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence0152 <1 849 gene locus_tag LOCUS_16950 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083281.1:dihydrolipoyl dehydrogenase 1318 1001 gene locus_tag LOCUS_16960 1318 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1401 2582 gene locus_tag LOCUS_16970 gene sucC 1401 2582 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439496.1 protein_id gnl|my_center|LOCUS_16970 2616 3629 gene locus_tag LOCUS_16980 gene sucD 2616 3629 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_16980 4078 4509 gene locus_tag LOCUS_16990 4078 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 4472 5830 gene locus_tag LOCUS_17000 4472 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 6009 7688 gene locus_tag LOCUS_17010 6009 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 8181 9677 gene locus_tag LOCUS_17020 8181 9677 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence0153 1534 443 gene locus_tag LOCUS_17030 1534 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2569 1733 gene locus_tag LOCUS_17040 2569 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence0154 435 734 gene locus_tag LOCUS_17050 435 734 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 protein_id gnl|my_center|LOCUS_17050 1618 797 gene locus_tag LOCUS_17060 1618 797 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213084.1 protein_id gnl|my_center|LOCUS_17060 3135 1624 gene locus_tag LOCUS_17070 3135 1624 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889049.1 protein_id gnl|my_center|LOCUS_17070 6194 3759 gene locus_tag LOCUS_17080 6194 3759 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_17080 6891 6196 gene locus_tag LOCUS_17090 6891 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 7053 6895 gene locus_tag LOCUS_17100 7053 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 8467 7031 gene locus_tag LOCUS_17110 gene ccoG 8467 7031 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_17110 9043 8471 gene locus_tag LOCUS_17120 9043 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 9215 9021 gene locus_tag LOCUS_17130 9215 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence0155 570 764 gene locus_tag LOCUS_17140 570 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 995 1612 gene locus_tag LOCUS_17150 995 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1609 2421 gene locus_tag LOCUS_17160 1609 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2408 2962 gene locus_tag LOCUS_17170 2408 2962 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_17170 2978 6400 gene locus_tag LOCUS_17180 gene brxC 2978 6400 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_17180 6415 8088 gene locus_tag LOCUS_17190 6415 8088 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151448733.1 protein_id gnl|my_center|LOCUS_17190 8501 8235 gene locus_tag LOCUS_17200 8501 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence0156 896 1255 gene locus_tag LOCUS_17210 896 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1354 3909 gene locus_tag LOCUS_17220 gene secD 1354 3909 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172795.1 protein_id gnl|my_center|LOCUS_17220 4006 5727 gene locus_tag LOCUS_17230 gene recJ 4006 5727 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_17230 5926 7011 gene locus_tag LOCUS_17240 gene aroB 5926 7011 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_17240 7115 7744 gene locus_tag LOCUS_17250 7115 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 7751 8515 gene locus_tag LOCUS_17260 gene lpxA 7751 8515 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384338.1 protein_id gnl|my_center|LOCUS_17260 8505 9428 gene locus_tag LOCUS_17270 gene pdxA 8505 9428 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384456.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence0157 <1 1166 gene locus_tag LOCUS_17280 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918997.1:TonB-dependent receptor 1172 2767 gene locus_tag LOCUS_17290 1172 2767 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339980.1 protein_id gnl|my_center|LOCUS_17290 2777 5647 gene locus_tag LOCUS_17300 2777 5647 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_17300 5647 6549 gene locus_tag LOCUS_17310 5647 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 6663 7340 gene locus_tag LOCUS_17320 6663 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 8187 7417 gene locus_tag LOCUS_17330 8187 7417 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_17330 <9628 8184 gene locus_tag LOCUS_17340 <9628 8184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839725.1:histidine kinase >Feature sequence0158 1451 3904 gene locus_tag LOCUS_17350 1451 3904 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_17350 3922 4857 gene locus_tag LOCUS_17360 3922 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4879 6711 gene locus_tag LOCUS_17370 4879 6711 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085949.1 protein_id gnl|my_center|LOCUS_17370 6822 9227 gene locus_tag LOCUS_17380 6822 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence0159 2078 2620 gene locus_tag LOCUS_17390 2078 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4153 2819 gene locus_tag LOCUS_17400 4153 2819 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035678.1 protein_id gnl|my_center|LOCUS_17400 4759 4214 gene locus_tag LOCUS_17410 4759 4214 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109429.1 protein_id gnl|my_center|LOCUS_17410 5605 4817 gene locus_tag LOCUS_17420 gene lpxA 5605 4817 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_17420 6938 5610 gene locus_tag LOCUS_17430 6938 5610 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_17430 7013 7636 gene locus_tag LOCUS_17440 gene efp 7013 7636 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258741.1 protein_id gnl|my_center|LOCUS_17440 8371 7724 gene locus_tag LOCUS_17450 gene can 8371 7724 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_17450 9417 8695 gene locus_tag LOCUS_17460 9417 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence0160 <1 786 gene locus_tag LOCUS_17470 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403101.1:cbb3-type cytochrome c oxidase subunit I 786 1439 gene locus_tag LOCUS_17480 786 1439 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403102.1 protein_id gnl|my_center|LOCUS_17480 1436 2101 gene locus_tag LOCUS_17490 1436 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3199 2201 gene locus_tag LOCUS_17500 gene rfaD 3199 2201 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_17500 4013 3207 gene locus_tag LOCUS_17510 gene proC 4013 3207 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275316.1 protein_id gnl|my_center|LOCUS_17510 4254 4036 gene locus_tag LOCUS_17520 4254 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 5137 4256 gene locus_tag LOCUS_17530 gene folD 5137 4256 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_17530 6023 5190 gene locus_tag LOCUS_17540 6023 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6822 6013 gene locus_tag LOCUS_17550 6822 6013 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227785.1 protein_id gnl|my_center|LOCUS_17550 6929 8098 gene locus_tag LOCUS_17560 6929 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 8169 8918 gene locus_tag LOCUS_17570 gene fabG 8169 8918 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_17570 8959 9222 gene locus_tag LOCUS_17580 gene acpP 8959 9222 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence0161 5136 1918 gene locus_tag LOCUS_17590 5136 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 5460 6221 gene locus_tag LOCUS_17600 5460 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 7599 6373 gene locus_tag LOCUS_17610 7599 6373 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence0162 <1 1823 gene locus_tag LOCUS_17620 <1 1823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071943.1:TonB-dependent receptor 1880 3112 gene locus_tag LOCUS_17630 1880 3112 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434862.1 protein_id gnl|my_center|LOCUS_17630 3495 4808 gene locus_tag LOCUS_17640 3495 4808 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_17640 4805 6832 gene locus_tag LOCUS_17650 4805 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence0163 <1 1407 gene locus_tag LOCUS_17660 <1 1407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein 5519 1851 gene locus_tag LOCUS_17670 5519 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 7183 5606 gene locus_tag LOCUS_17680 7183 5606 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927177.1 protein_id gnl|my_center|LOCUS_17680 7425 8996 gene locus_tag LOCUS_17690 7425 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence0164 786 196 gene locus_tag LOCUS_17700 786 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 844 1062 gene locus_tag LOCUS_17710 844 1062 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227795.1 protein_id gnl|my_center|LOCUS_17710 1059 1274 gene locus_tag LOCUS_17720 1059 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1398 1667 gene locus_tag LOCUS_17730 1398 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2472 1741 gene locus_tag LOCUS_17740 2472 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2693 5521 gene locus_tag LOCUS_17750 2693 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 7119 5692 gene locus_tag LOCUS_17760 7119 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 8192 7437 gene locus_tag LOCUS_17770 8192 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 8668 8594 gene locus_tag LOCUS_t00090 8668 8594 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9225 8965 gene locus_tag LOCUS_17780 9225 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence0165 1165 113 gene locus_tag LOCUS_17790 1165 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1336 2130 gene locus_tag LOCUS_17800 1336 2130 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_17800 2534 2461 gene locus_tag LOCUS_t00100 2534 2461 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3272 2667 gene locus_tag LOCUS_17810 gene recR 3272 2667 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_17810 3600 3292 gene locus_tag LOCUS_17820 3600 3292 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_17820 4552 3653 gene locus_tag LOCUS_17830 4552 3653 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_17830 4984 4673 gene locus_tag LOCUS_17840 4984 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 5093 6493 gene locus_tag LOCUS_17850 gene lpdA 5093 6493 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227834.1 protein_id gnl|my_center|LOCUS_17850 7377 6652 gene locus_tag LOCUS_17860 gene hisA 7377 6652 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461460.1 protein_id gnl|my_center|LOCUS_17860 7426 8499 gene locus_tag LOCUS_17870 7426 8499 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence0166 1291 3969 gene locus_tag LOCUS_17880 1291 3969 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 protein_id gnl|my_center|LOCUS_17880 3991 5655 gene locus_tag LOCUS_17890 3991 5655 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_17890 5666 7249 gene locus_tag LOCUS_17900 5666 7249 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_17900 7298 8938 gene locus_tag LOCUS_17910 7298 8938 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence0167 579 1460 gene locus_tag LOCUS_17920 gene atpG 579 1460 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457304.1 protein_id gnl|my_center|LOCUS_17920 1508 2929 gene locus_tag LOCUS_17930 gene atpD 1508 2929 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938076.1 protein_id gnl|my_center|LOCUS_17930 2936 3343 gene locus_tag LOCUS_17940 gene atpC 2936 3343 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056376.1 protein_id gnl|my_center|LOCUS_17940 3439 3690 gene locus_tag LOCUS_17950 3439 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3699 3938 gene locus_tag LOCUS_17960 3699 3938 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933404.1 protein_id gnl|my_center|LOCUS_17960 3957 6080 gene locus_tag LOCUS_17970 gene feoB 3957 6080 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249665.1 protein_id gnl|my_center|LOCUS_17970 6088 6246 gene locus_tag LOCUS_17980 6088 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 6324 7157 gene locus_tag LOCUS_17990 gene nagB 6324 7157 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_17990 8769 7264 gene locus_tag LOCUS_18000 gene gndA 8769 7264 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence0168 <1 1949 gene locus_tag LOCUS_18010 <1 1949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000819015.1:DEAD/DEAH box helicase family protein 2846 2004 gene locus_tag LOCUS_18020 2846 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 6251 3045 gene locus_tag LOCUS_18030 6251 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 7647 6343 gene locus_tag LOCUS_18040 7647 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 <9216 7728 gene locus_tag LOCUS_18050 <9216 7728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120624.1:alkaline phosphatase D family protein >Feature sequence0169 <1 910 gene locus_tag LOCUS_18060 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122544.1:ThuA domain-containing protein 1793 4225 gene locus_tag LOCUS_18070 1793 4225 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_18070 4240 5538 gene locus_tag LOCUS_18080 4240 5538 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_18080 6013 5714 gene locus_tag LOCUS_18090 6013 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 6278 6496 gene locus_tag LOCUS_18100 6278 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 6545 6829 gene locus_tag LOCUS_18110 6545 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 6951 7148 gene locus_tag LOCUS_18120 6951 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 7335 7799 gene locus_tag LOCUS_18130 7335 7799 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_18130 7845 8177 gene locus_tag LOCUS_18140 7845 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 8206 9057 gene locus_tag LOCUS_18150 8206 9057 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence0170 380 805 gene locus_tag LOCUS_18160 380 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1003 2931 gene locus_tag LOCUS_18170 1003 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2928 3140 gene locus_tag LOCUS_18180 2928 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3276 3647 gene locus_tag LOCUS_18190 3276 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3742 5229 gene locus_tag LOCUS_18200 3742 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 5226 6575 gene locus_tag LOCUS_18210 5226 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 6572 6994 gene locus_tag LOCUS_18220 6572 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 7117 7968 gene locus_tag LOCUS_18230 7117 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence0171 2836 38 gene locus_tag LOCUS_18240 2836 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3051 2902 gene locus_tag LOCUS_18250 3051 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 6076 3251 gene locus_tag LOCUS_18260 6076 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 <9145 6212 gene locus_tag LOCUS_18270 <9145 6212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167395505.1:TonB-dependent siderophore receptor >Feature sequence0172 291 3452 gene locus_tag LOCUS_18280 291 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3581 3745 gene locus_tag LOCUS_18290 3581 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 3755 4231 gene locus_tag LOCUS_18300 3755 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4487 5911 gene locus_tag LOCUS_18310 4487 5911 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_18310 6201 5890 gene locus_tag LOCUS_18320 6201 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 6639 6226 gene locus_tag LOCUS_18330 6639 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 7063 6743 gene locus_tag LOCUS_18340 7063 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 8733 7111 gene locus_tag LOCUS_18350 8733 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence0173 1063 80 gene locus_tag LOCUS_18360 1063 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2124 1075 gene locus_tag LOCUS_18370 2124 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3276 2224 gene locus_tag LOCUS_18380 3276 2224 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807348.1 protein_id gnl|my_center|LOCUS_18380 5993 3273 gene locus_tag LOCUS_18390 5993 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7264 6014 gene locus_tag LOCUS_18400 7264 6014 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_18400 8160 7261 gene locus_tag LOCUS_18410 8160 7261 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064999.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence0174 2625 790 gene locus_tag LOCUS_18420 2625 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 4661 2637 gene locus_tag LOCUS_18430 4661 2637 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615420.1 protein_id gnl|my_center|LOCUS_18430 6192 4729 gene locus_tag LOCUS_18440 6192 4729 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117864.1 protein_id gnl|my_center|LOCUS_18440 9109 6215 gene locus_tag LOCUS_18450 9109 6215 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108585.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence0175 389 1114 gene locus_tag LOCUS_18460 gene gspJ 389 1114 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082782.1 protein_id gnl|my_center|LOCUS_18460 1111 2556 gene locus_tag LOCUS_18470 1111 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2553 3968 gene locus_tag LOCUS_18480 2553 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3965 4510 gene locus_tag LOCUS_18490 3965 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 4507 5163 gene locus_tag LOCUS_18500 4507 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 5160 6377 gene locus_tag LOCUS_18510 5160 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 6415 7569 gene locus_tag LOCUS_18520 6415 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence0176 619 35 gene locus_tag LOCUS_18530 619 35 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957728.1 protein_id gnl|my_center|LOCUS_18530 1376 738 gene locus_tag LOCUS_18540 1376 738 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 protein_id gnl|my_center|LOCUS_18540 2091 1363 gene locus_tag LOCUS_18550 2091 1363 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_18550 3176 2193 gene locus_tag LOCUS_18560 3176 2193 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_18560 4321 3296 gene locus_tag LOCUS_18570 4321 3296 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_18570 4504 6837 gene locus_tag LOCUS_18580 4504 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 6839 7264 gene locus_tag LOCUS_18590 6839 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 8156 7290 gene locus_tag LOCUS_18600 8156 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 8589 8230 gene locus_tag LOCUS_18610 8589 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence0177 4876 1769 gene locus_tag LOCUS_18620 4876 1769 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267713.1 protein_id gnl|my_center|LOCUS_18620 6114 4876 gene locus_tag LOCUS_18630 6114 4876 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_18630 7134 6241 gene locus_tag LOCUS_18640 7134 6241 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_18640 8153 7128 gene locus_tag LOCUS_18650 8153 7128 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_18650 8976 8164 gene locus_tag LOCUS_18660 8976 8164 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence0178 647 267 gene locus_tag LOCUS_18670 gene rpsL 647 267 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118744.1 protein_id gnl|my_center|LOCUS_18670 2843 1170 gene locus_tag LOCUS_18680 2843 1170 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 protein_id gnl|my_center|LOCUS_18680 2993 4570 gene locus_tag LOCUS_18690 gene phoD 2993 4570 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_18690 4907 4710 gene locus_tag LOCUS_18700 4907 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4994 6451 gene locus_tag LOCUS_18710 4994 6451 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_18710 6448 7257 gene locus_tag LOCUS_18720 6448 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18720 >Feature sequence0179 2 1081 gene locus_tag LOCUS_18730 2 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1774 1106 gene locus_tag LOCUS_18740 1774 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2425 1943 gene locus_tag LOCUS_18750 2425 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_18750 3791 2745 gene locus_tag LOCUS_18760 3791 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3853 4626 gene locus_tag LOCUS_18770 3853 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4743 5360 gene locus_tag LOCUS_18780 4743 5360 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_18780 5379 6299 gene locus_tag LOCUS_18790 5379 6299 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_18790 6991 7653 gene locus_tag LOCUS_18800 6991 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 8235 8310 gene locus_tag LOCUS_t00110 8235 8310 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8388 8888 gene locus_tag LOCUS_18810 8388 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence0180 4969 5448 gene locus_tag LOCUS_18820 4969 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 5451 6278 gene locus_tag LOCUS_18830 5451 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 6268 6822 gene locus_tag LOCUS_18840 6268 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence0181 1017 283 gene locus_tag LOCUS_18850 1017 283 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_18850 2296 1028 gene locus_tag LOCUS_18860 2296 1028 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_18860 2599 2300 gene locus_tag LOCUS_18870 2599 2300 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140171.1 protein_id gnl|my_center|LOCUS_18870 2769 2584 gene locus_tag LOCUS_18880 2769 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 4565 2817 gene locus_tag LOCUS_18890 4565 2817 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_18890 6652 4592 gene locus_tag LOCUS_18900 gene gspD 6652 4592 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498847.1 protein_id gnl|my_center|LOCUS_18900 6975 8105 gene locus_tag LOCUS_18910 gene aroC 6975 8105 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_18910 8112 8861 gene locus_tag LOCUS_18920 8112 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence0182 95 337 gene locus_tag LOCUS_18930 95 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 600 382 gene locus_tag LOCUS_18940 600 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 481 786 gene locus_tag LOCUS_18950 481 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 915 1241 gene locus_tag LOCUS_18960 915 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1721 1287 gene locus_tag LOCUS_18970 1721 1287 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_18970 2705 1815 gene locus_tag LOCUS_18980 gene cyoE 2705 1815 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_18980 3553 2702 gene locus_tag LOCUS_18990 3553 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 3853 4728 gene locus_tag LOCUS_19000 3853 4728 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_19000 4725 5711 gene locus_tag LOCUS_19010 4725 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 6599 5829 gene locus_tag LOCUS_19020 6599 5829 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_19020 7090 6860 gene locus_tag LOCUS_19030 7090 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 6972 7727 gene locus_tag LOCUS_19040 6972 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 7825 8382 gene locus_tag LOCUS_19050 7825 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19050 >Feature sequence0183 1129 110 gene locus_tag LOCUS_19060 1129 110 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_19060 1775 1272 gene locus_tag LOCUS_19070 1775 1272 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_19070 2035 2688 gene locus_tag LOCUS_19080 2035 2688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_19080 2701 4029 gene locus_tag LOCUS_19090 gene fabF 2701 4029 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_19090 4047 4481 gene locus_tag LOCUS_19100 4047 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 4630 4911 gene locus_tag LOCUS_19110 4630 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 4968 5963 gene locus_tag LOCUS_19120 4968 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 8778 5953 gene locus_tag LOCUS_19130 8778 5953 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence0184 728 216 gene locus_tag LOCUS_19140 gene bcp 728 216 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_19140 2507 819 gene locus_tag LOCUS_19150 gene muiA 2507 819 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_19150 2710 8703 gene locus_tag LOCUS_19160 2710 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence0185 1115 2032 gene locus_tag LOCUS_19170 1115 2032 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083339.1 protein_id gnl|my_center|LOCUS_19170 2116 2952 gene locus_tag LOCUS_19180 2116 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 3072 4664 gene locus_tag LOCUS_19190 3072 4664 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539579.1 protein_id gnl|my_center|LOCUS_19190 4910 5116 gene locus_tag LOCUS_19200 4910 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5267 7177 gene locus_tag LOCUS_19210 gene yagF 5267 7177 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_19210 7269 8564 gene locus_tag LOCUS_19220 7269 8564 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence0186 123 1718 gene locus_tag LOCUS_19230 123 1718 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_19230 1719 3119 gene locus_tag LOCUS_19240 gene murF 1719 3119 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337237.1 protein_id gnl|my_center|LOCUS_19240 3113 4240 gene locus_tag LOCUS_19250 gene mraY 3113 4240 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707583.1 protein_id gnl|my_center|LOCUS_19250 4427 5338 gene locus_tag LOCUS_19260 4427 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5407 5946 gene locus_tag LOCUS_19270 5407 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19270 5959 6525 gene locus_tag LOCUS_19280 5959 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19280 6522 7649 gene locus_tag LOCUS_19290 gene murG 6522 7649 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766568.1 protein_id gnl|my_center|LOCUS_19290 7646 8629 gene locus_tag LOCUS_19300 gene murB 7646 8629 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence0187 <1 2155 gene locus_tag LOCUS_19310 <1 2155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257687.1:type I restriction endonuclease subunit R 2672 2599 gene locus_tag LOCUS_t00120 2672 2599 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6128 2772 gene locus_tag LOCUS_19320 6128 2772 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_19320 6966 6208 gene locus_tag LOCUS_19330 6966 6208 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812139.1 protein_id gnl|my_center|LOCUS_19330 7364 8104 gene locus_tag LOCUS_19340 7364 8104 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680775.1 protein_id gnl|my_center|LOCUS_19340 <8871 8197 gene locus_tag LOCUS_19350 <8871 8197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767327.1:sulfatase >Feature sequence0188 105 428 gene locus_tag LOCUS_19360 105 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2091 640 gene locus_tag LOCUS_19370 2091 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2980 2162 gene locus_tag LOCUS_19380 2980 2162 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640272.1 protein_id gnl|my_center|LOCUS_19380 4490 3411 gene locus_tag LOCUS_19390 4490 3411 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921628.1 protein_id gnl|my_center|LOCUS_19390 5964 4621 gene locus_tag LOCUS_19400 5964 4621 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_19400 6147 7289 gene locus_tag LOCUS_19410 6147 7289 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_19410 7360 7566 gene locus_tag LOCUS_19420 7360 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19420 7660 7992 gene locus_tag LOCUS_19430 7660 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence0189 600 7 gene locus_tag LOCUS_19440 gene def 600 7 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124236.1 protein_id gnl|my_center|LOCUS_19440 663 2327 gene locus_tag LOCUS_19450 663 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2324 3751 gene locus_tag LOCUS_19460 2324 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4675 3947 gene locus_tag LOCUS_19470 4675 3947 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_19470 4556 4771 gene locus_tag LOCUS_19480 4556 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 6070 4871 gene locus_tag LOCUS_19490 6070 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5954 6181 gene locus_tag LOCUS_19500 5954 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 6186 7409 gene locus_tag LOCUS_19510 6186 7409 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_19510 8662 7484 gene locus_tag LOCUS_19520 8662 7484 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176146113.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence0190 1991 87 gene locus_tag LOCUS_19530 1991 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2307 2062 gene locus_tag LOCUS_19540 2307 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3849 2413 gene locus_tag LOCUS_19550 3849 2413 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_19550 7280 3894 gene locus_tag LOCUS_19560 7280 3894 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032613447.1 protein_id gnl|my_center|LOCUS_19560 8283 7381 gene locus_tag LOCUS_19570 8283 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 <8792 8286 gene locus_tag LOCUS_19580 <8792 8286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259574.1:sigma-70 family RNA polymerase sigma factor >Feature sequence0191 4248 2803 gene locus_tag LOCUS_19590 4248 2803 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_19590 6943 4283 gene locus_tag LOCUS_19600 6943 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 7601 8410 gene locus_tag LOCUS_19610 gene trpA 7601 8410 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318459.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence0192 333 142 gene locus_tag LOCUS_19620 333 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 518 949 gene locus_tag LOCUS_19630 518 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 939 1244 gene locus_tag LOCUS_19640 939 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1754 2632 gene locus_tag LOCUS_19650 gene metF 1754 2632 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_19650 3382 2819 gene locus_tag LOCUS_19660 3382 2819 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037712.1 protein_id gnl|my_center|LOCUS_19660 4015 3566 gene locus_tag LOCUS_19670 4015 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4291 4019 gene locus_tag LOCUS_19680 4291 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4445 7255 gene locus_tag LOCUS_19690 4445 7255 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_19690 7345 8547 gene locus_tag LOCUS_19700 gene odhB 7345 8547 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence0193 <1 863 gene locus_tag LOCUS_19710 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146457347.1:sulfatase-like hydrolase/transferase 863 2080 gene locus_tag LOCUS_19720 863 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 3612 2278 gene locus_tag LOCUS_19730 3612 2278 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_19730 3854 5290 gene locus_tag LOCUS_19740 3854 5290 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_19740 5367 6941 gene locus_tag LOCUS_19750 5367 6941 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_19750 6960 7883 gene locus_tag LOCUS_19760 6960 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 7989 8441 gene locus_tag LOCUS_19770 7989 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence0194 <1 1458 gene locus_tag LOCUS_19780 <1 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118122.1:PSD1 and planctomycete cytochrome C domain-containing protein 1463 2833 gene locus_tag LOCUS_19790 1463 2833 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_19790 2929 4170 gene locus_tag LOCUS_19800 2929 4170 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_19800 4483 4271 gene locus_tag LOCUS_19810 4483 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 4373 5254 gene locus_tag LOCUS_19820 4373 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 6402 5248 gene locus_tag LOCUS_19830 6402 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence0195 221 724 gene locus_tag LOCUS_19840 221 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1942 782 gene locus_tag LOCUS_19850 gene pelA 1942 782 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_19850 2669 2121 gene locus_tag LOCUS_19860 2669 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3675 2740 gene locus_tag LOCUS_19870 3675 2740 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_19870 3964 6294 gene locus_tag LOCUS_19880 3964 6294 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932043.1 protein_id gnl|my_center|LOCUS_19880 6530 6823 gene locus_tag LOCUS_19890 6530 6823 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_19890 6838 7263 gene locus_tag LOCUS_19900 6838 7263 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_19900 7865 7635 gene locus_tag LOCUS_19910 7865 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 8095 8430 gene locus_tag LOCUS_19920 8095 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence0196 <1 805 gene locus_tag LOCUS_19930 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922709.1:sulfatase 844 2187 gene locus_tag LOCUS_19940 844 2187 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_19940 3772 2600 gene locus_tag LOCUS_19950 3772 2600 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_19950 3981 4466 gene locus_tag LOCUS_19960 3981 4466 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268368.1 protein_id gnl|my_center|LOCUS_19960 5067 4840 gene locus_tag LOCUS_19970 5067 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 5756 6835 gene locus_tag LOCUS_19980 gene rsmH 5756 6835 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_19980 7714 6839 gene locus_tag LOCUS_19990 7714 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 <8577 7911 gene locus_tag LOCUS_20000 <8577 7911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_078324130.1:ABC transporter ATP-binding protein >Feature sequence0197 1576 1031 gene locus_tag LOCUS_20010 1576 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1803 4565 gene locus_tag LOCUS_20020 1803 4565 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275339.1 protein_id gnl|my_center|LOCUS_20020 7214 5112 gene locus_tag LOCUS_20030 7214 5112 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence0198 75 1313 gene locus_tag LOCUS_20040 75 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1310 3415 gene locus_tag LOCUS_20050 1310 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3463 3693 gene locus_tag LOCUS_20060 3463 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4313 3846 gene locus_tag LOCUS_20070 gene hisI 4313 3846 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_20070 4730 4431 gene locus_tag LOCUS_20080 4730 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 5691 4843 gene locus_tag LOCUS_20090 5691 4843 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072167.1 protein_id gnl|my_center|LOCUS_20090 6389 5688 gene locus_tag LOCUS_20100 6389 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 7867 6386 gene locus_tag LOCUS_20110 7867 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 7966 8169 gene locus_tag LOCUS_20120 7966 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 8166 8486 gene locus_tag LOCUS_20130 8166 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence0199 1444 2199 gene locus_tag LOCUS_20140 1444 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2485 5847 gene locus_tag LOCUS_20150 2485 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 6326 8527 gene locus_tag LOCUS_20160 6326 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence0200 962 510 gene locus_tag LOCUS_20170 962 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2206 959 gene locus_tag LOCUS_20180 2206 959 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_20180 2696 2376 gene locus_tag LOCUS_20190 2696 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 4115 2913 gene locus_tag LOCUS_20200 4115 2913 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184299.1 protein_id gnl|my_center|LOCUS_20200 4361 4128 gene locus_tag LOCUS_20210 4361 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 4990 4358 gene locus_tag LOCUS_20220 4990 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 5433 4987 gene locus_tag LOCUS_20230 5433 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 5699 5430 gene locus_tag LOCUS_20240 5699 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 6147 5704 gene locus_tag LOCUS_20250 6147 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 6450 6160 gene locus_tag LOCUS_20260 6450 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 7175 6447 gene locus_tag LOCUS_20270 7175 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 7942 7172 gene locus_tag LOCUS_20280 7942 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 8413 7958 gene locus_tag LOCUS_20290 8413 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence0201 <1 665 gene locus_tag LOCUS_20300 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036182.1:Bax inhibitor-1/YccA family protein 2241 781 gene locus_tag LOCUS_20310 gene dacB 2241 781 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_20310 2498 2869 gene locus_tag LOCUS_20320 2498 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 3828 2980 gene locus_tag LOCUS_20330 3828 2980 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216809.1 protein_id gnl|my_center|LOCUS_20330 4068 5639 gene locus_tag LOCUS_20340 4068 5639 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_20340 5768 8302 gene locus_tag LOCUS_20350 5768 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence0202 632 33 gene locus_tag LOCUS_20360 gene yihA 632 33 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765852.1 protein_id gnl|my_center|LOCUS_20360 743 2821 gene locus_tag LOCUS_20370 743 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 3561 2956 gene locus_tag LOCUS_20380 3561 2956 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383266.1 protein_id gnl|my_center|LOCUS_20380 5279 3558 gene locus_tag LOCUS_20390 5279 3558 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_20390 8256 5416 gene locus_tag LOCUS_20400 8256 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence0203 194 1048 gene locus_tag LOCUS_20410 194 1048 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_20410 1099 2070 gene locus_tag LOCUS_20420 1099 2070 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_20420 2143 3441 gene locus_tag LOCUS_20430 2143 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 3438 5717 gene locus_tag LOCUS_20440 3438 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 5759 5974 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttgtcacgtattacgtgacaa 8008 6023 gene locus_tag LOCUS_20450 gene mrdA 8008 6023 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence0204 3117 826 gene locus_tag LOCUS_20460 3117 826 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615857.1 protein_id gnl|my_center|LOCUS_20460 5322 3217 gene locus_tag LOCUS_20470 5322 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 5692 5531 gene locus_tag LOCUS_20480 5692 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 6049 7491 gene locus_tag LOCUS_20490 6049 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 7494 8156 gene locus_tag LOCUS_20500 7494 8156 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence0205 46 1590 gene locus_tag LOCUS_20510 gene typA 46 1590 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_20510 2743 1739 gene locus_tag LOCUS_20520 2743 1739 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_20520 3855 2860 gene locus_tag LOCUS_20530 3855 2860 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399251.1 protein_id gnl|my_center|LOCUS_20530 3897 4466 gene locus_tag LOCUS_20540 3897 4466 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_20540 5342 4692 gene locus_tag LOCUS_20550 5342 4692 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_20550 6449 5442 gene locus_tag LOCUS_20560 6449 5442 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266539.1 protein_id gnl|my_center|LOCUS_20560 8056 6446 gene locus_tag LOCUS_20570 gene murJ 8056 6446 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383073.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence0206 1188 2786 gene locus_tag LOCUS_20580 1188 2786 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_20580 2825 4297 gene locus_tag LOCUS_20590 2825 4297 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_20590 4297 5736 gene locus_tag LOCUS_20600 4297 5736 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_20600 5750 5935 gene locus_tag LOCUS_20610 5750 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 7304 5943 gene locus_tag LOCUS_20620 7304 5943 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 protein_id gnl|my_center|LOCUS_20620 8042 7329 gene locus_tag LOCUS_20630 8042 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence0207 <1 778 gene locus_tag LOCUS_20640 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921592.1:PQQ-like beta-propeller repeat protein 1026 796 gene locus_tag LOCUS_20650 1026 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1001 2224 gene locus_tag LOCUS_20660 1001 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2279 2593 gene locus_tag LOCUS_20670 2279 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 3968 2877 gene locus_tag LOCUS_20680 3968 2877 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229212.1 protein_id gnl|my_center|LOCUS_20680 5048 4068 gene locus_tag LOCUS_20690 5048 4068 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_20690 5170 6606 gene locus_tag LOCUS_20700 5170 6606 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence0208 1412 147 gene locus_tag LOCUS_20710 1412 147 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_20710 1645 2649 gene locus_tag LOCUS_20720 1645 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117899.1 protein_id gnl|my_center|LOCUS_20720 3026 6208 gene locus_tag LOCUS_20730 3026 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence0209 2707 3171 gene locus_tag LOCUS_20740 2707 3171 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626366.1 protein_id gnl|my_center|LOCUS_20740 3184 4254 gene locus_tag LOCUS_20750 3184 4254 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082671.1 protein_id gnl|my_center|LOCUS_20750 4345 7677 gene locus_tag LOCUS_20760 4345 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence0210 722 39 gene locus_tag LOCUS_20770 gene lolD 722 39 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_20770 2002 770 gene locus_tag LOCUS_20780 2002 770 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_20780 3611 2094 gene locus_tag LOCUS_20790 gene lysS 3611 2094 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296055.1 protein_id gnl|my_center|LOCUS_20790 3985 4881 gene locus_tag LOCUS_20800 gene lipA 3985 4881 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_20800 5068 5949 gene locus_tag LOCUS_20810 gene elyC 5068 5949 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704890.1 protein_id gnl|my_center|LOCUS_20810 6188 7222 gene locus_tag LOCUS_20820 6188 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 <8200 7264 gene locus_tag LOCUS_20830 <8200 7264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232504.1:sporulation two-component system sensor histidine kinase KinE >Feature sequence0211 2855 4342 gene locus_tag LOCUS_20840 2855 4342 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669321.1 protein_id gnl|my_center|LOCUS_20840 4711 6348 gene locus_tag LOCUS_20850 4711 6348 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_20850 6626 7498 gene locus_tag LOCUS_20860 6626 7498 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201924.1 protein_id gnl|my_center|LOCUS_20860 7578 8027 gene locus_tag LOCUS_20870 7578 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence0212 1280 2314 gene locus_tag LOCUS_20880 1280 2314 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_20880 2645 4663 gene locus_tag LOCUS_20890 2645 4663 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072120.1 protein_id gnl|my_center|LOCUS_20890 5020 5937 gene locus_tag LOCUS_20900 5020 5937 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_20900 6040 7917 gene locus_tag LOCUS_20910 6040 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence0213 105 1400 gene locus_tag LOCUS_20920 105 1400 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_20920 1414 1866 gene locus_tag LOCUS_20930 gene ybgC 1414 1866 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378990.1 protein_id gnl|my_center|LOCUS_20930 2001 2522 gene locus_tag LOCUS_20940 2001 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2532 3782 gene locus_tag LOCUS_20950 2532 3782 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_20950 3925 4596 gene locus_tag LOCUS_20960 3925 4596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_20960 4619 7915 gene locus_tag LOCUS_20970 4619 7915 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence0214 <1 2800 gene locus_tag LOCUS_20980 <1 2800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921683.1:FG-GAP-like repeat-containing protein 2856 5765 gene locus_tag LOCUS_20990 2856 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 5788 6909 gene locus_tag LOCUS_21000 5788 6909 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_21000 6977 7507 gene locus_tag LOCUS_21010 6977 7507 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036240.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence0215 336 719 gene locus_tag LOCUS_21020 336 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1245 1042 gene locus_tag LOCUS_21030 1245 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1229 2419 gene locus_tag LOCUS_21040 1229 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2758 4044 gene locus_tag LOCUS_21050 2758 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 4041 6473 gene locus_tag LOCUS_21060 4041 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 6609 7748 gene locus_tag LOCUS_21070 6609 7748 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence0216 156 2729 gene locus_tag LOCUS_21080 156 2729 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_21080 2726 3508 gene locus_tag LOCUS_21090 2726 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 3555 3797 gene locus_tag LOCUS_21100 3555 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 4722 3883 gene locus_tag LOCUS_21110 4722 3883 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_21110 5495 4719 gene locus_tag LOCUS_21120 5495 4719 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_21120 6324 5497 gene locus_tag LOCUS_21130 6324 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 6859 6329 gene locus_tag LOCUS_21140 6859 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 7833 6856 gene locus_tag LOCUS_21150 7833 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence0217 <1 806 gene locus_tag LOCUS_21160 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942545.1:ABC transporter permease 809 1612 gene locus_tag LOCUS_21170 809 1612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914047.1 protein_id gnl|my_center|LOCUS_21170 1617 2615 gene locus_tag LOCUS_21180 1617 2615 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_21180 4124 2898 gene locus_tag LOCUS_21190 4124 2898 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_21190 6646 4313 gene locus_tag LOCUS_21200 6646 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 7985 6660 gene locus_tag LOCUS_21210 7985 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence0218 2111 1863 gene locus_tag LOCUS_21220 2111 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3567 2392 gene locus_tag LOCUS_21230 3567 2392 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_21230 3798 3580 gene locus_tag LOCUS_21240 3798 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 4387 5286 gene locus_tag LOCUS_21250 4387 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 5630 5785 gene locus_tag LOCUS_21260 5630 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 7844 5997 gene locus_tag LOCUS_21270 7844 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence0219 <1 651 gene locus_tag LOCUS_21280 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038818.1:SPFH domain-containing protein 599 1477 gene locus_tag LOCUS_21290 599 1477 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646942.1 protein_id gnl|my_center|LOCUS_21290 1474 1671 gene locus_tag LOCUS_21300 1474 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1838 2107 gene locus_tag LOCUS_21310 1838 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21310 2162 2407 gene locus_tag LOCUS_21320 2162 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21320 2450 2593 gene locus_tag LOCUS_21330 2450 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21330 3851 2652 gene locus_tag LOCUS_21340 3851 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 4029 5237 gene locus_tag LOCUS_21350 4029 5237 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_21350 5974 5282 gene locus_tag LOCUS_21360 5974 5282 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21360 6210 6001 gene locus_tag LOCUS_21370 6210 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 6646 6251 gene locus_tag LOCUS_21380 6646 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 6567 7418 gene locus_tag LOCUS_21390 6567 7418 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640183.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence0220 1538 2800 gene locus_tag LOCUS_21400 1538 2800 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_21400 3106 4155 gene locus_tag LOCUS_21410 3106 4155 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_21410 4254 4691 gene locus_tag LOCUS_21420 4254 4691 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969470.1 protein_id gnl|my_center|LOCUS_21420 4688 5992 gene locus_tag LOCUS_21430 4688 5992 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919324.1 protein_id gnl|my_center|LOCUS_21430 7365 6241 gene locus_tag LOCUS_21440 7365 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence0221 3481 77 gene locus_tag LOCUS_21450 3481 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 7351 3920 gene locus_tag LOCUS_21460 7351 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence0222 794 2026 gene locus_tag LOCUS_21470 794 2026 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_21470 2546 2277 gene locus_tag LOCUS_21480 2546 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 3023 2613 gene locus_tag LOCUS_21490 3023 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3555 2998 gene locus_tag LOCUS_21500 3555 2998 CDS product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958464.1 protein_id gnl|my_center|LOCUS_21500 4138 3815 gene locus_tag LOCUS_21510 4138 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 4322 4549 gene locus_tag LOCUS_21520 4322 4549 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_21520 4546 4875 gene locus_tag LOCUS_21530 4546 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 5372 5148 gene locus_tag LOCUS_21540 5372 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 5715 5320 gene locus_tag LOCUS_21550 5715 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 5930 5712 gene locus_tag LOCUS_21560 5930 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 6201 5962 gene locus_tag LOCUS_21570 6201 5962 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_21570 6338 7663 gene locus_tag LOCUS_21580 6338 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118655.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence0223 4129 2906 gene locus_tag LOCUS_21590 4129 2906 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_21590 7509 4150 gene locus_tag LOCUS_21600 7509 4150 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence0224 2752 899 gene locus_tag LOCUS_21610 2752 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2969 5350 gene locus_tag LOCUS_21620 2969 5350 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_21620 5652 6500 gene locus_tag LOCUS_21630 5652 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence0225 <1 940 gene locus_tag LOCUS_21640 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121616.1:sulfatase-like hydrolase/transferase 1148 2626 gene locus_tag LOCUS_21650 1148 2626 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_21650 2708 3451 gene locus_tag LOCUS_21660 2708 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3448 4494 gene locus_tag LOCUS_21670 3448 4494 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence0226 1113 3293 gene locus_tag LOCUS_21680 1113 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 3346 4869 gene locus_tag LOCUS_21690 3346 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence0227 <1 634 gene locus_tag LOCUS_21700 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257581.1:ABC transporter ATP-binding protein 2442 613 gene locus_tag LOCUS_21710 2442 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3128 2439 gene locus_tag LOCUS_21720 3128 2439 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_21720 3749 3507 gene locus_tag LOCUS_21730 3749 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4059 3763 gene locus_tag LOCUS_21740 4059 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 3949 6138 gene locus_tag LOCUS_21750 3949 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 6236 6466 gene locus_tag LOCUS_21760 6236 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 6471 6752 gene locus_tag LOCUS_21770 6471 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 6794 7456 gene locus_tag LOCUS_21780 6794 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21780 >Feature sequence0228 211 1014 gene locus_tag LOCUS_21790 211 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2600 1149 gene locus_tag LOCUS_21800 2600 1149 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118989.1 protein_id gnl|my_center|LOCUS_21800 6036 2620 gene locus_tag LOCUS_21810 6036 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 <7658 6336 gene locus_tag LOCUS_21820 <7658 6336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920959.1:MBL fold metallo-hydrolase >Feature sequence0229 209 1300 gene locus_tag LOCUS_21830 209 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1297 1968 gene locus_tag LOCUS_21840 1297 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1965 2447 gene locus_tag LOCUS_21850 1965 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2434 3972 gene locus_tag LOCUS_21860 2434 3972 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_21860 3972 5978 gene locus_tag LOCUS_21870 3972 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 6186 6590 gene locus_tag LOCUS_21880 6186 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 6587 7174 gene locus_tag LOCUS_21890 6587 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence0230 <1 532 gene locus_tag LOCUS_21900 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615507.1:GDSL-type esterase/lipase family protein 655 1425 gene locus_tag LOCUS_21910 655 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1525 4575 gene locus_tag LOCUS_21920 1525 4575 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_21920 4633 7623 gene locus_tag LOCUS_21930 4633 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence0231 1233 2222 gene locus_tag LOCUS_21940 1233 2222 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929455.1 protein_id gnl|my_center|LOCUS_21940 4542 2440 gene locus_tag LOCUS_21950 4542 2440 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 protein_id gnl|my_center|LOCUS_21950 4903 6321 gene locus_tag LOCUS_21960 4903 6321 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence0232 <1 1068 gene locus_tag LOCUS_21970 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142010.1:acetyl-CoA carboxylase biotin carboxylase subunit 1448 1522 gene locus_tag LOCUS_t00130 1448 1522 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2238 1558 gene locus_tag LOCUS_21980 2238 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 5375 2235 gene locus_tag LOCUS_21990 5375 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 6539 5379 gene locus_tag LOCUS_22000 6539 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 7171 6542 gene locus_tag LOCUS_22010 7171 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence0233 3798 1966 gene locus_tag LOCUS_22020 3798 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 4233 3940 gene locus_tag LOCUS_22030 4233 3940 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_22030 4445 5338 gene locus_tag LOCUS_22040 4445 5338 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890595.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence0234 1439 252 gene locus_tag LOCUS_22050 1439 252 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040383028.1 protein_id gnl|my_center|LOCUS_22050 2152 1661 gene locus_tag LOCUS_22060 2152 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2286 2795 gene locus_tag LOCUS_22070 2286 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 5651 3129 gene locus_tag LOCUS_22080 gene rnr 5651 3129 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391817.1 protein_id gnl|my_center|LOCUS_22080 5729 7171 gene locus_tag LOCUS_22090 gene glgA 5729 7171 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_22090 7312 7403 gene locus_tag LOCUS_t00140 7312 7403 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0235 2335 929 gene locus_tag LOCUS_22100 2335 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 3150 2545 gene locus_tag LOCUS_22110 3150 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4046 3147 gene locus_tag LOCUS_22120 gene rhlP 4046 3147 CDS product rhombotarget lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072488.1 protein_id gnl|my_center|LOCUS_22120 5106 4057 gene locus_tag LOCUS_22130 5106 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 6470 5103 gene locus_tag LOCUS_22140 6470 5103 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971000.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence0236 4119 1039 gene locus_tag LOCUS_22150 4119 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2550 2644 gene locus_tag LOCUS_t00150 2550 2644 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5436 4231 gene locus_tag LOCUS_22160 5436 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 6631 5873 gene locus_tag LOCUS_22170 6631 5873 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_22170 <7501 6663 gene locus_tag LOCUS_22180 <7501 6663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064251843.1:4-hydroxy-2-oxoheptanedioate aldolase >Feature sequence0237 391 702 gene locus_tag LOCUS_22190 391 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 699 1073 gene locus_tag LOCUS_22200 699 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2271 1180 gene locus_tag LOCUS_22210 2271 1180 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112643.1 protein_id gnl|my_center|LOCUS_22210 2842 2261 gene locus_tag LOCUS_22220 2842 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 4376 3081 gene locus_tag LOCUS_22230 4376 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 4707 4345 gene locus_tag LOCUS_22240 4707 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 6779 4812 gene locus_tag LOCUS_22250 6779 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence0238 803 3847 gene locus_tag LOCUS_22260 803 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 4620 3940 gene locus_tag LOCUS_22270 4620 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 4761 5852 gene locus_tag LOCUS_22280 4761 5852 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615432.1 protein_id gnl|my_center|LOCUS_22280 6174 5836 gene locus_tag LOCUS_22290 6174 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 6055 6804 gene locus_tag LOCUS_22300 6055 6804 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence0239 519 1592 gene locus_tag LOCUS_22310 519 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_22310 1672 3108 gene locus_tag LOCUS_22320 1672 3108 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_22320 3204 4388 gene locus_tag LOCUS_22330 3204 4388 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_22330 4582 5649 gene locus_tag LOCUS_22340 4582 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 5693 7027 gene locus_tag LOCUS_22350 5693 7027 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence0240 <1 3143 gene locus_tag LOCUS_22360 <1 3143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein 5490 3406 gene locus_tag LOCUS_22370 5490 3406 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_22370 6379 5504 gene locus_tag LOCUS_22380 6379 5504 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_22380 6520 6604 gene locus_tag LOCUS_t00160 6520 6604 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7140 6802 gene locus_tag LOCUS_22390 7140 6802 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_22390 7214 7435 gene locus_tag LOCUS_22400 7214 7435 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706772.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence0241 14 1639 gene locus_tag LOCUS_22410 14 1639 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_22410 4776 2038 gene locus_tag LOCUS_22420 4776 2038 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032613447.1 protein_id gnl|my_center|LOCUS_22420 6242 5271 gene locus_tag LOCUS_22430 6242 5271 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence0242 922 1659 gene locus_tag LOCUS_22440 922 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1694 2770 gene locus_tag LOCUS_22450 1694 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3847 2846 gene locus_tag LOCUS_22460 3847 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 4911 3844 gene locus_tag LOCUS_22470 4911 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 6415 4931 gene locus_tag LOCUS_22480 6415 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 7283 6426 gene locus_tag LOCUS_22490 7283 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence0243 2375 966 gene locus_tag LOCUS_22500 2375 966 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101973.1 protein_id gnl|my_center|LOCUS_22500 2597 5593 gene locus_tag LOCUS_22510 2597 5593 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_22510 6590 5742 gene locus_tag LOCUS_22520 6590 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence0244 591 1931 gene locus_tag LOCUS_22530 591 1931 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_22530 2165 4093 gene locus_tag LOCUS_22540 2165 4093 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_22540 5321 4209 gene locus_tag LOCUS_22550 5321 4209 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930937.1 protein_id gnl|my_center|LOCUS_22550 5513 6664 gene locus_tag LOCUS_22560 5513 6664 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence0245 2778 1126 gene locus_tag LOCUS_22570 2778 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2946 3476 gene locus_tag LOCUS_22580 2946 3476 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814464.1 protein_id gnl|my_center|LOCUS_22580 3473 4489 gene locus_tag LOCUS_22590 3473 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4486 5721 gene locus_tag LOCUS_22600 4486 5721 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921834.1 protein_id gnl|my_center|LOCUS_22600 7194 6085 gene locus_tag LOCUS_22610 7194 6085 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence0246 876 1922 gene locus_tag LOCUS_22620 876 1922 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_22620 2363 4597 gene locus_tag LOCUS_22630 2363 4597 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932948.1 protein_id gnl|my_center|LOCUS_22630 4889 5017 gene locus_tag LOCUS_22640 4889 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 5014 5229 gene locus_tag LOCUS_22650 5014 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence0247 1335 277 gene locus_tag LOCUS_22660 gene tyrS 1335 277 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22660 1270 1458 gene locus_tag LOCUS_22670 1270 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 1752 2225 gene locus_tag LOCUS_22680 1752 2225 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_22680 2287 4986 gene locus_tag LOCUS_22690 gene acnA 2287 4986 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_22690 5145 5657 gene locus_tag LOCUS_22700 5145 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 5772 7001 gene locus_tag LOCUS_22710 gene trpB 5772 7001 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence0248 3663 115 gene locus_tag LOCUS_22720 3663 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 4532 3666 gene locus_tag LOCUS_22730 4532 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 5582 4557 gene locus_tag LOCUS_22740 5582 4557 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_22740 6198 5587 gene locus_tag LOCUS_22750 6198 5587 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974802.1 protein_id gnl|my_center|LOCUS_22750 6267 7145 gene locus_tag LOCUS_22760 6267 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence0249 345 533 gene locus_tag LOCUS_22770 345 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 990 1265 gene locus_tag LOCUS_22780 990 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 1641 3746 gene locus_tag LOCUS_22790 1641 3746 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_22790 3857 5047 gene locus_tag LOCUS_22800 3857 5047 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_22800 5073 6293 gene locus_tag LOCUS_22810 5073 6293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_22810 6767 6297 gene locus_tag LOCUS_22820 6767 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence0250 <1 765 gene locus_tag LOCUS_22830 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391955.1:IclR family transcriptional regulator 783 1514 gene locus_tag LOCUS_22840 783 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1536 2996 gene locus_tag LOCUS_22850 1536 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3003 4586 gene locus_tag LOCUS_22860 3003 4586 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529476.1 protein_id gnl|my_center|LOCUS_22860 4595 5443 gene locus_tag LOCUS_22870 4595 5443 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160785845.1 protein_id gnl|my_center|LOCUS_22870 5545 6900 gene locus_tag LOCUS_22880 5545 6900 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence0251 57 506 gene locus_tag LOCUS_22890 57 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1581 733 gene locus_tag LOCUS_22900 1581 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1988 5056 gene locus_tag LOCUS_22910 1988 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 5551 5294 gene locus_tag LOCUS_22920 5551 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 5444 5953 gene locus_tag LOCUS_22930 5444 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123417.1 protein_id gnl|my_center|LOCUS_22930 6156 6641 gene locus_tag LOCUS_22940 6156 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence0252 3522 1276 gene locus_tag LOCUS_22950 3522 1276 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928491.1 protein_id gnl|my_center|LOCUS_22950 4635 5372 gene locus_tag LOCUS_22960 4635 5372 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626521.1 protein_id gnl|my_center|LOCUS_22960 5641 6054 gene locus_tag LOCUS_22970 5641 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 6822 6010 gene locus_tag LOCUS_22980 6822 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence0253 23 1399 gene locus_tag LOCUS_22990 23 1399 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146518596.1 protein_id gnl|my_center|LOCUS_22990 1567 2763 gene locus_tag LOCUS_23000 1567 2763 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_23000 3441 3698 gene locus_tag LOCUS_23010 3441 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3773 4147 gene locus_tag LOCUS_23020 3773 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 4823 4215 gene locus_tag LOCUS_23030 4823 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 6370 4925 gene locus_tag LOCUS_23040 6370 4925 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578646.1 protein_id gnl|my_center|LOCUS_23040 <6992 6376 gene locus_tag LOCUS_23050 <6992 6376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922613.1:sulfatase-like hydrolase/transferase >Feature sequence0254 549 863 gene locus_tag LOCUS_23060 549 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 977 1165 gene locus_tag LOCUS_23070 977 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1129 1341 gene locus_tag LOCUS_23080 1129 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 1428 2156 gene locus_tag LOCUS_23090 1428 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2164 4080 gene locus_tag LOCUS_23100 2164 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 4067 4834 gene locus_tag LOCUS_23110 4067 4834 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_23110 4831 5856 gene locus_tag LOCUS_23120 4831 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 6089 5853 gene locus_tag LOCUS_23130 6089 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 6105 6905 gene locus_tag LOCUS_23140 6105 6905 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence0255 2770 2186 gene locus_tag LOCUS_23150 gene coaE 2770 2186 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056742.1 protein_id gnl|my_center|LOCUS_23150 2872 3780 gene locus_tag LOCUS_23160 2872 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3818 5359 gene locus_tag LOCUS_23170 3818 5359 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_23170 6455 5427 gene locus_tag LOCUS_23180 6455 5427 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence0256 1339 41 gene locus_tag LOCUS_23190 1339 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1584 1387 gene locus_tag LOCUS_23200 1584 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2928 1612 gene locus_tag LOCUS_23210 2928 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 6105 2962 gene locus_tag LOCUS_23220 6105 2962 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_23220 <6942 6207 gene locus_tag LOCUS_23230 <6942 6207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112643.1:FecR family protein >Feature sequence0257 1130 216 gene locus_tag LOCUS_23240 1130 216 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_23240 2058 1138 gene locus_tag LOCUS_23250 gene oppB 2058 1138 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706429.1 protein_id gnl|my_center|LOCUS_23250 3956 2298 gene locus_tag LOCUS_23260 gene oppA 3956 2298 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169310.1 protein_id gnl|my_center|LOCUS_23260 4055 4513 gene locus_tag LOCUS_23270 4055 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4682 5359 gene locus_tag LOCUS_23280 4682 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 <6880 5384 gene locus_tag LOCUS_23290 <6880 5384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038609.1:M28 family metallopeptidase >Feature sequence0258 74 592 gene locus_tag LOCUS_23300 74 592 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_23300 3968 705 gene locus_tag LOCUS_23310 3968 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 4273 4647 gene locus_tag LOCUS_23320 4273 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 5012 4848 gene locus_tag LOCUS_23330 5012 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 6285 5047 gene locus_tag LOCUS_23340 6285 5047 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_23340 6797 6492 gene locus_tag LOCUS_23350 6797 6492 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence0259 3188 168 gene locus_tag LOCUS_23360 3188 168 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404755.1 protein_id gnl|my_center|LOCUS_23360 3658 3212 gene locus_tag LOCUS_23370 3658 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 3828 3664 gene locus_tag LOCUS_23380 3828 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3766 4191 gene locus_tag LOCUS_23390 3766 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 4922 5167 gene locus_tag LOCUS_23400 4922 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 5164 5580 gene locus_tag LOCUS_23410 5164 5580 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_23410 5613 6350 gene locus_tag LOCUS_23420 5613 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence0260 5 1243 gene locus_tag LOCUS_23430 5 1243 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_23430 1423 2655 gene locus_tag LOCUS_23440 1423 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 2700 5297 gene locus_tag LOCUS_23450 2700 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 5381 5764 gene locus_tag LOCUS_23460 gene rbfA 5381 5764 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360497.1 protein_id gnl|my_center|LOCUS_23460 5766 6779 gene locus_tag LOCUS_23470 5766 6779 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence0261 1284 4454 gene locus_tag LOCUS_23480 1284 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 5520 4474 gene locus_tag LOCUS_23490 gene argF 5520 4474 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_23490 6715 5495 gene locus_tag LOCUS_23500 6715 5495 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence0262 2510 3559 gene locus_tag LOCUS_23510 2510 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 3595 6189 gene locus_tag LOCUS_23520 3595 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence0263 942 4148 gene locus_tag LOCUS_23530 942 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 4145 5113 gene locus_tag LOCUS_23540 4145 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 5343 5681 gene locus_tag LOCUS_23550 5343 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 5699 6454 gene locus_tag LOCUS_23560 5699 6454 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence0264 2578 4641 gene locus_tag LOCUS_23570 2578 4641 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 protein_id gnl|my_center|LOCUS_23570 4707 5210 gene locus_tag LOCUS_23580 4707 5210 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200146.1 protein_id gnl|my_center|LOCUS_23580 5222 5716 gene locus_tag LOCUS_23590 5222 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 5713 6396 gene locus_tag LOCUS_23600 5713 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence0265 <1 1232 gene locus_tag LOCUS_23610 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783463.1:TonB-dependent receptor 1243 2616 gene locus_tag LOCUS_23620 1243 2616 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163929.1 protein_id gnl|my_center|LOCUS_23620 2864 3568 gene locus_tag LOCUS_23630 2864 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23630 3803 4918 gene locus_tag LOCUS_23640 3803 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 <6789 4953 gene locus_tag LOCUS_23650 <6789 4953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083633.1:SulP family inorganic anion transporter >Feature sequence0266 100 936 gene locus_tag LOCUS_23660 100 936 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820280.1 protein_id gnl|my_center|LOCUS_23660 2363 1413 gene locus_tag LOCUS_23670 gene fba 2363 1413 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_23670 3784 2543 gene locus_tag LOCUS_23680 3784 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 6696 3883 gene locus_tag LOCUS_23690 6696 3883 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence0267 37 1407 gene locus_tag LOCUS_23700 37 1407 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_23700 2365 1442 gene locus_tag LOCUS_23710 2365 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2670 3485 gene locus_tag LOCUS_23720 2670 3485 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687382.1 protein_id gnl|my_center|LOCUS_23720 3504 4796 gene locus_tag LOCUS_23730 3504 4796 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_23730 5936 4830 gene locus_tag LOCUS_23740 5936 4830 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120643.1 protein_id gnl|my_center|LOCUS_23740 <6746 5942 gene locus_tag LOCUS_23750 <6746 5942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878023.1:phosphonatase-like hydrolase >Feature sequence0268 181 924 gene locus_tag LOCUS_23760 181 924 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_23760 1538 2179 gene locus_tag LOCUS_23770 1538 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2348 2668 gene locus_tag LOCUS_23780 2348 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 3017 2754 gene locus_tag LOCUS_23790 3017 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3383 3024 gene locus_tag LOCUS_23800 3383 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 4994 3396 gene locus_tag LOCUS_23810 4994 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 5482 4991 gene locus_tag LOCUS_23820 5482 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 6186 5479 gene locus_tag LOCUS_23830 6186 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 6580 6191 gene locus_tag LOCUS_23840 6580 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence0269 1504 983 gene locus_tag LOCUS_23850 1504 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1850 2806 gene locus_tag LOCUS_23860 1850 2806 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 protein_id gnl|my_center|LOCUS_23860 2844 3794 gene locus_tag LOCUS_23870 2844 3794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_23870 3791 4930 gene locus_tag LOCUS_23880 3791 4930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_23880 5036 5272 gene locus_tag LOCUS_23890 5036 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 5262 5597 gene locus_tag LOCUS_23900 5262 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 <6714 5729 gene locus_tag LOCUS_23910 <6714 5729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807926.1:mechanosensitive ion channel family protein >Feature sequence0270 135 1229 gene locus_tag LOCUS_23920 135 1229 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_23920 1744 1502 gene locus_tag LOCUS_23930 1744 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 1697 2581 gene locus_tag LOCUS_23940 1697 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 2629 3450 gene locus_tag LOCUS_23950 2629 3450 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185449.1 protein_id gnl|my_center|LOCUS_23950 3574 4722 gene locus_tag LOCUS_23960 3574 4722 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640873.1 protein_id gnl|my_center|LOCUS_23960 4715 4999 gene locus_tag LOCUS_23970 4715 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 4999 5994 gene locus_tag LOCUS_23980 4999 5994 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250104.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence0271 1811 2428 gene locus_tag LOCUS_23990 1811 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2457 2831 gene locus_tag LOCUS_24000 2457 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 3779 2844 gene locus_tag LOCUS_24010 3779 2844 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118908.1 protein_id gnl|my_center|LOCUS_24010 4810 3776 gene locus_tag LOCUS_24020 gene gmd 4810 3776 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_24020 <6673 5305 gene locus_tag LOCUS_24030 <6673 5305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398606.1:valine--tRNA ligase >Feature sequence0272 <1 2225 gene locus_tag LOCUS_24040 <1 2225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616124.1:DUF1592 domain-containing protein 2442 3401 gene locus_tag LOCUS_24050 2442 3401 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_24050 3401 4909 gene locus_tag LOCUS_24060 3401 4909 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_24060 4979 5062 gene locus_tag LOCUS_t00170 4979 5062 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0273 819 328 gene locus_tag LOCUS_24070 819 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2153 816 gene locus_tag LOCUS_24080 2153 816 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_24080 2491 2222 gene locus_tag LOCUS_24090 2491 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2633 2484 gene locus_tag LOCUS_24100 2633 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2657 3142 gene locus_tag LOCUS_24110 gene mutT 2657 3142 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_24110 3437 3739 gene locus_tag LOCUS_24120 3437 3739 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_24120 3720 3968 gene locus_tag LOCUS_24130 3720 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 4899 4309 gene locus_tag LOCUS_24140 4899 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 5124 5372 gene locus_tag LOCUS_24150 5124 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 5369 5749 gene locus_tag LOCUS_24160 5369 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 6218 6433 gene locus_tag LOCUS_24170 6218 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence0274 486 103 gene locus_tag LOCUS_24180 gene gcvH 486 103 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098622.1 protein_id gnl|my_center|LOCUS_24180 1589 486 gene locus_tag LOCUS_24190 gene gcvT 1589 486 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393443.1 protein_id gnl|my_center|LOCUS_24190 1697 2521 gene locus_tag LOCUS_24200 gene lgt 1697 2521 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_24200 3774 2518 gene locus_tag LOCUS_24210 3774 2518 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_24210 3893 4828 gene locus_tag LOCUS_24220 3893 4828 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103232.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence0275 <1 836 gene locus_tag LOCUS_24230 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224817.1:DUF1365 domain-containing protein 833 2152 gene locus_tag LOCUS_24240 833 2152 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_24240 2299 3102 gene locus_tag LOCUS_24250 2299 3102 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_24250 3182 4192 gene locus_tag LOCUS_24260 3182 4192 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_24260 4721 5524 gene locus_tag LOCUS_24270 4721 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 5739 5521 gene locus_tag LOCUS_24280 5739 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 6527 5787 gene locus_tag LOCUS_24290 6527 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence0276 2115 2360 gene locus_tag LOCUS_24300 2115 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3683 2250 gene locus_tag LOCUS_24310 3683 2250 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_24310 <6615 3693 gene locus_tag LOCUS_24320 <6615 3693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121300.1:DUF1553 domain-containing protein >Feature sequence0277 1337 555 gene locus_tag LOCUS_24330 1337 555 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_24330 2170 1334 gene locus_tag LOCUS_24340 gene truA 2170 1334 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733032.1 protein_id gnl|my_center|LOCUS_24340 2147 2797 gene locus_tag LOCUS_24350 2147 2797 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_24350 3225 2794 gene locus_tag LOCUS_24360 gene ruvX 3225 2794 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_24360 3521 3267 gene locus_tag LOCUS_24370 3521 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 3414 4478 gene locus_tag LOCUS_24380 gene moeB 3414 4478 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_24380 5415 4501 gene locus_tag LOCUS_24390 5415 4501 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057878.1 protein_id gnl|my_center|LOCUS_24390 5910 5533 gene locus_tag LOCUS_24400 5910 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 <6603 5988 gene locus_tag LOCUS_24410 <6603 5988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332279.1:SDR family oxidoreductase >Feature sequence0278 1539 943 gene locus_tag LOCUS_24420 1539 943 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803670.1 protein_id gnl|my_center|LOCUS_24420 2939 1548 gene locus_tag LOCUS_24430 2939 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4072 2936 gene locus_tag LOCUS_24440 4072 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 3971 4270 gene locus_tag LOCUS_24450 3971 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence0279 305 1582 gene locus_tag LOCUS_24460 305 1582 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_24460 2948 1692 gene locus_tag LOCUS_24470 2948 1692 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_24470 3059 4474 gene locus_tag LOCUS_24480 3059 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 5760 4453 gene locus_tag LOCUS_24490 5760 4453 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_24490 <6589 5757 gene locus_tag LOCUS_24500 <6589 5757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118167.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence0280 4277 498 gene locus_tag LOCUS_24510 gene rpoB 4277 498 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882731.1 protein_id gnl|my_center|LOCUS_24510 4841 4458 gene locus_tag LOCUS_24520 gene rplL 4841 4458 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_24520 5474 4977 gene locus_tag LOCUS_24530 gene rplJ 5474 4977 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273085.1 protein_id gnl|my_center|LOCUS_24530 6187 5489 gene locus_tag LOCUS_24540 gene rplA 6187 5489 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_24540 6577 6257 gene locus_tag LOCUS_24550 6577 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence0281 2099 141 gene locus_tag LOCUS_24560 gene acs 2099 141 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_24560 2200 3468 gene locus_tag LOCUS_24570 gene rho 2200 3468 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330229.1 protein_id gnl|my_center|LOCUS_24570 3560 5320 gene locus_tag LOCUS_24580 3560 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 5419 6180 gene locus_tag LOCUS_24590 gene hisF 5419 6180 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence0282 274 1737 gene locus_tag LOCUS_24600 274 1737 CDS product BNR-4 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921364.1 protein_id gnl|my_center|LOCUS_24600 1837 2295 gene locus_tag LOCUS_24610 1837 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2414 3409 gene locus_tag LOCUS_24620 2414 3409 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_24620 3522 4820 gene locus_tag LOCUS_24630 3522 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 4912 6336 gene locus_tag LOCUS_24640 4912 6336 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067535.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence0283 <1 828 gene locus_tag LOCUS_24650 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083692.1:site-specific integrase 825 1742 gene locus_tag LOCUS_24660 825 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1792 2124 gene locus_tag LOCUS_24670 1792 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2121 3308 gene locus_tag LOCUS_24680 2121 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 3305 4852 gene locus_tag LOCUS_24690 3305 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 5399 4920 gene locus_tag LOCUS_24700 5399 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence0284 77 253 gene locus_tag LOCUS_24710 77 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 255 2636 gene locus_tag LOCUS_24720 255 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 4201 2834 gene locus_tag LOCUS_24730 4201 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 4705 4968 gene locus_tag LOCUS_24740 4705 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 5080 5250 gene locus_tag LOCUS_24750 5080 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence0285 <1 1653 gene locus_tag LOCUS_24760 <1 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:PSD1 and planctomycete cytochrome C domain-containing protein 1659 3098 gene locus_tag LOCUS_24770 1659 3098 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_24770 3107 6385 gene locus_tag LOCUS_24780 3107 6385 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence0286 1 909 gene locus_tag LOCUS_24790 1 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 922 2322 gene locus_tag LOCUS_24800 gene mshL 922 2322 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_24800 2325 3524 gene locus_tag LOCUS_24810 2325 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3564 4319 gene locus_tag LOCUS_24820 3564 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 4297 5538 gene locus_tag LOCUS_24830 4297 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 5535 6254 gene locus_tag LOCUS_24840 5535 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence0287 <1 1949 gene locus_tag LOCUS_24850 <1 1949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258948.1:transcription-repair coupling factor 1442 1349 gene locus_tag LOCUS_t00180 1442 1349 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1949 2950 gene locus_tag LOCUS_24860 1949 2950 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897434.1 protein_id gnl|my_center|LOCUS_24860 3695 2952 gene locus_tag LOCUS_24870 3695 2952 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972957.1 protein_id gnl|my_center|LOCUS_24870 3743 4468 gene locus_tag LOCUS_24880 gene radC 3743 4468 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence0288 <1 1426 gene locus_tag LOCUS_24890 <1 1426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089686.1:TonB-dependent receptor 1683 2030 gene locus_tag LOCUS_24900 1683 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 2129 3013 gene locus_tag LOCUS_24910 2129 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3117 4724 gene locus_tag LOCUS_24920 3117 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 4961 4782 gene locus_tag LOCUS_24930 4961 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 4881 5147 gene locus_tag LOCUS_24940 4881 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence0289 124 1386 gene locus_tag LOCUS_24950 124 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 1487 2746 gene locus_tag LOCUS_24960 1487 2746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919685.1 protein_id gnl|my_center|LOCUS_24960 4532 2769 gene locus_tag LOCUS_24970 4532 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 4786 4529 gene locus_tag LOCUS_24980 4786 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 5069 4938 gene locus_tag LOCUS_24990 5069 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 5814 5401 gene locus_tag LOCUS_25000 5814 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 <6515 5903 gene locus_tag LOCUS_25010 <6515 5903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036901.1:alanine--tRNA ligase >Feature sequence0290 1696 746 gene locus_tag LOCUS_25020 1696 746 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807565.1 protein_id gnl|my_center|LOCUS_25020 2809 1706 gene locus_tag LOCUS_25030 2809 1706 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_25030 3815 2979 gene locus_tag LOCUS_25040 3815 2979 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence0291 20 376 gene locus_tag LOCUS_25050 20 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1996 590 gene locus_tag LOCUS_25060 1996 590 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_25060 3491 2013 gene locus_tag LOCUS_25070 3491 2013 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_25070 3513 5180 gene locus_tag LOCUS_25080 gene malQ 3513 5180 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_25080 <6479 5177 gene locus_tag LOCUS_25090 <6479 5177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267714.1:efflux RND transporter permease subunit >Feature sequence0292 2533 2784 gene locus_tag LOCUS_25100 2533 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2863 3258 gene locus_tag LOCUS_25110 2863 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 3313 5478 gene locus_tag LOCUS_25120 3313 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence0293 1308 559 gene locus_tag LOCUS_25130 1308 559 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_25130 2903 1491 gene locus_tag LOCUS_25140 2903 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 3010 3588 gene locus_tag LOCUS_25150 3010 3588 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_25150 4868 3609 gene locus_tag LOCUS_25160 4868 3609 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_25160 4952 5440 gene locus_tag LOCUS_25170 4952 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 5481 6119 gene locus_tag LOCUS_25180 gene pdxH 5481 6119 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence0294 960 2846 gene locus_tag LOCUS_25190 960 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2860 4248 gene locus_tag LOCUS_25200 2860 4248 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_25200 4270 6381 gene locus_tag LOCUS_25210 4270 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence0295 1040 1471 gene locus_tag LOCUS_25220 1040 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 1519 2121 gene locus_tag LOCUS_25230 gene phnH 1519 2121 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392105.1 protein_id gnl|my_center|LOCUS_25230 2137 3276 gene locus_tag LOCUS_25240 2137 3276 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861993.1 protein_id gnl|my_center|LOCUS_25240 3273 4175 gene locus_tag LOCUS_25250 3273 4175 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435861.1 protein_id gnl|my_center|LOCUS_25250 4191 5039 gene locus_tag LOCUS_25260 4191 5039 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 protein_id gnl|my_center|LOCUS_25260 5051 5764 gene locus_tag LOCUS_25270 5051 5764 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258833.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence0296 69 1508 gene locus_tag LOCUS_25280 69 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1953 3176 gene locus_tag LOCUS_25290 1953 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 3437 4963 gene locus_tag LOCUS_25300 3437 4963 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_25300 5073 6407 gene locus_tag LOCUS_25310 5073 6407 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence0297 <1 555 gene locus_tag LOCUS_25320 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002668968.1:type I glyceraldehyde-3-phosphate dehydrogenase 681 1925 gene locus_tag LOCUS_25330 681 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25330 1938 2708 gene locus_tag LOCUS_25340 1938 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25340 3716 2811 gene locus_tag LOCUS_25350 3716 2811 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_25350 3841 4158 gene locus_tag LOCUS_25360 3841 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 4174 4836 gene locus_tag LOCUS_25370 4174 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 4914 5999 gene locus_tag LOCUS_25380 4914 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence0298 1161 415 gene locus_tag LOCUS_25390 1161 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 1961 1158 gene locus_tag LOCUS_25400 1961 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2096 3316 gene locus_tag LOCUS_25410 2096 3316 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258832.1 protein_id gnl|my_center|LOCUS_25410 3329 4123 gene locus_tag LOCUS_25420 3329 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 4148 4852 gene locus_tag LOCUS_25430 4148 4852 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966112.1 protein_id gnl|my_center|LOCUS_25430 4876 5256 gene locus_tag LOCUS_25440 4876 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 5301 6125 gene locus_tag LOCUS_25450 gene phnC 5301 6125 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201618.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence0299 3444 2413 gene locus_tag LOCUS_25460 gene hemE 3444 2413 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444333.1 protein_id gnl|my_center|LOCUS_25460 4433 3441 gene locus_tag LOCUS_25470 gene hemF 4433 3441 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_25470 4655 5365 gene locus_tag LOCUS_25480 4655 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918209.1 protein_id gnl|my_center|LOCUS_25480 <6387 5518 gene locus_tag LOCUS_25490 <6387 5518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000831996.1:serine-type D-Ala-D-Ala carboxypeptidase DacF >Feature sequence0300 1082 114 gene locus_tag LOCUS_25500 1082 114 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047962736.1 protein_id gnl|my_center|LOCUS_25500 1425 1658 gene locus_tag LOCUS_25510 1425 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2085 2261 gene locus_tag LOCUS_25520 2085 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2265 2462 gene locus_tag LOCUS_25530 2265 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 4171 2666 gene locus_tag LOCUS_25540 gene mqo 4171 2666 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099345.1 protein_id gnl|my_center|LOCUS_25540 <6325 4813 gene locus_tag LOCUS_25550 <6325 4813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037254759.1:arylsulfatase >Feature sequence0301 <1 1065 gene locus_tag LOCUS_25560 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108128.1:dipeptidase 1714 1148 gene locus_tag LOCUS_25570 gene pal 1714 1148 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176628.1 protein_id gnl|my_center|LOCUS_25570 2137 2063 gene locus_tag LOCUS_t00190 2137 2063 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2313 2918 gene locus_tag LOCUS_25580 gene rpoE 2313 2918 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_25580 2966 3697 gene locus_tag LOCUS_25590 2966 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 4368 3766 gene locus_tag LOCUS_25600 gene ruvA 4368 3766 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_25600 5181 4450 gene locus_tag LOCUS_25610 gene dapB 5181 4450 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_25610 6080 5193 gene locus_tag LOCUS_25620 gene dapA 6080 5193 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_25620 5979 6266 gene locus_tag LOCUS_25630 5979 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence0302 100 1647 gene locus_tag LOCUS_25640 100 1647 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_25640 1805 2629 gene locus_tag LOCUS_25650 1805 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 3021 6263 gene locus_tag LOCUS_25660 3021 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence0303 2456 1113 gene locus_tag LOCUS_25670 2456 1113 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921850.1 protein_id gnl|my_center|LOCUS_25670 2758 3528 gene locus_tag LOCUS_25680 2758 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3597 4178 gene locus_tag LOCUS_25690 gene pth 3597 4178 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_25690 4175 4471 gene locus_tag LOCUS_25700 4175 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 4496 4978 gene locus_tag LOCUS_25710 4496 4978 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_25710 5094 5618 gene locus_tag LOCUS_25720 gene rplI 5094 5618 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881335.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence0304 2390 3274 gene locus_tag LOCUS_25730 2390 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 5116 3470 gene locus_tag LOCUS_25740 5116 3470 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_25740 <6233 5113 gene locus_tag LOCUS_25750 <6233 5113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922507.1:arylsulfatase >Feature sequence0305 2 271 gene locus_tag LOCUS_25760 2 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 728 291 gene locus_tag LOCUS_25770 728 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 917 3043 gene locus_tag LOCUS_25780 917 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3135 4112 gene locus_tag LOCUS_25790 3135 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 4562 4116 gene locus_tag LOCUS_25800 4562 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 4671 5702 gene locus_tag LOCUS_25810 4671 5702 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975000.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence0306 <1 652 gene locus_tag LOCUS_25820 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942408.1:1-deoxy-D-xylulose-5-phosphate synthase 2525 672 gene locus_tag LOCUS_25830 2525 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 4122 2725 gene locus_tag LOCUS_25840 4122 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 5310 4138 gene locus_tag LOCUS_25850 5310 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 5820 5470 gene locus_tag LOCUS_25860 5820 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence0307 247 753 gene locus_tag LOCUS_25870 247 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 771 1418 gene locus_tag LOCUS_25880 gene tmk 771 1418 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_25880 1497 2453 gene locus_tag LOCUS_25890 1497 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3089 2496 gene locus_tag LOCUS_25900 3089 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 4986 3151 gene locus_tag LOCUS_25910 4986 3151 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_25910 5707 4994 gene locus_tag LOCUS_25920 5707 4994 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence0308 175 588 gene locus_tag LOCUS_25930 175 588 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770645.1 protein_id gnl|my_center|LOCUS_25930 707 1393 gene locus_tag LOCUS_25940 707 1393 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_25940 1468 3636 gene locus_tag LOCUS_25950 1468 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 <6160 3972 gene locus_tag LOCUS_25960 <6160 3972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121080.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence0309 4027 1151 gene locus_tag LOCUS_25970 4027 1151 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_25970 4241 5509 gene locus_tag LOCUS_25980 4241 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence0310 <1 1084 gene locus_tag LOCUS_25990 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918789.1:flagellar basal-body MS-ring/collar protein FliF 1097 2119 gene locus_tag LOCUS_26000 gene fliG 1097 2119 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_26000 2124 2708 gene locus_tag LOCUS_26010 2124 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2705 4030 gene locus_tag LOCUS_26020 gene fliI 2705 4030 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_26020 4027 4482 gene locus_tag LOCUS_26030 4027 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 4479 5111 gene locus_tag LOCUS_26040 4479 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 >Feature sequence0311 1096 4131 gene locus_tag LOCUS_26050 1096 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 4322 6046 gene locus_tag LOCUS_26060 4322 6046 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence0312 72 1049 gene locus_tag LOCUS_26070 72 1049 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505124.1 protein_id gnl|my_center|LOCUS_26070 1046 1570 gene locus_tag LOCUS_26080 1046 1570 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033059696.1 protein_id gnl|my_center|LOCUS_26080 1825 2379 gene locus_tag LOCUS_26090 1825 2379 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_26090 2376 3446 gene locus_tag LOCUS_26100 2376 3446 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918866.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence0313 584 2263 gene locus_tag LOCUS_26110 584 2263 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_26110 2253 3401 gene locus_tag LOCUS_26120 2253 3401 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_26120 3510 4130 gene locus_tag LOCUS_26130 3510 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26130 4218 4823 gene locus_tag LOCUS_26140 4218 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26140 4820 5380 gene locus_tag LOCUS_26150 4820 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence0314 69 602 gene locus_tag LOCUS_26160 69 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 835 2235 gene locus_tag LOCUS_26170 835 2235 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889353.1 protein_id gnl|my_center|LOCUS_26170 2419 4101 gene locus_tag LOCUS_26180 2419 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 4126 4275 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agcggcgagcgccagcaagc 4345 5460 gene locus_tag LOCUS_26190 4345 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 5557 5952 gene locus_tag LOCUS_26200 5557 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence0315 736 212 gene locus_tag LOCUS_26210 736 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1276 866 gene locus_tag LOCUS_26220 1276 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 3480 1198 gene locus_tag LOCUS_26230 3480 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 3846 3580 gene locus_tag LOCUS_26240 3846 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 4260 4012 gene locus_tag LOCUS_26250 4260 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 5022 4282 gene locus_tag LOCUS_26260 5022 4282 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence0316 1513 269 gene locus_tag LOCUS_26270 1513 269 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469535.1 protein_id gnl|my_center|LOCUS_26270 4974 1690 gene locus_tag LOCUS_26280 4974 1690 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404755.1 protein_id gnl|my_center|LOCUS_26280 5314 5069 gene locus_tag LOCUS_26290 5314 5069 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 protein_id gnl|my_center|LOCUS_26290 5739 5317 gene locus_tag LOCUS_26300 5739 5317 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037032.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence0317 2179 137 gene locus_tag LOCUS_26310 gene brxL 2179 137 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_26310 4487 2181 gene locus_tag LOCUS_26320 gene pglZ 4487 2181 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_26320 5530 4490 gene locus_tag LOCUS_26330 5530 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393723.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence0318 <1 1619 gene locus_tag LOCUS_26340 <1 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206290416.1:TonB-dependent receptor 1968 2402 gene locus_tag LOCUS_26350 1968 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 2518 3756 gene locus_tag LOCUS_26360 2518 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 3778 5073 gene locus_tag LOCUS_26370 3778 5073 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275505.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence0319 68 862 gene locus_tag LOCUS_26380 68 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1307 1606 gene locus_tag LOCUS_26390 1307 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2252 1626 gene locus_tag LOCUS_26400 2252 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2468 3838 gene locus_tag LOCUS_26410 2468 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096324.1 protein_id gnl|my_center|LOCUS_26410 5640 4498 gene locus_tag LOCUS_26420 5640 4498 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence0320 <1 2277 gene locus_tag LOCUS_26430 <1 2277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920248.1:CusA/CzcA family heavy metal efflux RND transporter 2327 2905 gene locus_tag LOCUS_26440 2327 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 4448 3027 gene locus_tag LOCUS_26450 gene chrA 4448 3027 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969287.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence0321 1588 311 gene locus_tag LOCUS_26460 1588 311 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_26460 4619 1755 gene locus_tag LOCUS_26470 4619 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 5743 4616 gene locus_tag LOCUS_26480 5743 4616 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767017.1 protein_id gnl|my_center|LOCUS_26480 5933 5781 gene locus_tag LOCUS_26490 5933 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence0322 461 111 gene locus_tag LOCUS_26500 461 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1656 475 gene locus_tag LOCUS_26510 1656 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2669 1707 gene locus_tag LOCUS_26520 2669 1707 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392660.1 protein_id gnl|my_center|LOCUS_26520 2662 3471 gene locus_tag LOCUS_26530 gene queC 2662 3471 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972958.1 protein_id gnl|my_center|LOCUS_26530 3528 4223 gene locus_tag LOCUS_26540 3528 4223 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921555.1 protein_id gnl|my_center|LOCUS_26540 4243 4890 gene locus_tag LOCUS_26550 4243 4890 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819224.1 protein_id gnl|my_center|LOCUS_26550 >Feature sequence0323 175 990 gene locus_tag LOCUS_26560 175 990 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479587.1 protein_id gnl|my_center|LOCUS_26560 987 1205 gene locus_tag LOCUS_26570 987 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1660 2805 gene locus_tag LOCUS_26580 gene galK 1660 2805 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_26580 3734 2802 gene locus_tag LOCUS_26590 3734 2802 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_26590 4733 3810 gene locus_tag LOCUS_26600 4733 3810 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_26600 5674 4808 gene locus_tag LOCUS_26610 5674 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence0324 1039 2547 gene locus_tag LOCUS_26620 1039 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3773 2748 gene locus_tag LOCUS_26630 3773 2748 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_26630 3824 5008 gene locus_tag LOCUS_26640 gene prfA 3824 5008 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_26640 5010 5864 gene locus_tag LOCUS_26650 gene prmC 5010 5864 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence0325 235 984 gene locus_tag LOCUS_26660 235 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26660 1397 2032 gene locus_tag LOCUS_26670 1397 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2937 2749 gene locus_tag LOCUS_26680 2937 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2917 5256 gene locus_tag LOCUS_26690 2917 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence0326 656 1534 gene locus_tag LOCUS_26700 656 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 1569 3086 gene locus_tag LOCUS_26710 1569 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 3083 4006 gene locus_tag LOCUS_26720 gene pfkB 3083 4006 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_26720 4084 4398 gene locus_tag LOCUS_26730 gene rplU 4084 4398 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896540.1 protein_id gnl|my_center|LOCUS_26730 4414 4659 gene locus_tag LOCUS_26740 gene rpmA 4414 4659 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007650346.1 protein_id gnl|my_center|LOCUS_26740 <5939 5139 gene locus_tag LOCUS_26750 <5939 5139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943245.1:prephenate dehydratase >Feature sequence0327 146 415 gene locus_tag LOCUS_26760 146 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 419 625 gene locus_tag LOCUS_26770 419 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 728 4765 gene locus_tag LOCUS_26780 728 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 5209 5649 gene locus_tag LOCUS_26790 5209 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence0328 1921 3399 gene locus_tag LOCUS_26800 1921 3399 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_26800 3402 4634 gene locus_tag LOCUS_26810 3402 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 4937 5782 gene locus_tag LOCUS_26820 4937 5782 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence0329 2105 555 gene locus_tag LOCUS_26830 2105 555 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_26830 5911 2465 gene locus_tag LOCUS_26840 5911 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence0330 552 157 gene locus_tag LOCUS_26850 552 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 433 870 gene locus_tag LOCUS_26860 433 870 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_26860 1439 936 gene locus_tag LOCUS_26870 gene folA 1439 936 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 protein_id gnl|my_center|LOCUS_26870 1665 2528 gene locus_tag LOCUS_26880 1665 2528 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815329.1 protein_id gnl|my_center|LOCUS_26880 2525 3508 gene locus_tag LOCUS_26890 2525 3508 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707170.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence0331 1139 4141 gene locus_tag LOCUS_26900 1139 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 4188 5774 gene locus_tag LOCUS_26910 4188 5774 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence0332 1395 2606 gene locus_tag LOCUS_26920 gene mpgS 1395 2606 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228323.1 protein_id gnl|my_center|LOCUS_26920 2603 3460 gene locus_tag LOCUS_26930 gene mpgP 2603 3460 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228324.1 protein_id gnl|my_center|LOCUS_26930 3845 5548 gene locus_tag LOCUS_26940 3845 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence0333 173 1471 gene locus_tag LOCUS_26950 173 1471 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933016.1 protein_id gnl|my_center|LOCUS_26950 1516 2256 gene locus_tag LOCUS_26960 1516 2256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_26960 2270 3520 gene locus_tag LOCUS_26970 2270 3520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933018.1 protein_id gnl|my_center|LOCUS_26970 3533 4756 gene locus_tag LOCUS_26980 3533 4756 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_26980 <5889 4819 gene locus_tag LOCUS_26990 <5889 4819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615753.1:nucleoside monophosphate kinase >Feature sequence0334 623 1864 gene locus_tag LOCUS_27000 623 1864 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_27000 2733 1894 gene locus_tag LOCUS_27010 2733 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2968 4923 gene locus_tag LOCUS_27020 2968 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 5156 5455 gene locus_tag LOCUS_27030 5156 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 5476 5814 gene locus_tag LOCUS_27040 5476 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence0335 <1 2687 gene locus_tag LOCUS_27050 <1 2687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922467.1:DUF1592 domain-containing protein 2727 4130 gene locus_tag LOCUS_27060 2727 4130 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326881.1 protein_id gnl|my_center|LOCUS_27060 4123 4317 gene locus_tag LOCUS_27070 4123 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 5520 4306 gene locus_tag LOCUS_27080 5520 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 5837 5517 gene locus_tag LOCUS_27090 5837 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence0336 289 828 gene locus_tag LOCUS_27100 289 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 839 1126 gene locus_tag LOCUS_27110 839 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 1126 2349 gene locus_tag LOCUS_27120 1126 2349 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098062761.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence0337 1045 191 gene locus_tag LOCUS_27130 1045 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1200 2105 gene locus_tag LOCUS_27140 1200 2105 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_27140 4950 2119 gene locus_tag LOCUS_27150 gene rapA 4950 2119 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704808.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence0338 1492 1118 gene locus_tag LOCUS_27160 1492 1118 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_27160 2626 1583 gene locus_tag LOCUS_27170 2626 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 2798 4663 gene locus_tag LOCUS_27180 2798 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence0339 3174 2533 gene locus_tag LOCUS_27190 3174 2533 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 protein_id gnl|my_center|LOCUS_27190 5307 3211 gene locus_tag LOCUS_27200 5307 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence0340 3525 787 gene locus_tag LOCUS_27210 3525 787 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_27210 4211 3663 gene locus_tag LOCUS_27220 4211 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 4435 4217 gene locus_tag LOCUS_27230 4435 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 <5798 4524 gene locus_tag LOCUS_27240 <5798 4524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140537.1:GTP-binding protein >Feature sequence0341 1902 1033 gene locus_tag LOCUS_27250 1902 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3597 1909 gene locus_tag LOCUS_27260 gene ettA 3597 1909 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_27260 3638 3886 gene locus_tag LOCUS_27270 3638 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 4164 4088 gene locus_tag LOCUS_t00200 4164 4088 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5706 4453 gene locus_tag LOCUS_27280 5706 4453 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804458.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence0342 <1 1362 gene locus_tag LOCUS_27290 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090339627.1:ThuA domain-containing protein 3007 1409 gene locus_tag LOCUS_27300 3007 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3576 3004 gene locus_tag LOCUS_27310 3576 3004 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119049.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence0343 1888 146 gene locus_tag LOCUS_27320 1888 146 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_27320 5016 1900 gene locus_tag LOCUS_27330 5016 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 5414 5250 gene locus_tag LOCUS_27340 5414 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence0344 975 604 gene locus_tag LOCUS_27350 975 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 997 1449 gene locus_tag LOCUS_27360 997 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1500 2324 gene locus_tag LOCUS_27370 1500 2324 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 protein_id gnl|my_center|LOCUS_27370 3523 2513 gene locus_tag LOCUS_27380 3523 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 3676 4620 gene locus_tag LOCUS_27390 3676 4620 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_27390 5155 4838 gene locus_tag LOCUS_27400 5155 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence0345 539 330 gene locus_tag LOCUS_27410 539 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 637 3831 gene locus_tag LOCUS_27420 637 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 3897 5336 gene locus_tag LOCUS_27430 3897 5336 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence0346 1667 2050 gene locus_tag LOCUS_27440 1667 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence0347 <1 1400 gene locus_tag LOCUS_27450 <1 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144201.1:DUF1800 domain-containing protein 1539 2690 gene locus_tag LOCUS_27460 1539 2690 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_27460 2824 2576 gene locus_tag LOCUS_27470 2824 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2875 4398 gene locus_tag LOCUS_27480 gene xylB 2875 4398 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267678.1 protein_id gnl|my_center|LOCUS_27480 5532 4447 gene locus_tag LOCUS_27490 gene rpoD 5532 4447 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence0348 394 954 gene locus_tag LOCUS_27500 394 954 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706500.1 protein_id gnl|my_center|LOCUS_27500 947 1939 gene locus_tag LOCUS_27510 gene yhaM 947 1939 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 protein_id gnl|my_center|LOCUS_27510 3172 1994 gene locus_tag LOCUS_27520 3172 1994 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_27520 4868 3177 gene locus_tag LOCUS_27530 4868 3177 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_27530 <5608 4897 gene locus_tag LOCUS_27540 <5608 4897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329383.1:type IV pilus twitching motility protein PilT >Feature sequence0349 <1 2800 gene locus_tag LOCUS_27550 <1 2800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404755.1:TonB-dependent receptor 3984 2986 gene locus_tag LOCUS_27560 3984 2986 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_27560 4503 4024 gene locus_tag LOCUS_27570 4503 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 5414 4620 gene locus_tag LOCUS_27580 gene kdsA 5414 4620 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_27580 >Feature sequence0350 4279 1307 gene locus_tag LOCUS_27590 4279 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 4419 5468 gene locus_tag LOCUS_27600 4419 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence0351 725 477 gene locus_tag LOCUS_27610 725 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 612 1268 gene locus_tag LOCUS_27620 612 1268 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_27620 1412 4975 gene locus_tag LOCUS_27630 1412 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence0352 <1 605 gene locus_tag LOCUS_27640 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188711.1:methyltransferase 3216 1132 gene locus_tag LOCUS_27650 3216 1132 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence0353 779 1678 gene locus_tag LOCUS_27660 779 1678 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170031.1 protein_id gnl|my_center|LOCUS_27660 1675 2922 gene locus_tag LOCUS_27670 1675 2922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_27670 2927 4075 gene locus_tag LOCUS_27680 2927 4075 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967366.1 protein_id gnl|my_center|LOCUS_27680 4072 5076 gene locus_tag LOCUS_27690 4072 5076 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974641.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence0354 <5575 632 gene locus_tag LOCUS_27700 <5575 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:Calx-beta domain-containing protein >Feature sequence0355 437 616 gene locus_tag LOCUS_27710 437 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 652 1713 gene locus_tag LOCUS_27720 gene plsX 652 1713 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_27720 1727 2719 gene locus_tag LOCUS_27730 1727 2719 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_27730 2732 3796 gene locus_tag LOCUS_27740 2732 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 3886 4413 gene locus_tag LOCUS_27750 3886 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 4584 4330 gene locus_tag LOCUS_27760 4584 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 4639 5304 gene locus_tag LOCUS_27770 gene rpe 4639 5304 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence0356 2105 564 gene locus_tag LOCUS_27780 gene guaA 2105 564 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_27780 4028 2208 gene locus_tag LOCUS_27790 4028 2208 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence0357 205 1080 gene locus_tag LOCUS_27800 205 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2282 1077 gene locus_tag LOCUS_27810 2282 1077 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 protein_id gnl|my_center|LOCUS_27810 4454 2289 gene locus_tag LOCUS_27820 4454 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence0358 1737 877 gene locus_tag LOCUS_27830 1737 877 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336892.1 protein_id gnl|my_center|LOCUS_27830 2200 1805 gene locus_tag LOCUS_27840 2200 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27840 2616 2197 gene locus_tag LOCUS_27850 2616 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 4665 3385 gene locus_tag LOCUS_27860 gene gltS 4665 3385 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468822.1 protein_id gnl|my_center|LOCUS_27860 4866 4940 gene locus_tag LOCUS_t00210 4866 4940 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0359 1002 157 gene locus_tag LOCUS_27870 1002 157 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 protein_id gnl|my_center|LOCUS_27870 1937 1002 gene locus_tag LOCUS_27880 1937 1002 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091572.1 protein_id gnl|my_center|LOCUS_27880 2235 3170 gene locus_tag LOCUS_27890 2235 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 3187 4011 gene locus_tag LOCUS_27900 gene fabG 3187 4011 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_27900 4023 5072 gene locus_tag LOCUS_27910 4023 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence0360 1881 604 gene locus_tag LOCUS_27920 gene gltP 1881 604 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821134.1 protein_id gnl|my_center|LOCUS_27920 2543 1887 gene locus_tag LOCUS_27930 2543 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 <5464 2590 gene locus_tag LOCUS_27940 <5464 2590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275339.1:TonB-dependent receptor >Feature sequence0361 124 1050 gene locus_tag LOCUS_27950 124 1050 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_27950 1123 1521 gene locus_tag LOCUS_27960 1123 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1529 2407 gene locus_tag LOCUS_27970 1529 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 2404 3066 gene locus_tag LOCUS_27980 2404 3066 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818863.1 protein_id gnl|my_center|LOCUS_27980 3196 3522 gene locus_tag LOCUS_27990 3196 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 3522 3701 gene locus_tag LOCUS_28000 3522 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 3661 4854 gene locus_tag LOCUS_28010 3661 4854 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142594.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence0362 762 61 gene locus_tag LOCUS_28020 762 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015462938.1 protein_id gnl|my_center|LOCUS_28020 1267 749 gene locus_tag LOCUS_28030 1267 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_28030 1456 1899 gene locus_tag LOCUS_28040 1456 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2789 1923 gene locus_tag LOCUS_28050 2789 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 3545 3838 gene locus_tag LOCUS_28060 3545 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 3835 5145 gene locus_tag LOCUS_28070 3835 5145 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence0363 655 1242 gene locus_tag LOCUS_28080 655 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 1598 1260 gene locus_tag LOCUS_28090 1598 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 1488 2672 gene locus_tag LOCUS_28100 1488 2672 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_28100 2675 3103 gene locus_tag LOCUS_28110 2675 3103 CDS product monoheme cytochrome C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853099.1 protein_id gnl|my_center|LOCUS_28110 3526 3305 gene locus_tag LOCUS_28120 3526 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 4268 3618 gene locus_tag LOCUS_28130 4268 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 4754 4296 gene locus_tag LOCUS_28140 4754 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence0364 1272 118 gene locus_tag LOCUS_28150 gene tgt 1272 118 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_28150 1339 1905 gene locus_tag LOCUS_28160 1339 1905 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_28160 1916 2386 gene locus_tag LOCUS_28170 gene nrdR 1916 2386 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459010.1 protein_id gnl|my_center|LOCUS_28170 2478 2984 gene locus_tag LOCUS_28180 2478 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 3086 3424 gene locus_tag LOCUS_28190 3086 3424 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence0365 1711 461 gene locus_tag LOCUS_28200 1711 461 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035547.1 protein_id gnl|my_center|LOCUS_28200 1913 2803 gene locus_tag LOCUS_28210 1913 2803 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_28210 2855 3313 gene locus_tag LOCUS_28220 2855 3313 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855793.1 protein_id gnl|my_center|LOCUS_28220 4054 3407 gene locus_tag LOCUS_28230 4054 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 4749 3982 gene locus_tag LOCUS_28240 4749 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28240 5370 4792 gene locus_tag LOCUS_28250 5370 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 >Feature sequence0366 129 1223 gene locus_tag LOCUS_28260 129 1223 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_28260 1274 1933 gene locus_tag LOCUS_28270 1274 1933 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 protein_id gnl|my_center|LOCUS_28270 2743 2249 gene locus_tag LOCUS_28280 2743 2249 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_28280 4006 3542 gene locus_tag LOCUS_28290 4006 3542 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_28290 5250 4003 gene locus_tag LOCUS_28300 5250 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence0367 1599 70 gene locus_tag LOCUS_28310 1599 70 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_28310 1792 5190 gene locus_tag LOCUS_28320 1792 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence0368 <1 721 gene locus_tag LOCUS_28330 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920939.1:phosphoribosylamine--glycine ligase 721 1395 gene locus_tag LOCUS_28340 721 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1505 1987 gene locus_tag LOCUS_28350 1505 1987 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_28350 2176 3441 gene locus_tag LOCUS_28360 2176 3441 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073318.1 protein_id gnl|my_center|LOCUS_28360 3849 5195 gene locus_tag LOCUS_28370 3849 5195 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982317.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence0369 1639 746 gene locus_tag LOCUS_28380 1639 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 3296 1779 gene locus_tag LOCUS_28390 3296 1779 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828527.1 protein_id gnl|my_center|LOCUS_28390 4480 3419 gene locus_tag LOCUS_28400 4480 3419 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_28400 <5341 4486 gene locus_tag LOCUS_28410 <5341 4486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001087135.1:solute:sodium symporter family transporter >Feature sequence0370 459 1139 gene locus_tag LOCUS_28420 gene ispD 459 1139 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_28420 1152 1634 gene locus_tag LOCUS_28430 gene ispF 1152 1634 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_28430 1631 3256 gene locus_tag LOCUS_28440 1631 3256 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_28440 3291 4964 gene locus_tag LOCUS_28450 3291 4964 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140950.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence0371 3496 509 gene locus_tag LOCUS_28460 3496 509 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849598.1 protein_id gnl|my_center|LOCUS_28460 <5330 3538 gene locus_tag LOCUS_28470 <5330 3538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640332.1:TonB-dependent receptor >Feature sequence0372 539 913 gene locus_tag LOCUS_28480 539 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1624 1124 gene locus_tag LOCUS_28490 1624 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 2794 1793 gene locus_tag LOCUS_28500 2794 1793 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_28500 3635 2844 gene locus_tag LOCUS_28510 3635 2844 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_28510 4748 3642 gene locus_tag LOCUS_28520 4748 3642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence0373 1200 457 gene locus_tag LOCUS_28530 1200 457 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_28530 1378 1211 gene locus_tag LOCUS_28540 1378 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1499 2431 gene locus_tag LOCUS_28550 1499 2431 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036000.1 protein_id gnl|my_center|LOCUS_28550 3854 2520 gene locus_tag LOCUS_28560 3854 2520 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_28560 5048 4167 gene locus_tag LOCUS_28570 5048 4167 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence0374 1275 205 gene locus_tag LOCUS_28580 1275 205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_28580 1439 2008 gene locus_tag LOCUS_28590 gene hpt 1439 2008 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 protein_id gnl|my_center|LOCUS_28590 2970 2593 gene locus_tag LOCUS_28600 2970 2593 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_28600 3200 2967 gene locus_tag LOCUS_28610 3200 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3626 3294 gene locus_tag LOCUS_28620 3626 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 <5296 3804 gene locus_tag LOCUS_28630 <5296 3804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391795.1:excinuclease ABC subunit UvrB >Feature sequence0375 1904 1155 gene locus_tag LOCUS_28640 1904 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 4460 2019 gene locus_tag LOCUS_28650 4460 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 4940 4479 gene locus_tag LOCUS_28660 4940 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence0376 122 3226 gene locus_tag LOCUS_28670 122 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 3951 3265 gene locus_tag LOCUS_28680 3951 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 5188 4064 gene locus_tag LOCUS_28690 gene gguB 5188 4064 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974840.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence0377 <1 638 gene locus_tag LOCUS_28700 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970553.1:3-ketoacyl-ACP reductase 748 1104 gene locus_tag LOCUS_28710 748 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 1278 2423 gene locus_tag LOCUS_28720 gene rlmM 1278 2423 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036052.1 protein_id gnl|my_center|LOCUS_28720 2707 3666 gene locus_tag LOCUS_28730 2707 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3742 5145 gene locus_tag LOCUS_28740 3742 5145 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence0378 <1 3761 gene locus_tag LOCUS_28750 <1 3761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728333.1:chromosome segregation protein SMC >Feature sequence0379 339 1733 gene locus_tag LOCUS_28760 gene hisD 339 1733 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968703.1 protein_id gnl|my_center|LOCUS_28760 1802 2914 gene locus_tag LOCUS_28770 gene hisC 1802 2914 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_28770 2890 3492 gene locus_tag LOCUS_28780 gene hisB 2890 3492 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_28780 3505 4089 gene locus_tag LOCUS_28790 3505 4089 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043551827.1 protein_id gnl|my_center|LOCUS_28790 4097 4723 gene locus_tag LOCUS_28800 gene hisH 4097 4723 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence0380 88 984 gene locus_tag LOCUS_28810 88 984 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941223.1 protein_id gnl|my_center|LOCUS_28810 1840 1064 gene locus_tag LOCUS_28820 1840 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 2866 1850 gene locus_tag LOCUS_28830 2866 1850 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142883.1 protein_id gnl|my_center|LOCUS_28830 2938 3570 gene locus_tag LOCUS_28840 2938 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 3680 4357 gene locus_tag LOCUS_28850 3680 4357 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_28850 4857 4648 gene locus_tag LOCUS_28860 4857 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence0381 32 2065 gene locus_tag LOCUS_28870 32 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 2308 3438 gene locus_tag LOCUS_28880 2308 3438 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_28880 4473 3583 gene locus_tag LOCUS_28890 4473 3583 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082250.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence0382 1726 131 gene locus_tag LOCUS_28900 1726 131 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_28900 2425 2592 gene locus_tag LOCUS_28910 2425 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 2685 3131 gene locus_tag LOCUS_28920 2685 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3128 4780 gene locus_tag LOCUS_28930 3128 4780 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence0383 4812 2737 gene locus_tag LOCUS_28940 4812 2737 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928501.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence0384 3159 10 gene locus_tag LOCUS_28950 3159 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 4772 3339 gene locus_tag LOCUS_28960 4772 3339 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_28960 >Feature sequence0385 2370 994 gene locus_tag LOCUS_28970 gene hemL 2370 994 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704436.1 protein_id gnl|my_center|LOCUS_28970 2733 2374 gene locus_tag LOCUS_28980 2733 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 2908 2621 gene locus_tag LOCUS_28990 2908 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 2858 3046 gene locus_tag LOCUS_29000 2858 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 3093 4709 gene locus_tag LOCUS_29010 3093 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 4657 4878 gene locus_tag LOCUS_29020 4657 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence0386 <1 2536 gene locus_tag LOCUS_29030 <1 2536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265653.1:TonB-dependent receptor >Feature sequence0387 <1 1333 gene locus_tag LOCUS_29040 <1 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118026.1:arylsulfatase 1477 1866 gene locus_tag LOCUS_29050 1477 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 1851 4235 gene locus_tag LOCUS_29060 1851 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence0388 106 912 gene locus_tag LOCUS_29070 106 912 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883514.1 protein_id gnl|my_center|LOCUS_29070 2036 1170 gene locus_tag LOCUS_29080 2036 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29080 2231 2055 gene locus_tag LOCUS_29090 2231 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 2503 3942 gene locus_tag LOCUS_29100 gene pyk 2503 3942 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122699.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence0389 494 1129 gene locus_tag LOCUS_29110 gene rplD 494 1129 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_29110 1129 1410 gene locus_tag LOCUS_29120 gene rplW 1129 1410 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879929.1 protein_id gnl|my_center|LOCUS_29120 1500 2309 gene locus_tag LOCUS_29130 gene rplB 1500 2309 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_29130 2328 2603 gene locus_tag LOCUS_29140 gene rpsS 2328 2603 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_29140 2615 2941 gene locus_tag LOCUS_29150 2615 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 3035 3376 gene locus_tag LOCUS_29160 gene rplV 3035 3376 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393932.1 protein_id gnl|my_center|LOCUS_29160 3389 4021 gene locus_tag LOCUS_29170 gene rpsC 3389 4021 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_29170 4062 4484 gene locus_tag LOCUS_29180 gene rplP 4062 4484 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_29180 4503 4706 gene locus_tag LOCUS_29190 4503 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 4735 5076 gene locus_tag LOCUS_29200 4735 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence0390 1765 980 gene locus_tag LOCUS_29210 1765 980 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921987.1 protein_id gnl|my_center|LOCUS_29210 3371 2127 gene locus_tag LOCUS_29220 3371 2127 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_29220 3310 3558 gene locus_tag LOCUS_29230 3310 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 3683 4540 gene locus_tag LOCUS_29240 3683 4540 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence0391 3240 4625 gene locus_tag LOCUS_29250 3240 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence0392 1226 504 gene locus_tag LOCUS_29260 1226 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 2090 1653 gene locus_tag LOCUS_29270 2090 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 2795 2100 gene locus_tag LOCUS_29280 2795 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 3330 4424 gene locus_tag LOCUS_29290 3330 4424 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence0393 1620 577 gene locus_tag LOCUS_29300 gene pheS 1620 577 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_29300 2180 1797 gene locus_tag LOCUS_29310 gene rplT 2180 1797 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553161.1 protein_id gnl|my_center|LOCUS_29310 2467 2273 gene locus_tag LOCUS_29320 2467 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 4430 2733 gene locus_tag LOCUS_29330 gene ggt 4430 2733 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_29330 >Feature sequence0394 2139 1048 gene locus_tag LOCUS_29340 2139 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 2234 4897 gene locus_tag LOCUS_29350 2234 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence0395 2920 899 gene locus_tag LOCUS_29360 gene ftsH 2920 899 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156284.1 protein_id gnl|my_center|LOCUS_29360 4006 2969 gene locus_tag LOCUS_29370 4006 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 <5093 4055 gene locus_tag LOCUS_29380 <5093 4055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404592.1:serine--tRNA ligase >Feature sequence0396 4835 1236 gene locus_tag LOCUS_29390 4835 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence0397 206 478 gene locus_tag LOCUS_29400 206 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 570 3704 gene locus_tag LOCUS_29410 570 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence0398 2148 265 gene locus_tag LOCUS_29420 2148 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 2392 3696 gene locus_tag LOCUS_29430 2392 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence0399 7 474 gene locus_tag LOCUS_29440 gene trmL 7 474 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_29440 2326 593 gene locus_tag LOCUS_29450 2326 593 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_29450 2607 4031 gene locus_tag LOCUS_29460 2607 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence0400 167 415 gene locus_tag LOCUS_29470 167 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 3052 440 gene locus_tag LOCUS_29480 3052 440 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_29480 4100 3054 gene locus_tag LOCUS_29490 4100 3054 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083543.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29490 4895 4362 gene locus_tag LOCUS_29500 4895 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence0401 626 910 gene locus_tag LOCUS_29510 626 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 907 1314 gene locus_tag LOCUS_29520 907 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2209 4290 gene locus_tag LOCUS_29530 2209 4290 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164889854.1 protein_id gnl|my_center|LOCUS_29530 >Feature sequence0402 1131 3449 gene locus_tag LOCUS_29540 1131 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 3758 3522 gene locus_tag LOCUS_29550 gene tatA 3758 3522 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_29550 4212 3814 gene locus_tag LOCUS_29560 4212 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 4880 4251 gene locus_tag LOCUS_29570 4880 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence0403 3689 4069 gene locus_tag LOCUS_29580 3689 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29580 4175 4879 gene locus_tag LOCUS_29590 4175 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence0404 1533 505 gene locus_tag LOCUS_29600 gene ilvC 1533 505 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880791.1 protein_id gnl|my_center|LOCUS_29600 2052 1582 gene locus_tag LOCUS_29610 gene ilvN 2052 1582 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_29610 2156 2080 gene locus_tag LOCUS_t00220 2156 2080 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3327 2281 gene locus_tag LOCUS_29620 3327 2281 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_29620 3311 3868 gene locus_tag LOCUS_29630 3311 3868 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_29630 4332 3925 gene locus_tag LOCUS_29640 4332 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 4723 4370 gene locus_tag LOCUS_29650 4723 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence0405 614 444 gene locus_tag LOCUS_29660 614 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 598 2382 gene locus_tag LOCUS_29670 598 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3159 2737 gene locus_tag LOCUS_29680 3159 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3437 3156 gene locus_tag LOCUS_29690 3437 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 3626 3447 gene locus_tag LOCUS_29700 3626 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence0406 569 207 gene locus_tag LOCUS_29710 569 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 900 586 gene locus_tag LOCUS_29720 900 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 1107 1943 gene locus_tag LOCUS_29730 1107 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 2428 2048 gene locus_tag LOCUS_29740 2428 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 2658 2425 gene locus_tag LOCUS_29750 2658 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3031 2762 gene locus_tag LOCUS_29760 3031 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 3320 2943 gene locus_tag LOCUS_29770 3320 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 4940 3516 gene locus_tag LOCUS_29780 4940 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 >Feature sequence0407 356 1213 gene locus_tag LOCUS_29790 gene rsmA 356 1213 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_29790 1252 1941 gene locus_tag LOCUS_29800 1252 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 2049 2546 gene locus_tag LOCUS_29810 2049 2546 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193331.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence0408 3 584 gene locus_tag LOCUS_29820 3 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 789 2585 gene locus_tag LOCUS_29830 789 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 2633 4372 gene locus_tag LOCUS_29840 2633 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 4369 4683 gene locus_tag LOCUS_29850 gene rhaM 4369 4683 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099341.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence0409 <1 2872 gene locus_tag LOCUS_29860 <1 2872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626173.1:TonB-dependent siderophore receptor 3262 4896 gene locus_tag LOCUS_29870 3262 4896 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132123697.1 protein_id gnl|my_center|LOCUS_29870 >Feature sequence0410 3682 794 gene locus_tag LOCUS_29880 3682 794 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838099.1 protein_id gnl|my_center|LOCUS_29880 <4895 3736 gene locus_tag LOCUS_29890 <4895 3736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783463.1:TonB-dependent receptor >Feature sequence0411 1464 139 gene locus_tag LOCUS_29900 gene rsmB 1464 139 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_29900 1578 3416 gene locus_tag LOCUS_29910 1578 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 >Feature sequence0412 2104 1571 gene locus_tag LOCUS_29920 2104 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 2649 2101 gene locus_tag LOCUS_29930 2649 2101 CDS product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958464.1 protein_id gnl|my_center|LOCUS_29930 <4873 2844 gene locus_tag LOCUS_29940 <4873 2844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933346.1:pyruvate, phosphate dikinase >Feature sequence0413 355 131 gene locus_tag LOCUS_29950 355 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 668 1051 gene locus_tag LOCUS_29960 668 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 2124 1039 gene locus_tag LOCUS_29970 gene rsgA 2124 1039 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_29970 2817 2155 gene locus_tag LOCUS_29980 2817 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 2909 4537 gene locus_tag LOCUS_29990 2909 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence0414 1529 87 gene locus_tag LOCUS_30000 gene mpl 1529 87 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266525.1 protein_id gnl|my_center|LOCUS_30000 2354 1641 gene locus_tag LOCUS_30010 2354 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 2515 3105 gene locus_tag LOCUS_30020 2515 3105 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_30020 3102 4037 gene locus_tag LOCUS_30030 3102 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 >Feature sequence0415 <1 1429 gene locus_tag LOCUS_30040 <1 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072546.1:DUF1329 domain-containing protein 1471 2382 gene locus_tag LOCUS_30050 1471 2382 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 protein_id gnl|my_center|LOCUS_30050 2454 4799 gene locus_tag LOCUS_30060 2454 4799 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_30060 >Feature sequence0416 1 801 gene locus_tag LOCUS_30070 1 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 1508 759 gene locus_tag LOCUS_30080 1508 759 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_30080 2147 2872 gene locus_tag LOCUS_30090 2147 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 2874 4163 gene locus_tag LOCUS_30100 gene xseA 2874 4163 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261371.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence0417 <1 1052 gene locus_tag LOCUS_30110 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095328.1:Gfo/Idh/MocA family oxidoreductase 1255 1404 gene locus_tag LOCUS_30120 1255 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 1415 1606 gene locus_tag LOCUS_30130 1415 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 1584 1991 gene locus_tag LOCUS_30140 gene vapc11 1584 1991 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_30140 1998 2540 gene locus_tag LOCUS_30150 1998 2540 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_30150 2676 3254 gene locus_tag LOCUS_30160 2676 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 <4832 3332 gene locus_tag LOCUS_30170 <4832 3332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460344.1:PhoH family protein >Feature sequence0418 2293 1106 gene locus_tag LOCUS_30180 2293 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 4584 2302 gene locus_tag LOCUS_30190 4584 2302 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545674.1 protein_id gnl|my_center|LOCUS_30190 >Feature sequence0419 <1 1425 gene locus_tag LOCUS_30200 <1 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261780.1:amidohydrolase 1956 1429 gene locus_tag LOCUS_30210 1956 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30210 2652 2098 gene locus_tag LOCUS_30220 2652 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30220 >Feature sequence0420 2997 262 gene locus_tag LOCUS_30230 2997 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 4347 3088 gene locus_tag LOCUS_30240 4347 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921591.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence0421 1028 1819 gene locus_tag LOCUS_30250 1028 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 1800 2264 gene locus_tag LOCUS_30260 1800 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2323 3549 gene locus_tag LOCUS_30270 2323 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 <4806 3921 gene locus_tag LOCUS_30280 <4806 3921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338948.1:plasmid partitioning protein RepB C-terminal domain-containing protein >Feature sequence0422 800 198 gene locus_tag LOCUS_30290 gene leuD 800 198 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_30290 2325 913 gene locus_tag LOCUS_30300 gene leuC 2325 913 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_30300 2580 3557 gene locus_tag LOCUS_30310 2580 3557 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808657.1 protein_id gnl|my_center|LOCUS_30310 <4736 3840 gene locus_tag LOCUS_30320 <4736 3840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004967149.1:IS66-like element ISSfl3 family transposase >Feature sequence0423 160 993 gene locus_tag LOCUS_30330 160 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 1084 1746 gene locus_tag LOCUS_30340 gene pnuC 1084 1746 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035913.1 protein_id gnl|my_center|LOCUS_30340 1743 2294 gene locus_tag LOCUS_30350 1743 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 2361 3224 gene locus_tag LOCUS_30360 2361 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3477 3674 gene locus_tag LOCUS_30370 3477 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3671 4066 gene locus_tag LOCUS_30380 3671 4066 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_30380 >Feature sequence0424 188 1288 gene locus_tag LOCUS_30390 188 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 4554 1369 gene locus_tag LOCUS_30400 4554 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence0425 698 318 gene locus_tag LOCUS_30410 698 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 1081 773 gene locus_tag LOCUS_30420 1081 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 2619 1588 gene locus_tag LOCUS_30430 gene aroF 2619 1588 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_30430 3423 2662 gene locus_tag LOCUS_30440 3423 2662 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073014.1 protein_id gnl|my_center|LOCUS_30440 4544 3420 gene locus_tag LOCUS_30450 4544 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 >Feature sequence0426 2967 2167 gene locus_tag LOCUS_30460 2967 2167 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907549.1 protein_id gnl|my_center|LOCUS_30460 3994 3395 gene locus_tag LOCUS_30470 3994 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence0427 1042 230 gene locus_tag LOCUS_30480 1042 230 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30480 1228 1055 gene locus_tag LOCUS_30490 1228 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30490 2166 1225 gene locus_tag LOCUS_30500 2166 1225 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_30500 2933 2163 gene locus_tag LOCUS_30510 2933 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 3153 3356 gene locus_tag LOCUS_30520 3153 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 <4655 3616 gene locus_tag LOCUS_30530 <4655 3616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064987376.1:IS1380 family transposase >Feature sequence0428 268 3744 gene locus_tag LOCUS_30540 268 3744 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence0429 1792 680 gene locus_tag LOCUS_30550 1792 680 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_30550 2253 1789 gene locus_tag LOCUS_30560 2253 1789 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_30560 <4636 2250 gene locus_tag LOCUS_30570 <4636 2250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119753.1:PQQ-dependent sugar dehydrogenase >Feature sequence0430 1112 381 gene locus_tag LOCUS_30580 1112 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 1812 1195 gene locus_tag LOCUS_30590 1812 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 2531 1860 gene locus_tag LOCUS_30600 2531 1860 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_30600 3284 2685 gene locus_tag LOCUS_30610 3284 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 <4632 3545 gene locus_tag LOCUS_30620 <4632 3545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964604.1:HD family phosphohydrolase >Feature sequence0431 246 88 gene locus_tag LOCUS_30630 246 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 1657 239 gene locus_tag LOCUS_30640 1657 239 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928739.1 protein_id gnl|my_center|LOCUS_30640 3081 1654 gene locus_tag LOCUS_30650 3081 1654 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_30650 <4632 3089 gene locus_tag LOCUS_30660 <4632 3089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035779.1:TonB-dependent receptor >Feature sequence0432 1882 743 gene locus_tag LOCUS_30670 1882 743 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_30670 2980 1886 gene locus_tag LOCUS_30680 2980 1886 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_30680 4340 3006 gene locus_tag LOCUS_30690 gene hemL 4340 3006 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence0433 1529 351 gene locus_tag LOCUS_30700 1529 351 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_30700 1687 2313 gene locus_tag LOCUS_30710 1687 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 3467 2292 gene locus_tag LOCUS_30720 gene aepY 3467 2292 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_30720 <4612 3481 gene locus_tag LOCUS_30730 <4612 3481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188554.1:phosphoenolpyruvate mutase >Feature sequence0434 1508 429 gene locus_tag LOCUS_30740 1508 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 3168 1669 gene locus_tag LOCUS_30750 3168 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 4502 3165 gene locus_tag LOCUS_30760 4502 3165 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence0435 <1 1339 gene locus_tag LOCUS_30770 <1 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257847.1:NADH-quinone oxidoreductase subunit M 1336 2877 gene locus_tag LOCUS_30780 1336 2877 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_30780 2874 4352 gene locus_tag LOCUS_30790 2874 4352 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257845.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence0436 2225 987 gene locus_tag LOCUS_30800 gene pelA 2225 987 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427768.1 protein_id gnl|my_center|LOCUS_30800 2935 2510 gene locus_tag LOCUS_30810 2935 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3322 3173 gene locus_tag LOCUS_30820 3322 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3397 4479 gene locus_tag LOCUS_30830 3397 4479 CDS product glycosyltransferase family 61 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190897490.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence0437 239 490 gene locus_tag LOCUS_30840 239 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 408 695 gene locus_tag LOCUS_30850 408 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 1280 1507 gene locus_tag LOCUS_30860 1280 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 2825 3193 gene locus_tag LOCUS_30870 2825 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence0438 <1 774 gene locus_tag LOCUS_30880 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861272.1:ABC transporter permease 981 2300 gene locus_tag LOCUS_30890 981 2300 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356165.1 protein_id gnl|my_center|LOCUS_30890 4184 2310 gene locus_tag LOCUS_30900 4184 2310 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_30900 4500 4249 gene locus_tag LOCUS_30910 4500 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence0439 1021 2745 gene locus_tag LOCUS_30920 1021 2745 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_30920 2772 3962 gene locus_tag LOCUS_30930 2772 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 4360 4058 gene locus_tag LOCUS_30940 4360 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence0440 93 3299 gene locus_tag LOCUS_30950 gene dnaE2 93 3299 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908228.1 protein_id gnl|my_center|LOCUS_30950 3897 4064 gene locus_tag LOCUS_30960 3897 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 4064 4429 gene locus_tag LOCUS_30970 gene crcB 4064 4429 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_30970 >Feature sequence0441 1712 2041 gene locus_tag LOCUS_30980 1712 2041 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_30980 2231 3475 gene locus_tag LOCUS_30990 2231 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 3488 4402 gene locus_tag LOCUS_31000 3488 4402 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_31000 >Feature sequence0442 235 1068 gene locus_tag LOCUS_31010 235 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 1065 3035 gene locus_tag LOCUS_31020 1065 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence0443 155 1075 gene locus_tag LOCUS_31030 155 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 1922 1068 gene locus_tag LOCUS_31040 1922 1068 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 protein_id gnl|my_center|LOCUS_31040 2048 2896 gene locus_tag LOCUS_31050 2048 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 2993 4276 gene locus_tag LOCUS_31060 2993 4276 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_31060 >Feature sequence0444 616 404 gene locus_tag LOCUS_31070 616 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 1151 654 gene locus_tag LOCUS_31080 1151 654 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_31080 1282 2286 gene locus_tag LOCUS_31090 gene xylF 1282 2286 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_31090 2327 4015 gene locus_tag LOCUS_31100 2327 4015 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_31100 4040 4510 gene locus_tag LOCUS_31110 4040 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence0445 149 565 gene locus_tag LOCUS_31120 149 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 1162 2727 gene locus_tag LOCUS_31130 1162 2727 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338946.1 protein_id gnl|my_center|LOCUS_31130 2724 3608 gene locus_tag LOCUS_31140 2724 3608 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974304.1 protein_id gnl|my_center|LOCUS_31140 3608 4492 gene locus_tag LOCUS_31150 3608 4492 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338948.1 protein_id gnl|my_center|LOCUS_31150 >Feature sequence0446 <1 949 gene locus_tag LOCUS_31160 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921302.1:DUF1501 domain-containing protein 1048 1608 gene locus_tag LOCUS_31170 1048 1608 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880755.1 protein_id gnl|my_center|LOCUS_31170 1961 4399 gene locus_tag LOCUS_31180 1961 4399 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_31180 >Feature sequence0447 3 197 gene locus_tag LOCUS_31190 3 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 317 1333 gene locus_tag LOCUS_31200 317 1333 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_31200 4430 1515 gene locus_tag LOCUS_31210 4430 1515 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence0448 2945 2157 gene locus_tag LOCUS_31220 2945 2157 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256806.1 protein_id gnl|my_center|LOCUS_31220 2944 4083 gene locus_tag LOCUS_31230 2944 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 >Feature sequence0449 <1 850 gene locus_tag LOCUS_31240 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015839.1:DMT family transporter 1729 857 gene locus_tag LOCUS_31250 1729 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 2455 1883 gene locus_tag LOCUS_31260 2455 1883 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_31260 2913 2479 gene locus_tag LOCUS_31270 2913 2479 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258016.1 protein_id gnl|my_center|LOCUS_31270 3080 3748 gene locus_tag LOCUS_31280 gene lexA 3080 3748 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942262.1 protein_id gnl|my_center|LOCUS_31280 3777 4421 gene locus_tag LOCUS_31290 3777 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 >Feature sequence0450 <1 2350 gene locus_tag LOCUS_31300 <1 2350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein 2363 3763 gene locus_tag LOCUS_31310 gene mshL 2363 3763 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456314.1 protein_id gnl|my_center|LOCUS_31310 >Feature sequence0451 862 368 gene locus_tag LOCUS_31320 862 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 <4426 1380 gene locus_tag LOCUS_31330 <4426 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009871661.1:DNA-directed RNA polymerase subunit beta' >Feature sequence0452 <1 1635 gene locus_tag LOCUS_31340 <1 1635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006313182.1:DNA mismatch repair endonuclease MutL 1706 4339 gene locus_tag LOCUS_31350 1706 4339 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706264.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence0453 1970 3700 gene locus_tag LOCUS_31360 1970 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence0454 2622 2215 gene locus_tag LOCUS_31370 2622 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 2761 4263 gene locus_tag LOCUS_31380 2761 4263 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence0455 2876 1350 gene locus_tag LOCUS_31390 2876 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 4078 2873 gene locus_tag LOCUS_31400 4078 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence0456 1382 627 gene locus_tag LOCUS_31410 1382 627 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_31410 2640 1483 gene locus_tag LOCUS_31420 2640 1483 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_31420 3614 2679 gene locus_tag LOCUS_31430 3614 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 <4365 3611 gene locus_tag LOCUS_31440 <4365 3611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227986.1:FAD-linked oxidase C-terminal domain-containing protein >Feature sequence0457 89 670 gene locus_tag LOCUS_31450 89 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 739 1542 gene locus_tag LOCUS_31460 739 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 3029 1671 gene locus_tag LOCUS_31470 3029 1671 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_31470 3483 3097 gene locus_tag LOCUS_31480 3483 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence0458 333 1241 gene locus_tag LOCUS_31490 333 1241 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941223.1 protein_id gnl|my_center|LOCUS_31490 3166 2588 gene locus_tag LOCUS_31500 3166 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31500 3502 3170 gene locus_tag LOCUS_31510 3502 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 3900 3553 gene locus_tag LOCUS_31520 gene tnpB 3900 3553 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622997.1 protein_id gnl|my_center|LOCUS_31520 4238 3990 gene locus_tag LOCUS_31530 4238 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence0459 <1 2487 gene locus_tag LOCUS_31540 <1 2487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921281.1:PSD1 and planctomycete cytochrome C domain-containing protein 2501 3955 gene locus_tag LOCUS_31550 2501 3955 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329353.1 protein_id gnl|my_center|LOCUS_31550 3982 4287 gene locus_tag LOCUS_31560 3982 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence0460 1165 1314 gene locus_tag LOCUS_31570 1165 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 2525 1689 gene locus_tag LOCUS_31580 2525 1689 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948577.1 protein_id gnl|my_center|LOCUS_31580 2977 4242 gene locus_tag LOCUS_31590 2977 4242 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112131468.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence0461 1330 38 gene locus_tag LOCUS_31600 1330 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 1729 1373 gene locus_tag LOCUS_31610 1729 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 1847 2152 gene locus_tag LOCUS_31620 1847 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 2266 2679 gene locus_tag LOCUS_31630 2266 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2706 3317 gene locus_tag LOCUS_31640 2706 3317 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_31640 <4334 3495 gene locus_tag LOCUS_31650 <4334 3495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933069.1:ATP-dependent RecD-like DNA helicase >Feature sequence0462 <1 552 gene locus_tag LOCUS_31660 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327063.1:MoxR family ATPase 558 1523 gene locus_tag LOCUS_31670 558 1523 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_31670 1520 3592 gene locus_tag LOCUS_31680 1520 3592 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_31680 >Feature sequence0463 <1 525 gene locus_tag LOCUS_31690 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391554.1:DNA replication/repair protein RecF 522 1268 gene locus_tag LOCUS_31700 522 1268 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122308.1 protein_id gnl|my_center|LOCUS_31700 1256 1870 gene locus_tag LOCUS_31710 1256 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 2691 1999 gene locus_tag LOCUS_31720 2691 1999 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 protein_id gnl|my_center|LOCUS_31720 3086 2721 gene locus_tag LOCUS_31730 3086 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 <4328 3309 gene locus_tag LOCUS_31740 <4328 3309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein >Feature sequence0464 905 1624 gene locus_tag LOCUS_31750 905 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 2299 3438 gene locus_tag LOCUS_31760 2299 3438 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_31760 <4327 3538 gene locus_tag LOCUS_31770 <4327 3538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226386.1:rhamnulokinase family protein >Feature sequence0465 <1 1147 gene locus_tag LOCUS_31780 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392119.1:radical SAM family heme chaperone HemW 1409 1891 gene locus_tag LOCUS_31790 1409 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1891 2907 gene locus_tag LOCUS_31800 1891 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 3151 3077 gene locus_tag LOCUS_t00230 3151 3077 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3941 3246 gene locus_tag LOCUS_31810 3941 3246 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 protein_id gnl|my_center|LOCUS_31810 4209 3991 gene locus_tag LOCUS_31820 4209 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 >Feature sequence0466 834 559 gene locus_tag LOCUS_31830 834 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1342 923 gene locus_tag LOCUS_31840 gene ndk 1342 923 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123449.1 protein_id gnl|my_center|LOCUS_31840 >Feature sequence0467 365 1837 gene locus_tag LOCUS_31850 365 1837 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_31850 >Feature sequence0468 1801 194 gene locus_tag LOCUS_31860 1801 194 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_31860 3153 1798 gene locus_tag LOCUS_31870 3153 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 3359 3150 gene locus_tag LOCUS_31880 3359 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 <4310 3443 gene locus_tag LOCUS_31890 <4310 3443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404755.1:TonB-dependent receptor >Feature sequence0469 59 844 gene locus_tag LOCUS_31900 59 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 945 1700 gene locus_tag LOCUS_31910 945 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 1966 1631 gene locus_tag LOCUS_31920 1966 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 3808 2285 gene locus_tag LOCUS_31930 3808 2285 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460435.1 protein_id gnl|my_center|LOCUS_31930 >Feature sequence0470 <1 1212 gene locus_tag LOCUS_31940 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003819869.1:iron ABC transporter permease 1369 2319 gene locus_tag LOCUS_31950 1369 2319 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418680.1 protein_id gnl|my_center|LOCUS_31950 3511 2453 gene locus_tag LOCUS_31960 3511 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence0471 <1 2523 gene locus_tag LOCUS_31970 <1 2523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404755.1:TonB-dependent receptor 3422 2928 gene locus_tag LOCUS_31980 3422 2928 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 protein_id gnl|my_center|LOCUS_31980 3601 3939 gene locus_tag LOCUS_31990 3601 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 >Feature sequence0472 1703 660 gene locus_tag LOCUS_32000 1703 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 2294 1902 gene locus_tag LOCUS_32010 2294 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 3829 2372 gene locus_tag LOCUS_32020 3829 2372 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275161.1 protein_id gnl|my_center|LOCUS_32020 >Feature sequence0473 366 971 gene locus_tag LOCUS_32030 366 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 968 1885 gene locus_tag LOCUS_32040 968 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 2446 1988 gene locus_tag LOCUS_32050 gene lspA 2446 1988 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245047.1 protein_id gnl|my_center|LOCUS_32050 3594 2593 gene locus_tag LOCUS_32060 3594 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 <4293 3625 gene locus_tag LOCUS_32070 <4293 3625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546193.1:isoleucine--tRNA ligase >Feature sequence0474 384 1307 gene locus_tag LOCUS_32080 384 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 1304 3394 gene locus_tag LOCUS_32090 1304 3394 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921685.1 protein_id gnl|my_center|LOCUS_32090 >Feature sequence0475 693 1076 gene locus_tag LOCUS_32100 693 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 1152 1844 gene locus_tag LOCUS_32110 1152 1844 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083678.1 protein_id gnl|my_center|LOCUS_32110 3966 1855 gene locus_tag LOCUS_32120 3966 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 >Feature sequence0476 908 3904 gene locus_tag LOCUS_32130 908 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 >Feature sequence0477 920 120 gene locus_tag LOCUS_32140 920 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 1440 2657 gene locus_tag LOCUS_32150 1440 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 4159 2876 gene locus_tag LOCUS_32160 gene fabB 4159 2876 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence0478 <1 617 gene locus_tag LOCUS_32170 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146849598.1:PSD1 and planctomycete cytochrome C domain-containing protein 730 2193 gene locus_tag LOCUS_32180 730 2193 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_32180 3676 2330 gene locus_tag LOCUS_32190 3676 2330 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_32190 3785 4159 gene locus_tag LOCUS_32200 3785 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence0479 <1 1348 gene locus_tag LOCUS_32210 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921292.1:sulfatase-like hydrolase/transferase 3364 1730 gene locus_tag LOCUS_32220 3364 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 3526 3726 gene locus_tag LOCUS_32230 3526 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 >Feature sequence0480 822 505 gene locus_tag LOCUS_32240 gene nuoK 822 505 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_32240 1403 819 gene locus_tag LOCUS_32250 1403 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 2703 1450 gene locus_tag LOCUS_32260 gene nuoH 2703 1450 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257851.1 protein_id gnl|my_center|LOCUS_32260 3317 2700 gene locus_tag LOCUS_32270 3317 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 <4203 3442 gene locus_tag LOCUS_32280 <4203 3442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257853.1:NADH-quinone oxidoreductase subunit D >Feature sequence0481 <1 1063 gene locus_tag LOCUS_32290 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816805.1:DUF1549 and DUF1553 domain-containing protein 1084 2361 gene locus_tag LOCUS_32300 1084 2361 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_32300 2458 3687 gene locus_tag LOCUS_32310 2458 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 >Feature sequence0482 262 2883 gene locus_tag LOCUS_32320 262 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 4105 3107 gene locus_tag LOCUS_32330 4105 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence0483 3796 2744 gene locus_tag LOCUS_32340 3796 2744 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918866.1 protein_id gnl|my_center|LOCUS_32340 >Feature sequence0484 <1 1531 gene locus_tag LOCUS_32350 <1 1531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921791.1:DUF1501 domain-containing protein >Feature sequence0485 1791 781 gene locus_tag LOCUS_32360 1791 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 2285 1788 gene locus_tag LOCUS_32370 2285 1788 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921864.1 protein_id gnl|my_center|LOCUS_32370 3570 3070 gene locus_tag LOCUS_32380 3570 3070 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_32380 3812 3567 gene locus_tag LOCUS_32390 3812 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 >Feature sequence0486 <1 856 gene locus_tag LOCUS_32400 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222557.1:3-amino-5-hydroxybenzoate synthase 893 1834 gene locus_tag LOCUS_32410 893 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 2281 3642 gene locus_tag LOCUS_32420 2281 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3723 3813 gene locus_tag LOCUS_t00240 3723 3813 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0487 1140 139 gene locus_tag LOCUS_32430 1140 139 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_32430 2009 1314 gene locus_tag LOCUS_32440 2009 1314 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227310.1 protein_id gnl|my_center|LOCUS_32440 3937 2006 gene locus_tag LOCUS_32450 3937 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence0488 211 1272 gene locus_tag LOCUS_32460 211 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 1445 2215 gene locus_tag LOCUS_32470 1445 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3107 2205 gene locus_tag LOCUS_32480 3107 2205 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055221127.1 protein_id gnl|my_center|LOCUS_32480 >Feature sequence0489 442 1338 gene locus_tag LOCUS_32490 gene ispE 442 1338 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923490.1 protein_id gnl|my_center|LOCUS_32490 1414 3189 gene locus_tag LOCUS_32500 gene ptsP 1414 3189 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_32500 3371 3964 gene locus_tag LOCUS_32510 3371 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence0490 12 1673 gene locus_tag LOCUS_32520 12 1673 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_32520 2623 1736 gene locus_tag LOCUS_32530 2623 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 2666 3241 gene locus_tag LOCUS_32540 gene pyrE 2666 3241 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393616.1 protein_id gnl|my_center|LOCUS_32540 <4127 3321 gene locus_tag LOCUS_32550 <4127 3321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933114.1:DegQ family serine endoprotease >Feature sequence0491 1584 559 gene locus_tag LOCUS_32560 1584 559 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_32560 3334 1607 gene locus_tag LOCUS_32570 3334 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence0492 3204 1534 gene locus_tag LOCUS_32580 3204 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 3986 3201 gene locus_tag LOCUS_32590 3986 3201 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253881.1 protein_id gnl|my_center|LOCUS_32590 >Feature sequence0493 191 1996 gene locus_tag LOCUS_32600 gene lepA 191 1996 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_32600 1997 2980 gene locus_tag LOCUS_32610 gene lepB 1997 2980 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 protein_id gnl|my_center|LOCUS_32610 3013 3756 gene locus_tag LOCUS_32620 3013 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence0494 1075 2043 gene locus_tag LOCUS_32630 1075 2043 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_32630 >Feature sequence0495 176 1390 gene locus_tag LOCUS_32640 176 1390 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_32640 1486 2844 gene locus_tag LOCUS_32650 gene thrC 1486 2844 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153458433.1 protein_id gnl|my_center|LOCUS_32650 3131 3568 gene locus_tag LOCUS_32660 3131 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 >Feature sequence0496 472 1728 gene locus_tag LOCUS_32670 472 1728 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640575.1 protein_id gnl|my_center|LOCUS_32670 1730 1963 gene locus_tag LOCUS_32680 1730 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 1967 2341 gene locus_tag LOCUS_32690 1967 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 <4081 2371 gene locus_tag LOCUS_32700 <4081 2371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080037.1:ATP-dependent helicase >Feature sequence0497 72 875 gene locus_tag LOCUS_32710 72 875 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_32710 1360 950 gene locus_tag LOCUS_32720 1360 950 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185161.1 protein_id gnl|my_center|LOCUS_32720 1673 2908 gene locus_tag LOCUS_32730 1673 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 >Feature sequence0498 1788 388 gene locus_tag LOCUS_32740 1788 388 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_32740 2483 1857 gene locus_tag LOCUS_32750 2483 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 2857 2483 gene locus_tag LOCUS_32760 2857 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 3395 2847 gene locus_tag LOCUS_32770 3395 2847 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_32770 >Feature sequence0499 <1 2127 gene locus_tag LOCUS_32780 <1 2127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920130.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 3927 2209 gene locus_tag LOCUS_32790 3927 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence0500 <1 1284 gene locus_tag LOCUS_32800 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051073366.1:sulfatase >Feature sequence0501 <1 702 gene locus_tag LOCUS_32810 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121664.1:sulfatase-like hydrolase/transferase 749 3931 gene locus_tag LOCUS_32820 749 3931 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence0502 478 68 gene locus_tag LOCUS_32830 478 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32830 1992 589 gene locus_tag LOCUS_32840 1992 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921598.1 protein_id gnl|my_center|LOCUS_32840 2493 3266 gene locus_tag LOCUS_32850 2493 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence0503 303 1007 gene locus_tag LOCUS_32860 303 1007 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889164.1 protein_id gnl|my_center|LOCUS_32860 1554 1039 gene locus_tag LOCUS_32870 1554 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 1681 2118 gene locus_tag LOCUS_32880 1681 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 2127 2936 gene locus_tag LOCUS_32890 2127 2936 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_32890 >Feature sequence0504 50 1198 gene locus_tag LOCUS_32900 50 1198 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393241.1 protein_id gnl|my_center|LOCUS_32900 1337 2032 gene locus_tag LOCUS_32910 1337 2032 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_32910 2926 2102 gene locus_tag LOCUS_32920 2926 2102 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_32920 >Feature sequence0505 3702 916 gene locus_tag LOCUS_32930 3702 916 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence0506 192 3227 gene locus_tag LOCUS_32940 192 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence0507 674 402 gene locus_tag LOCUS_32950 674 402 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 protein_id gnl|my_center|LOCUS_32950 2615 780 gene locus_tag LOCUS_32960 2615 780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_32960 <3967 2782 gene locus_tag LOCUS_32970 <3967 2782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813559.1:ABC transporter ATP-binding protein >Feature sequence0508 <3965 2659 gene locus_tag LOCUS_32980 <3965 2659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545206.1:apolipoprotein N-acyltransferase >Feature sequence0509 3806 2517 gene locus_tag LOCUS_32990 3806 2517 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766635.1 protein_id gnl|my_center|LOCUS_32990 >Feature sequence0510 1251 2828 gene locus_tag LOCUS_33000 1251 2828 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_33000 <3927 2907 gene locus_tag LOCUS_33010 <3927 2907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404755.1:TonB-dependent receptor >Feature sequence0511 <1 2010 gene locus_tag LOCUS_33020 <1 2010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583665.1:phenylalanine--tRNA ligase subunit beta 2066 2374 gene locus_tag LOCUS_33030 gene gatC 2066 2374 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722233.1 protein_id gnl|my_center|LOCUS_33030 2415 3878 gene locus_tag LOCUS_33040 gene gatA 2415 3878 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_33040 >Feature sequence0512 >Feature sequence0513 886 1755 gene locus_tag LOCUS_33050 gene ilvE 886 1755 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_33050 1949 2461 gene locus_tag LOCUS_33060 1949 2461 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128393.1 protein_id gnl|my_center|LOCUS_33060 2466 3557 gene locus_tag LOCUS_33070 2466 3557 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810224.1 protein_id gnl|my_center|LOCUS_33070 >Feature sequence0514 >Feature sequence0515 2977 2738 gene locus_tag LOCUS_33080 2977 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 3608 3132 gene locus_tag LOCUS_33090 3608 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 3525 3731 gene locus_tag LOCUS_33100 3525 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 >Feature sequence0516 1107 3023 gene locus_tag LOCUS_33110 1107 3023 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_33110 >Feature sequence0517 <1 683 gene locus_tag LOCUS_33120 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107128.1:GntP family permease 680 1768 gene locus_tag LOCUS_33130 680 1768 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_33130 2027 3121 gene locus_tag LOCUS_33140 2027 3121 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence0518 <1 1032 gene locus_tag LOCUS_33150 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727455.1:CaiB/BaiF CoA-transferase family protein 1029 1823 gene locus_tag LOCUS_33160 1029 1823 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_33160 1905 2258 gene locus_tag LOCUS_33170 1905 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33170 2283 2510 gene locus_tag LOCUS_33180 2283 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33180 2483 2701 gene locus_tag LOCUS_33190 2483 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 2729 3235 gene locus_tag LOCUS_33200 2729 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3129 3650 gene locus_tag LOCUS_33210 3129 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence0519 1219 3237 gene locus_tag LOCUS_33220 1219 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence0520 184 396 gene locus_tag LOCUS_33230 184 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 396 662 gene locus_tag LOCUS_33240 396 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 659 1726 gene locus_tag LOCUS_33250 gene rfbB 659 1726 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_33250 1766 2089 gene locus_tag LOCUS_33260 1766 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 2134 3060 gene locus_tag LOCUS_33270 gene rfbA 2134 3060 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_33270 >Feature sequence0521 <1 986 gene locus_tag LOCUS_33280 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942580.1:biotin--[acetyl-CoA-carboxylase] ligase 2116 2355 gene locus_tag LOCUS_33290 2116 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 2687 3694 gene locus_tag LOCUS_33300 2687 3694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence0522 333 1853 gene locus_tag LOCUS_33310 333 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 >Feature sequence0523 91 1353 gene locus_tag LOCUS_33320 91 1353 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence0524 1096 437 gene locus_tag LOCUS_33330 1096 437 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883952.1 protein_id gnl|my_center|LOCUS_33330 3159 1096 gene locus_tag LOCUS_33340 3159 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 >Feature sequence0525 836 363 gene locus_tag LOCUS_33350 gene ribH 836 363 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249384.1 protein_id gnl|my_center|LOCUS_33350 2564 1197 gene locus_tag LOCUS_33360 2564 1197 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_33360 >Feature sequence0526 <1 1413 gene locus_tag LOCUS_33370 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120149.1:sulfatase 1487 2935 gene locus_tag LOCUS_33380 1487 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence0527 <1 1108 gene locus_tag LOCUS_33390 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886436.1:rhamnogalacturonan lyase 1150 1746 gene locus_tag LOCUS_33400 1150 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 3317 2874 gene locus_tag LOCUS_33410 3317 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence0528 93 878 gene locus_tag LOCUS_33420 93 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 889 2199 gene locus_tag LOCUS_33430 gene ftsZ 889 2199 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014920.1 protein_id gnl|my_center|LOCUS_33430 2276 3316 gene locus_tag LOCUS_33440 gene obgE 2276 3316 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_33440 >Feature sequence0529 1954 866 gene locus_tag LOCUS_33450 1954 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence0530 1663 2592 gene locus_tag LOCUS_33460 1663 2592 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_33460 2589 3506 gene locus_tag LOCUS_33470 2589 3506 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385340.1 protein_id gnl|my_center|LOCUS_33470 >Feature sequence0531 223 729 gene locus_tag LOCUS_33480 223 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 742 1656 gene locus_tag LOCUS_33490 742 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 1805 3592 gene locus_tag LOCUS_33500 1805 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence0532 >Feature sequence0533 132 1004 gene locus_tag LOCUS_33510 132 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 2456 1074 gene locus_tag LOCUS_33520 2456 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_33520 2851 3198 gene locus_tag LOCUS_33530 2851 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3230 3544 gene locus_tag LOCUS_33540 3230 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 >Feature sequence0534 487 1683 gene locus_tag LOCUS_33550 487 1683 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403293.1 protein_id gnl|my_center|LOCUS_33550 2824 1859 gene locus_tag LOCUS_33560 2824 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 <3768 2875 gene locus_tag LOCUS_33570 <3768 2875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061530.1:glycosyltransferase family 4 protein >Feature sequence0535 <1 903 gene locus_tag LOCUS_33580 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008663661.1:Nramp family divalent metal transporter 1073 2797 gene locus_tag LOCUS_33590 1073 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence0536 <1 3439 gene locus_tag LOCUS_33600 <1 3439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615995.1:c-type cytochrome >Feature sequence0537 2520 505 gene locus_tag LOCUS_33610 2520 505 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_33610 3314 3108 gene locus_tag LOCUS_33620 3314 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 >Feature sequence0538 991 116 gene locus_tag LOCUS_33630 991 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 1190 2308 gene locus_tag LOCUS_33640 1190 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941754.1 protein_id gnl|my_center|LOCUS_33640 >Feature sequence0539 >Feature sequence0540 3715 1196 gene locus_tag LOCUS_33650 3715 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence0541 1067 339 gene locus_tag LOCUS_33660 1067 339 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334461.1 protein_id gnl|my_center|LOCUS_33660 1354 2049 gene locus_tag LOCUS_33670 1354 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 2046 3101 gene locus_tag LOCUS_33680 2046 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence0542 923 3217 gene locus_tag LOCUS_33690 923 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 >Feature sequence0543 >Feature sequence0544 154 1077 gene locus_tag LOCUS_33700 154 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 1710 1180 gene locus_tag LOCUS_33710 1710 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 >Feature sequence0545 <1 2621 gene locus_tag LOCUS_33720 <1 2621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920956.1:efflux RND transporter permease subunit <3690 3001 gene locus_tag LOCUS_33730 <3690 3001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085976166.1:IS3 family transposase >Feature sequence0546 317 1255 gene locus_tag LOCUS_33740 317 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 2710 1337 gene locus_tag LOCUS_33750 2710 1337 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037764.1 protein_id gnl|my_center|LOCUS_33750 <3689 2753 gene locus_tag LOCUS_33760 <3689 2753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921592.1:PQQ-like beta-propeller repeat protein >Feature sequence0547 770 1801 gene locus_tag LOCUS_33770 gene lpxD 770 1801 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521195.1 protein_id gnl|my_center|LOCUS_33770 1907 2854 gene locus_tag LOCUS_33780 1907 2854 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_33780 >Feature sequence0548 1055 603 gene locus_tag LOCUS_33790 gene tnpA 1055 603 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_33790 2803 1967 gene locus_tag LOCUS_33800 2803 1967 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_33800 <3665 3014 gene locus_tag LOCUS_33810 <3665 3014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109307.1:restriction endonuclease subunit S >Feature sequence0549 <3664 919 gene locus_tag LOCUS_33820 <3664 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147390609.1:TonB-dependent receptor >Feature sequence0550 <1 2490 gene locus_tag LOCUS_33830 <1 2490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707204.1:glycosyl hydrolase family 18 protein 2614 3495 gene locus_tag LOCUS_33840 2614 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 >Feature sequence0551 1922 3562 gene locus_tag LOCUS_33850 1922 3562 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841352.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence0552 203 862 gene locus_tag LOCUS_33860 203 862 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115288.1 protein_id gnl|my_center|LOCUS_33860 2608 917 gene locus_tag LOCUS_33870 2608 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 <3662 3075 gene locus_tag LOCUS_33880 <3662 3075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974307.1:nucleotidyl transferase AbiEii/AbiGii toxin family protein >Feature sequence0553 728 1636 gene locus_tag LOCUS_33890 gene miaA 728 1636 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888325.1 protein_id gnl|my_center|LOCUS_33890 2406 1651 gene locus_tag LOCUS_33900 2406 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 2946 2416 gene locus_tag LOCUS_33910 2946 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 3564 2986 gene locus_tag LOCUS_33920 3564 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 >Feature sequence0554 467 3634 gene locus_tag LOCUS_33930 467 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence0555 3555 310 gene locus_tag LOCUS_33940 3555 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 >Feature sequence0556 1416 259 gene locus_tag LOCUS_33950 1416 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 >Feature sequence0557 1266 229 gene locus_tag LOCUS_33960 gene hemB 1266 229 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_33960 1396 2763 gene locus_tag LOCUS_33970 gene cysS 1396 2763 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883567.1 protein_id gnl|my_center|LOCUS_33970 2845 3519 gene locus_tag LOCUS_33980 2845 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33980 >Feature sequence0558 <1 1614 gene locus_tag LOCUS_33990 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015154897.1:TonB-dependent siderophore receptor 1653 2810 gene locus_tag LOCUS_34000 1653 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3370 3005 gene locus_tag LOCUS_34010 3370 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 >Feature sequence0559 1444 1749 gene locus_tag LOCUS_34020 1444 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 2393 1701 gene locus_tag LOCUS_34030 2393 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 >Feature sequence0560 895 320 gene locus_tag LOCUS_34040 895 320 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085340.1 protein_id gnl|my_center|LOCUS_34040 <3602 1457 gene locus_tag LOCUS_34050 <3602 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008669069.1:ThuA domain-containing protein >Feature sequence0561 1249 335 gene locus_tag LOCUS_34060 gene rarD 1249 335 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791842.1 protein_id gnl|my_center|LOCUS_34060 1591 1334 gene locus_tag LOCUS_34070 1591 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 2898 2218 gene locus_tag LOCUS_34080 2898 2218 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017302344.1 protein_id gnl|my_center|LOCUS_34080 >Feature sequence0562 1823 687 gene locus_tag LOCUS_34090 1823 687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067540.1 protein_id gnl|my_center|LOCUS_34090 3361 1820 gene locus_tag LOCUS_34100 3361 1820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_34100 >Feature sequence0563 881 567 gene locus_tag LOCUS_34110 881 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 1063 866 gene locus_tag LOCUS_34120 1063 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 2392 1103 gene locus_tag LOCUS_34130 2392 1103 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809762.1 protein_id gnl|my_center|LOCUS_34130 >Feature sequence0564 1949 486 gene locus_tag LOCUS_34140 1949 486 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_34140 <3568 1952 gene locus_tag LOCUS_34150 <3568 1952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158257889.1:sulfatase >Feature sequence0565 1176 241 gene locus_tag LOCUS_34160 1176 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 2769 1180 gene locus_tag LOCUS_34170 2769 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 >Feature sequence0566 1021 2349 gene locus_tag LOCUS_34180 gene glpT 1021 2349 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705541.1 protein_id gnl|my_center|LOCUS_34180 2379 3422 gene locus_tag LOCUS_34190 gene glpQ 2379 3422 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706146.1 protein_id gnl|my_center|LOCUS_34190 >Feature sequence0567 1654 92 gene locus_tag LOCUS_34200 1654 92 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085949.1 protein_id gnl|my_center|LOCUS_34200 2727 1666 gene locus_tag LOCUS_34210 2727 1666 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920127.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence0568 488 1096 gene locus_tag LOCUS_34220 488 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 >Feature sequence0569 511 1548 gene locus_tag LOCUS_34230 511 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 2506 1679 gene locus_tag LOCUS_34240 2506 1679 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_34240 >Feature sequence0570 299 1339 gene locus_tag LOCUS_34250 gene glpQ 299 1339 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705544.1 protein_id gnl|my_center|LOCUS_34250 1676 2500 gene locus_tag LOCUS_34260 1676 2500 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_34260 2508 2972 gene locus_tag LOCUS_34270 2508 2972 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_34270 >Feature sequence0571 1495 962 gene locus_tag LOCUS_34280 1495 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 2885 1548 gene locus_tag LOCUS_34290 2885 1548 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 protein_id gnl|my_center|LOCUS_34290 >Feature sequence0572 1768 356 gene locus_tag LOCUS_34300 1768 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 2979 1828 gene locus_tag LOCUS_34310 2979 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 <3514 2996 gene locus_tag LOCUS_34320 <3514 2996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118057.1:sulfatase-like hydrolase/transferase >Feature sequence0573 415 1020 gene locus_tag LOCUS_34330 415 1020 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334933.1 protein_id gnl|my_center|LOCUS_34330 1030 2157 gene locus_tag LOCUS_34340 1030 2157 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_34340 >Feature sequence0574 >Feature sequence0575 1393 2658 gene locus_tag LOCUS_34350 1393 2658 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_34350 3259 3074 gene locus_tag LOCUS_34360 3259 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence0576 3077 1488 gene locus_tag LOCUS_34370 3077 1488 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_34370 >Feature sequence0577 1460 408 gene locus_tag LOCUS_34380 1460 408 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_34380 2898 1795 gene locus_tag LOCUS_34390 gene mtnA 2898 1795 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_34390 >Feature sequence0578 1035 2864 gene locus_tag LOCUS_34400 gene sppA 1035 2864 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_34400 2875 3408 gene locus_tag LOCUS_34410 gene sufT 2875 3408 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_34410 >Feature sequence0579 2509 692 gene locus_tag LOCUS_34420 2509 692 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_34420 <3461 2524 gene locus_tag LOCUS_34430 <3461 2524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_234705053.1:arylsulfatase >Feature sequence0580 2628 22 gene locus_tag LOCUS_34440 2628 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 >Feature sequence0581 1848 370 gene locus_tag LOCUS_34450 1848 370 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_34450 <3458 1936 gene locus_tag LOCUS_34460 <3458 1936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118057.1:sulfatase-like hydrolase/transferase >Feature sequence0582 208 2796 gene locus_tag LOCUS_34470 gene mobF 208 2796 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_34470 2812 3162 gene locus_tag LOCUS_34480 2812 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence0583 221 850 gene locus_tag LOCUS_34490 221 850 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_34490 1009 2340 gene locus_tag LOCUS_34500 1009 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 2380 3276 gene locus_tag LOCUS_34510 2380 3276 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_34510 >Feature sequence0584 1333 284 gene locus_tag LOCUS_34520 1333 284 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 protein_id gnl|my_center|LOCUS_34520 2630 1362 gene locus_tag LOCUS_34530 2630 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 <3441 2785 gene locus_tag LOCUS_34540 <3441 2785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392423.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN >Feature sequence0585 <1 1640 gene locus_tag LOCUS_34550 <1 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261398.1:sodium:solute symporter 1879 2997 gene locus_tag LOCUS_34560 1879 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 >Feature sequence0586 1280 3064 gene locus_tag LOCUS_34570 gene argS 1280 3064 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_34570 >Feature sequence0587 151 1254 gene locus_tag LOCUS_34580 gene ychF 151 1254 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_34580 1361 2167 gene locus_tag LOCUS_34590 1361 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence0588 55 804 gene locus_tag LOCUS_34600 55 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence0589 367 152 gene locus_tag LOCUS_34610 367 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 360 1328 gene locus_tag LOCUS_34620 360 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 3424 1466 gene locus_tag LOCUS_34630 3424 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence0590 <1 1365 gene locus_tag LOCUS_34640 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921302.1:DUF1501 domain-containing protein 1856 3121 gene locus_tag LOCUS_34650 1856 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 >Feature sequence0591 >Feature sequence0592 <3404 344 gene locus_tag LOCUS_34660 <3404 344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918997.1:TonB-dependent receptor >Feature sequence0593 <1 1038 gene locus_tag LOCUS_34670 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615922.1:ATPase, T2SS/T4P/T4SS family 1052 2335 gene locus_tag LOCUS_34680 1052 2335 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_34680 2344 2796 gene locus_tag LOCUS_34690 gene gspG 2344 2796 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_34690 2891 3373 gene locus_tag LOCUS_34700 2891 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence0594 1647 3242 gene locus_tag LOCUS_34710 1647 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 >Feature sequence0595 <1 615 gene locus_tag LOCUS_34720 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230571.1:methyltransferase domain-containing protein 1184 2782 gene locus_tag LOCUS_34730 1184 2782 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_34730 >Feature sequence0596 744 439 gene locus_tag LOCUS_34740 744 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 963 745 gene locus_tag LOCUS_34750 963 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 1936 995 gene locus_tag LOCUS_34760 1936 995 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583299.1 protein_id gnl|my_center|LOCUS_34760 2830 1940 gene locus_tag LOCUS_34770 2830 1940 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642246.1 protein_id gnl|my_center|LOCUS_34770 >Feature sequence0597 >Feature sequence0598 1313 546 gene locus_tag LOCUS_34780 gene hisN 1313 546 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_34780 1467 2069 gene locus_tag LOCUS_34790 1467 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 >Feature sequence0599 3116 297 gene locus_tag LOCUS_34800 3116 297 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_34800 >Feature sequence0600 >Feature sequence0601 <1 1089 gene locus_tag LOCUS_34810 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117891.1:DUF1552 domain-containing protein 1335 1910 gene locus_tag LOCUS_34820 1335 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 2064 2645 gene locus_tag LOCUS_34830 2064 2645 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_34830 >Feature sequence0602 1292 2776 gene locus_tag LOCUS_34840 1292 2776 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261223.1 protein_id gnl|my_center|LOCUS_34840 >Feature sequence0603 2660 1143 gene locus_tag LOCUS_34850 2660 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 >Feature sequence0604 1771 1073 gene locus_tag LOCUS_34860 1771 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 3149 1764 gene locus_tag LOCUS_34870 3149 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 >Feature sequence0605 <1 862 gene locus_tag LOCUS_34880 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918464.1:cyanophycinase 859 2061 gene locus_tag LOCUS_34890 859 2061 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_34890 >Feature sequence0606 1582 659 gene locus_tag LOCUS_34900 1582 659 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_34900 2734 1595 gene locus_tag LOCUS_34910 2734 1595 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_34910 <3350 2682 gene locus_tag LOCUS_34920 <3350 2682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008669321.1:sulfatase >Feature sequence0607 1660 884 gene locus_tag LOCUS_34930 1660 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 3018 1657 gene locus_tag LOCUS_34940 3018 1657 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_34940 >Feature sequence0608 <1 813 gene locus_tag LOCUS_34950 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022342.1:helix-turn-helix domain-containing protein 1807 2958 gene locus_tag LOCUS_34960 1807 2958 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_34960 >Feature sequence0609 2379 1483 gene locus_tag LOCUS_34970 2379 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 >Feature sequence0610 1470 91 gene locus_tag LOCUS_34980 1470 91 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_34980 >Feature sequence0611 1322 2257 gene locus_tag LOCUS_34990 1322 2257 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529363.1 protein_id gnl|my_center|LOCUS_34990 2665 3156 gene locus_tag LOCUS_35000 2665 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 >Feature sequence0612 3139 269 gene locus_tag LOCUS_35010 gene uvrA 3139 269 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036348.1 protein_id gnl|my_center|LOCUS_35010 >Feature sequence0613 >Feature sequence0614 <1 576 gene locus_tag LOCUS_35020 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000018115.1:phosphopyruvate hydratase 748 1377 gene locus_tag LOCUS_35030 748 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 2555 1383 gene locus_tag LOCUS_35040 2555 1383 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929520.1 protein_id gnl|my_center|LOCUS_35040 >Feature sequence0615 368 66 gene locus_tag LOCUS_35050 368 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 753 2105 gene locus_tag LOCUS_35060 753 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 <3281 2128 gene locus_tag LOCUS_35070 <3281 2128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122824.1:SLC13 family permease >Feature sequence0616 282 698 gene locus_tag LOCUS_35080 282 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 695 1240 gene locus_tag LOCUS_35090 695 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 <3278 1333 gene locus_tag LOCUS_35100 <3278 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679721.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0617 628 1740 gene locus_tag LOCUS_35110 628 1740 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_35110 1749 3083 gene locus_tag LOCUS_35120 1749 3083 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107128.1 protein_id gnl|my_center|LOCUS_35120 >Feature sequence0618 175 3117 gene locus_tag LOCUS_35130 175 3117 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120396.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35130 >Feature sequence0619 243 2963 gene locus_tag LOCUS_35140 243 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 >Feature sequence0620 2036 708 gene locus_tag LOCUS_35150 2036 708 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_35150 >Feature sequence0621 827 2419 gene locus_tag LOCUS_35160 827 2419 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_35160 >Feature sequence0622 306 779 gene locus_tag LOCUS_35170 306 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 801 2366 gene locus_tag LOCUS_35180 801 2366 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338946.1 protein_id gnl|my_center|LOCUS_35180 >Feature sequence0623 >Feature sequence0624 130 891 gene locus_tag LOCUS_35190 130 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 1993 839 gene locus_tag LOCUS_35200 1993 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 2862 2005 gene locus_tag LOCUS_35210 2862 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 >Feature sequence0625 1563 418 gene locus_tag LOCUS_35220 1563 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 3235 1571 gene locus_tag LOCUS_35230 3235 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence0626 131 964 gene locus_tag LOCUS_35240 131 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 981 2168 gene locus_tag LOCUS_35250 981 2168 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084045.1 protein_id gnl|my_center|LOCUS_35250 3097 2192 gene locus_tag LOCUS_35260 gene phnD 3097 2192 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975698.1 protein_id gnl|my_center|LOCUS_35260 >Feature sequence0627 <1 1276 gene locus_tag LOCUS_35270 <1 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922457.1:alpha/beta hydrolase-fold protein 1546 2472 gene locus_tag LOCUS_35280 1546 2472 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815329.1 protein_id gnl|my_center|LOCUS_35280 <3211 2492 gene locus_tag LOCUS_35290 <3211 2492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941581.1:ATP-binding cassette domain-containing protein >Feature sequence0628 241 1527 gene locus_tag LOCUS_35300 241 1527 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_35300 2796 1549 gene locus_tag LOCUS_35310 2796 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 >Feature sequence0629 1402 545 gene locus_tag LOCUS_35320 1402 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 2889 1789 gene locus_tag LOCUS_35330 2889 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 >Feature sequence0630 1327 404 gene locus_tag LOCUS_35340 1327 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35340 1794 1225 gene locus_tag LOCUS_35350 1794 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35350 2078 1791 gene locus_tag LOCUS_35360 2078 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 2736 2086 gene locus_tag LOCUS_35370 2736 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence0631 735 49 gene locus_tag LOCUS_35380 735 49 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_35380 1426 710 gene locus_tag LOCUS_35390 gene phoU 1426 710 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_35390 2300 1404 gene locus_tag LOCUS_35400 gene pstB 2300 1404 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286625.1 protein_id gnl|my_center|LOCUS_35400 3181 2294 gene locus_tag LOCUS_35410 3181 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 >Feature sequence0632 1103 294 gene locus_tag LOCUS_35420 1103 294 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 protein_id gnl|my_center|LOCUS_35420 2517 1168 gene locus_tag LOCUS_35430 2517 1168 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_35430 3100 2795 gene locus_tag LOCUS_35440 3100 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 >Feature sequence0633 1398 472 gene locus_tag LOCUS_35450 1398 472 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958159.1 protein_id gnl|my_center|LOCUS_35450 1479 1757 gene locus_tag LOCUS_35460 1479 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 >Feature sequence0634 >Feature sequence0635 <1 1594 gene locus_tag LOCUS_35470 <1 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118036.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0636 1743 1483 gene locus_tag LOCUS_35480 1743 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 1964 2890 gene locus_tag LOCUS_35490 1964 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence0637 <1 1596 gene locus_tag LOCUS_35500 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118727.1:DUF1501 domain-containing protein 2434 2631 gene locus_tag LOCUS_35510 2434 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 >Feature sequence0638 <1 1450 gene locus_tag LOCUS_35520 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035377.1:TonB-dependent receptor 1610 2446 gene locus_tag LOCUS_35530 gene kduI 1610 2446 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529046.1 protein_id gnl|my_center|LOCUS_35530 3126 2512 gene locus_tag LOCUS_35540 3126 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 >Feature sequence0639 1514 42 gene locus_tag LOCUS_35550 1514 42 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_35550 >Feature sequence0640 <1 899 gene locus_tag LOCUS_35560 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258814.1:acyl-CoA synthetase 896 2143 gene locus_tag LOCUS_35570 896 2143 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400886.1 protein_id gnl|my_center|LOCUS_35570 2140 2847 gene locus_tag LOCUS_35580 2140 2847 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_35580 >Feature sequence0641 611 1297 gene locus_tag LOCUS_35590 611 1297 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_35590 1294 2190 gene locus_tag LOCUS_35600 1294 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 >Feature sequence0642 1518 691 gene locus_tag LOCUS_35610 1518 691 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838507.1 protein_id gnl|my_center|LOCUS_35610 2877 1633 gene locus_tag LOCUS_35620 2877 1633 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_35620 >Feature sequence0643 146 376 gene locus_tag LOCUS_35630 146 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 386 1546 gene locus_tag LOCUS_35640 gene nuoH 386 1546 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104353.1 protein_id gnl|my_center|LOCUS_35640 1565 2107 gene locus_tag LOCUS_35650 1565 2107 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_35650 2230 2745 gene locus_tag LOCUS_35660 2230 2745 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_35660 2742 3050 gene locus_tag LOCUS_35670 gene nuoK 2742 3050 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_35670 >Feature sequence0644 950 1285 gene locus_tag LOCUS_35680 950 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 1515 1841 gene locus_tag LOCUS_35690 1515 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 1915 2352 gene locus_tag LOCUS_35700 1915 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence0645 2910 1864 gene locus_tag LOCUS_35710 2910 1864 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266000.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence0646 <1 1845 gene locus_tag LOCUS_35720 <1 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460436.1:NADH-quinone oxidoreductase subunit L >Feature sequence0647 1602 370 gene locus_tag LOCUS_35730 gene nuoD 1602 370 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_35730 2244 1615 gene locus_tag LOCUS_35740 2244 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 2791 2276 gene locus_tag LOCUS_35750 2791 2276 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_35750 >Feature sequence0648 >Feature sequence0649 171 416 gene locus_tag LOCUS_35760 171 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 938 480 gene locus_tag LOCUS_35770 938 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 1553 960 gene locus_tag LOCUS_35780 gene tsf 1553 960 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_35780 2492 1575 gene locus_tag LOCUS_35790 gene rpsB 2492 1575 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899528.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence0650 >Feature sequence0651 2022 1807 gene locus_tag LOCUS_35800 2022 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence0652 249 614 gene locus_tag LOCUS_35810 249 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 659 1639 gene locus_tag LOCUS_35820 659 1639 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883648.1 protein_id gnl|my_center|LOCUS_35820 2546 1755 gene locus_tag LOCUS_35830 2546 1755 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_35830 >Feature sequence0653 2805 70 gene locus_tag LOCUS_35840 2805 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 >Feature sequence0654 726 406 gene locus_tag LOCUS_35850 726 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35850 1226 852 gene locus_tag LOCUS_35860 1226 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 1480 1250 gene locus_tag LOCUS_35870 1480 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 2733 1477 gene locus_tag LOCUS_35880 2733 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 >Feature sequence0655 <1 1107 gene locus_tag LOCUS_35890 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545149.1:flagellar filament capping protein FliD 1108 1806 gene locus_tag LOCUS_35900 1108 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 2011 2175 gene locus_tag LOCUS_35910 2011 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 2207 2620 gene locus_tag LOCUS_35920 gene fliS 2207 2620 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546221.1 protein_id gnl|my_center|LOCUS_35920 2633 2962 gene locus_tag LOCUS_35930 2633 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 >Feature sequence0656 1401 7 gene locus_tag LOCUS_35940 1401 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 2993 1551 gene locus_tag LOCUS_35950 2993 1551 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_35950 >Feature sequence0657 1218 2633 gene locus_tag LOCUS_35960 1218 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 >Feature sequence0658 <1 2199 gene locus_tag LOCUS_35970 <1 2199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615966.1:DUF1592 domain-containing protein >Feature sequence0659 <1 895 gene locus_tag LOCUS_35980 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921686.1:sulfatase 998 1270 gene locus_tag LOCUS_35990 998 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 1267 1704 gene locus_tag LOCUS_36000 1267 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 1769 2911 gene locus_tag LOCUS_36010 1769 2911 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227266.1 protein_id gnl|my_center|LOCUS_36010 >Feature sequence0660 <1 1258 gene locus_tag LOCUS_36020 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616082.1:PQQ-binding-like beta-propeller repeat protein 1255 2703 gene locus_tag LOCUS_36030 1255 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence0661 169 507 gene locus_tag LOCUS_36040 169 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 580 2151 gene locus_tag LOCUS_36050 580 2151 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921866.1 protein_id gnl|my_center|LOCUS_36050 >Feature sequence0662 524 267 gene locus_tag LOCUS_36060 524 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 2070 673 gene locus_tag LOCUS_36070 2070 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_36070 2723 2956 gene locus_tag LOCUS_36080 2723 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence0663 1539 664 gene locus_tag LOCUS_36090 1539 664 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 protein_id gnl|my_center|LOCUS_36090 1681 2535 gene locus_tag LOCUS_36100 1681 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence0664 1015 857 gene locus_tag LOCUS_36110 1015 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 2457 1927 gene locus_tag LOCUS_36120 2457 1927 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164013248.1 protein_id gnl|my_center|LOCUS_36120 <2992 2454 gene locus_tag LOCUS_36130 <2992 2454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329168.1:ATP-binding protein >Feature sequence0665 1446 337 gene locus_tag LOCUS_36140 1446 337 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119520.1 protein_id gnl|my_center|LOCUS_36140 2598 1459 gene locus_tag LOCUS_36150 gene devC 2598 1459 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_36150 >Feature sequence0666 <1 573 gene locus_tag LOCUS_36160 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962330.1:aminopeptidase P family protein 660 2858 gene locus_tag LOCUS_36170 660 2858 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_36170 >Feature sequence0667 >Feature sequence0668 314 1891 gene locus_tag LOCUS_36180 314 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 >Feature sequence0669 291 524 gene locus_tag LOCUS_36190 291 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 676 1881 gene locus_tag LOCUS_36200 676 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence0670 2100 2627 gene locus_tag LOCUS_36210 2100 2627 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626366.1 protein_id gnl|my_center|LOCUS_36210 >Feature sequence0671 46 972 gene locus_tag LOCUS_36220 46 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 1091 1684 gene locus_tag LOCUS_36230 gene tsf 1091 1684 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545220.1 protein_id gnl|my_center|LOCUS_36230 1966 2376 gene locus_tag LOCUS_36240 1966 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 2464 2553 gene locus_tag LOCUS_t00250 2464 2553 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0672 1196 90 gene locus_tag LOCUS_36250 1196 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 <2940 1230 gene locus_tag LOCUS_36260 <2940 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124073.1:alpha/beta hydrolase >Feature sequence0673 234 602 gene locus_tag LOCUS_36270 234 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 655 996 gene locus_tag LOCUS_36280 655 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 1164 1649 gene locus_tag LOCUS_36290 1164 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 1649 2452 gene locus_tag LOCUS_36300 1649 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 2582 2932 gene locus_tag LOCUS_36310 2582 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 >Feature sequence0674 707 246 gene locus_tag LOCUS_36320 707 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 1011 694 gene locus_tag LOCUS_36330 gene clpS 1011 694 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776026.1 protein_id gnl|my_center|LOCUS_36330 >Feature sequence0675 2145 1099 gene locus_tag LOCUS_36340 gene trpD 2145 1099 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480347.1 protein_id gnl|my_center|LOCUS_36340 >Feature sequence0676 1200 268 gene locus_tag LOCUS_36350 1200 268 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_36350 2066 1266 gene locus_tag LOCUS_36360 2066 1266 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_36360 <2931 2063 gene locus_tag LOCUS_36370 <2931 2063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272541.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0677 <1 1029 gene locus_tag LOCUS_36380 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_119656495.1:efflux RND transporter permease subunit 1687 1142 gene locus_tag LOCUS_36390 1687 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 2546 1860 gene locus_tag LOCUS_36400 2546 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 >Feature sequence0678 >Feature sequence0679 2223 379 gene locus_tag LOCUS_36410 2223 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36410 >Feature sequence0680 <1 540 gene locus_tag LOCUS_36420 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389559.1:FGGY-family carbohydrate kinase 537 2411 gene locus_tag LOCUS_36430 537 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 >Feature sequence0681 2241 1516 gene locus_tag LOCUS_36440 2241 1516 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_36440 >Feature sequence0682 570 2816 gene locus_tag LOCUS_36450 570 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 >Feature sequence0683 1363 2415 gene locus_tag LOCUS_36460 1363 2415 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267493.1 protein_id gnl|my_center|LOCUS_36460 >Feature sequence0684 982 1875 gene locus_tag LOCUS_36470 982 1875 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181859.1 protein_id gnl|my_center|LOCUS_36470 1946 2176 gene locus_tag LOCUS_36480 gene rpmB 1946 2176 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124776.1 protein_id gnl|my_center|LOCUS_36480 2895 2263 gene locus_tag LOCUS_36490 2895 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence0685 455 306 gene locus_tag LOCUS_36500 455 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 520 2343 gene locus_tag LOCUS_36510 gene ggt 520 2343 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_36510 >Feature sequence0686 <2894 876 gene locus_tag LOCUS_36520 <2894 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein >Feature sequence0687 836 1264 gene locus_tag LOCUS_36530 836 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 1261 2760 gene locus_tag LOCUS_36540 1261 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 >Feature sequence0688 2169 757 gene locus_tag LOCUS_36550 2169 757 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715453.1 protein_id gnl|my_center|LOCUS_36550 2371 2757 gene locus_tag LOCUS_36560 2371 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence0689 1542 982 gene locus_tag LOCUS_36570 gene fpvI 1542 982 CDS product pyoverdine signaling pathway sigma factor FpvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103620.1 protein_id gnl|my_center|LOCUS_36570 2250 1840 gene locus_tag LOCUS_36580 2250 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 2593 2255 gene locus_tag LOCUS_36590 2593 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 >Feature sequence0690 <1 1009 gene locus_tag LOCUS_36600 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016327153.1:Nramp family divalent metal transporter >Feature sequence0691 1558 320 gene locus_tag LOCUS_36610 1558 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 2285 1530 gene locus_tag LOCUS_36620 2285 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 <2881 2334 gene locus_tag LOCUS_36630 <2881 2334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918063.1:type II secretion system ATPase GspE >Feature sequence0692 1392 397 gene locus_tag LOCUS_36640 1392 397 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 protein_id gnl|my_center|LOCUS_36640 2338 1379 gene locus_tag LOCUS_36650 2338 1379 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_36650 2880 2335 gene locus_tag LOCUS_36660 2880 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence0693 <1 1755 gene locus_tag LOCUS_36670 <1 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265674.1:TonB-dependent receptor 2688 1759 gene locus_tag LOCUS_36680 2688 1759 CDS product IS630-like element ISRj1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084514.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence0694 1039 914 gene locus_tag LOCUS_36690 1039 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 2308 1109 gene locus_tag LOCUS_36700 2308 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence0695 <1 724 gene locus_tag LOCUS_36710 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072867.1:phage major capsid protein 783 1055 gene locus_tag LOCUS_36720 783 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 1055 1597 gene locus_tag LOCUS_36730 1055 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 1582 1935 gene locus_tag LOCUS_36740 1582 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 1932 2495 gene locus_tag LOCUS_36750 1932 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 >Feature sequence0696 1047 160 gene locus_tag LOCUS_36760 1047 160 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086675089.1 protein_id gnl|my_center|LOCUS_36760 >Feature sequence0697 200 1417 gene locus_tag LOCUS_36770 200 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 1414 2082 gene locus_tag LOCUS_36780 1414 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 2148 2597 gene locus_tag LOCUS_36790 2148 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 2594 2773 gene locus_tag LOCUS_36800 2594 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 >Feature sequence0698 <1 666 gene locus_tag LOCUS_36810 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003592867.1:helicase C-terminal domain-containing protein >Feature sequence0699 >Feature sequence0700 <1 544 gene locus_tag LOCUS_36820 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035718.1:virulence RhuM family protein 648 2627 gene locus_tag LOCUS_36830 gene thrS 648 2627 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888712.1 protein_id gnl|my_center|LOCUS_36830 >Feature sequence0701 576 13 gene locus_tag LOCUS_36840 576 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 624 1007 gene locus_tag LOCUS_36850 624 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 1982 1077 gene locus_tag LOCUS_36860 1982 1077 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902918.1 protein_id gnl|my_center|LOCUS_36860 2479 1979 gene locus_tag LOCUS_36870 2479 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 >Feature sequence0702 >Feature sequence0703 138 992 gene locus_tag LOCUS_36880 138 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 1054 2469 gene locus_tag LOCUS_36890 1054 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 >Feature sequence0704 274 1155 gene locus_tag LOCUS_36900 274 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 1173 2576 gene locus_tag LOCUS_36910 1173 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 >Feature sequence0705 431 1330 gene locus_tag LOCUS_36920 431 1330 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_36920 1487 1771 gene locus_tag LOCUS_36930 1487 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 1768 2184 gene locus_tag LOCUS_36940 1768 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 2174 2249 gene locus_tag LOCUS_t00260 2174 2249 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2616 2320 gene locus_tag LOCUS_36950 2616 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence0706 372 530 gene locus_tag LOCUS_36960 372 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 598 1134 gene locus_tag LOCUS_36970 598 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 2352 1300 gene locus_tag LOCUS_36980 2352 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 >Feature sequence0707 897 10 gene locus_tag LOCUS_36990 897 10 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_36990 1169 894 gene locus_tag LOCUS_37000 1169 894 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475805.1 protein_id gnl|my_center|LOCUS_37000 1296 1988 gene locus_tag LOCUS_37010 1296 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 >Feature sequence0708 56 1618 gene locus_tag LOCUS_37020 gene cimA 56 1618 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_37020 1937 2022 gene locus_tag LOCUS_t00270 1937 2022 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0709 1257 250 gene locus_tag LOCUS_37030 1257 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 2172 1471 gene locus_tag LOCUS_37040 gene infC 2172 1471 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888718.1 protein_id gnl|my_center|LOCUS_37040 2672 2280 gene locus_tag LOCUS_37050 gene iscA 2672 2280 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039700.1 protein_id gnl|my_center|LOCUS_37050 >Feature sequence0710 >Feature sequence0711 126 1697 gene locus_tag LOCUS_37060 126 1697 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_37060 >Feature sequence0712 >Feature sequence0713 2181 1780 gene locus_tag LOCUS_37070 2181 1780 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_37070 2417 2178 gene locus_tag LOCUS_37080 2417 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 >Feature sequence0714 >Feature sequence0715 >Feature sequence0716 <2737 183 gene locus_tag LOCUS_37090 <2737 183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921311.1:ThuA domain-containing protein >Feature sequence0717 1 1686 gene locus_tag LOCUS_37100 1 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 >Feature sequence0718 948 2264 gene locus_tag LOCUS_37110 gene oprJ 948 2264 CDS product multidrug efflux transporter outer membrane subunit OprJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112802.1 protein_id gnl|my_center|LOCUS_37110 >Feature sequence0719 519 1364 gene locus_tag LOCUS_37120 519 1364 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975348.1 protein_id gnl|my_center|LOCUS_37120 1402 2331 gene locus_tag LOCUS_37130 1402 2331 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122544.1 protein_id gnl|my_center|LOCUS_37130 >Feature sequence0720 <2687 2021 gene locus_tag LOCUS_37140 <2687 2021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922285.1:DUF1501 domain-containing protein >Feature sequence0721 2496 1324 gene locus_tag LOCUS_37150 gene dinB 2496 1324 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_37150 >Feature sequence0722 1915 182 gene locus_tag LOCUS_37160 1915 182 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118507.1 protein_id gnl|my_center|LOCUS_37160 >Feature sequence0723 <1 772 gene locus_tag LOCUS_37170 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922453.1:Gfo/Idh/MocA family oxidoreductase <2675 975 gene locus_tag LOCUS_37180 <2675 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein >Feature sequence0724 >Feature sequence0725 745 182 gene locus_tag LOCUS_37190 gene rsmD 745 182 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_37190 1080 2636 gene locus_tag LOCUS_37200 1080 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_37200 >Feature sequence0726 296 372 gene locus_tag LOCUS_t00280 296 372 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2582 483 gene locus_tag LOCUS_37210 2582 483 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 protein_id gnl|my_center|LOCUS_37210 >Feature sequence0727 507 217 gene locus_tag LOCUS_37220 507 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 412 1326 gene locus_tag LOCUS_37230 412 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 <2665 1342 gene locus_tag LOCUS_37240 <2665 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229234.1:tannase/feruloyl esterase family alpha/beta hydrolase >Feature sequence0728 269 96 gene locus_tag LOCUS_37250 269 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 1008 1436 gene locus_tag LOCUS_37260 1008 1436 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336801.1 protein_id gnl|my_center|LOCUS_37260 <2663 1497 gene locus_tag LOCUS_37270 <2663 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680159.1:formylglycine-generating enzyme family protein >Feature sequence0729 787 626 gene locus_tag LOCUS_37280 787 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 1153 845 gene locus_tag LOCUS_37290 1153 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 2096 1269 gene locus_tag LOCUS_37300 2096 1269 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_37300 >Feature sequence0730 2314 1394 gene locus_tag LOCUS_37310 2314 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 >Feature sequence0731 <1 2364 gene locus_tag LOCUS_37320 <1 2364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000365401.1:ATP-dependent chaperone ClpB >Feature sequence0732 1552 1989 gene locus_tag LOCUS_37330 1552 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 >Feature sequence0733 203 1075 gene locus_tag LOCUS_37340 203 1075 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970360.1 protein_id gnl|my_center|LOCUS_37340 1167 2078 gene locus_tag LOCUS_37350 gene yfeB 1167 2078 CDS product iron/manganese ABC transporter ATP-binding protein YfeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211843.1 protein_id gnl|my_center|LOCUS_37350 >Feature sequence0734 771 1253 gene locus_tag LOCUS_37360 gene coaD 771 1253 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_37360 >Feature sequence0735 1197 217 gene locus_tag LOCUS_37370 1197 217 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_37370 2218 1262 gene locus_tag LOCUS_37380 2218 1262 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_37380 >Feature sequence0736 >Feature sequence0737 1526 1053 gene locus_tag LOCUS_37390 1526 1053 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_37390 2498 1602 gene locus_tag LOCUS_37400 2498 1602 CDS product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_37400 >Feature sequence0738 1397 465 gene locus_tag LOCUS_37410 1397 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 <2605 1435 gene locus_tag LOCUS_37420 <2605 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921626.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0739 >Feature sequence0740 >Feature sequence0741 <1 921 gene locus_tag LOCUS_37430 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146457347.1:sulfatase-like hydrolase/transferase 918 2501 gene locus_tag LOCUS_37440 918 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 >Feature sequence0742 <2594 1015 gene locus_tag LOCUS_37450 <2594 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003219444.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence0743 1124 744 gene locus_tag LOCUS_37460 1124 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 1694 2056 gene locus_tag LOCUS_37470 1694 2056 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972404.1 protein_id gnl|my_center|LOCUS_37470 2399 2220 gene locus_tag LOCUS_37480 2399 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 >Feature sequence0744 185 1348 gene locus_tag LOCUS_37490 185 1348 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_37490 2509 1643 gene locus_tag LOCUS_37500 2509 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 >Feature sequence0745 2250 2423 gene locus_tag LOCUS_37510 2250 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 >Feature sequence0746 >Feature sequence0747 283 116 gene locus_tag LOCUS_37520 283 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37520 501 280 gene locus_tag LOCUS_37530 501 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 821 498 gene locus_tag LOCUS_37540 821 498 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_37540 1038 880 gene locus_tag LOCUS_37550 1038 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 1780 1373 gene locus_tag LOCUS_37560 1780 1373 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229002.1 protein_id gnl|my_center|LOCUS_37560 2108 1761 gene locus_tag LOCUS_37570 2108 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 >Feature sequence0748 1523 1921 gene locus_tag LOCUS_37580 1523 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence0749 1085 45 gene locus_tag LOCUS_37590 1085 45 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_37590 <2574 1234 gene locus_tag LOCUS_37600 <2574 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223493.1:class I mannose-6-phosphate isomerase >Feature sequence0750 339 1325 gene locus_tag LOCUS_37610 339 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 >Feature sequence0751 1600 68 gene locus_tag LOCUS_37620 1600 68 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258810.1 protein_id gnl|my_center|LOCUS_37620 <2567 1780 gene locus_tag LOCUS_37630 <2567 1780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117989.1:DUF1552 domain-containing protein >Feature sequence0752 <2559 1227 gene locus_tag LOCUS_37640 <2559 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895527.1:succinylglutamate-semialdehyde dehydrogenase >Feature sequence0753 408 1559 gene locus_tag LOCUS_37650 408 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 >Feature sequence0754 45 443 gene locus_tag LOCUS_37660 45 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 521 1819 gene locus_tag LOCUS_37670 521 1819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205593.1 protein_id gnl|my_center|LOCUS_37670 >Feature sequence0755 2178 271 gene locus_tag LOCUS_37680 2178 271 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765068.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence0756 312 1526 gene locus_tag LOCUS_37690 312 1526 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_37690 >Feature sequence0757 603 818 gene locus_tag LOCUS_37700 603 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 831 1013 gene locus_tag LOCUS_37710 831 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 1127 1339 gene locus_tag LOCUS_37720 1127 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 1407 1634 gene locus_tag LOCUS_37730 1407 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 1899 2435 gene locus_tag LOCUS_37740 1899 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 >Feature sequence0758 2 355 gene locus_tag LOCUS_37750 2 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 382 1695 gene locus_tag LOCUS_37760 382 1695 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227872.1 protein_id gnl|my_center|LOCUS_37760 >Feature sequence0759 302 105 gene locus_tag LOCUS_37770 302 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 2264 336 gene locus_tag LOCUS_37780 2264 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 >Feature sequence0760 541 1518 gene locus_tag LOCUS_37790 541 1518 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_37790 >Feature sequence0761 6 1979 gene locus_tag LOCUS_37800 gene katG 6 1979 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_37800 >Feature sequence0762 168 1091 gene locus_tag LOCUS_37810 168 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 1643 1125 gene locus_tag LOCUS_37820 1643 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 2246 1647 gene locus_tag LOCUS_37830 gene pgsA 2246 1647 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090204.1 protein_id gnl|my_center|LOCUS_37830 >Feature sequence0763 735 1721 gene locus_tag LOCUS_37840 735 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 2436 1726 gene locus_tag LOCUS_37850 2436 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 >Feature sequence0764 <1 993 gene locus_tag LOCUS_37860 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943408.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0765 1971 952 gene locus_tag LOCUS_37870 gene hprK 1971 952 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_37870 >Feature sequence0766 >Feature sequence0767 <1 1269 gene locus_tag LOCUS_37880 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921626.1:Gfo/Idh/MocA family oxidoreductase 1319 2119 gene locus_tag LOCUS_37890 1319 2119 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665481.1 protein_id gnl|my_center|LOCUS_37890 >Feature sequence0768 1 774 gene locus_tag LOCUS_37900 1 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 1432 776 gene locus_tag LOCUS_37910 gene pcp 1432 776 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704765.1 protein_id gnl|my_center|LOCUS_37910 2420 1464 gene locus_tag LOCUS_37920 2420 1464 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021671.1 protein_id gnl|my_center|LOCUS_37920 >Feature sequence0769 <2507 1710 gene locus_tag LOCUS_37930 <2507 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390122.1:PQQ-dependent sugar dehydrogenase >Feature sequence0770 2157 376 gene locus_tag LOCUS_37940 2157 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 >Feature sequence0771 124 1500 gene locus_tag LOCUS_37950 124 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_37950 <2492 1723 gene locus_tag LOCUS_37960 <2492 1723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707167.1:DNA/RNA non-specific endonuclease >Feature sequence0772 <1 1356 gene locus_tag LOCUS_37970 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105472.1:RecQ family ATP-dependent DNA helicase <2487 1573 gene locus_tag LOCUS_37980 <2487 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123560.1:TIM barrel protein >Feature sequence0773 498 298 gene locus_tag LOCUS_37990 498 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 1785 553 gene locus_tag LOCUS_38000 1785 553 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 protein_id gnl|my_center|LOCUS_38000 <2485 1810 gene locus_tag LOCUS_38010 <2485 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001193633.1:HK97 family phage prohead protease >Feature sequence0774 331 20 gene locus_tag LOCUS_38020 331 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 1338 856 gene locus_tag LOCUS_38030 1338 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 1730 1431 gene locus_tag LOCUS_38040 1730 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 2082 1750 gene locus_tag LOCUS_38050 2082 1750 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_38050 2372 2079 gene locus_tag LOCUS_38060 2372 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 >Feature sequence0775 >Feature sequence0776 2184 595 gene locus_tag LOCUS_38070 gene serA 2184 595 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_38070 >Feature sequence0777 2353 1964 gene locus_tag LOCUS_38080 2353 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 >Feature sequence0778 <2461 576 gene locus_tag LOCUS_38090 <2461 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0779 <1 2361 gene locus_tag LOCUS_38100 <1 2361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106392.1:DUF1800 domain-containing protein >Feature sequence0780 1302 1709 gene locus_tag LOCUS_38110 1302 1709 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_38110 2024 2368 gene locus_tag LOCUS_38120 2024 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 >Feature sequence0781 <1 1423 gene locus_tag LOCUS_38130 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729994.1:3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) 1509 2426 gene locus_tag LOCUS_38140 gene iolE 1509 2426 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339182.1 protein_id gnl|my_center|LOCUS_38140 >Feature sequence0782 >Feature sequence0783 1659 217 gene locus_tag LOCUS_38150 1659 217 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_38150 >Feature sequence0784 1190 375 gene locus_tag LOCUS_38160 1190 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 >Feature sequence0785 <1 1453 gene locus_tag LOCUS_38170 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922210.1:redoxin domain-containing protein >Feature sequence0786 1782 850 gene locus_tag LOCUS_38180 1782 850 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 protein_id gnl|my_center|LOCUS_38180 1858 2175 gene locus_tag LOCUS_38190 1858 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 >Feature sequence0787 <1 900 gene locus_tag LOCUS_38200 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258538.1:VWA domain-containing protein 902 1279 gene locus_tag LOCUS_38210 902 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 1292 1888 gene locus_tag LOCUS_38220 1292 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 >Feature sequence0788 751 602 gene locus_tag LOCUS_38230 751 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 2190 748 gene locus_tag LOCUS_38240 2190 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence0789 <1 1574 gene locus_tag LOCUS_38250 <1 1574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791107.1:sulfatase >Feature sequence0790 1884 1324 gene locus_tag LOCUS_38260 1884 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 >Feature sequence0791 542 1255 gene locus_tag LOCUS_38270 542 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38270 >Feature sequence0792 >Feature sequence0793 >Feature sequence0794 <1 840 gene locus_tag LOCUS_38280 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173402000.1:arylsulfatase >Feature sequence0795 244 1335 gene locus_tag LOCUS_38290 244 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38290 1311 1898 gene locus_tag LOCUS_38300 1311 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 >Feature sequence0796 1031 582 gene locus_tag LOCUS_38310 1031 582 CDS product lpg2359 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_38310 1994 1245 gene locus_tag LOCUS_38320 1994 1245 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_38320 >Feature sequence0797 1505 621 gene locus_tag LOCUS_38330 1505 621 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688119.1 protein_id gnl|my_center|LOCUS_38330 1627 2343 gene locus_tag LOCUS_38340 1627 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 >Feature sequence0798 <2370 1014 gene locus_tag LOCUS_38350 <2370 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965969.1:DUF3300 domain-containing protein >Feature sequence0799 <1 840 gene locus_tag LOCUS_38360 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:efflux RND transporter permease subunit 1055 2299 gene locus_tag LOCUS_38370 1055 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 >Feature sequence0800 530 1456 gene locus_tag LOCUS_38380 530 1456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_38380 1497 2333 gene locus_tag LOCUS_38390 1497 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 >Feature sequence0801 1192 929 gene locus_tag LOCUS_38400 1192 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 1420 1241 gene locus_tag LOCUS_38410 1420 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 >Feature sequence0802 61 1002 gene locus_tag LOCUS_38420 61 1002 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_38420 1036 1824 gene locus_tag LOCUS_38430 1036 1824 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_38430 >Feature sequence0803 1652 672 gene locus_tag LOCUS_38440 1652 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 2197 1655 gene locus_tag LOCUS_38450 2197 1655 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_38450 >Feature sequence0804 571 1509 gene locus_tag LOCUS_38460 571 1509 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_38460 1632 1880 gene locus_tag LOCUS_38470 1632 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence0805 >Feature sequence0806 332 1126 gene locus_tag LOCUS_38480 332 1126 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence0807 769 173 gene locus_tag LOCUS_38490 gene yetL 769 173 CDS product transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233796.1 protein_id gnl|my_center|LOCUS_38490 <2331 1008 gene locus_tag LOCUS_38500 <2331 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224677.1:transketolase >Feature sequence0808 1331 678 gene locus_tag LOCUS_38510 1331 678 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976241.1 protein_id gnl|my_center|LOCUS_38510 <2326 1354 gene locus_tag LOCUS_38520 <2326 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117868.1:BtaA family protein >Feature sequence0809 <1 629 gene locus_tag LOCUS_38530 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095112.1:phosphonate ABC transporter substrate-binding protein 648 1508 gene locus_tag LOCUS_38540 gene phnC 648 1508 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168130.1 protein_id gnl|my_center|LOCUS_38540 >Feature sequence0810 2124 568 gene locus_tag LOCUS_38550 gene menD 2124 568 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence0811 >Feature sequence0812 124 372 gene locus_tag LOCUS_38560 124 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 760 374 gene locus_tag LOCUS_38570 760 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 909 1085 gene locus_tag LOCUS_38580 909 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 1153 1461 gene locus_tag LOCUS_38590 1153 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 1458 1928 gene locus_tag LOCUS_38600 1458 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 >Feature sequence0813 <1 817 gene locus_tag LOCUS_38610 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963595.1:di-heme oxidoredictase family protein <2281 973 gene locus_tag LOCUS_38620 <2281 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120107.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0814 >Feature sequence0815 <2274 139 gene locus_tag LOCUS_38630 <2274 139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918997.1:TonB-dependent receptor >Feature sequence0816 1207 2244 gene locus_tag LOCUS_38640 gene prfB 1207 2244 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence0817 755 345 gene locus_tag LOCUS_38650 755 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 991 2022 gene locus_tag LOCUS_38660 991 2022 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392175.1 protein_id gnl|my_center|LOCUS_38660 >Feature sequence0818 28 1386 gene locus_tag LOCUS_38670 28 1386 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_38670 >Feature sequence0819 90 383 gene locus_tag LOCUS_38680 90 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 417 605 gene locus_tag LOCUS_38690 417 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 602 850 gene locus_tag LOCUS_38700 602 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 837 1097 gene locus_tag LOCUS_38710 837 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 1094 1774 gene locus_tag LOCUS_38720 1094 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 1767 2102 gene locus_tag LOCUS_38730 1767 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 >Feature sequence0820 1044 640 gene locus_tag LOCUS_38740 1044 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 <2259 1380 gene locus_tag LOCUS_38750 <2259 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120135.1:DUF1552 domain-containing protein >Feature sequence0821 <1 1188 gene locus_tag LOCUS_38760 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922487.1:sulfatase >Feature sequence0822 <1 2048 gene locus_tag LOCUS_38770 <1 2048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225834.1:glycoside hydrolase N-terminal domain-containing protein >Feature sequence0823 369 815 gene locus_tag LOCUS_38780 gene rplO 369 815 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766093.1 protein_id gnl|my_center|LOCUS_38780 >Feature sequence0824 <2231 321 gene locus_tag LOCUS_38790 <2231 321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164741614.1:TonB-dependent receptor >Feature sequence0825 <2225 817 gene locus_tag LOCUS_38800 <2225 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256405.1:glucose-6-phosphate dehydrogenase >Feature sequence0826 1137 226 gene locus_tag LOCUS_38810 gene thrB 1137 226 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_38810 1613 1137 gene locus_tag LOCUS_38820 gene smpB 1613 1137 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_38820 1917 1708 gene locus_tag LOCUS_38830 1917 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 >Feature sequence0827 500 1879 gene locus_tag LOCUS_38840 500 1879 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969228.1 protein_id gnl|my_center|LOCUS_38840 >Feature sequence0828 1785 2027 gene locus_tag LOCUS_38850 1785 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 >Feature sequence0829 2210 750 gene locus_tag LOCUS_38860 2210 750 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065470.1 protein_id gnl|my_center|LOCUS_38860 >Feature sequence0830 >Feature sequence0831 >Feature sequence0832 2132 90 gene locus_tag LOCUS_38870 2132 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence0833 111 593 gene locus_tag LOCUS_38880 111 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 709 993 gene locus_tag LOCUS_38890 709 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 1761 1186 gene locus_tag LOCUS_38900 1761 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 >Feature sequence0834 1877 489 gene locus_tag LOCUS_38910 1877 489 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_38910 >Feature sequence0835 1085 1849 gene locus_tag LOCUS_38920 1085 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 >Feature sequence0836 <1 1043 gene locus_tag LOCUS_38930 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921299.1:sulfatase 2029 1070 gene locus_tag LOCUS_38940 2029 1070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_38940 >Feature sequence0837 3 236 gene locus_tag LOCUS_38950 3 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 247 1041 gene locus_tag LOCUS_38960 247 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 >Feature sequence0838 1565 84 gene locus_tag LOCUS_38970 1565 84 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_38970 <2185 1572 gene locus_tag LOCUS_38980 <2185 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0839 759 388 gene locus_tag LOCUS_38990 759 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 >Feature sequence0840 <1 1336 gene locus_tag LOCUS_39000 <1 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158257889.1:sulfatase 1515 1721 gene locus_tag LOCUS_39010 1515 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 1718 2104 gene locus_tag LOCUS_39020 1718 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 >Feature sequence0841 337 807 gene locus_tag LOCUS_39030 337 807 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965933.1 protein_id gnl|my_center|LOCUS_39030 1928 786 gene locus_tag LOCUS_39040 1928 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 >Feature sequence0842 295 477 gene locus_tag LOCUS_39050 295 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 659 1945 gene locus_tag LOCUS_39060 659 1945 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_39060 2133 2057 gene locus_tag LOCUS_t00290 2133 2057 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0843 104 1015 gene locus_tag LOCUS_39070 104 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 1464 982 gene locus_tag LOCUS_39080 1464 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 1640 1876 gene locus_tag LOCUS_39090 1640 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 >Feature sequence0844 >Feature sequence0845 1422 2075 gene locus_tag LOCUS_39100 gene nth 1422 2075 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_39100 >Feature sequence0846 775 1944 gene locus_tag LOCUS_39110 775 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 >Feature sequence0847 >Feature sequence0848 66 875 gene locus_tag LOCUS_39120 66 875 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114816.1 protein_id gnl|my_center|LOCUS_39120 962 1570 gene locus_tag LOCUS_39130 962 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 2002 1676 gene locus_tag LOCUS_39140 2002 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 >Feature sequence0849 >Feature sequence0850 <1 2127 gene locus_tag LOCUS_39150 <1 2127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681492.1:FAD-dependent oxidoreductase >Feature sequence0851 <1 1915 gene locus_tag LOCUS_39160 <1 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140250.1:aminomethyl-transferring glycine dehydrogenase >Feature sequence0852 238 1794 gene locus_tag LOCUS_39170 238 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 >Feature sequence0853 1468 107 gene locus_tag LOCUS_39180 1468 107 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 protein_id gnl|my_center|LOCUS_39180 >Feature sequence0854 >Feature sequence0855 346 8 gene locus_tag LOCUS_39190 346 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 632 387 gene locus_tag LOCUS_39200 632 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 780 607 gene locus_tag LOCUS_39210 780 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 997 749 gene locus_tag LOCUS_39220 997 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 1668 994 gene locus_tag LOCUS_39230 1668 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 >Feature sequence0856 1800 16 gene locus_tag LOCUS_39240 1800 16 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_39240 >Feature sequence0857 199 1452 gene locus_tag LOCUS_39250 199 1452 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_39250 >Feature sequence0858 <1 1461 gene locus_tag LOCUS_39260 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922522.1:sulfatase-like hydrolase/transferase >Feature sequence0859 1073 1393 gene locus_tag LOCUS_39270 1073 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence0860 356 1402 gene locus_tag LOCUS_39280 356 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 >Feature sequence0861 230 718 gene locus_tag LOCUS_39290 230 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 916 1557 gene locus_tag LOCUS_39300 916 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 >Feature sequence0862 1195 1878 gene locus_tag LOCUS_39310 gene eda 1195 1878 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_39310 >Feature sequence0863 >Feature sequence0864 <1 1381 gene locus_tag LOCUS_39320 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028443.1:stealth conserved region 3 domain-containing protein >Feature sequence0865 912 397 gene locus_tag LOCUS_39330 gene rplQ 912 397 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 protein_id gnl|my_center|LOCUS_39330 1998 997 gene locus_tag LOCUS_39340 1998 997 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_39340 >Feature sequence0866 >Feature sequence0867 167 853 gene locus_tag LOCUS_39350 167 853 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_39350 893 1333 gene locus_tag LOCUS_39360 gene rpiB 893 1333 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence0868 442 215 gene locus_tag LOCUS_39370 442 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39370 2076 451 gene locus_tag LOCUS_39380 2076 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 >Feature sequence0869 639 106 gene locus_tag LOCUS_39390 639 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 838 641 gene locus_tag LOCUS_39400 838 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 1740 847 gene locus_tag LOCUS_39410 1740 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 >Feature sequence0870 <1 596 gene locus_tag LOCUS_39420 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107730.1:glucose-1-phosphate cytidylyltransferase 602 1774 gene locus_tag LOCUS_39430 gene rfbG 602 1774 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937384.1 protein_id gnl|my_center|LOCUS_39430 >Feature sequence0871 305 751 gene locus_tag LOCUS_39440 305 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 1271 897 gene locus_tag LOCUS_39450 1271 897 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_39450 1601 2008 gene locus_tag LOCUS_39460 1601 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence0872 229 145 gene locus_tag LOCUS_t00300 229 145 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1413 352 gene locus_tag LOCUS_39470 1413 352 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 protein_id gnl|my_center|LOCUS_39470 >Feature sequence0873 590 1003 gene locus_tag LOCUS_39480 590 1003 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626602.1 protein_id gnl|my_center|LOCUS_39480 1047 1952 gene locus_tag LOCUS_39490 1047 1952 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869939.1 protein_id gnl|my_center|LOCUS_39490 >Feature sequence0874 <1 1902 gene locus_tag LOCUS_39500 <1 1902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146390841.1:DUF1549 domain-containing protein >Feature sequence0875 229 744 gene locus_tag LOCUS_39510 229 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 805 880 gene locus_tag LOCUS_t00310 805 880 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1696 920 gene locus_tag LOCUS_39520 1696 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 >Feature sequence0876 <1 599 gene locus_tag LOCUS_39530 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099260625.1:DUF4159 domain-containing protein 601 1623 gene locus_tag LOCUS_39540 601 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 >Feature sequence0877 553 119 gene locus_tag LOCUS_39550 553 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 1914 952 gene locus_tag LOCUS_39560 gene yedA 1914 952 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_39560 >Feature sequence0878 <2059 1277 gene locus_tag LOCUS_39570 <2059 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918194.1:ABC transporter ATP-binding protein >Feature sequence0879 >Feature sequence0880 370 1836 gene locus_tag LOCUS_39580 370 1836 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366800.1 protein_id gnl|my_center|LOCUS_39580 >Feature sequence0881 785 501 gene locus_tag LOCUS_39590 785 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 993 760 gene locus_tag LOCUS_39600 993 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 1402 1629 gene locus_tag LOCUS_39610 1402 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 1626 1922 gene locus_tag LOCUS_39620 1626 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 >Feature sequence0882 78 1136 gene locus_tag LOCUS_39630 78 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 >Feature sequence0883 101 514 gene locus_tag LOCUS_39640 101 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 647 1954 gene locus_tag LOCUS_39650 647 1954 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_39650 >Feature sequence0884 821 363 gene locus_tag LOCUS_39660 821 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 994 857 gene locus_tag LOCUS_39670 994 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 >Feature sequence0885 1 70 gene locus_tag LOCUS_t00320 1 70 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 210 731 gene locus_tag LOCUS_39680 210 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 982 1419 gene locus_tag LOCUS_39690 982 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 >Feature sequence0886 <2028 149 gene locus_tag LOCUS_39700 <2028 149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766132.1:sodium:solute symporter >Feature sequence0887 <1 1639 gene locus_tag LOCUS_39710 <1 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920761.1:TonB-dependent receptor >Feature sequence0888 953 96 gene locus_tag LOCUS_39720 gene rsmH 953 96 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39720 1689 1189 gene locus_tag LOCUS_39730 1689 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 >Feature sequence0889 177 749 gene locus_tag LOCUS_39740 177 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence0890 873 103 gene locus_tag LOCUS_39750 873 103 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 protein_id gnl|my_center|LOCUS_39750 1185 1042 gene locus_tag LOCUS_39760 1185 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 1336 1196 gene locus_tag LOCUS_39770 1336 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 1773 1351 gene locus_tag LOCUS_39780 1773 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 >Feature sequence0891 1493 1224 gene locus_tag LOCUS_39790 1493 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 1920 1759 gene locus_tag LOCUS_39800 1920 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 >Feature sequence0892 1 315 gene locus_tag LOCUS_39810 1 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 456 262 gene locus_tag LOCUS_39820 456 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 1093 422 gene locus_tag LOCUS_39830 1093 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 1192 1992 gene locus_tag LOCUS_39840 gene trpC 1192 1992 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_39840 >Feature sequence0893 1010 135 gene locus_tag LOCUS_39850 1010 135 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258970.1 protein_id gnl|my_center|LOCUS_39850 <2013 1022 gene locus_tag LOCUS_39860 <2013 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332028.1:SPFH domain-containing protein >Feature sequence0894 <1 1229 gene locus_tag LOCUS_39870 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189933.1:tetratricopeptide repeat protein >Feature sequence0895 >Feature sequence0896 1276 581 gene locus_tag LOCUS_39880 gene pxpA 1276 581 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097547.1 protein_id gnl|my_center|LOCUS_39880 <1994 1279 gene locus_tag LOCUS_39890 <1994 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000382245.1:biotin-dependent carboxyltransferase family protein >Feature sequence0897 >Feature sequence0898 >Feature sequence0899 <1 786 gene locus_tag LOCUS_39900 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546449.1:D-alanine--D-alanine ligase 858 1718 gene locus_tag LOCUS_39910 858 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 >Feature sequence0900 >Feature sequence0901 <1983 334 gene locus_tag LOCUS_39920 <1983 334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257848.1:NADH-quinone oxidoreductase subunit L >Feature sequence0902 1327 578 gene locus_tag LOCUS_39930 1327 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 1511 1921 gene locus_tag LOCUS_39940 1511 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 >Feature sequence0903 >Feature sequence0904 <1 549 gene locus_tag LOCUS_39950 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887796.1:allantoinase <1976 1011 gene locus_tag LOCUS_39960 <1976 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922898.1:FAD-dependent oxidoreductase >Feature sequence0905 <1 1762 gene locus_tag LOCUS_39970 <1 1762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962990.1:ABC transporter transmembrane domain-containing protein >Feature sequence0906 >Feature sequence0907 465 1925 gene locus_tag LOCUS_39980 465 1925 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_39980 >Feature sequence0908 >Feature sequence0909 593 1672 gene locus_tag LOCUS_39990 593 1672 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795124.1 protein_id gnl|my_center|LOCUS_39990 >Feature sequence0910 1696 278 gene locus_tag LOCUS_40000 1696 278 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_40000 >Feature sequence0911 588 175 gene locus_tag LOCUS_40010 588 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 1145 585 gene locus_tag LOCUS_40020 1145 585 CDS product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958464.1 protein_id gnl|my_center|LOCUS_40020 >Feature sequence0912 >Feature sequence0913 1558 785 gene locus_tag LOCUS_40030 1558 785 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705502.1 protein_id gnl|my_center|LOCUS_40030 >Feature sequence0914 734 1633 gene locus_tag LOCUS_40040 734 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 >Feature sequence0915 1309 122 gene locus_tag LOCUS_40050 1309 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 >Feature sequence0916 <1 677 gene locus_tag LOCUS_40060 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674084.1:transaldolase >Feature sequence0917 1474 377 gene locus_tag LOCUS_40070 1474 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40070 1944 1468 gene locus_tag LOCUS_40080 1944 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 >Feature sequence0918 340 1479 gene locus_tag LOCUS_40090 340 1479 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037106.1 protein_id gnl|my_center|LOCUS_40090 >Feature sequence0919 <1934 793 gene locus_tag LOCUS_40100 <1934 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257221.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence0920 >Feature sequence0921 1162 1323 gene locus_tag LOCUS_40110 1162 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 >Feature sequence0922 969 415 gene locus_tag LOCUS_40120 969 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 >Feature sequence0923 <1 928 gene locus_tag LOCUS_40130 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120390.1:sugar phosphate isomerase/epimerase <1927 1230 gene locus_tag LOCUS_40140 <1927 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032840507.1:rhamnogalacturonan acetylesterase >Feature sequence0924 215 63 gene locus_tag LOCUS_40150 215 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 1484 261 gene locus_tag LOCUS_40160 1484 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 >Feature sequence0925 506 1852 gene locus_tag LOCUS_40170 506 1852 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109157.1 protein_id gnl|my_center|LOCUS_40170 >Feature sequence0926 399 1229 gene locus_tag LOCUS_40180 399 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 >Feature sequence0927 <1 1164 gene locus_tag LOCUS_40190 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073343.1:DUF5009 domain-containing protein >Feature sequence0928 >Feature sequence0929 499 1563 gene locus_tag LOCUS_40200 gene tsaD 499 1563 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_40200 >Feature sequence0930 763 1563 gene locus_tag LOCUS_40210 763 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 >Feature sequence0931 1758 862 gene locus_tag LOCUS_40220 1758 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 >Feature sequence0932 1686 439 gene locus_tag LOCUS_40230 1686 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 >Feature sequence0933 1866 727 gene locus_tag LOCUS_40240 1866 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence0934 1216 941 gene locus_tag LOCUS_40250 1216 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 >Feature sequence0935 >Feature sequence0936 1161 271 gene locus_tag LOCUS_40260 1161 271 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958251.1 protein_id gnl|my_center|LOCUS_40260 >Feature sequence0937 <1 745 gene locus_tag LOCUS_40270 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729175.1:mechanosensitive ion channel family protein >Feature sequence0938 <1 535 gene locus_tag LOCUS_40280 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037394575.1:type II secretion system secretin GspD 538 1737 gene locus_tag LOCUS_40290 538 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 >Feature sequence0939 815 1102 gene locus_tag LOCUS_40300 815 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 1106 1516 gene locus_tag LOCUS_40310 1106 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence0940 1613 87 gene locus_tag LOCUS_40320 1613 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 >Feature sequence0941 157 696 gene locus_tag LOCUS_40330 157 696 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_40330 >Feature sequence0942 1760 903 gene locus_tag LOCUS_40340 1760 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 >Feature sequence0943 146 1057 gene locus_tag LOCUS_40350 146 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 <1857 1077 gene locus_tag LOCUS_40360 <1857 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083412.1:gamma-glutamyltransferase >Feature sequence0944 >Feature sequence0945 463 1581 gene locus_tag LOCUS_40370 gene proB 463 1581 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_40370 >Feature sequence0946 927 262 gene locus_tag LOCUS_40380 927 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 <1846 1001 gene locus_tag LOCUS_40390 <1846 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010147544.1:tRNA dihydrouridine synthase DusB >Feature sequence0947 >Feature sequence0948 659 291 gene locus_tag LOCUS_40400 659 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 969 640 gene locus_tag LOCUS_40410 969 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 1453 1160 gene locus_tag LOCUS_40420 1453 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 1650 1450 gene locus_tag LOCUS_40430 1650 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 >Feature sequence0949 804 469 gene locus_tag LOCUS_40440 804 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 938 1750 gene locus_tag LOCUS_40450 938 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 >Feature sequence0950 485 252 gene locus_tag LOCUS_40460 485 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 1096 740 gene locus_tag LOCUS_40470 1096 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 1559 1167 gene locus_tag LOCUS_40480 1559 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 >Feature sequence0951 <1830 976 gene locus_tag LOCUS_40490 <1830 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896022.1:2-oxoacid:acceptor oxidoreductase subunit alpha >Feature sequence0952 1790 861 gene locus_tag LOCUS_40500 1790 861 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_40500 >Feature sequence0953 >Feature sequence0954 230 1744 gene locus_tag LOCUS_40510 230 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 >Feature sequence0955 534 100 gene locus_tag LOCUS_40520 534 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 >Feature sequence0956 <1 813 gene locus_tag LOCUS_40530 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058107.1:serine hydrolase 1583 864 gene locus_tag LOCUS_40540 1583 864 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_40540 >Feature sequence0957 61 1032 gene locus_tag LOCUS_40550 61 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 >Feature sequence0958 >Feature sequence0959 108 1385 gene locus_tag LOCUS_40560 108 1385 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_40560 1378 1674 gene locus_tag LOCUS_40570 1378 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 >Feature sequence0960 >Feature sequence0961 730 92 gene locus_tag LOCUS_40580 730 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 1236 790 gene locus_tag LOCUS_40590 1236 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 >Feature sequence0962 <1 842 gene locus_tag LOCUS_40600 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729162.1:MDR family MFS transporter 931 1425 gene locus_tag LOCUS_40610 931 1425 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729161.1 protein_id gnl|my_center|LOCUS_40610 >Feature sequence0963 >Feature sequence0964 739 323 gene locus_tag LOCUS_40620 739 323 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967510.1 protein_id gnl|my_center|LOCUS_40620 978 736 gene locus_tag LOCUS_40630 978 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 >Feature sequence0965 >Feature sequence0966 1574 933 gene locus_tag LOCUS_40640 1574 933 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036867.1 protein_id gnl|my_center|LOCUS_40640 >Feature sequence0967 >Feature sequence0968 2 538 gene locus_tag LOCUS_40650 2 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 641 1624 gene locus_tag LOCUS_40660 641 1624 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_40660 >Feature sequence0969 >Feature sequence0970 >Feature sequence0971 1482 7 gene locus_tag LOCUS_40670 1482 7 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_40670 >Feature sequence0972 2 1138 gene locus_tag LOCUS_40680 2 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 1184 1366 gene locus_tag LOCUS_40690 1184 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 1371 1580 gene locus_tag LOCUS_40700 1371 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 >Feature sequence0973 584 1231 gene locus_tag LOCUS_40710 584 1231 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_40710 >Feature sequence0974 >Feature sequence0975 >Feature sequence0976 1655 639 gene locus_tag LOCUS_40720 1655 639 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_40720 >Feature sequence0977 >Feature sequence0978 8 1660 gene locus_tag LOCUS_40730 8 1660 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_40730 >Feature sequence0979 1202 270 gene locus_tag LOCUS_40740 1202 270 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_40740 >Feature sequence0980 1100 138 gene locus_tag LOCUS_40750 1100 138 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 protein_id gnl|my_center|LOCUS_40750 <1718 1168 gene locus_tag LOCUS_40760 <1718 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224600.1:sigma-70 family RNA polymerase sigma factor >Feature sequence0981 >Feature sequence0982 740 186 gene locus_tag LOCUS_40770 740 186 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 protein_id gnl|my_center|LOCUS_40770 >Feature sequence0983 <1 1473 gene locus_tag LOCUS_40780 <1 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926995.1:DEAD/DEAH box helicase family protein >Feature sequence0984 499 1149 gene locus_tag LOCUS_40790 499 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 >Feature sequence0985 311 1162 gene locus_tag LOCUS_40800 311 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 >Feature sequence0986 529 230 gene locus_tag LOCUS_40810 529 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 1494 625 gene locus_tag LOCUS_40820 1494 625 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921844.1 protein_id gnl|my_center|LOCUS_40820 >Feature sequence0987 1498 728 gene locus_tag LOCUS_40830 1498 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 >Feature sequence0988 <1701 317 gene locus_tag LOCUS_40840 <1701 317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein >Feature sequence0989 <1 551 gene locus_tag LOCUS_40850 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963947.1:trans-2-enoyl-CoA reductase family protein 610 1125 gene locus_tag LOCUS_40860 gene dtd 610 1125 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_40860 >Feature sequence0990 192 1076 gene locus_tag LOCUS_40870 192 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 >Feature sequence0991 <1694 162 gene locus_tag LOCUS_40880 <1694 162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117861.1:FAD-dependent oxidoreductase >Feature sequence0992 >Feature sequence0993 1128 1625 gene locus_tag LOCUS_40890 1128 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 >Feature sequence0994 195 992 gene locus_tag LOCUS_40900 gene phnE 195 992 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_40900 >Feature sequence0995 >Feature sequence0996 283 1227 gene locus_tag LOCUS_40910 283 1227 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899748.1 protein_id gnl|my_center|LOCUS_40910 >Feature sequence0997 <1668 1062 gene locus_tag LOCUS_40920 <1668 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001830529.1:sugar porter family MFS transporter >Feature sequence0998 473 87 gene locus_tag LOCUS_40930 gene rplS 473 87 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068669.1 protein_id gnl|my_center|LOCUS_40930 1162 470 gene locus_tag LOCUS_40940 gene trmD 1162 470 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_40940 1519 1253 gene locus_tag LOCUS_40950 gene rpsP 1519 1253 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929697.1 protein_id gnl|my_center|LOCUS_40950 >Feature sequence0999 >Feature sequence1000 305 1291 gene locus_tag LOCUS_40960 305 1291 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_40960 >Feature sequence1001 <1653 1021 gene locus_tag LOCUS_40970 <1653 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919382.1:MFS transporter >Feature sequence1002 201 1454 gene locus_tag LOCUS_40980 201 1454 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_40980 >Feature sequence1003 >Feature sequence1004 >Feature sequence1005 <1 1356 gene locus_tag LOCUS_40990 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615806.1:tetratricopeptide repeat protein >Feature sequence1006 1507 146 gene locus_tag LOCUS_41000 gene nuoF 1507 146 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_41000 >Feature sequence1007 2 373 gene locus_tag LOCUS_41010 2 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 352 1260 gene locus_tag LOCUS_41020 352 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404655.1 protein_id gnl|my_center|LOCUS_41020 >Feature sequence1008 >Feature sequence1009 <1 1142 gene locus_tag LOCUS_41030 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192539.1:NAD-dependent DNA ligase LigA >Feature sequence1010 <1 1269 gene locus_tag LOCUS_41040 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123786.1:DUF1552 domain-containing protein >Feature sequence1011 <1 1095 gene locus_tag LOCUS_41050 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein 1346 1422 gene locus_tag LOCUS_t00330 1346 1422 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1012 <1613 682 gene locus_tag LOCUS_41060 <1613 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393753.1:TIM barrel protein >Feature sequence1013 <1 728 gene locus_tag LOCUS_41070 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941668.1:nitrogen fixation sigma-54 dependent transcriptional regulator GnfM >Feature sequence1014 1269 445 gene locus_tag LOCUS_41080 1269 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 >Feature sequence1015 289 630 gene locus_tag LOCUS_41090 289 630 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257824.1 protein_id gnl|my_center|LOCUS_41090 617 1027 gene locus_tag LOCUS_41100 617 1027 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257825.1 protein_id gnl|my_center|LOCUS_41100 1110 1517 gene locus_tag LOCUS_41110 1110 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 >Feature sequence1016 1292 633 gene locus_tag LOCUS_41120 1292 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 >Feature sequence1017 <1602 16 gene locus_tag LOCUS_41130 <1602 16 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666716.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence1018 1386 139 gene locus_tag LOCUS_41140 1386 139 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727103.1 protein_id gnl|my_center|LOCUS_41140 >Feature sequence1019 >Feature sequence1020 <1 1449 gene locus_tag LOCUS_41150 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921573.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence1021 >Feature sequence1022 >Feature sequence1023 112 1257 gene locus_tag LOCUS_41160 112 1257 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_41160 >Feature sequence1024 >Feature sequence1025 <1582 793 gene locus_tag LOCUS_41170 <1582 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392434.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II >Feature sequence1026 <1581 263 gene locus_tag LOCUS_41180 <1581 263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence1027 <1580 189 gene locus_tag LOCUS_41190 <1580 189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024901093.1:heavy metal translocating P-type ATPase >Feature sequence1028 209 439 gene locus_tag LOCUS_41200 209 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 436 1020 gene locus_tag LOCUS_41210 436 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 >Feature sequence1029 >Feature sequence1030 >Feature sequence1031 >Feature sequence1032 <1 822 gene locus_tag LOCUS_41220 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259152.1:ATP-binding cassette domain-containing protein >Feature sequence1033 >Feature sequence1034 <1553 71 gene locus_tag LOCUS_41230 <1553 71 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803903.1:serine hydrolase domain-containing protein >Feature sequence1035 279 593 gene locus_tag LOCUS_41240 279 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 574 807 gene locus_tag LOCUS_41250 574 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41250 818 1117 gene locus_tag LOCUS_41260 818 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41260 1158 1529 gene locus_tag LOCUS_41270 1158 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 >Feature sequence1036 >Feature sequence1037 >Feature sequence1038 1301 1152 gene locus_tag LOCUS_41280 1301 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 >Feature sequence1039 335 1213 gene locus_tag LOCUS_41290 335 1213 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_41290 >Feature sequence1040 >Feature sequence1041 <1539 408 gene locus_tag LOCUS_41300 <1539 408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000126347.1:lipopolysaccharide biosynthesis protein RfbH >Feature sequence1042 >Feature sequence1043 >Feature sequence1044 121 717 gene locus_tag LOCUS_41310 121 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 >Feature sequence1045 <1 1399 gene locus_tag LOCUS_41320 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091628724.1:FkbM family methyltransferase >Feature sequence1046 >Feature sequence1047 <1 1464 gene locus_tag LOCUS_41330 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_087861794.1:DNA polymerase IV >Feature sequence1048 >Feature sequence1049 766 20 gene locus_tag LOCUS_41340 766 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 >Feature sequence1050 >Feature sequence1051 495 13 gene locus_tag LOCUS_41350 495 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 <1506 503 gene locus_tag LOCUS_41360 <1506 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120136.1:DUF1592 domain-containing protein >Feature sequence1052 103 402 gene locus_tag LOCUS_41370 103 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 471 680 gene locus_tag LOCUS_41380 471 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 768 1223 gene locus_tag LOCUS_41390 768 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 1220 1399 gene locus_tag LOCUS_41400 1220 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 >Feature sequence1053