>Feature sequence01 248 1732 gene locus_tag LOCUS_00010 248 1732 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_00010 2597 1812 gene locus_tag LOCUS_00020 2597 1812 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320550.1 protein_id gnl|my_center|LOCUS_00020 4397 2658 gene locus_tag LOCUS_00030 4397 2658 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_00030 6209 4416 gene locus_tag LOCUS_00040 gene nuoF 6209 4416 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_00040 6593 6222 gene locus_tag LOCUS_00050 6593 6222 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_00050 7203 6646 gene locus_tag LOCUS_00060 7203 6646 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_00060 7705 7208 gene locus_tag LOCUS_00070 gene nuoE 7705 7208 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_00070 8878 8123 gene locus_tag LOCUS_00080 8878 8123 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869446.1 protein_id gnl|my_center|LOCUS_00080 9210 8875 gene locus_tag LOCUS_00090 9210 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10561 9212 gene locus_tag LOCUS_00100 10561 9212 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_00100 11032 10598 gene locus_tag LOCUS_00110 11032 10598 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869443.1 protein_id gnl|my_center|LOCUS_00110 11379 11029 gene locus_tag LOCUS_00120 11379 11029 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_00120 11759 12844 gene locus_tag LOCUS_00130 gene serC 11759 12844 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_00130 12844 14004 gene locus_tag LOCUS_00140 12844 14004 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_00140 14844 14077 gene locus_tag LOCUS_00150 14844 14077 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_00150 15167 14940 gene locus_tag LOCUS_00160 15167 14940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15294 17639 gene locus_tag LOCUS_00170 15294 17639 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599517.1 protein_id gnl|my_center|LOCUS_00170 17929 17717 gene locus_tag LOCUS_00180 17929 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18448 18305 gene locus_tag LOCUS_00190 18448 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19241 18744 gene locus_tag LOCUS_00200 19241 18744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19638 19444 gene locus_tag LOCUS_00210 19638 19444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19600 20325 gene locus_tag LOCUS_00220 19600 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20539 21936 gene locus_tag LOCUS_00230 20539 21936 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_00230 22322 21993 gene locus_tag LOCUS_00240 22322 21993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22578 23180 gene locus_tag LOCUS_00250 22578 23180 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642400.1 protein_id gnl|my_center|LOCUS_00250 23388 24482 gene locus_tag LOCUS_00260 gene ychF 23388 24482 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_00260 25338 24652 gene locus_tag LOCUS_00270 25338 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26902 25508 gene locus_tag LOCUS_00280 26902 25508 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945002.1 protein_id gnl|my_center|LOCUS_00280 28548 27244 gene locus_tag LOCUS_00290 28548 27244 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_00290 29209 28634 gene locus_tag LOCUS_00300 29209 28634 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392451.1 protein_id gnl|my_center|LOCUS_00300 31020 29209 gene locus_tag LOCUS_00310 gene iorA 31020 29209 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392452.1 protein_id gnl|my_center|LOCUS_00310 32500 31199 gene locus_tag LOCUS_00320 32500 31199 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682090.1 protein_id gnl|my_center|LOCUS_00320 33418 32633 gene locus_tag LOCUS_00330 33418 32633 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101871.1 protein_id gnl|my_center|LOCUS_00330 34421 33525 gene locus_tag LOCUS_00340 34421 33525 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_00340 36109 34418 gene locus_tag LOCUS_00350 36109 34418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38114 36291 gene locus_tag LOCUS_00360 gene typA 38114 36291 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_00360 38398 39282 gene locus_tag LOCUS_00370 38398 39282 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 protein_id gnl|my_center|LOCUS_00370 39397 39975 gene locus_tag LOCUS_00380 39397 39975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40144 41538 gene locus_tag LOCUS_00390 40144 41538 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_00390 41985 41641 gene locus_tag LOCUS_00400 41985 41641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42545 42060 gene locus_tag LOCUS_00410 42545 42060 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_00410 43246 42545 gene locus_tag LOCUS_00420 43246 42545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 44619 43243 gene locus_tag LOCUS_00430 44619 43243 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_00430 44880 45701 gene locus_tag LOCUS_00440 44880 45701 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_00440 47091 45943 gene locus_tag LOCUS_00450 gene fucO 47091 45943 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783906.1 protein_id gnl|my_center|LOCUS_00450 47658 47161 gene locus_tag LOCUS_00460 47658 47161 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674933.1 protein_id gnl|my_center|LOCUS_00460 48579 47758 gene locus_tag LOCUS_00470 gene rhaD 48579 47758 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209103.1 protein_id gnl|my_center|LOCUS_00470 49899 48622 gene locus_tag LOCUS_00480 49899 48622 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211475.1 protein_id gnl|my_center|LOCUS_00480 51107 49896 gene locus_tag LOCUS_00490 gene coaBC 51107 49896 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_00490 52542 51115 gene locus_tag LOCUS_00500 gene rhaB 52542 51115 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243094.1 protein_id gnl|my_center|LOCUS_00500 53073 52744 gene locus_tag LOCUS_00510 53073 52744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 53435 54949 gene locus_tag LOCUS_00520 gene abfA 53435 54949 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_00520 55051 55581 gene locus_tag LOCUS_00530 55051 55581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 55601 56077 gene locus_tag LOCUS_00540 55601 56077 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_00540 56070 56852 gene locus_tag LOCUS_00550 56070 56852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 58084 57770 gene locus_tag LOCUS_00560 58084 57770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 59101 58139 gene locus_tag LOCUS_00570 59101 58139 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476555.1 protein_id gnl|my_center|LOCUS_00570 59782 59132 gene locus_tag LOCUS_00580 59782 59132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 60531 59779 gene locus_tag LOCUS_00590 60531 59779 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_00590 60645 61172 gene locus_tag LOCUS_00600 60645 61172 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_00600 63041 61737 gene locus_tag LOCUS_00610 63041 61737 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964854.1 protein_id gnl|my_center|LOCUS_00610 63485 63057 gene locus_tag LOCUS_00620 63485 63057 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_00620 64140 63475 gene locus_tag LOCUS_00630 gene deoC 64140 63475 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_00630 64955 64257 gene locus_tag LOCUS_00640 gene deoD 64955 64257 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829961.1 protein_id gnl|my_center|LOCUS_00640 65460 65032 gene locus_tag LOCUS_00650 65460 65032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 66606 65632 gene locus_tag LOCUS_00660 66606 65632 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_00660 67646 66642 gene locus_tag LOCUS_00670 67646 66642 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963717.1 protein_id gnl|my_center|LOCUS_00670 68669 67710 gene locus_tag LOCUS_00680 gene manA 68669 67710 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_00680 69609 68833 gene locus_tag LOCUS_00690 69609 68833 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_00690 70877 69789 gene locus_tag LOCUS_00700 70877 69789 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287288.1 protein_id gnl|my_center|LOCUS_00700 71444 71088 gene locus_tag LOCUS_00710 71444 71088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 74441 71463 gene locus_tag LOCUS_00720 74441 71463 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_00720 74625 77819 gene locus_tag LOCUS_00730 74625 77819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 78073 78762 gene locus_tag LOCUS_00740 78073 78762 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_00740 78777 80366 gene locus_tag LOCUS_00750 78777 80366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 80359 81945 gene locus_tag LOCUS_00760 80359 81945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 82546 82082 gene locus_tag LOCUS_00770 82546 82082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 83118 82564 gene locus_tag LOCUS_00780 83118 82564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 84190 83132 gene locus_tag LOCUS_00790 84190 83132 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940117.1 protein_id gnl|my_center|LOCUS_00790 84536 84180 gene locus_tag LOCUS_00800 84536 84180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 84876 84526 gene locus_tag LOCUS_00810 84876 84526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 85830 84940 gene locus_tag LOCUS_00820 85830 84940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 86339 85827 gene locus_tag LOCUS_00830 86339 85827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 87101 86409 gene locus_tag LOCUS_00840 87101 86409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 87417 87088 gene locus_tag LOCUS_00850 87417 87088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 87770 87405 gene locus_tag LOCUS_00860 87770 87405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 88863 87844 gene locus_tag LOCUS_00870 88863 87844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 89850 88879 gene locus_tag LOCUS_00880 89850 88879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 90970 89834 gene locus_tag LOCUS_00890 90970 89834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 92229 90958 gene locus_tag LOCUS_00900 92229 90958 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_00900 92540 92226 gene locus_tag LOCUS_00910 92540 92226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 93586 92891 gene locus_tag LOCUS_00920 93586 92891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 94095 93664 gene locus_tag LOCUS_00930 94095 93664 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_00930 95518 94220 gene locus_tag LOCUS_00940 95518 94220 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_00940 96107 95541 gene locus_tag LOCUS_00950 96107 95541 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_00950 97869 96145 gene locus_tag LOCUS_00960 gene iorA 97869 96145 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_00960 99254 97962 gene locus_tag LOCUS_00970 99254 97962 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_00970 100326 99451 gene locus_tag LOCUS_00980 100326 99451 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_00980 100710 102668 gene locus_tag LOCUS_00990 gene metG 100710 102668 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_00990 102677 103450 gene locus_tag LOCUS_01000 102677 103450 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_01000 103474 104079 gene locus_tag LOCUS_01010 103474 104079 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_01010 104817 104170 gene locus_tag LOCUS_01020 104817 104170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 106304 104829 gene locus_tag LOCUS_01030 106304 104829 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_01030 106509 107354 gene locus_tag LOCUS_01040 106509 107354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 109049 107541 gene locus_tag LOCUS_01050 gene malQ 109049 107541 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_01050 111522 109198 gene locus_tag LOCUS_01060 gene spoIIE 111522 109198 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048377.1 protein_id gnl|my_center|LOCUS_01060 112073 113260 gene locus_tag LOCUS_01070 112073 113260 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_01070 113334 114353 gene locus_tag LOCUS_01080 gene trpS 113334 114353 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 protein_id gnl|my_center|LOCUS_01080 114570 115877 gene locus_tag LOCUS_01090 114570 115877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 116622 115996 gene locus_tag LOCUS_01100 116622 115996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 117762 116674 gene locus_tag LOCUS_01110 gene mnmA 117762 116674 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460325.1 protein_id gnl|my_center|LOCUS_01110 118252 117740 gene locus_tag LOCUS_01120 118252 117740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 118588 118346 gene locus_tag LOCUS_01130 118588 118346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 118779 118561 gene locus_tag LOCUS_01140 118779 118561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 118990 119193 gene locus_tag LOCUS_01150 118990 119193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 119183 119500 gene locus_tag LOCUS_01160 119183 119500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 119587 121725 gene locus_tag LOCUS_01170 119587 121725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 121727 122524 gene locus_tag LOCUS_01180 121727 122524 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_01180 123792 122653 gene locus_tag LOCUS_01190 123792 122653 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_01190 124743 123877 gene locus_tag LOCUS_01200 124743 123877 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_01200 126055 124880 gene locus_tag LOCUS_01210 126055 124880 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_01210 126330 126142 gene locus_tag LOCUS_01220 126330 126142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 126733 126338 gene locus_tag LOCUS_01230 126733 126338 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145288.1 protein_id gnl|my_center|LOCUS_01230 128088 126967 gene locus_tag LOCUS_01240 gene ftsZ 128088 126967 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_01240 129377 128442 gene locus_tag LOCUS_01250 129377 128442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 130768 129458 gene locus_tag LOCUS_01260 gene murA 130768 129458 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_01260 131969 130854 gene locus_tag LOCUS_01270 gene murG 131969 130854 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286637.1 protein_id gnl|my_center|LOCUS_01270 133335 132070 gene locus_tag LOCUS_01280 gene spoVE 133335 132070 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_01280 134434 133433 gene locus_tag LOCUS_01290 gene mraY 134434 133433 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893058.1 protein_id gnl|my_center|LOCUS_01290 136909 134471 gene locus_tag LOCUS_01300 136909 134471 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_01300 137596 137078 gene locus_tag LOCUS_01310 137596 137078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 138588 137638 gene locus_tag LOCUS_01320 gene rsmH 138588 137638 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_01320 139013 138594 gene locus_tag LOCUS_01330 gene mraZ 139013 138594 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_01330 139994 139500 gene locus_tag LOCUS_01340 139994 139500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258265.1 protein_id gnl|my_center|LOCUS_01340 140516 140028 gene locus_tag LOCUS_01350 gene coaD 140516 140028 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_01350 141084 140539 gene locus_tag LOCUS_01360 gene rsmD 141084 140539 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_01360 143143 141263 gene locus_tag LOCUS_01370 gene uvrC 143143 141263 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_01370 143523 143260 gene locus_tag LOCUS_01380 143523 143260 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_01380 144493 143771 gene locus_tag LOCUS_01390 gene trmD 144493 143771 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_01390 145037 144483 gene locus_tag LOCUS_01400 gene rimM 145037 144483 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 protein_id gnl|my_center|LOCUS_01400 145451 145218 gene locus_tag LOCUS_01410 145451 145218 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_01410 145728 145489 gene locus_tag LOCUS_01420 gene rpsP 145728 145489 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_01420 147173 145803 gene locus_tag LOCUS_01430 gene ffh 147173 145803 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_01430 147564 147202 gene locus_tag LOCUS_01440 147564 147202 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_01440 147852 148076 gene locus_tag LOCUS_01450 147852 148076 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922422.1 protein_id gnl|my_center|LOCUS_01450 148165 149208 gene locus_tag LOCUS_01460 148165 149208 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_01460 149499 150197 gene locus_tag LOCUS_01470 149499 150197 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_01470 150212 150898 gene locus_tag LOCUS_01480 150212 150898 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389343.1 protein_id gnl|my_center|LOCUS_01480 150933 152816 gene locus_tag LOCUS_01490 150933 152816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_01490 152797 154677 gene locus_tag LOCUS_01500 152797 154677 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671827.1 protein_id gnl|my_center|LOCUS_01500 156759 154756 gene locus_tag LOCUS_01510 156759 154756 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_01510 157761 156955 gene locus_tag LOCUS_01520 157761 156955 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064825.1 protein_id gnl|my_center|LOCUS_01520 157889 159097 gene locus_tag LOCUS_01530 157889 159097 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_01530 159172 160005 gene locus_tag LOCUS_01540 159172 160005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 160453 162120 gene locus_tag LOCUS_01550 160453 162120 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_01550 162296 162793 gene locus_tag LOCUS_01560 162296 162793 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_01560 163616 163029 gene locus_tag LOCUS_01570 163616 163029 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763965.1 protein_id gnl|my_center|LOCUS_01570 164861 163704 gene locus_tag LOCUS_01580 164861 163704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 165211 164969 gene locus_tag LOCUS_01590 165211 164969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 166184 165348 gene locus_tag LOCUS_01600 166184 165348 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_01600 166521 167312 gene locus_tag LOCUS_01610 166521 167312 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_01610 167327 168568 gene locus_tag LOCUS_01620 167327 168568 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_01620 168766 169734 gene locus_tag LOCUS_01630 gene gluQRS 168766 169734 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_01630 171584 169827 gene locus_tag LOCUS_01640 171584 169827 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_01640 172713 172204 gene locus_tag LOCUS_01650 172713 172204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 173257 172730 gene locus_tag LOCUS_01660 173257 172730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 173579 173292 gene locus_tag LOCUS_01670 173579 173292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 174861 173599 gene locus_tag LOCUS_01680 174861 173599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 176449 175832 gene locus_tag LOCUS_01690 176449 175832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 176919 176446 gene locus_tag LOCUS_01700 176919 176446 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_01700 177411 177151 gene locus_tag LOCUS_01710 177411 177151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 177488 177730 gene locus_tag LOCUS_01720 177488 177730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01720 179326 177764 gene locus_tag LOCUS_01730 179326 177764 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_01730 179845 179489 gene locus_tag LOCUS_01740 179845 179489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 180100 180291 gene locus_tag LOCUS_01750 180100 180291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 180288 180431 gene locus_tag LOCUS_01760 180288 180431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 180389 181042 gene locus_tag LOCUS_01770 180389 181042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 181014 181235 gene locus_tag LOCUS_01780 181014 181235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 181225 181626 gene locus_tag LOCUS_01790 181225 181626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 181620 183008 gene locus_tag LOCUS_01800 181620 183008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 183011 183916 gene locus_tag LOCUS_01810 183011 183916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 183921 186443 gene locus_tag LOCUS_01820 183921 186443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 186443 187474 gene locus_tag LOCUS_01830 186443 187474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 187489 187611 gene locus_tag LOCUS_01840 187489 187611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 187598 187837 gene locus_tag LOCUS_01850 187598 187837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 187852 188376 gene locus_tag LOCUS_01860 187852 188376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 188433 188663 gene locus_tag LOCUS_01870 188433 188663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 188660 189211 gene locus_tag LOCUS_01880 188660 189211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 189215 189601 gene locus_tag LOCUS_01890 189215 189601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 189614 190255 gene locus_tag LOCUS_01900 gene thyX 189614 190255 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393959.1 protein_id gnl|my_center|LOCUS_01900 190242 190658 gene locus_tag LOCUS_01910 190242 190658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 190651 190896 gene locus_tag LOCUS_01920 190651 190896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 190893 191189 gene locus_tag LOCUS_01930 190893 191189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 191176 191970 gene locus_tag LOCUS_01940 191176 191970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 192091 192663 gene locus_tag LOCUS_01950 192091 192663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 192724 193761 gene locus_tag LOCUS_01960 192724 193761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 193765 193935 gene locus_tag LOCUS_01970 193765 193935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 193935 194438 gene locus_tag LOCUS_01980 193935 194438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 194422 195900 gene locus_tag LOCUS_01990 194422 195900 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090968.1 protein_id gnl|my_center|LOCUS_01990 195900 196643 gene locus_tag LOCUS_02000 195900 196643 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004056545.1 protein_id gnl|my_center|LOCUS_02000 196926 197621 gene locus_tag LOCUS_02010 196926 197621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 198034 198411 gene locus_tag LOCUS_02020 198034 198411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 198425 198781 gene locus_tag LOCUS_02030 198425 198781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 198785 199252 gene locus_tag LOCUS_02040 198785 199252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 199270 199563 gene locus_tag LOCUS_02050 199270 199563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 200121 200336 gene locus_tag LOCUS_02060 200121 200336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 200498 201256 gene locus_tag LOCUS_02070 200498 201256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 201258 201695 gene locus_tag LOCUS_02080 201258 201695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 201900 203540 gene locus_tag LOCUS_02090 gene terL 201900 203540 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819485.1 protein_id gnl|my_center|LOCUS_02090 203746 205200 gene locus_tag LOCUS_02100 203746 205200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 205321 205893 gene locus_tag LOCUS_02110 205321 205893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 205893 206645 gene locus_tag LOCUS_02120 205893 206645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 206662 206877 gene locus_tag LOCUS_02130 206662 206877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 206897 207214 gene locus_tag LOCUS_02140 206897 207214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 207211 207618 gene locus_tag LOCUS_02150 207211 207618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 207605 208132 gene locus_tag LOCUS_02160 207605 208132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 208129 208533 gene locus_tag LOCUS_02170 208129 208533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 208539 208967 gene locus_tag LOCUS_02180 208539 208967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 208993 209322 gene locus_tag LOCUS_02190 208993 209322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 209316 209774 gene locus_tag LOCUS_02200 209316 209774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 209781 214394 gene locus_tag LOCUS_02210 209781 214394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 214407 214778 gene locus_tag LOCUS_02220 214407 214778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 214793 217015 gene locus_tag LOCUS_02230 214793 217015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 217018 217443 gene locus_tag LOCUS_02240 217018 217443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 217444 218100 gene locus_tag LOCUS_02250 217444 218100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 218104 218976 gene locus_tag LOCUS_02260 218104 218976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 219022 219657 gene locus_tag LOCUS_02270 219022 219657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 220159 220920 gene locus_tag LOCUS_02280 220159 220920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 220881 221213 gene locus_tag LOCUS_02290 220881 221213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 221381 221509 gene locus_tag LOCUS_02300 221381 221509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 221590 222120 gene locus_tag LOCUS_02310 221590 222120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 222136 223644 gene locus_tag LOCUS_02320 222136 223644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 223648 223944 gene locus_tag LOCUS_02330 223648 223944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 223937 224248 gene locus_tag LOCUS_02340 223937 224248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 224406 224330 gene locus_tag LOCUS_t00010 224406 224330 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 226256 224589 gene locus_tag LOCUS_02350 226256 224589 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_02350 227268 226444 gene locus_tag LOCUS_02360 227268 226444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053699.1 protein_id gnl|my_center|LOCUS_02360 227770 227270 gene locus_tag LOCUS_02370 227770 227270 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296548.1 protein_id gnl|my_center|LOCUS_02370 228936 227800 gene locus_tag LOCUS_02380 gene pheA 228936 227800 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_02380 230046 228970 gene locus_tag LOCUS_02390 gene aroC 230046 228970 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_02390 231313 230024 gene locus_tag LOCUS_02400 gene aroA 231313 230024 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_02400 232418 231342 gene locus_tag LOCUS_02410 gene aroB 232418 231342 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_02410 233245 232418 gene locus_tag LOCUS_02420 233245 232418 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_02420 234308 233295 gene locus_tag LOCUS_02430 gene aroF 234308 233295 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_02430 235295 234657 gene locus_tag LOCUS_02440 235295 234657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 236239 235370 gene locus_tag LOCUS_02450 236239 235370 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_02450 236412 236639 gene locus_tag LOCUS_02460 gene acpP 236412 236639 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_02460 236768 238207 gene locus_tag LOCUS_02470 gene proS 236768 238207 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_02470 238452 239570 gene locus_tag LOCUS_02480 238452 239570 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_02480 239655 240506 gene locus_tag LOCUS_02490 239655 240506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 242197 240641 gene locus_tag LOCUS_02500 242197 240641 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_02500 242813 242325 gene locus_tag LOCUS_02510 242813 242325 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_02510 243923 242856 gene locus_tag LOCUS_02520 243923 242856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 245003 243963 gene locus_tag LOCUS_02530 gene prmA 245003 243963 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 protein_id gnl|my_center|LOCUS_02530 244997 246562 gene locus_tag LOCUS_02540 244997 246562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 247439 246552 gene locus_tag LOCUS_02550 247439 246552 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003517572.1 protein_id gnl|my_center|LOCUS_02550 248366 247458 gene locus_tag LOCUS_02560 248366 247458 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_02560 250301 248463 gene locus_tag LOCUS_02570 250301 248463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 251667 250702 gene locus_tag LOCUS_02580 251667 250702 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 protein_id gnl|my_center|LOCUS_02580 251897 253168 gene locus_tag LOCUS_02590 251897 253168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 253351 253097 gene locus_tag LOCUS_02600 253351 253097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 253338 254003 gene locus_tag LOCUS_02610 253338 254003 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_02610 254155 254466 gene locus_tag LOCUS_02620 254155 254466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 254494 256206 gene locus_tag LOCUS_02630 254494 256206 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817202.1 protein_id gnl|my_center|LOCUS_02630 258069 256222 gene locus_tag LOCUS_02640 258069 256222 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948830.1 protein_id gnl|my_center|LOCUS_02640 259025 258273 gene locus_tag LOCUS_02650 259025 258273 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679175.1 protein_id gnl|my_center|LOCUS_02650 260608 259247 gene locus_tag LOCUS_02660 260608 259247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 261182 260625 gene locus_tag LOCUS_02670 261182 260625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 261244 261489 gene locus_tag LOCUS_02680 261244 261489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 262848 261391 gene locus_tag LOCUS_02690 262848 261391 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_02690 264224 262863 gene locus_tag LOCUS_02700 gene trkA 264224 262863 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_02700 265266 264361 gene locus_tag LOCUS_02710 265266 264361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 265372 266001 gene locus_tag LOCUS_02720 265372 266001 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889536.1 protein_id gnl|my_center|LOCUS_02720 266581 266048 gene locus_tag LOCUS_02730 266581 266048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 267230 266721 gene locus_tag LOCUS_02740 267230 266721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 267638 267231 gene locus_tag LOCUS_02750 267638 267231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 268817 267990 gene locus_tag LOCUS_02760 268817 267990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 269497 268820 gene locus_tag LOCUS_02770 gene trmB 269497 268820 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355768.1 protein_id gnl|my_center|LOCUS_02770 269886 270740 gene locus_tag LOCUS_02780 269886 270740 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767761.1 protein_id gnl|my_center|LOCUS_02780 271556 270795 gene locus_tag LOCUS_02790 271556 270795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 271719 272639 gene locus_tag LOCUS_02800 271719 272639 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732615.1 protein_id gnl|my_center|LOCUS_02800 272655 273092 gene locus_tag LOCUS_02810 272655 273092 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548951.1 protein_id gnl|my_center|LOCUS_02810 273292 273218 gene locus_tag LOCUS_t00020 273292 273218 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 392 802 gene locus_tag LOCUS_02820 392 802 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_02820 1750 893 gene locus_tag LOCUS_02830 1750 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2228 1776 gene locus_tag LOCUS_02840 2228 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 2649 3272 gene locus_tag LOCUS_02850 gene lexA 2649 3272 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392634.1 protein_id gnl|my_center|LOCUS_02850 3398 4291 gene locus_tag LOCUS_02860 3398 4291 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832366.1 protein_id gnl|my_center|LOCUS_02860 4404 4571 gene locus_tag LOCUS_02870 4404 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 4668 5534 gene locus_tag LOCUS_02880 4668 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 5922 6122 gene locus_tag LOCUS_02890 5922 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 6229 7185 gene locus_tag LOCUS_02900 6229 7185 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588488.1 protein_id gnl|my_center|LOCUS_02900 7389 8234 gene locus_tag LOCUS_02910 7389 8234 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906177.1 protein_id gnl|my_center|LOCUS_02910 8284 8841 gene locus_tag LOCUS_02920 8284 8841 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_02920 8977 9846 gene locus_tag LOCUS_02930 8977 9846 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301722.1 protein_id gnl|my_center|LOCUS_02930 9863 10720 gene locus_tag LOCUS_02940 9863 10720 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_02940 11234 11503 gene locus_tag LOCUS_02950 11234 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 11651 12631 gene locus_tag LOCUS_02960 11651 12631 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_02960 13242 12745 gene locus_tag LOCUS_02970 13242 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 13434 14480 gene locus_tag LOCUS_02980 13434 14480 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200459.1 protein_id gnl|my_center|LOCUS_02980 15158 14562 gene locus_tag LOCUS_02990 15158 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 15299 15868 gene locus_tag LOCUS_03000 gene eutD 15299 15868 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896361.1 protein_id gnl|my_center|LOCUS_03000 16393 15986 gene locus_tag LOCUS_03010 16393 15986 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644009.1 protein_id gnl|my_center|LOCUS_03010 17505 16456 gene locus_tag LOCUS_03020 17505 16456 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_03020 18477 17512 gene locus_tag LOCUS_03030 18477 17512 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 protein_id gnl|my_center|LOCUS_03030 18661 18747 gene locus_tag LOCUS_t00030 18661 18747 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18939 20111 gene locus_tag LOCUS_03040 18939 20111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 20328 21167 gene locus_tag LOCUS_03050 20328 21167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 21291 23543 gene locus_tag LOCUS_03060 21291 23543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 23648 23803 gene locus_tag LOCUS_03070 23648 23803 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804009.1 protein_id gnl|my_center|LOCUS_03070 23886 24953 gene locus_tag LOCUS_03080 gene mutY 23886 24953 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532756.1 protein_id gnl|my_center|LOCUS_03080 25456 25145 gene locus_tag LOCUS_03090 25456 25145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 25832 25575 gene locus_tag LOCUS_03100 25832 25575 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_03100 28354 25997 gene locus_tag LOCUS_03110 gene pheT 28354 25997 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_03110 29410 28376 gene locus_tag LOCUS_03120 gene pheS 29410 28376 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_03120 29951 30484 gene locus_tag LOCUS_03130 29951 30484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 30552 30692 gene locus_tag LOCUS_03140 30552 30692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 30781 32289 gene locus_tag LOCUS_03150 30781 32289 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_03150 32403 32762 gene locus_tag LOCUS_03160 32403 32762 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_03160 32933 34150 gene locus_tag LOCUS_03170 32933 34150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 34672 34151 gene locus_tag LOCUS_03180 34672 34151 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 protein_id gnl|my_center|LOCUS_03180 35286 34741 gene locus_tag LOCUS_03190 gene dcd 35286 34741 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881042.1 protein_id gnl|my_center|LOCUS_03190 36662 35283 gene locus_tag LOCUS_03200 36662 35283 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_03200 37697 36696 gene locus_tag LOCUS_03210 37697 36696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 37949 38440 gene locus_tag LOCUS_03220 37949 38440 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_03220 38557 39768 gene locus_tag LOCUS_03230 38557 39768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 39749 40147 gene locus_tag LOCUS_03240 39749 40147 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 protein_id gnl|my_center|LOCUS_03240 42032 40308 gene locus_tag LOCUS_03250 42032 40308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 42973 42194 gene locus_tag LOCUS_03260 gene sigG 42973 42194 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774282.1 protein_id gnl|my_center|LOCUS_03260 43147 43416 gene locus_tag LOCUS_03270 43147 43416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 43673 44413 gene locus_tag LOCUS_03280 gene rpsB 43673 44413 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_03280 44458 45378 gene locus_tag LOCUS_03290 gene tsf 44458 45378 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_03290 45484 46326 gene locus_tag LOCUS_03300 45484 46326 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996787.1 protein_id gnl|my_center|LOCUS_03300 47276 46443 gene locus_tag LOCUS_03310 47276 46443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 48753 47479 gene locus_tag LOCUS_03320 48753 47479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 49178 48855 gene locus_tag LOCUS_03330 49178 48855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 49769 49693 gene locus_tag LOCUS_t00040 49769 49693 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 50220 49786 gene locus_tag LOCUS_03340 50220 49786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 51137 50565 gene locus_tag LOCUS_03350 51137 50565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 51488 51790 gene locus_tag LOCUS_03360 51488 51790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 51843 52223 gene locus_tag LOCUS_03370 51843 52223 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_03370 52265 53461 gene locus_tag LOCUS_03380 52265 53461 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_03380 53493 54950 gene locus_tag LOCUS_03390 53493 54950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 55167 56471 gene locus_tag LOCUS_03400 55167 56471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 56511 57401 gene locus_tag LOCUS_03410 56511 57401 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130718.1 protein_id gnl|my_center|LOCUS_03410 57427 58152 gene locus_tag LOCUS_03420 gene radC 57427 58152 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385427.1 protein_id gnl|my_center|LOCUS_03420 58374 58198 gene locus_tag LOCUS_03430 58374 58198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 58699 58493 gene locus_tag LOCUS_03440 58699 58493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 59758 58706 gene locus_tag LOCUS_03450 59758 58706 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682378.1 protein_id gnl|my_center|LOCUS_03450 60761 59769 gene locus_tag LOCUS_03460 60761 59769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682379.1 protein_id gnl|my_center|LOCUS_03460 62583 60769 gene locus_tag LOCUS_03470 62583 60769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 63590 62598 gene locus_tag LOCUS_03480 63590 62598 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671815.1 protein_id gnl|my_center|LOCUS_03480 65622 63706 gene locus_tag LOCUS_03490 65622 63706 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990590.1 protein_id gnl|my_center|LOCUS_03490 67626 65821 gene locus_tag LOCUS_03500 gene pepF 67626 65821 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_03500 68958 68065 gene locus_tag LOCUS_03510 68958 68065 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_03510 69235 69570 gene locus_tag LOCUS_03520 69235 69570 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_03520 70480 69626 gene locus_tag LOCUS_03530 70480 69626 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893097.1 protein_id gnl|my_center|LOCUS_03530 70557 71201 gene locus_tag LOCUS_03540 70557 71201 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_03540 72568 71219 gene locus_tag LOCUS_03550 72568 71219 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864507.1 protein_id gnl|my_center|LOCUS_03550 72990 73397 gene locus_tag LOCUS_03560 72990 73397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 73394 74269 gene locus_tag LOCUS_03570 73394 74269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 74684 76660 gene locus_tag LOCUS_03580 gene uvrB 74684 76660 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_03580 76662 77426 gene locus_tag LOCUS_03590 76662 77426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 77527 80358 gene locus_tag LOCUS_03600 gene uvrA 77527 80358 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_03600 80831 82375 gene locus_tag LOCUS_03610 80831 82375 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054872.1 protein_id gnl|my_center|LOCUS_03610 82447 83376 gene locus_tag LOCUS_03620 82447 83376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 83380 83997 gene locus_tag LOCUS_03630 83380 83997 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_03630 84017 84553 gene locus_tag LOCUS_03640 84017 84553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948006.1 protein_id gnl|my_center|LOCUS_03640 85820 84615 gene locus_tag LOCUS_03650 85820 84615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 86947 85817 gene locus_tag LOCUS_03660 86947 85817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 87888 86944 gene locus_tag LOCUS_03670 87888 86944 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608770.1 protein_id gnl|my_center|LOCUS_03670 88296 89174 gene locus_tag LOCUS_03680 88296 89174 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_03680 89164 90402 gene locus_tag LOCUS_03690 89164 90402 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_03690 90421 91083 gene locus_tag LOCUS_03700 gene cmk 90421 91083 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729300.1 protein_id gnl|my_center|LOCUS_03700 91088 91747 gene locus_tag LOCUS_03710 91088 91747 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_03710 91744 93669 gene locus_tag LOCUS_03720 91744 93669 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_03720 93791 95203 gene locus_tag LOCUS_03730 93791 95203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 95200 96144 gene locus_tag LOCUS_03740 gene secF 95200 96144 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393192.1 protein_id gnl|my_center|LOCUS_03740 96653 96405 gene locus_tag LOCUS_03750 96653 96405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 96951 98798 gene locus_tag LOCUS_03760 96951 98798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 101193 98863 gene locus_tag LOCUS_03770 101193 98863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 101624 102532 gene locus_tag LOCUS_03780 101624 102532 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_03780 102552 103478 gene locus_tag LOCUS_03790 102552 103478 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027800.1 protein_id gnl|my_center|LOCUS_03790 103543 105165 gene locus_tag LOCUS_03800 103543 105165 CDS product DUF3502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161603547.1 protein_id gnl|my_center|LOCUS_03800 105340 106638 gene locus_tag LOCUS_03810 105340 106638 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286021.1 protein_id gnl|my_center|LOCUS_03810 106661 108157 gene locus_tag LOCUS_03820 106661 108157 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_03820 108193 108879 gene locus_tag LOCUS_03830 108193 108879 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_03830 108876 109814 gene locus_tag LOCUS_03840 108876 109814 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109361.1 protein_id gnl|my_center|LOCUS_03840 110096 109893 gene locus_tag LOCUS_03850 110096 109893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 111533 110172 gene locus_tag LOCUS_03860 111533 110172 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461680.1 protein_id gnl|my_center|LOCUS_03860 111831 111562 gene locus_tag LOCUS_03870 111831 111562 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963800.1 protein_id gnl|my_center|LOCUS_03870 111994 112848 gene locus_tag LOCUS_03880 111994 112848 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_03880 112854 113354 gene locus_tag LOCUS_03890 112854 113354 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814642.1 protein_id gnl|my_center|LOCUS_03890 113347 114522 gene locus_tag LOCUS_03900 113347 114522 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_03900 114519 115649 gene locus_tag LOCUS_03910 114519 115649 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436749.1 protein_id gnl|my_center|LOCUS_03910 115664 116548 gene locus_tag LOCUS_03920 gene ispE 115664 116548 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_03920 116712 116785 gene locus_tag LOCUS_t00050 116712 116785 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 116816 116892 gene locus_tag LOCUS_t00060 116816 116892 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 116977 117501 gene locus_tag LOCUS_03930 116977 117501 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965823.1 protein_id gnl|my_center|LOCUS_03930 118125 119039 gene locus_tag LOCUS_03940 118125 119039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_03940 119057 120127 gene locus_tag LOCUS_03950 119057 120127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_03950 120133 121227 gene locus_tag LOCUS_03960 120133 121227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_03960 121241 122287 gene locus_tag LOCUS_03970 121241 122287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_03970 122386 124194 gene locus_tag LOCUS_03980 122386 124194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 124722 124339 gene locus_tag LOCUS_03990 124722 124339 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_03990 124880 125266 gene locus_tag LOCUS_04000 124880 125266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 127568 125460 gene locus_tag LOCUS_04010 127568 125460 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_04010 127997 129121 gene locus_tag LOCUS_04020 127997 129121 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_04020 129128 130633 gene locus_tag LOCUS_04030 129128 130633 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392806.1 protein_id gnl|my_center|LOCUS_04030 130704 131135 gene locus_tag LOCUS_04040 130704 131135 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392805.1 protein_id gnl|my_center|LOCUS_04040 131140 132372 gene locus_tag LOCUS_04050 131140 132372 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878451.1 protein_id gnl|my_center|LOCUS_04050 132385 133038 gene locus_tag LOCUS_04060 132385 133038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_04060 133182 134384 gene locus_tag LOCUS_04070 gene glnA 133182 134384 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_04070 134399 134983 gene locus_tag LOCUS_04080 134399 134983 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_04080 135006 136460 gene locus_tag LOCUS_04090 gene purF 135006 136460 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_04090 136500 137573 gene locus_tag LOCUS_04100 136500 137573 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828686.1 protein_id gnl|my_center|LOCUS_04100 137653 141702 gene locus_tag LOCUS_04110 gene carB 137653 141702 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_04110 141790 142707 gene locus_tag LOCUS_04120 gene dapF 141790 142707 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_04120 142780 144387 gene locus_tag LOCUS_04130 142780 144387 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723607.1 protein_id gnl|my_center|LOCUS_04130 144426 145607 gene locus_tag LOCUS_04140 144426 145607 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765060.1 protein_id gnl|my_center|LOCUS_04140 145726 147024 gene locus_tag LOCUS_04150 145726 147024 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_04150 147028 147723 gene locus_tag LOCUS_04160 gene araD 147028 147723 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094947.1 protein_id gnl|my_center|LOCUS_04160 147934 149340 gene locus_tag LOCUS_04170 147934 149340 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_04170 149447 152056 gene locus_tag LOCUS_04180 149447 152056 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355749.1 protein_id gnl|my_center|LOCUS_04180 154073 152226 gene locus_tag LOCUS_04190 gene asnB 154073 152226 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703387.1 protein_id gnl|my_center|LOCUS_04190 154817 154101 gene locus_tag LOCUS_04200 154817 154101 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702044.1 protein_id gnl|my_center|LOCUS_04200 156061 154817 gene locus_tag LOCUS_04210 156061 154817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 protein_id gnl|my_center|LOCUS_04210 157954 156077 gene locus_tag LOCUS_04220 gene asnB 157954 156077 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 protein_id gnl|my_center|LOCUS_04220 158645 157977 gene locus_tag LOCUS_04230 158645 157977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 158827 159561 gene locus_tag LOCUS_04240 158827 159561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 159693 160232 gene locus_tag LOCUS_04250 159693 160232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 160256 161968 gene locus_tag LOCUS_04260 gene leuA 160256 161968 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_04260 163230 161986 gene locus_tag LOCUS_04270 163230 161986 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528966.1 protein_id gnl|my_center|LOCUS_04270 164736 163273 gene locus_tag LOCUS_04280 164736 163273 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987127.1 protein_id gnl|my_center|LOCUS_04280 165293 164793 gene locus_tag LOCUS_04290 165293 164793 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_04290 165513 167624 gene locus_tag LOCUS_04300 165513 167624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 167762 168622 gene locus_tag LOCUS_04310 gene rsmA 167762 168622 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_04310 168690 168896 gene locus_tag LOCUS_04320 168690 168896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 168984 170132 gene locus_tag LOCUS_04330 168984 170132 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_04330 171023 170250 gene locus_tag LOCUS_04340 171023 170250 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390072.1 protein_id gnl|my_center|LOCUS_04340 172509 171130 gene locus_tag LOCUS_04350 gene murC 172509 171130 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425936.1 protein_id gnl|my_center|LOCUS_04350 172757 173611 gene locus_tag LOCUS_04360 gene dpsA 172757 173611 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460385.1 protein_id gnl|my_center|LOCUS_04360 173622 174185 gene locus_tag LOCUS_04370 173622 174185 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_04370 174262 174726 gene locus_tag LOCUS_04380 174262 174726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 174764 176044 gene locus_tag LOCUS_04390 174764 176044 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_04390 176196 176519 gene locus_tag LOCUS_04400 176196 176519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 178842 176596 gene locus_tag LOCUS_04410 178842 176596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 179530 178823 gene locus_tag LOCUS_04420 179530 178823 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454617.1 protein_id gnl|my_center|LOCUS_04420 179725 180564 gene locus_tag LOCUS_04430 gene pdaA 179725 180564 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_04430 180706 181986 gene locus_tag LOCUS_04440 180706 181986 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_04440 181983 183605 gene locus_tag LOCUS_04450 181983 183605 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620446.1 protein_id gnl|my_center|LOCUS_04450 184228 184713 gene locus_tag LOCUS_04460 184228 184713 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_04460 184854 185330 gene locus_tag LOCUS_04470 184854 185330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 186705 185428 gene locus_tag LOCUS_04480 186705 185428 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_04480 187336 186749 gene locus_tag LOCUS_04490 187336 186749 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964891.1 protein_id gnl|my_center|LOCUS_04490 188411 187464 gene locus_tag LOCUS_04500 188411 187464 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_04500 190045 188468 gene locus_tag LOCUS_04510 190045 188468 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861711.1 protein_id gnl|my_center|LOCUS_04510 190178 190819 gene locus_tag LOCUS_04520 190178 190819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 190902 194228 gene locus_tag LOCUS_04530 gene addB 190902 194228 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 protein_id gnl|my_center|LOCUS_04530 194209 197733 gene locus_tag LOCUS_04540 gene addA 194209 197733 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572298.1 protein_id gnl|my_center|LOCUS_04540 197938 198726 gene locus_tag LOCUS_04550 197938 198726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 198732 199538 gene locus_tag LOCUS_04560 198732 199538 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639351.1 protein_id gnl|my_center|LOCUS_04560 199556 200530 gene locus_tag LOCUS_04570 199556 200530 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681592.1 protein_id gnl|my_center|LOCUS_04570 200810 201274 gene locus_tag LOCUS_04580 gene infC 200810 201274 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_04580 201297 201500 gene locus_tag LOCUS_04590 gene rpmI 201297 201500 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232040.1 protein_id gnl|my_center|LOCUS_04590 201628 201981 gene locus_tag LOCUS_04600 gene rplT 201628 201981 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 protein_id gnl|my_center|LOCUS_04600 202145 202858 gene locus_tag LOCUS_04610 202145 202858 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129512.1 protein_id gnl|my_center|LOCUS_04610 202863 204062 gene locus_tag LOCUS_04620 gene dprA 202863 204062 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935893.1 protein_id gnl|my_center|LOCUS_04620 204141 206249 gene locus_tag LOCUS_04630 gene topA 204141 206249 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_04630 206239 207588 gene locus_tag LOCUS_04640 gene trmFO 206239 207588 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_04640 207591 208604 gene locus_tag LOCUS_04650 gene plsX 207591 208604 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_04650 208625 209326 gene locus_tag LOCUS_04660 gene rnc 208625 209326 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_04660 209541 210323 gene locus_tag LOCUS_04670 209541 210323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 210328 213897 gene locus_tag LOCUS_04680 gene smc 210328 213897 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 protein_id gnl|my_center|LOCUS_04680 213936 214856 gene locus_tag LOCUS_04690 213936 214856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 214853 215686 gene locus_tag LOCUS_04700 214853 215686 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146572.1 protein_id gnl|my_center|LOCUS_04700 215702 216304 gene locus_tag LOCUS_04710 215702 216304 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215614.1 protein_id gnl|my_center|LOCUS_04710 216298 216603 gene locus_tag LOCUS_04720 216298 216603 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034585320.1 protein_id gnl|my_center|LOCUS_04720 216683 217303 gene locus_tag LOCUS_04730 216683 217303 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287632.1 protein_id gnl|my_center|LOCUS_04730 217300 217884 gene locus_tag LOCUS_04740 gene yqeK 217300 217884 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_04740 217907 218266 gene locus_tag LOCUS_04750 gene rsfS 217907 218266 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880811.1 protein_id gnl|my_center|LOCUS_04750 218307 220718 gene locus_tag LOCUS_04760 gene leuS 218307 220718 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_04760 220829 221422 gene locus_tag LOCUS_04770 220829 221422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 221437 222183 gene locus_tag LOCUS_04780 221437 222183 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_04780 222251 223207 gene locus_tag LOCUS_04790 gene pyrB 222251 223207 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_04790 223201 223629 gene locus_tag LOCUS_04800 223201 223629 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_04800 223622 223834 gene locus_tag LOCUS_04810 223622 223834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 224248 224030 gene locus_tag LOCUS_04820 224248 224030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 224377 225396 gene locus_tag LOCUS_04830 224377 225396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 225861 225415 gene locus_tag LOCUS_04840 225861 225415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 226263 225868 gene locus_tag LOCUS_04850 226263 225868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 226394 227452 gene locus_tag LOCUS_04860 226394 227452 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_04860 227526 227726 gene locus_tag LOCUS_04870 227526 227726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 227766 228395 gene locus_tag LOCUS_04880 227766 228395 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_04880 228414 229406 gene locus_tag LOCUS_04890 228414 229406 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107209.1 protein_id gnl|my_center|LOCUS_04890 229476 229766 gene locus_tag LOCUS_04900 229476 229766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04900 229791 230039 gene locus_tag LOCUS_04910 229791 230039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04910 230027 231505 gene locus_tag LOCUS_04920 230027 231505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 231581 232822 gene locus_tag LOCUS_04930 231581 232822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 232882 233334 gene locus_tag LOCUS_04940 232882 233334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 233744 233436 gene locus_tag LOCUS_04950 233744 233436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence03 703 619 gene locus_tag LOCUS_t00070 703 619 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 789 716 gene locus_tag LOCUS_t00080 789 716 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1277 1080 gene locus_tag LOCUS_04960 1277 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 1179 1649 gene locus_tag LOCUS_04970 1179 1649 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902435.1 protein_id gnl|my_center|LOCUS_04970 1934 3121 gene locus_tag LOCUS_04980 1934 3121 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835622.1 protein_id gnl|my_center|LOCUS_04980 3247 4662 gene locus_tag LOCUS_04990 3247 4662 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_04990 4794 5462 gene locus_tag LOCUS_05000 4794 5462 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_05000 5443 5955 gene locus_tag LOCUS_05010 5443 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 8593 6194 gene locus_tag LOCUS_05020 8593 6194 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_05020 9312 8611 gene locus_tag LOCUS_05030 9312 8611 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_05030 10171 9299 gene locus_tag LOCUS_05040 gene metF 10171 9299 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_05040 12059 10305 gene locus_tag LOCUS_05050 12059 10305 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 protein_id gnl|my_center|LOCUS_05050 12229 13050 gene locus_tag LOCUS_05060 12229 13050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 13065 13592 gene locus_tag LOCUS_05070 13065 13592 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897695.1 protein_id gnl|my_center|LOCUS_05070 13589 14599 gene locus_tag LOCUS_05080 gene tsaD 13589 14599 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_05080 15898 14681 gene locus_tag LOCUS_05090 15898 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 15928 16215 gene locus_tag LOCUS_05100 15928 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 18740 16104 gene locus_tag LOCUS_05110 18740 16104 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548204.1 protein_id gnl|my_center|LOCUS_05110 20898 18946 gene locus_tag LOCUS_05120 20898 18946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 21775 20873 gene locus_tag LOCUS_05130 21775 20873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_05130 22164 21772 gene locus_tag LOCUS_05140 gene ytrA 22164 21772 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_05140 22667 23248 gene locus_tag LOCUS_05150 22667 23248 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_05150 25293 23389 gene locus_tag LOCUS_05160 gene thrS 25293 23389 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_05160 25879 27441 gene locus_tag LOCUS_05170 gene rny 25879 27441 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_05170 28003 28431 gene locus_tag LOCUS_05180 28003 28431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 28742 29620 gene locus_tag LOCUS_05190 28742 29620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 29652 29780 gene locus_tag LOCUS_05200 29652 29780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 30946 29843 gene locus_tag LOCUS_05210 30946 29843 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_05210 31295 32890 gene locus_tag LOCUS_05220 31295 32890 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454209.1 protein_id gnl|my_center|LOCUS_05220 32928 33941 gene locus_tag LOCUS_05230 32928 33941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454207.1 protein_id gnl|my_center|LOCUS_05230 33934 34836 gene locus_tag LOCUS_05240 33934 34836 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385607.1 protein_id gnl|my_center|LOCUS_05240 34826 35818 gene locus_tag LOCUS_05250 34826 35818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895878.1 protein_id gnl|my_center|LOCUS_05250 35815 36702 gene locus_tag LOCUS_05260 35815 36702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902199.1 protein_id gnl|my_center|LOCUS_05260 36739 37482 gene locus_tag LOCUS_05270 gene larE 36739 37482 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964093.1 protein_id gnl|my_center|LOCUS_05270 37482 38246 gene locus_tag LOCUS_05280 gene larB 37482 38246 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435015.1 protein_id gnl|my_center|LOCUS_05280 38284 39534 gene locus_tag LOCUS_05290 gene larC 38284 39534 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_05290 41244 39679 gene locus_tag LOCUS_05300 41244 39679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 41464 41237 gene locus_tag LOCUS_05310 41464 41237 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816366.1 protein_id gnl|my_center|LOCUS_05310 41929 41477 gene locus_tag LOCUS_05320 41929 41477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 43313 42186 gene locus_tag LOCUS_05330 43313 42186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 43963 44172 gene locus_tag LOCUS_05340 43963 44172 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355647.1 protein_id gnl|my_center|LOCUS_05340 44354 44596 gene locus_tag LOCUS_05350 44354 44596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 45727 44645 gene locus_tag LOCUS_05360 45727 44645 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_05360 47241 45856 gene locus_tag LOCUS_05370 47241 45856 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035938.1 protein_id gnl|my_center|LOCUS_05370 48281 47415 gene locus_tag LOCUS_05380 48281 47415 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_05380 48560 49318 gene locus_tag LOCUS_05390 gene spo0A 48560 49318 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_05390 51235 49466 gene locus_tag LOCUS_05400 51235 49466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732216.1 protein_id gnl|my_center|LOCUS_05400 53001 51235 gene locus_tag LOCUS_05410 53001 51235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357553.1 protein_id gnl|my_center|LOCUS_05410 53871 53368 gene locus_tag LOCUS_05420 53871 53368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 55027 54149 gene locus_tag LOCUS_05430 55027 54149 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234196.1 protein_id gnl|my_center|LOCUS_05430 55177 55632 gene locus_tag LOCUS_05440 gene dtd 55177 55632 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337353.1 protein_id gnl|my_center|LOCUS_05440 55644 56513 gene locus_tag LOCUS_05450 55644 56513 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_05450 57399 56623 gene locus_tag LOCUS_05460 57399 56623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 57947 57447 gene locus_tag LOCUS_05470 57947 57447 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720561.1 protein_id gnl|my_center|LOCUS_05470 58909 58052 gene locus_tag LOCUS_05480 58909 58052 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_05480 59170 59511 gene locus_tag LOCUS_05490 59170 59511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 59938 59615 gene locus_tag LOCUS_05500 59938 59615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 61341 60676 gene locus_tag LOCUS_05510 61341 60676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 62053 61355 gene locus_tag LOCUS_05520 62053 61355 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_05520 62712 62053 gene locus_tag LOCUS_05530 62712 62053 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583636.1 protein_id gnl|my_center|LOCUS_05530 63507 62977 gene locus_tag LOCUS_05540 63507 62977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 63889 66321 gene locus_tag LOCUS_05550 63889 66321 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_05550 67133 66471 gene locus_tag LOCUS_05560 gene pyrE 67133 66471 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_05560 67638 67381 gene locus_tag LOCUS_05570 67638 67381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 69395 67815 gene locus_tag LOCUS_05580 gene asnB 69395 67815 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_05580 69923 71446 gene locus_tag LOCUS_05590 69923 71446 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989833.1 protein_id gnl|my_center|LOCUS_05590 73679 71505 gene locus_tag LOCUS_05600 gene feoB 73679 71505 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_05600 74318 73779 gene locus_tag LOCUS_05610 gene raiA 74318 73779 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_05610 74687 74514 gene locus_tag LOCUS_05620 74687 74514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 75230 74733 gene locus_tag LOCUS_05630 75230 74733 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356258.1 protein_id gnl|my_center|LOCUS_05630 75610 75266 gene locus_tag LOCUS_05640 75610 75266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 76098 75652 gene locus_tag LOCUS_05650 76098 75652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 76370 76095 gene locus_tag LOCUS_05660 76370 76095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 76905 76528 gene locus_tag LOCUS_05670 76905 76528 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948047.1 protein_id gnl|my_center|LOCUS_05670 77178 76930 gene locus_tag LOCUS_05680 77178 76930 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 protein_id gnl|my_center|LOCUS_05680 77550 77275 gene locus_tag LOCUS_05690 77550 77275 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_05690 78315 77617 gene locus_tag LOCUS_05700 gene mazG 78315 77617 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_05700 80170 78449 gene locus_tag LOCUS_05710 80170 78449 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_05710 80768 80307 gene locus_tag LOCUS_05720 80768 80307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 81877 80909 gene locus_tag LOCUS_05730 81877 80909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 83312 81849 gene locus_tag LOCUS_05740 83312 81849 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460348.1 protein_id gnl|my_center|LOCUS_05740 83960 83352 gene locus_tag LOCUS_05750 83960 83352 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_05750 86181 83986 gene locus_tag LOCUS_05760 86181 83986 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965572.1 protein_id gnl|my_center|LOCUS_05760 88250 86211 gene locus_tag LOCUS_05770 88250 86211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 88530 88784 gene locus_tag LOCUS_05780 88530 88784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 90228 88888 gene locus_tag LOCUS_05790 90228 88888 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731931.1 protein_id gnl|my_center|LOCUS_05790 91124 90228 gene locus_tag LOCUS_05800 gene cdaA 91124 90228 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_05800 92426 91257 gene locus_tag LOCUS_05810 92426 91257 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943290.1 protein_id gnl|my_center|LOCUS_05810 92671 92423 gene locus_tag LOCUS_05820 92671 92423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 93244 92777 gene locus_tag LOCUS_05830 gene ispF 93244 92777 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_05830 93650 93297 gene locus_tag LOCUS_05840 93650 93297 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967147.1 protein_id gnl|my_center|LOCUS_05840 94359 93667 gene locus_tag LOCUS_05850 gene ispD 94359 93667 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_05850 94877 94623 gene locus_tag LOCUS_05860 gene spoIIID 94877 94623 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_05860 98752 95081 gene locus_tag LOCUS_05870 gene nifJ 98752 95081 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_05870 99099 100490 gene locus_tag LOCUS_05880 99099 100490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 101576 100677 gene locus_tag LOCUS_05890 101576 100677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 103047 101710 gene locus_tag LOCUS_05900 103047 101710 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047968.1 protein_id gnl|my_center|LOCUS_05900 104375 103377 gene locus_tag LOCUS_05910 104375 103377 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_05910 105082 104390 gene locus_tag LOCUS_05920 105082 104390 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_05920 105686 105480 gene locus_tag LOCUS_05930 105686 105480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 106112 105714 gene locus_tag LOCUS_05940 106112 105714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 107066 106146 gene locus_tag LOCUS_05950 107066 106146 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_05950 108185 107091 gene locus_tag LOCUS_05960 108185 107091 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986984.1 protein_id gnl|my_center|LOCUS_05960 108796 108344 gene locus_tag LOCUS_05970 108796 108344 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_05970 109741 108818 gene locus_tag LOCUS_05980 gene trxB 109741 108818 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_05980 111340 110996 gene locus_tag LOCUS_05990 111340 110996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 111784 112092 gene locus_tag LOCUS_06000 111784 112092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 112448 112909 gene locus_tag LOCUS_06010 112448 112909 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680818.1 protein_id gnl|my_center|LOCUS_06010 112924 113655 gene locus_tag LOCUS_06020 112924 113655 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368777.1 protein_id gnl|my_center|LOCUS_06020 113645 113965 gene locus_tag LOCUS_06030 113645 113965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 115187 114063 gene locus_tag LOCUS_06040 115187 114063 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_06040 115563 115264 gene locus_tag LOCUS_06050 115563 115264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 116695 115661 gene locus_tag LOCUS_06060 gene gap 116695 115661 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_06060 117712 116816 gene locus_tag LOCUS_06070 117712 116816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 117994 118470 gene locus_tag LOCUS_06080 117994 118470 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055872.1 protein_id gnl|my_center|LOCUS_06080 118467 120227 gene locus_tag LOCUS_06090 118467 120227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_06090 120211 122136 gene locus_tag LOCUS_06100 120211 122136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_06100 122231 122440 gene locus_tag LOCUS_06110 122231 122440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 122841 126356 gene locus_tag LOCUS_06120 122841 126356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 126520 126972 gene locus_tag LOCUS_06130 gene spoVAC 126520 126972 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403642.1 protein_id gnl|my_center|LOCUS_06130 127010 128011 gene locus_tag LOCUS_06140 gene spoVAD 127010 128011 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_06140 128240 128941 gene locus_tag LOCUS_06150 128240 128941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_06150 128932 129759 gene locus_tag LOCUS_06160 128932 129759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_06160 131122 129863 gene locus_tag LOCUS_06170 131122 129863 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 protein_id gnl|my_center|LOCUS_06170 132119 131175 gene locus_tag LOCUS_06180 132119 131175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811522.1 protein_id gnl|my_center|LOCUS_06180 133526 132180 gene locus_tag LOCUS_06190 133526 132180 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_06190 135080 133608 gene locus_tag LOCUS_06200 135080 133608 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_06200 136780 135185 gene locus_tag LOCUS_06210 gene cimA 136780 135185 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_06210 137738 137001 gene locus_tag LOCUS_06220 137738 137001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 140550 138028 gene locus_tag LOCUS_06230 140550 138028 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_06230 141027 140575 gene locus_tag LOCUS_06240 141027 140575 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432565.1 protein_id gnl|my_center|LOCUS_06240 141353 141057 gene locus_tag LOCUS_06250 141353 141057 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_06250 142060 141599 gene locus_tag LOCUS_06260 142060 141599 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_06260 142630 142088 gene locus_tag LOCUS_06270 gene nrdG 142630 142088 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_06270 144801 142642 gene locus_tag LOCUS_06280 gene nrdD 144801 142642 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187775.1 protein_id gnl|my_center|LOCUS_06280 145607 145224 gene locus_tag LOCUS_06290 145607 145224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 145947 145597 gene locus_tag LOCUS_06300 145947 145597 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461033.1 protein_id gnl|my_center|LOCUS_06300 147605 145947 gene locus_tag LOCUS_06310 gene cydC 147605 145947 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_06310 149340 147607 gene locus_tag LOCUS_06320 149340 147607 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_06320 151537 149660 gene locus_tag LOCUS_06330 151537 149660 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_06330 152601 151723 gene locus_tag LOCUS_06340 152601 151723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 154281 153160 gene locus_tag LOCUS_06350 gene nagA 154281 153160 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989627.1 protein_id gnl|my_center|LOCUS_06350 154543 154364 gene locus_tag LOCUS_06360 154543 154364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 156852 154627 gene locus_tag LOCUS_06370 gene rnr 156852 154627 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391817.1 protein_id gnl|my_center|LOCUS_06370 158384 156984 gene locus_tag LOCUS_06380 gene murD 158384 156984 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_06380 159419 158409 gene locus_tag LOCUS_06390 159419 158409 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_06390 160021 159542 gene locus_tag LOCUS_06400 160021 159542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 161834 160053 gene locus_tag LOCUS_06410 161834 160053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_06410 163544 161943 gene locus_tag LOCUS_06420 163544 161943 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_06420 165154 163775 gene locus_tag LOCUS_06430 165154 163775 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989642.1 protein_id gnl|my_center|LOCUS_06430 166116 165154 gene locus_tag LOCUS_06440 166116 165154 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_06440 166997 166143 gene locus_tag LOCUS_06450 166997 166143 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_06450 168133 167597 gene locus_tag LOCUS_06460 168133 167597 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965709.1 protein_id gnl|my_center|LOCUS_06460 168445 169497 gene locus_tag LOCUS_06470 168445 169497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 170694 169594 gene locus_tag LOCUS_06480 170694 169594 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223493.1 protein_id gnl|my_center|LOCUS_06480 172336 170792 gene locus_tag LOCUS_06490 172336 170792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 175192 172517 gene locus_tag LOCUS_06500 175192 172517 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_06500 177335 175554 gene locus_tag LOCUS_06510 177335 175554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 178337 177438 gene locus_tag LOCUS_06520 178337 177438 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_06520 179292 178351 gene locus_tag LOCUS_06530 179292 178351 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_06530 180223 181104 gene locus_tag LOCUS_06540 180223 181104 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803903.1 protein_id gnl|my_center|LOCUS_06540 181523 181281 gene locus_tag LOCUS_06550 181523 181281 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545730.1 protein_id gnl|my_center|LOCUS_06550 181627 182481 gene locus_tag LOCUS_06560 181627 182481 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763945.1 protein_id gnl|my_center|LOCUS_06560 183014 182601 gene locus_tag LOCUS_06570 183014 182601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 184324 183068 gene locus_tag LOCUS_06580 gene eno 184324 183068 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815650.1 protein_id gnl|my_center|LOCUS_06580 185738 184467 gene locus_tag LOCUS_06590 185738 184467 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722637.1 protein_id gnl|my_center|LOCUS_06590 186414 185911 gene locus_tag LOCUS_06600 gene folK 186414 185911 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_06600 186773 186411 gene locus_tag LOCUS_06610 gene folB 186773 186411 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544155.1 protein_id gnl|my_center|LOCUS_06610 187639 186809 gene locus_tag LOCUS_06620 gene folP 187639 186809 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492526.1 protein_id gnl|my_center|LOCUS_06620 188211 187654 gene locus_tag LOCUS_06630 gene folE 188211 187654 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014794265.1 protein_id gnl|my_center|LOCUS_06630 188643 188368 gene locus_tag LOCUS_06640 188643 188368 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_06640 188918 189130 gene locus_tag LOCUS_06650 188918 189130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 189179 189400 gene locus_tag LOCUS_06660 189179 189400 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_06660 189488 191980 gene locus_tag LOCUS_06670 189488 191980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 192011 192181 gene locus_tag LOCUS_06680 192011 192181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 192245 192700 gene locus_tag LOCUS_06690 192245 192700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 192697 192954 gene locus_tag LOCUS_06700 192697 192954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 193016 193990 gene locus_tag LOCUS_06710 193016 193990 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986747.1 protein_id gnl|my_center|LOCUS_06710 194147 194443 gene locus_tag LOCUS_06720 194147 194443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 194436 194990 gene locus_tag LOCUS_06730 194436 194990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 195024 195449 gene locus_tag LOCUS_06740 195024 195449 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_06740 196056 196358 gene locus_tag LOCUS_06750 196056 196358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 <197409 196310 gene locus_tag LOCUS_06760 <197409 196310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_075365474.1:TIGR02679 domain-containing protein >Feature sequence04 212 126 gene locus_tag LOCUS_t00090 212 126 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 931 311 gene locus_tag LOCUS_06770 931 311 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_06770 2320 1103 gene locus_tag LOCUS_06780 2320 1103 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_06780 4278 2344 gene locus_tag LOCUS_06790 4278 2344 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_06790 4488 4336 gene locus_tag LOCUS_06800 4488 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4638 5396 gene locus_tag LOCUS_06810 4638 5396 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_06810 5481 6422 gene locus_tag LOCUS_06820 gene uppP 5481 6422 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_06820 6459 9218 gene locus_tag LOCUS_06830 6459 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 9215 10147 gene locus_tag LOCUS_06840 9215 10147 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813684.1 protein_id gnl|my_center|LOCUS_06840 10162 10383 gene locus_tag LOCUS_06850 10162 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 10951 10523 gene locus_tag LOCUS_06860 10951 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 11263 12279 gene locus_tag LOCUS_06870 gene galE 11263 12279 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861656.1 protein_id gnl|my_center|LOCUS_06870 12269 12850 gene locus_tag LOCUS_06880 12269 12850 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_06880 12901 13503 gene locus_tag LOCUS_06890 12901 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 13634 15616 gene locus_tag LOCUS_06900 gene ligA 13634 15616 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_06900 15768 16427 gene locus_tag LOCUS_06910 15768 16427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 16466 17701 gene locus_tag LOCUS_06920 gene galK 16466 17701 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_06920 18221 17787 gene locus_tag LOCUS_06930 18221 17787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 18685 18218 gene locus_tag LOCUS_06940 18685 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 19044 18682 gene locus_tag LOCUS_06950 19044 18682 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393829.1 protein_id gnl|my_center|LOCUS_06950 19329 20744 gene locus_tag LOCUS_06960 gene miaB 19329 20744 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_06960 20836 21246 gene locus_tag LOCUS_06970 20836 21246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 21281 23902 gene locus_tag LOCUS_06980 gene mutS 21281 23902 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_06980 23952 25970 gene locus_tag LOCUS_06990 23952 25970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 25989 26966 gene locus_tag LOCUS_07000 gene miaA 25989 26966 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_07000 26963 28273 gene locus_tag LOCUS_07010 26963 28273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 28254 28982 gene locus_tag LOCUS_07020 28254 28982 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_07020 29002 29460 gene locus_tag LOCUS_07030 29002 29460 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392378.1 protein_id gnl|my_center|LOCUS_07030 29460 30206 gene locus_tag LOCUS_07040 29460 30206 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570132.1 protein_id gnl|my_center|LOCUS_07040 30217 31137 gene locus_tag LOCUS_07050 30217 31137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 31243 33966 gene locus_tag LOCUS_07060 gene ileS 31243 33966 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_07060 34038 34538 gene locus_tag LOCUS_07070 gene lspA 34038 34538 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565533.1 protein_id gnl|my_center|LOCUS_07070 34522 35442 gene locus_tag LOCUS_07080 34522 35442 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371731.1 protein_id gnl|my_center|LOCUS_07080 35444 35812 gene locus_tag LOCUS_07090 35444 35812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 37105 35879 gene locus_tag LOCUS_07100 gene tyrS 37105 35879 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963956.1 protein_id gnl|my_center|LOCUS_07100 38023 37427 gene locus_tag LOCUS_07110 gene rnmV 38023 37427 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674939.1 protein_id gnl|my_center|LOCUS_07110 39092 38037 gene locus_tag LOCUS_07120 gene holA 39092 38037 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964585.1 protein_id gnl|my_center|LOCUS_07120 41276 39114 gene locus_tag LOCUS_07130 41276 39114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 41982 41281 gene locus_tag LOCUS_07140 41982 41281 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 protein_id gnl|my_center|LOCUS_07140 42287 42003 gene locus_tag LOCUS_07150 42287 42003 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_07150 42401 43678 gene locus_tag LOCUS_07160 42401 43678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 43774 44325 gene locus_tag LOCUS_07170 43774 44325 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022863.1 protein_id gnl|my_center|LOCUS_07170 44381 46048 gene locus_tag LOCUS_07180 44381 46048 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_07180 46918 46148 gene locus_tag LOCUS_07190 gene ant(9) 46918 46148 CDS product aminoglycoside nucleotidyltransferase ANT(9)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067268.1 protein_id gnl|my_center|LOCUS_07190 48215 46908 gene locus_tag LOCUS_07200 gene mtaB 48215 46908 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_07200 50139 48217 gene locus_tag LOCUS_07210 50139 48217 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_07210 50301 51086 gene locus_tag LOCUS_07220 50301 51086 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742120.1 protein_id gnl|my_center|LOCUS_07220 51172 51630 gene locus_tag LOCUS_07230 gene nrdR 51172 51630 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_07230 51641 52075 gene locus_tag LOCUS_07240 51641 52075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 52341 53813 gene locus_tag LOCUS_07250 gene abfB 52341 53813 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_07250 53813 54067 gene locus_tag LOCUS_07260 53813 54067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 54167 55192 gene locus_tag LOCUS_07270 54167 55192 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582778.1 protein_id gnl|my_center|LOCUS_07270 55228 56067 gene locus_tag LOCUS_07280 55228 56067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 56383 57654 gene locus_tag LOCUS_07290 56383 57654 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387388.1 protein_id gnl|my_center|LOCUS_07290 57651 58946 gene locus_tag LOCUS_07300 57651 58946 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_07300 58983 60089 gene locus_tag LOCUS_07310 58983 60089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 60073 60945 gene locus_tag LOCUS_07320 gene folD 60073 60945 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_07320 61037 62899 gene locus_tag LOCUS_07330 gene dxs 61037 62899 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_07330 62909 63721 gene locus_tag LOCUS_07340 62909 63721 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_07340 63752 64600 gene locus_tag LOCUS_07350 63752 64600 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_07350 64639 65094 gene locus_tag LOCUS_07360 64639 65094 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986439.1 protein_id gnl|my_center|LOCUS_07360 65097 66773 gene locus_tag LOCUS_07370 gene recN 65097 66773 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 protein_id gnl|my_center|LOCUS_07370 66839 67270 gene locus_tag LOCUS_07380 66839 67270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 67339 67611 gene locus_tag LOCUS_07390 67339 67611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 67730 68698 gene locus_tag LOCUS_07400 67730 68698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 68784 69422 gene locus_tag LOCUS_07410 68784 69422 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_07410 69515 69757 gene locus_tag LOCUS_07420 69515 69757 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_07420 69805 70200 gene locus_tag LOCUS_07430 69805 70200 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_07430 70206 71879 gene locus_tag LOCUS_07440 70206 71879 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_07440 71872 73044 gene locus_tag LOCUS_07450 71872 73044 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_07450 73078 74535 gene locus_tag LOCUS_07460 73078 74535 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_07460 74630 75652 gene locus_tag LOCUS_07470 74630 75652 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975419.1 protein_id gnl|my_center|LOCUS_07470 75849 77309 gene locus_tag LOCUS_07480 75849 77309 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_07480 77931 78062 gene locus_tag LOCUS_07490 77931 78062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 78480 78100 gene locus_tag LOCUS_07500 78480 78100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 79172 78477 gene locus_tag LOCUS_07510 79172 78477 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_07510 79305 80762 gene locus_tag LOCUS_07520 79305 80762 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_07520 80759 81841 gene locus_tag LOCUS_07530 80759 81841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 81838 82926 gene locus_tag LOCUS_07540 81838 82926 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890704.1 protein_id gnl|my_center|LOCUS_07540 84780 82933 gene locus_tag LOCUS_07550 gene asnB 84780 82933 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_07550 85521 84955 gene locus_tag LOCUS_07560 85521 84955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 85666 88053 gene locus_tag LOCUS_07570 gene pcrA 85666 88053 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_07570 88170 89393 gene locus_tag LOCUS_07580 88170 89393 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807909.1 protein_id gnl|my_center|LOCUS_07580 90279 89467 gene locus_tag LOCUS_07590 90279 89467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965639.1 protein_id gnl|my_center|LOCUS_07590 90453 91109 gene locus_tag LOCUS_07600 90453 91109 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_07600 91106 91648 gene locus_tag LOCUS_07610 91106 91648 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_07610 91678 92235 gene locus_tag LOCUS_07620 91678 92235 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_07620 92232 93530 gene locus_tag LOCUS_07630 92232 93530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 93657 94895 gene locus_tag LOCUS_07640 93657 94895 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_07640 94974 96572 gene locus_tag LOCUS_07650 94974 96572 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438168.1 protein_id gnl|my_center|LOCUS_07650 96596 96949 gene locus_tag LOCUS_07660 96596 96949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 97229 98248 gene locus_tag LOCUS_07670 97229 98248 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836873.1 protein_id gnl|my_center|LOCUS_07670 98274 100904 gene locus_tag LOCUS_07680 gene alaS 98274 100904 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_07680 100992 101330 gene locus_tag LOCUS_07690 100992 101330 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_07690 101367 101906 gene locus_tag LOCUS_07700 101367 101906 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_07700 102008 102730 gene locus_tag LOCUS_07710 102008 102730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 102817 104196 gene locus_tag LOCUS_07720 gene radA 102817 104196 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_07720 104187 104957 gene locus_tag LOCUS_07730 104187 104957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048138.1 protein_id gnl|my_center|LOCUS_07730 105221 106207 gene locus_tag LOCUS_07740 105221 106207 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_07740 107339 106329 gene locus_tag LOCUS_07750 107339 106329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 108259 107360 gene locus_tag LOCUS_07760 gene xerD 108259 107360 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_07760 108863 108273 gene locus_tag LOCUS_07770 108863 108273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 109744 108926 gene locus_tag LOCUS_07780 gene proC 109744 108926 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095814.1 protein_id gnl|my_center|LOCUS_07780 110340 109963 gene locus_tag LOCUS_07790 110340 109963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 110752 110417 gene locus_tag LOCUS_07800 gene yajC 110752 110417 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080747.1 protein_id gnl|my_center|LOCUS_07800 112042 110912 gene locus_tag LOCUS_07810 gene tgt 112042 110912 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_07810 112908 112135 gene locus_tag LOCUS_07820 gene fecE 112908 112135 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 protein_id gnl|my_center|LOCUS_07820 113875 112901 gene locus_tag LOCUS_07830 113875 112901 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445949.1 protein_id gnl|my_center|LOCUS_07830 114887 113889 gene locus_tag LOCUS_07840 114887 113889 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156774516.1 protein_id gnl|my_center|LOCUS_07840 115459 115130 gene locus_tag LOCUS_07850 115459 115130 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_07850 115980 115600 gene locus_tag LOCUS_07860 115980 115600 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671440.1 protein_id gnl|my_center|LOCUS_07860 117771 117423 gene locus_tag LOCUS_tm00010 117771 117423 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 118260 117796 gene locus_tag LOCUS_07870 gene smpB 118260 117796 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_07870 118942 118340 gene locus_tag LOCUS_07880 gene recR 118942 118340 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_07880 119294 118944 gene locus_tag LOCUS_07890 119294 118944 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_07890 120931 119321 gene locus_tag LOCUS_07900 120931 119321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 122312 121266 gene locus_tag LOCUS_07910 122312 121266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 123087 122314 gene locus_tag LOCUS_07920 123087 122314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 123938 123084 gene locus_tag LOCUS_07930 123938 123084 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963984.1 protein_id gnl|my_center|LOCUS_07930 125396 123972 gene locus_tag LOCUS_07940 125396 123972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 127109 125679 gene locus_tag LOCUS_07950 127109 125679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 128794 127391 gene locus_tag LOCUS_07960 128794 127391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 129611 130117 gene locus_tag LOCUS_07970 129611 130117 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_07970 132267 130204 gene locus_tag LOCUS_07980 132267 130204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 133309 132365 gene locus_tag LOCUS_07990 133309 132365 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_07990 134156 133311 gene locus_tag LOCUS_08000 134156 133311 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_08000 134376 134675 gene locus_tag LOCUS_08010 134376 134675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 135463 134798 gene locus_tag LOCUS_08020 135463 134798 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870309.1 protein_id gnl|my_center|LOCUS_08020 136811 135540 gene locus_tag LOCUS_08030 136811 135540 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_08030 138083 136833 gene locus_tag LOCUS_08040 138083 136833 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_08040 138809 138135 gene locus_tag LOCUS_08050 138809 138135 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_08050 138934 139569 gene locus_tag LOCUS_08060 gene nth 138934 139569 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_08060 139623 141425 gene locus_tag LOCUS_08070 gene ade 139623 141425 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948084.1 protein_id gnl|my_center|LOCUS_08070 141464 142651 gene locus_tag LOCUS_08080 141464 142651 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679364.1 protein_id gnl|my_center|LOCUS_08080 142648 143436 gene locus_tag LOCUS_08090 142648 143436 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_08090 145075 143735 gene locus_tag LOCUS_08100 145075 143735 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_08100 146757 145159 gene locus_tag LOCUS_08110 146757 145159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 147714 146824 gene locus_tag LOCUS_08120 147714 146824 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_08120 148669 147737 gene locus_tag LOCUS_08130 148669 147737 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_08130 149135 150691 gene locus_tag LOCUS_08140 149135 150691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 150694 152535 gene locus_tag LOCUS_08150 150694 152535 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_08150 152674 154023 gene locus_tag LOCUS_08160 152674 154023 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228115.1 protein_id gnl|my_center|LOCUS_08160 154130 155377 gene locus_tag LOCUS_08170 154130 155377 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_08170 156077 155475 gene locus_tag LOCUS_08180 156077 155475 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183373.1 protein_id gnl|my_center|LOCUS_08180 156314 157381 gene locus_tag LOCUS_08190 156314 157381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 158439 157504 gene locus_tag LOCUS_08200 gene cysK 158439 157504 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_08200 158690 160138 gene locus_tag LOCUS_08210 158690 160138 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937330.1 protein_id gnl|my_center|LOCUS_08210 160135 160833 gene locus_tag LOCUS_08220 160135 160833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631603.1 protein_id gnl|my_center|LOCUS_08220 160830 162764 gene locus_tag LOCUS_08230 160830 162764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 162761 164017 gene locus_tag LOCUS_08240 162761 164017 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_08240 164537 164121 gene locus_tag LOCUS_08250 164537 164121 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_08250 164866 164549 gene locus_tag LOCUS_08260 gene trxA 164866 164549 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173768.1 protein_id gnl|my_center|LOCUS_08260 165720 164890 gene locus_tag LOCUS_08270 165720 164890 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027287.1 protein_id gnl|my_center|LOCUS_08270 165898 166818 gene locus_tag LOCUS_08280 165898 166818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 167099 168418 gene locus_tag LOCUS_08290 167099 168418 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_08290 170969 168498 gene locus_tag LOCUS_08300 170969 168498 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_08300 172112 171072 gene locus_tag LOCUS_08310 172112 171072 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 protein_id gnl|my_center|LOCUS_08310 172632 172105 gene locus_tag LOCUS_08320 172632 172105 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_08320 173126 172674 gene locus_tag LOCUS_08330 173126 172674 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425587.1 protein_id gnl|my_center|LOCUS_08330 173358 173501 gene locus_tag LOCUS_08340 173358 173501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 174261 173614 gene locus_tag LOCUS_08350 174261 173614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 174606 174352 gene locus_tag LOCUS_08360 174606 174352 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_08360 175443 174622 gene locus_tag LOCUS_08370 175443 174622 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_08370 176271 175462 gene locus_tag LOCUS_08380 176271 175462 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948543.1 protein_id gnl|my_center|LOCUS_08380 177184 176252 gene locus_tag LOCUS_08390 177184 176252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948544.1 protein_id gnl|my_center|LOCUS_08390 177789 177205 gene locus_tag LOCUS_08400 177789 177205 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_08400 177961 177794 gene locus_tag LOCUS_08410 177961 177794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 178843 178040 gene locus_tag LOCUS_08420 178843 178040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 179858 178989 gene locus_tag LOCUS_08430 179858 178989 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_08430 180509 179979 gene locus_tag LOCUS_08440 180509 179979 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409124.1 protein_id gnl|my_center|LOCUS_08440 181418 180579 gene locus_tag LOCUS_08450 181418 180579 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_08450 182518 181463 gene locus_tag LOCUS_08460 182518 181463 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_08460 183443 182532 gene locus_tag LOCUS_08470 183443 182532 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_08470 184052 183549 gene locus_tag LOCUS_08480 184052 183549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 184196 184915 gene locus_tag LOCUS_08490 184196 184915 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_08490 184919 185752 gene locus_tag LOCUS_08500 184919 185752 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_08500 186076 185867 gene locus_tag LOCUS_08510 186076 185867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 186232 187077 gene locus_tag LOCUS_08520 186232 187077 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837501.1 protein_id gnl|my_center|LOCUS_08520 187217 188242 gene locus_tag LOCUS_08530 187217 188242 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_08530 189403 188378 gene locus_tag LOCUS_08540 189403 188378 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675004.1 protein_id gnl|my_center|LOCUS_08540 190301 189549 gene locus_tag LOCUS_08550 190301 189549 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_08550 192153 190555 gene locus_tag LOCUS_08560 192153 190555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 192931 192398 gene locus_tag LOCUS_08570 192931 192398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 193287 192928 gene locus_tag LOCUS_08580 193287 192928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 194246 193392 gene locus_tag LOCUS_08590 194246 193392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 194449 194237 gene locus_tag LOCUS_08600 194449 194237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 194975 194478 gene locus_tag LOCUS_08610 194975 194478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 195591 194992 gene locus_tag LOCUS_08620 195591 194992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence05 265 450 gene locus_tag LOCUS_08630 265 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1446 583 gene locus_tag LOCUS_08640 gene rhaR 1446 583 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230731.1 protein_id gnl|my_center|LOCUS_08640 1650 3902 gene locus_tag LOCUS_08650 1650 3902 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922246.1 protein_id gnl|my_center|LOCUS_08650 3948 4820 gene locus_tag LOCUS_08660 3948 4820 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_08660 4967 6769 gene locus_tag LOCUS_08670 4967 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 7396 6935 gene locus_tag LOCUS_08680 7396 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 9093 7495 gene locus_tag LOCUS_08690 9093 7495 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_08690 9243 10343 gene locus_tag LOCUS_08700 9243 10343 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_08700 10658 10479 gene locus_tag LOCUS_08710 10658 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 11266 10778 gene locus_tag LOCUS_08720 11266 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 12348 11407 gene locus_tag LOCUS_08730 12348 11407 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263651.1 protein_id gnl|my_center|LOCUS_08730 13962 12523 gene locus_tag LOCUS_08740 13962 12523 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_08740 14637 13984 gene locus_tag LOCUS_08750 gene cysE 14637 13984 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071396735.1 protein_id gnl|my_center|LOCUS_08750 15477 15112 gene locus_tag LOCUS_08760 15477 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 17136 15958 gene locus_tag LOCUS_08770 17136 15958 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_08770 19329 17263 gene locus_tag LOCUS_08780 19329 17263 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097213.1 protein_id gnl|my_center|LOCUS_08780 20234 19656 gene locus_tag LOCUS_08790 20234 19656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 20731 20231 gene locus_tag LOCUS_08800 20731 20231 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_08800 22265 20895 gene locus_tag LOCUS_08810 22265 20895 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 protein_id gnl|my_center|LOCUS_08810 23638 22289 gene locus_tag LOCUS_08820 23638 22289 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643131.1 protein_id gnl|my_center|LOCUS_08820 24023 23733 gene locus_tag LOCUS_08830 24023 23733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 24962 24120 gene locus_tag LOCUS_08840 gene prmC 24962 24120 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_08840 25897 24959 gene locus_tag LOCUS_08850 25897 24959 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_08850 27447 25924 gene locus_tag LOCUS_08860 27447 25924 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814305.1 protein_id gnl|my_center|LOCUS_08860 28168 27464 gene locus_tag LOCUS_08870 28168 27464 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036073.1 protein_id gnl|my_center|LOCUS_08870 29565 28189 gene locus_tag LOCUS_08880 29565 28189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 29812 30288 gene locus_tag LOCUS_08890 29812 30288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 30278 30730 gene locus_tag LOCUS_08900 30278 30730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 31161 30820 gene locus_tag LOCUS_08910 31161 30820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 34435 31292 gene locus_tag LOCUS_08920 34435 31292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 35204 34437 gene locus_tag LOCUS_08930 gene rlmB 35204 34437 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_08930 36067 36777 gene locus_tag LOCUS_08940 36067 36777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 36774 37610 gene locus_tag LOCUS_08950 36774 37610 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_08950 39639 37816 gene locus_tag LOCUS_08960 gene glgB 39639 37816 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775138.1 protein_id gnl|my_center|LOCUS_08960 39811 40344 gene locus_tag LOCUS_08970 39811 40344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 40471 41175 gene locus_tag LOCUS_08980 40471 41175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_08980 41196 44645 gene locus_tag LOCUS_08990 41196 44645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_08990 45910 44804 gene locus_tag LOCUS_09000 gene hemW 45910 44804 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901389.1 protein_id gnl|my_center|LOCUS_09000 48075 46273 gene locus_tag LOCUS_09010 gene lepA 48075 46273 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_09010 48350 49087 gene locus_tag LOCUS_09020 48350 49087 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_09020 49084 49806 gene locus_tag LOCUS_09030 gene fabG 49084 49806 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_09030 49894 50067 gene locus_tag LOCUS_09040 49894 50067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 50108 51034 gene locus_tag LOCUS_09050 50108 51034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 51063 52094 gene locus_tag LOCUS_09060 51063 52094 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_09060 52124 52654 gene locus_tag LOCUS_09070 52124 52654 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359138.1 protein_id gnl|my_center|LOCUS_09070 52843 53385 gene locus_tag LOCUS_09080 52843 53385 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_09080 54412 53738 gene locus_tag LOCUS_09090 54412 53738 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236552.1 protein_id gnl|my_center|LOCUS_09090 55848 54460 gene locus_tag LOCUS_09100 55848 54460 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_09100 57164 55986 gene locus_tag LOCUS_09110 57164 55986 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104266.1 protein_id gnl|my_center|LOCUS_09110 57559 57350 gene locus_tag LOCUS_09120 57559 57350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 57785 57657 gene locus_tag LOCUS_09130 57785 57657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 58769 57810 gene locus_tag LOCUS_09140 58769 57810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 59132 58956 gene locus_tag LOCUS_09150 59132 58956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 59873 59358 gene locus_tag LOCUS_09160 59873 59358 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_09160 61165 59915 gene locus_tag LOCUS_09170 61165 59915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 62111 61155 gene locus_tag LOCUS_09180 62111 61155 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_09180 62789 62199 gene locus_tag LOCUS_09190 gene pgsA 62789 62199 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_09190 64232 62910 gene locus_tag LOCUS_09200 gene rimO 64232 62910 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_09200 64822 64361 gene locus_tag LOCUS_09210 64822 64361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 65507 64887 gene locus_tag LOCUS_09220 65507 64887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 66682 65504 gene locus_tag LOCUS_09230 gene recA 66682 65504 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428218.1 protein_id gnl|my_center|LOCUS_09230 67392 66940 gene locus_tag LOCUS_09240 67392 66940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 69212 67512 gene locus_tag LOCUS_09250 69212 67512 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_09250 69903 69436 gene locus_tag LOCUS_09260 69903 69436 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_09260 70010 70246 gene locus_tag LOCUS_09270 70010 70246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 70280 70705 gene locus_tag LOCUS_09280 70280 70705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 70725 71033 gene locus_tag LOCUS_09290 70725 71033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 72267 71026 gene locus_tag LOCUS_09300 72267 71026 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_09300 73100 72309 gene locus_tag LOCUS_09310 gene proB 73100 72309 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_09310 73878 73111 gene locus_tag LOCUS_09320 73878 73111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 76226 74040 gene locus_tag LOCUS_09330 gene pnp 76226 74040 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_09330 76681 76418 gene locus_tag LOCUS_09340 gene rpsO 76681 76418 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_09340 76949 77803 gene locus_tag LOCUS_09350 76949 77803 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_09350 78801 77875 gene locus_tag LOCUS_09360 78801 77875 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_09360 79756 78854 gene locus_tag LOCUS_09370 gene truB 79756 78854 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_09370 80776 79808 gene locus_tag LOCUS_09380 80776 79808 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_09380 81173 80796 gene locus_tag LOCUS_09390 gene rbfA 81173 80796 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_09390 82356 81223 gene locus_tag LOCUS_09400 82356 81223 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_09400 84861 82429 gene locus_tag LOCUS_09410 gene infB 84861 82429 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541506.1 protein_id gnl|my_center|LOCUS_09410 85208 84861 gene locus_tag LOCUS_09420 85208 84861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 85538 85224 gene locus_tag LOCUS_09430 85538 85224 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_09430 86662 85571 gene locus_tag LOCUS_09440 gene nusA 86662 85571 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_09440 87189 86698 gene locus_tag LOCUS_09450 gene rimP 87189 86698 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_09450 88925 87438 gene locus_tag LOCUS_09460 88925 87438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 90479 88953 gene locus_tag LOCUS_09470 90479 88953 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_09470 91202 90495 gene locus_tag LOCUS_09480 91202 90495 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487316.1 protein_id gnl|my_center|LOCUS_09480 92227 91199 gene locus_tag LOCUS_09490 92227 91199 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_09490 93201 92593 gene locus_tag LOCUS_09500 gene rpe 93201 92593 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174250.1 protein_id gnl|my_center|LOCUS_09500 94171 93251 gene locus_tag LOCUS_09510 94171 93251 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 protein_id gnl|my_center|LOCUS_09510 94455 94174 gene locus_tag LOCUS_09520 94455 94174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 94996 94655 gene locus_tag LOCUS_09530 gene rplQ 94996 94655 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_09530 95980 95027 gene locus_tag LOCUS_09540 95980 95027 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_09540 96666 96040 gene locus_tag LOCUS_09550 gene rpsD 96666 96040 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_09550 97099 96689 gene locus_tag LOCUS_09560 gene rpsK 97099 96689 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_09560 97485 97117 gene locus_tag LOCUS_09570 gene rpsM 97485 97117 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_09570 97897 97679 gene locus_tag LOCUS_09580 gene infA 97897 97679 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_09580 98163 97912 gene locus_tag LOCUS_09590 98163 97912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 98928 98176 gene locus_tag LOCUS_09600 gene map 98928 98176 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_09600 99564 98932 gene locus_tag LOCUS_09610 99564 98932 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_09610 100916 99609 gene locus_tag LOCUS_09620 gene secY 100916 99609 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_09620 101358 100918 gene locus_tag LOCUS_09630 gene rplO 101358 100918 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_09630 101552 101373 gene locus_tag LOCUS_09640 gene rpmD 101552 101373 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966394.1 protein_id gnl|my_center|LOCUS_09640 102066 101566 gene locus_tag LOCUS_09650 gene rpsE 102066 101566 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_09650 102443 102084 gene locus_tag LOCUS_09660 gene rplR 102443 102084 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_09660 103007 102465 gene locus_tag LOCUS_09670 gene rplF 103007 102465 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810135.1 protein_id gnl|my_center|LOCUS_09670 103424 103026 gene locus_tag LOCUS_09680 gene rpsH 103424 103026 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_09680 103634 103449 gene locus_tag LOCUS_09690 103634 103449 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_09690 104186 103647 gene locus_tag LOCUS_09700 gene rplE 104186 103647 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_09700 104519 104202 gene locus_tag LOCUS_09710 gene rplX 104519 104202 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357467.1 protein_id gnl|my_center|LOCUS_09710 104904 104536 gene locus_tag LOCUS_09720 gene rplN 104904 104536 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_09720 105190 104933 gene locus_tag LOCUS_09730 gene rpsQ 105190 104933 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_09730 105413 105210 gene locus_tag LOCUS_09740 gene rpmC 105413 105210 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_09740 105832 105419 gene locus_tag LOCUS_09750 gene rplP 105832 105419 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_09750 106506 105832 gene locus_tag LOCUS_09760 gene rpsC 106506 105832 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_09760 106860 106525 gene locus_tag LOCUS_09770 gene rplV 106860 106525 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_09770 107089 106880 gene locus_tag LOCUS_09780 107089 106880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 108011 107178 gene locus_tag LOCUS_09790 gene rplB 108011 107178 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_09790 108378 108088 gene locus_tag LOCUS_09800 gene rplW 108378 108088 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_09800 109001 108378 gene locus_tag LOCUS_09810 gene rplD 109001 108378 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_09810 109652 109020 gene locus_tag LOCUS_09820 gene rplC 109652 109020 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 protein_id gnl|my_center|LOCUS_09820 110051 109740 gene locus_tag LOCUS_09830 gene rpsJ 110051 109740 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_09830 110497 110327 gene locus_tag LOCUS_09840 110497 110327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 111093 110599 gene locus_tag LOCUS_09850 111093 110599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 112646 111195 gene locus_tag LOCUS_09860 112646 111195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 114468 113368 gene locus_tag LOCUS_09870 114468 113368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 117460 114686 gene locus_tag LOCUS_09880 117460 114686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 117792 118586 gene locus_tag LOCUS_09890 117792 118586 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_09890 118644 119891 gene locus_tag LOCUS_09900 118644 119891 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272444.1 protein_id gnl|my_center|LOCUS_09900 121577 120099 gene locus_tag LOCUS_09910 gene guaB 121577 120099 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264088.1 protein_id gnl|my_center|LOCUS_09910 121936 123150 gene locus_tag LOCUS_09920 121936 123150 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242781.1 protein_id gnl|my_center|LOCUS_09920 125015 123729 gene locus_tag LOCUS_09930 gene serS 125015 123729 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_09930 125877 125068 gene locus_tag LOCUS_09940 125877 125068 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775488.1 protein_id gnl|my_center|LOCUS_09940 126691 125882 gene locus_tag LOCUS_09950 126691 125882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 127656 126688 gene locus_tag LOCUS_09960 127656 126688 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_09960 128534 127683 gene locus_tag LOCUS_09970 128534 127683 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 protein_id gnl|my_center|LOCUS_09970 129325 128561 gene locus_tag LOCUS_09980 129325 128561 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_09980 130322 129522 gene locus_tag LOCUS_09990 gene noc 130322 129522 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_09990 130496 131044 gene locus_tag LOCUS_10000 130496 131044 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919483.1 protein_id gnl|my_center|LOCUS_10000 131591 131154 gene locus_tag LOCUS_10010 131591 131154 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965763.1 protein_id gnl|my_center|LOCUS_10010 132441 131680 gene locus_tag LOCUS_10020 gene rsmG 132441 131680 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 protein_id gnl|my_center|LOCUS_10020 134349 132463 gene locus_tag LOCUS_10030 gene mnmG 134349 132463 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_10030 135779 134415 gene locus_tag LOCUS_10040 gene mnmE 135779 134415 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 protein_id gnl|my_center|LOCUS_10040 136804 135998 gene locus_tag LOCUS_10050 136804 135998 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_10050 137958 136885 gene locus_tag LOCUS_10060 137958 136885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 138226 137984 gene locus_tag LOCUS_10070 gene yidD 138226 137984 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_10070 138612 138223 gene locus_tag LOCUS_10080 gene rnpA 138612 138223 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723727.1 protein_id gnl|my_center|LOCUS_10080 139238 140539 gene locus_tag LOCUS_10090 gene dnaA 139238 140539 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_10090 140874 141980 gene locus_tag LOCUS_10100 gene dnaN 140874 141980 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_10100 142061 142282 gene locus_tag LOCUS_10110 142061 142282 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325922.1 protein_id gnl|my_center|LOCUS_10110 142287 143390 gene locus_tag LOCUS_10120 gene recF 142287 143390 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_10120 143527 143826 gene locus_tag LOCUS_10130 143527 143826 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 protein_id gnl|my_center|LOCUS_10130 143848 144279 gene locus_tag LOCUS_10140 143848 144279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 144510 146453 gene locus_tag LOCUS_10150 gene gyrB 144510 146453 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_10150 146475 149012 gene locus_tag LOCUS_10160 gene gyrA 146475 149012 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_10160 150607 149162 gene locus_tag LOCUS_10170 150607 149162 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065911.1 protein_id gnl|my_center|LOCUS_10170 151157 150612 gene locus_tag LOCUS_10180 151157 150612 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365240.1 protein_id gnl|my_center|LOCUS_10180 151330 151989 gene locus_tag LOCUS_10190 151330 151989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 153630 152149 gene locus_tag LOCUS_10200 153630 152149 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_10200 154044 153757 gene locus_tag LOCUS_10210 154044 153757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 155017 154157 gene locus_tag LOCUS_10220 155017 154157 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920018.1 protein_id gnl|my_center|LOCUS_10220 155959 155072 gene locus_tag LOCUS_10230 155959 155072 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897167.1 protein_id gnl|my_center|LOCUS_10230 156116 158521 gene locus_tag LOCUS_10240 gene yicI 156116 158521 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582725.1 protein_id gnl|my_center|LOCUS_10240 159083 158877 gene locus_tag LOCUS_10250 159083 158877 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_10250 160367 159258 gene locus_tag LOCUS_10260 160367 159258 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_10260 161247 160432 gene locus_tag LOCUS_10270 161247 160432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 162127 161261 gene locus_tag LOCUS_10280 162127 161261 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_10280 163092 162124 gene locus_tag LOCUS_10290 163092 162124 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286312.1 protein_id gnl|my_center|LOCUS_10290 163933 163220 gene locus_tag LOCUS_10300 163933 163220 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_10300 164191 164081 gene locus_tag LOCUS_r00010 164191 164081 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 165867 164344 gene locus_tag LOCUS_10310 gene xylB 165867 164344 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_10310 166089 167528 gene locus_tag LOCUS_10320 166089 167528 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_10320 167525 168781 gene locus_tag LOCUS_10330 167525 168781 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_10330 168783 169172 gene locus_tag LOCUS_10340 168783 169172 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_10340 169169 169894 gene locus_tag LOCUS_10350 169169 169894 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584037.1 protein_id gnl|my_center|LOCUS_10350 169944 170411 gene locus_tag LOCUS_10360 169944 170411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 170408 171163 gene locus_tag LOCUS_10370 170408 171163 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 protein_id gnl|my_center|LOCUS_10370 171488 171916 gene locus_tag LOCUS_10380 gene rplM 171488 171916 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_10380 171933 172334 gene locus_tag LOCUS_10390 gene rpsI 171933 172334 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence06 222 1973 gene locus_tag LOCUS_10400 gene pyk 222 1973 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_10400 1970 2815 gene locus_tag LOCUS_10410 1970 2815 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721653.1 protein_id gnl|my_center|LOCUS_10410 3586 2885 gene locus_tag LOCUS_10420 3586 2885 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518847.1 protein_id gnl|my_center|LOCUS_10420 4161 3583 gene locus_tag LOCUS_10430 4161 3583 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458824.1 protein_id gnl|my_center|LOCUS_10430 4405 5034 gene locus_tag LOCUS_10440 4405 5034 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263803.1 protein_id gnl|my_center|LOCUS_10440 6410 5385 gene locus_tag LOCUS_10450 6410 5385 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298109.1 protein_id gnl|my_center|LOCUS_10450 6528 7316 gene locus_tag LOCUS_10460 6528 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7475 7624 gene locus_tag LOCUS_10470 gene rpmG 7475 7624 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_10470 7640 7873 gene locus_tag LOCUS_10480 7640 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 7918 8442 gene locus_tag LOCUS_10490 gene nusG 7918 8442 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_10490 8561 8986 gene locus_tag LOCUS_10500 gene rplK 8561 8986 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_10500 9050 9742 gene locus_tag LOCUS_10510 gene rplA 9050 9742 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_10510 10011 10562 gene locus_tag LOCUS_10520 gene rplJ 10011 10562 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_10520 10624 11001 gene locus_tag LOCUS_10530 gene rplL 10624 11001 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_10530 11359 11856 gene locus_tag LOCUS_10540 11359 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 11864 14083 gene locus_tag LOCUS_10550 11864 14083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_10550 14080 15945 gene locus_tag LOCUS_10560 14080 15945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_10560 18755 16035 gene locus_tag LOCUS_10570 18755 16035 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229784.1 protein_id gnl|my_center|LOCUS_10570 19879 18758 gene locus_tag LOCUS_10580 19879 18758 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706825.1 protein_id gnl|my_center|LOCUS_10580 20067 21527 gene locus_tag LOCUS_10590 gene dacF 20067 21527 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_10590 22583 21666 gene locus_tag LOCUS_10600 22583 21666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 23341 22634 gene locus_tag LOCUS_10610 23341 22634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 24742 23360 gene locus_tag LOCUS_10620 24742 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 25125 26618 gene locus_tag LOCUS_10630 25125 26618 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644038.1 protein_id gnl|my_center|LOCUS_10630 26735 27316 gene locus_tag LOCUS_10640 26735 27316 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870005.1 protein_id gnl|my_center|LOCUS_10640 28259 27405 gene locus_tag LOCUS_10650 28259 27405 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258584.1 protein_id gnl|my_center|LOCUS_10650 28907 28278 gene locus_tag LOCUS_10660 28907 28278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 29314 30279 gene locus_tag LOCUS_10670 gene hprK 29314 30279 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_10670 30300 31076 gene locus_tag LOCUS_10680 30300 31076 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048308.1 protein_id gnl|my_center|LOCUS_10680 31069 31980 gene locus_tag LOCUS_10690 gene murB 31069 31980 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_10690 32022 32882 gene locus_tag LOCUS_10700 gene rapZ 32022 32882 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_10700 32947 33903 gene locus_tag LOCUS_10710 gene whiA 32947 33903 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243775.1 protein_id gnl|my_center|LOCUS_10710 33955 37500 gene locus_tag LOCUS_10720 33955 37500 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_10720 37622 38590 gene locus_tag LOCUS_10730 gene pfkA 37622 38590 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_10730 38726 38801 gene locus_tag LOCUS_t00100 38726 38801 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 38805 38881 gene locus_tag LOCUS_t00110 38805 38881 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 38916 38991 gene locus_tag LOCUS_t00120 38916 38991 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 40149 39094 gene locus_tag LOCUS_10740 40149 39094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 40952 40278 gene locus_tag LOCUS_10750 40952 40278 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_10750 41124 41873 gene locus_tag LOCUS_10760 41124 41873 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_10760 41899 42369 gene locus_tag LOCUS_10770 41899 42369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 42476 43459 gene locus_tag LOCUS_10780 42476 43459 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892682.1 protein_id gnl|my_center|LOCUS_10780 43486 44511 gene locus_tag LOCUS_10790 43486 44511 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_10790 46736 44697 gene locus_tag LOCUS_10800 gene recG 46736 44697 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_10800 48526 46835 gene locus_tag LOCUS_10810 48526 46835 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_10810 49446 48673 gene locus_tag LOCUS_10820 49446 48673 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_10820 50407 49526 gene locus_tag LOCUS_10830 50407 49526 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258548.1 protein_id gnl|my_center|LOCUS_10830 50709 51653 gene locus_tag LOCUS_10840 50709 51653 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_10840 51753 52622 gene locus_tag LOCUS_10850 gene pstC 51753 52622 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_10850 52626 53483 gene locus_tag LOCUS_10860 gene pstA 52626 53483 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_10860 53506 54255 gene locus_tag LOCUS_10870 gene pstB 53506 54255 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965015.1 protein_id gnl|my_center|LOCUS_10870 54288 54926 gene locus_tag LOCUS_10880 gene phoU 54288 54926 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_10880 54975 55682 gene locus_tag LOCUS_10890 54975 55682 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_10890 55703 57352 gene locus_tag LOCUS_10900 55703 57352 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_10900 57524 57868 gene locus_tag LOCUS_10910 57524 57868 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380304.1 protein_id gnl|my_center|LOCUS_10910 57909 58982 gene locus_tag LOCUS_10920 57909 58982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048859.1 protein_id gnl|my_center|LOCUS_10920 59183 60562 gene locus_tag LOCUS_10930 59183 60562 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993891.1 protein_id gnl|my_center|LOCUS_10930 60605 60871 gene locus_tag LOCUS_10940 60605 60871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 61845 60919 gene locus_tag LOCUS_10950 61845 60919 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174372.1 protein_id gnl|my_center|LOCUS_10950 62256 63119 gene locus_tag LOCUS_10960 62256 63119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 63138 63524 gene locus_tag LOCUS_10970 63138 63524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 63546 64025 gene locus_tag LOCUS_10980 63546 64025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 64018 65796 gene locus_tag LOCUS_10990 gene atpA 64018 65796 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_10990 65802 66701 gene locus_tag LOCUS_11000 gene atpG 65802 66701 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_11000 66698 68110 gene locus_tag LOCUS_11010 gene atpD 66698 68110 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_11010 68110 68520 gene locus_tag LOCUS_11020 68110 68520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 68689 69174 gene locus_tag LOCUS_11030 gene adhR 68689 69174 CDS product aldehyde stress transcriptional regulator AdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398725.1 protein_id gnl|my_center|LOCUS_11030 69514 69702 gene locus_tag LOCUS_11040 69514 69702 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_11040 70234 69803 gene locus_tag LOCUS_11050 70234 69803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 70355 72862 gene locus_tag LOCUS_11060 70355 72862 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_11060 73013 73450 gene locus_tag LOCUS_11070 73013 73450 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 protein_id gnl|my_center|LOCUS_11070 73473 74717 gene locus_tag LOCUS_11080 73473 74717 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_11080 74735 75631 gene locus_tag LOCUS_11090 gene thrB 74735 75631 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964548.1 protein_id gnl|my_center|LOCUS_11090 75696 76913 gene locus_tag LOCUS_11100 75696 76913 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_11100 76973 77170 gene locus_tag LOCUS_11110 76973 77170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 77732 78370 gene locus_tag LOCUS_11120 77732 78370 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129648.1 protein_id gnl|my_center|LOCUS_11120 78386 79864 gene locus_tag LOCUS_11130 78386 79864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 80036 80308 gene locus_tag LOCUS_11140 80036 80308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 80292 80699 gene locus_tag LOCUS_11150 80292 80699 CDS product pyrimidine (deoxy)nucleoside triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592145.1 protein_id gnl|my_center|LOCUS_11150 80885 81253 gene locus_tag LOCUS_11160 80885 81253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 81266 81457 gene locus_tag LOCUS_11170 81266 81457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 81500 82174 gene locus_tag LOCUS_11180 81500 82174 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_11180 82171 83265 gene locus_tag LOCUS_11190 82171 83265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 83252 83623 gene locus_tag LOCUS_11200 83252 83623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 83638 84018 gene locus_tag LOCUS_11210 83638 84018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 85043 84180 gene locus_tag LOCUS_11220 85043 84180 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_11220 86615 85572 gene locus_tag LOCUS_11230 gene eutH 86615 85572 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016133.1 protein_id gnl|my_center|LOCUS_11230 87908 86649 gene locus_tag LOCUS_11240 87908 86649 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_11240 88409 88110 gene locus_tag LOCUS_11250 88409 88110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_11250 89761 88406 gene locus_tag LOCUS_11260 89761 88406 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_11260 89995 90225 gene locus_tag LOCUS_11270 89995 90225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 90426 92129 gene locus_tag LOCUS_11280 gene msbA 90426 92129 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930870.1 protein_id gnl|my_center|LOCUS_11280 92192 92269 gene locus_tag LOCUS_t00130 92192 92269 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 92903 92565 gene locus_tag LOCUS_11290 92903 92565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 93637 93774 gene locus_tag LOCUS_11300 93637 93774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 94266 94487 gene locus_tag LOCUS_11310 94266 94487 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence07 600 1055 gene locus_tag LOCUS_11320 600 1055 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_11320 1155 1568 gene locus_tag LOCUS_11330 1155 1568 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_11330 1638 3758 gene locus_tag LOCUS_11340 1638 3758 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678967.1 protein_id gnl|my_center|LOCUS_11340 3925 5199 gene locus_tag LOCUS_11350 3925 5199 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_11350 5265 6137 gene locus_tag LOCUS_11360 5265 6137 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_11360 7175 6201 gene locus_tag LOCUS_11370 gene spoIID 7175 6201 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672663.1 protein_id gnl|my_center|LOCUS_11370 7383 8753 gene locus_tag LOCUS_11380 7383 8753 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_11380 8884 9840 gene locus_tag LOCUS_11390 8884 9840 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804471.1 protein_id gnl|my_center|LOCUS_11390 9911 11002 gene locus_tag LOCUS_11400 9911 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 10965 13181 gene locus_tag LOCUS_11410 10965 13181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 13368 16448 gene locus_tag LOCUS_11420 13368 16448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 16551 17846 gene locus_tag LOCUS_11430 16551 17846 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_11430 18516 17896 gene locus_tag LOCUS_11440 18516 17896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 19017 18574 gene locus_tag LOCUS_11450 19017 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 19984 20691 gene locus_tag LOCUS_11460 19984 20691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021134.1 protein_id gnl|my_center|LOCUS_11460 20684 22255 gene locus_tag LOCUS_11470 20684 22255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990774.1 protein_id gnl|my_center|LOCUS_11470 23702 22374 gene locus_tag LOCUS_11480 23702 22374 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013342.1 protein_id gnl|my_center|LOCUS_11480 25651 23702 gene locus_tag LOCUS_11490 25651 23702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 26334 25663 gene locus_tag LOCUS_11500 26334 25663 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_11500 27184 26555 gene locus_tag LOCUS_11510 27184 26555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 27964 27194 gene locus_tag LOCUS_11520 27964 27194 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263785.1 protein_id gnl|my_center|LOCUS_11520 28211 29959 gene locus_tag LOCUS_11530 28211 29959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_11530 29956 31710 gene locus_tag LOCUS_11540 29956 31710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_11540 31802 33766 gene locus_tag LOCUS_11550 31802 33766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 33980 34987 gene locus_tag LOCUS_11560 gene asnA 33980 34987 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_11560 36413 35109 gene locus_tag LOCUS_11570 36413 35109 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787705.1 protein_id gnl|my_center|LOCUS_11570 36912 37559 gene locus_tag LOCUS_11580 36912 37559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 38379 37618 gene locus_tag LOCUS_11590 38379 37618 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_11590 38633 39976 gene locus_tag LOCUS_11600 38633 39976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 40085 40789 gene locus_tag LOCUS_11610 40085 40789 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_11610 40814 41971 gene locus_tag LOCUS_11620 40814 41971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11620 41971 42174 gene locus_tag LOCUS_11630 41971 42174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 42238 42822 gene locus_tag LOCUS_11640 42238 42822 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_11640 42828 43679 gene locus_tag LOCUS_11650 42828 43679 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002094186.1 protein_id gnl|my_center|LOCUS_11650 43991 44491 gene locus_tag LOCUS_11660 gene purE 43991 44491 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_11660 44522 45760 gene locus_tag LOCUS_11670 44522 45760 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 protein_id gnl|my_center|LOCUS_11670 45822 46856 gene locus_tag LOCUS_11680 gene purM 45822 46856 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_11680 46850 47479 gene locus_tag LOCUS_11690 gene purN 46850 47479 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_11690 47565 48284 gene locus_tag LOCUS_11700 47565 48284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 48311 49486 gene locus_tag LOCUS_11710 48311 49486 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_11710 49505 50044 gene locus_tag LOCUS_11720 49505 50044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 50041 51306 gene locus_tag LOCUS_11730 gene purD 50041 51306 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_11730 51552 51361 gene locus_tag LOCUS_11740 51552 51361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 51680 52036 gene locus_tag LOCUS_11750 51680 52036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 54284 52110 gene locus_tag LOCUS_11760 54284 52110 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_11760 56520 54436 gene locus_tag LOCUS_11770 56520 54436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 56796 57797 gene locus_tag LOCUS_11780 56796 57797 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_11780 58065 58721 gene locus_tag LOCUS_11790 58065 58721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 59064 60455 gene locus_tag LOCUS_11800 59064 60455 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 protein_id gnl|my_center|LOCUS_11800 61885 60563 gene locus_tag LOCUS_11810 61885 60563 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391589.1 protein_id gnl|my_center|LOCUS_11810 63291 61909 gene locus_tag LOCUS_11820 gene scfB 63291 61909 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_11820 63556 63407 gene locus_tag LOCUS_11830 gene scfA 63556 63407 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_11830 64110 63661 gene locus_tag LOCUS_11840 64110 63661 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_11840 64416 64231 gene locus_tag LOCUS_11850 64416 64231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 65183 64425 gene locus_tag LOCUS_11860 65183 64425 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 protein_id gnl|my_center|LOCUS_11860 65855 65196 gene locus_tag LOCUS_11870 65855 65196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 66758 65931 gene locus_tag LOCUS_11880 66758 65931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 68848 67130 gene locus_tag LOCUS_11890 68848 67130 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_11890 69641 68874 gene locus_tag LOCUS_11900 69641 68874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 69808 70533 gene locus_tag LOCUS_11910 gene aroD 69808 70533 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721277.1 protein_id gnl|my_center|LOCUS_11910 71574 70561 gene locus_tag LOCUS_11920 71574 70561 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681095.1 protein_id gnl|my_center|LOCUS_11920 71770 72540 gene locus_tag LOCUS_11930 71770 72540 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_11930 72545 74623 gene locus_tag LOCUS_11940 72545 74623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 74982 75716 gene locus_tag LOCUS_11950 74982 75716 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459753.1 protein_id gnl|my_center|LOCUS_11950 75910 77022 gene locus_tag LOCUS_11960 75910 77022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 77045 77989 gene locus_tag LOCUS_11970 77045 77989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 78153 79259 gene locus_tag LOCUS_11980 78153 79259 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 protein_id gnl|my_center|LOCUS_11980 79367 80281 gene locus_tag LOCUS_11990 79367 80281 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927052.1 protein_id gnl|my_center|LOCUS_11990 80278 80859 gene locus_tag LOCUS_12000 80278 80859 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 protein_id gnl|my_center|LOCUS_12000 81090 82436 gene locus_tag LOCUS_12010 gene rsxC 81090 82436 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869095.1 protein_id gnl|my_center|LOCUS_12010 82433 83386 gene locus_tag LOCUS_12020 82433 83386 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_12020 83383 83931 gene locus_tag LOCUS_12030 83383 83931 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_12030 83933 84622 gene locus_tag LOCUS_12040 83933 84622 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_12040 84622 85233 gene locus_tag LOCUS_12050 84622 85233 CDS product RnfABCDGE type electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869099.1 protein_id gnl|my_center|LOCUS_12050 85266 86057 gene locus_tag LOCUS_12060 85266 86057 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_12060 87322 86123 gene locus_tag LOCUS_12070 gene hydF 87322 86123 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964958.1 protein_id gnl|my_center|LOCUS_12070 88820 87405 gene locus_tag LOCUS_12080 gene hydG 88820 87405 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_12080 89164 88886 gene locus_tag LOCUS_12090 89164 88886 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_12090 89758 90042 gene locus_tag LOCUS_12100 89758 90042 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_12100 90114 91778 gene locus_tag LOCUS_12110 gene groL 90114 91778 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357641.1 protein_id gnl|my_center|LOCUS_12110 92470 92228 gene locus_tag LOCUS_12120 92470 92228 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence08 5051 4845 gene locus_tag LOCUS_12130 5051 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 6384 5449 gene locus_tag LOCUS_12140 6384 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 7162 6341 gene locus_tag LOCUS_12150 7162 6341 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_12150 7454 7290 gene locus_tag LOCUS_12160 7454 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 8253 9182 gene locus_tag LOCUS_12170 8253 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 10077 9388 gene locus_tag LOCUS_12180 10077 9388 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_12180 10312 11442 gene locus_tag LOCUS_12190 10312 11442 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356002.1 protein_id gnl|my_center|LOCUS_12190 11459 11596 gene locus_tag LOCUS_12200 11459 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 12700 11663 gene locus_tag LOCUS_12210 12700 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 13798 12710 gene locus_tag LOCUS_12220 13798 12710 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_12220 14000 14149 gene locus_tag LOCUS_12230 14000 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 14673 14317 gene locus_tag LOCUS_12240 gene spoVAE 14673 14317 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_12240 14809 15846 gene locus_tag LOCUS_12250 14809 15846 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_12250 16182 15862 gene locus_tag LOCUS_12260 16182 15862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 17277 16333 gene locus_tag LOCUS_12270 17277 16333 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_12270 17492 17944 gene locus_tag LOCUS_12280 17492 17944 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 protein_id gnl|my_center|LOCUS_12280 18821 17991 gene locus_tag LOCUS_12290 18821 17991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 19264 19590 gene locus_tag LOCUS_12300 gene rpsT 19264 19590 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_12300 20413 19802 gene locus_tag LOCUS_12310 20413 19802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 20970 20581 gene locus_tag LOCUS_12320 20970 20581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 21233 21003 gene locus_tag LOCUS_12330 21233 21003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 21538 21275 gene locus_tag LOCUS_12340 21538 21275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 21649 21963 gene locus_tag LOCUS_12350 21649 21963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 22962 22039 gene locus_tag LOCUS_12360 22962 22039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 23148 23723 gene locus_tag LOCUS_12370 23148 23723 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459865.1 protein_id gnl|my_center|LOCUS_12370 25206 23941 gene locus_tag LOCUS_12380 25206 23941 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387108.1 protein_id gnl|my_center|LOCUS_12380 26091 25249 gene locus_tag LOCUS_12390 26091 25249 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_12390 26339 26698 gene locus_tag LOCUS_12400 26339 26698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 26723 27583 gene locus_tag LOCUS_12410 26723 27583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 27732 28175 gene locus_tag LOCUS_12420 27732 28175 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019670.1 protein_id gnl|my_center|LOCUS_12420 30201 28276 gene locus_tag LOCUS_12430 30201 28276 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 protein_id gnl|my_center|LOCUS_12430 30449 30889 gene locus_tag LOCUS_12440 30449 30889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 31855 30959 gene locus_tag LOCUS_12450 31855 30959 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460597.1 protein_id gnl|my_center|LOCUS_12450 32693 31866 gene locus_tag LOCUS_12460 32693 31866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 33600 32686 gene locus_tag LOCUS_12470 33600 32686 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_12470 34355 33693 gene locus_tag LOCUS_12480 34355 33693 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796158.1 protein_id gnl|my_center|LOCUS_12480 35248 34409 gene locus_tag LOCUS_12490 gene rsmI 35248 34409 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_12490 36014 35253 gene locus_tag LOCUS_12500 36014 35253 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_12500 36312 36142 gene locus_tag LOCUS_12510 36312 36142 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_12510 37455 36589 gene locus_tag LOCUS_12520 37455 36589 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_12520 38478 37486 gene locus_tag LOCUS_12530 38478 37486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 38802 38479 gene locus_tag LOCUS_12540 38802 38479 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 protein_id gnl|my_center|LOCUS_12540 40220 38907 gene locus_tag LOCUS_12550 40220 38907 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938025.1 protein_id gnl|my_center|LOCUS_12550 40756 40217 gene locus_tag LOCUS_12560 40756 40217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 41685 40819 gene locus_tag LOCUS_12570 41685 40819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 41838 42290 gene locus_tag LOCUS_12580 41838 42290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 43309 42368 gene locus_tag LOCUS_12590 43309 42368 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102569.1 protein_id gnl|my_center|LOCUS_12590 44078 43383 gene locus_tag LOCUS_12600 44078 43383 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_12600 44520 46319 gene locus_tag LOCUS_12610 44520 46319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_12610 46347 48158 gene locus_tag LOCUS_12620 46347 48158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_12620 48552 48331 gene locus_tag LOCUS_12630 48552 48331 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_12630 49178 48564 gene locus_tag LOCUS_12640 49178 48564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 50183 49419 gene locus_tag LOCUS_12650 50183 49419 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362363.1 protein_id gnl|my_center|LOCUS_12650 51088 50183 gene locus_tag LOCUS_12660 gene accD 51088 50183 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173385.1 protein_id gnl|my_center|LOCUS_12660 52466 51153 gene locus_tag LOCUS_12670 52466 51153 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_12670 52912 52496 gene locus_tag LOCUS_12680 gene fabZ 52912 52496 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287621.1 protein_id gnl|my_center|LOCUS_12680 53364 52933 gene locus_tag LOCUS_12690 gene accB 53364 52933 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931852.1 protein_id gnl|my_center|LOCUS_12690 54649 53414 gene locus_tag LOCUS_12700 gene fabF 54649 53414 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_12700 55879 55142 gene locus_tag LOCUS_12710 gene fabG 55879 55142 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_12710 56802 55876 gene locus_tag LOCUS_12720 gene fabD 56802 55876 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_12720 57734 56790 gene locus_tag LOCUS_12730 gene fabK 57734 56790 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_12730 58786 57827 gene locus_tag LOCUS_12740 58786 57827 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_12740 59245 58805 gene locus_tag LOCUS_12750 59245 58805 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362455.1 protein_id gnl|my_center|LOCUS_12750 59618 61030 gene locus_tag LOCUS_12760 59618 61030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 62731 61247 gene locus_tag LOCUS_12770 62731 61247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 63052 63747 gene locus_tag LOCUS_12780 63052 63747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 64135 64599 gene locus_tag LOCUS_12790 gene spoVT 64135 64599 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_12790 64806 66878 gene locus_tag LOCUS_12800 gene fusA 64806 66878 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_12800 67035 67961 gene locus_tag LOCUS_12810 67035 67961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 68091 68357 gene locus_tag LOCUS_12820 68091 68357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 68522 69823 gene locus_tag LOCUS_12830 68522 69823 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_12830 69947 70021 gene locus_tag LOCUS_t00140 69947 70021 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 70743 70667 gene locus_tag LOCUS_t00150 70743 70667 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 70824 70748 gene locus_tag LOCUS_t00160 70824 70748 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 70938 70865 gene locus_tag LOCUS_t00170 70938 70865 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 71140 71808 gene locus_tag LOCUS_12840 71140 71808 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812251.1 protein_id gnl|my_center|LOCUS_12840 71850 72935 gene locus_tag LOCUS_12850 71850 72935 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_12850 72910 73719 gene locus_tag LOCUS_12860 72910 73719 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_12860 73706 74302 gene locus_tag LOCUS_12870 73706 74302 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_12870 75779 74448 gene locus_tag LOCUS_12880 75779 74448 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_12880 75679 76026 gene locus_tag LOCUS_12890 75679 76026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 77351 75975 gene locus_tag LOCUS_12900 77351 75975 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 protein_id gnl|my_center|LOCUS_12900 78353 77457 gene locus_tag LOCUS_12910 78353 77457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_12910 79237 78791 gene locus_tag LOCUS_12920 79237 78791 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_12920 80607 79507 gene locus_tag LOCUS_12930 80607 79507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 82020 80620 gene locus_tag LOCUS_12940 82020 80620 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_12940 82639 82046 gene locus_tag LOCUS_12950 82639 82046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 83335 82793 gene locus_tag LOCUS_12960 83335 82793 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365476.1 protein_id gnl|my_center|LOCUS_12960 83643 83326 gene locus_tag LOCUS_12970 83643 83326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence09 225 734 gene locus_tag LOCUS_12980 225 734 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721853.1 protein_id gnl|my_center|LOCUS_12980 1064 1822 gene locus_tag LOCUS_12990 gene tam 1064 1822 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 protein_id gnl|my_center|LOCUS_12990 2096 2184 gene locus_tag LOCUS_t00180 2096 2184 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2214 2303 gene locus_tag LOCUS_t00190 2214 2303 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2427 2645 gene locus_tag LOCUS_13000 2427 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2982 5249 gene locus_tag LOCUS_13010 2982 5249 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_13010 5271 6599 gene locus_tag LOCUS_13020 5271 6599 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933982.1 protein_id gnl|my_center|LOCUS_13020 6659 6742 gene locus_tag LOCUS_t00200 6659 6742 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7227 6799 gene locus_tag LOCUS_13030 7227 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7577 7227 gene locus_tag LOCUS_13040 7577 7227 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273857.1 protein_id gnl|my_center|LOCUS_13040 7853 8428 gene locus_tag LOCUS_13050 7853 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 9566 8568 gene locus_tag LOCUS_13060 9566 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 10742 9735 gene locus_tag LOCUS_13070 10742 9735 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 protein_id gnl|my_center|LOCUS_13070 10843 11322 gene locus_tag LOCUS_13080 10843 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 12120 11314 gene locus_tag LOCUS_13090 12120 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 12461 12210 gene locus_tag LOCUS_13100 gene rpsR 12461 12210 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_13100 13021 12503 gene locus_tag LOCUS_13110 13021 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 13462 13055 gene locus_tag LOCUS_13120 13462 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 14536 13661 gene locus_tag LOCUS_13130 gene galU 14536 13661 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_13130 15724 14657 gene locus_tag LOCUS_13140 15724 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 16010 17137 gene locus_tag LOCUS_13150 gene prfB 16010 17137 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191976281.1 protein_id gnl|my_center|LOCUS_13150 17417 18682 gene locus_tag LOCUS_13160 gene ectB 17417 18682 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976955.1 protein_id gnl|my_center|LOCUS_13160 18858 20549 gene locus_tag LOCUS_13170 18858 20549 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_13170 21668 20667 gene locus_tag LOCUS_13180 21668 20667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 22692 21703 gene locus_tag LOCUS_13190 22692 21703 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_13190 23735 22752 gene locus_tag LOCUS_13200 23735 22752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 23941 24015 gene locus_tag LOCUS_t00210 23941 24015 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24180 24878 gene locus_tag LOCUS_13210 24180 24878 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965748.1 protein_id gnl|my_center|LOCUS_13210 25398 26105 gene locus_tag LOCUS_13220 25398 26105 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_13220 26127 26834 gene locus_tag LOCUS_13230 26127 26834 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_13230 26851 27396 gene locus_tag LOCUS_13240 gene scpB 26851 27396 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_13240 27393 28040 gene locus_tag LOCUS_13250 27393 28040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 28045 28452 gene locus_tag LOCUS_13260 gene ytfJ 28045 28452 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402813.1 protein_id gnl|my_center|LOCUS_13260 28542 29630 gene locus_tag LOCUS_13270 28542 29630 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_13270 29718 30554 gene locus_tag LOCUS_13280 29718 30554 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_13280 30478 30870 gene locus_tag LOCUS_13290 30478 30870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 31060 31938 gene locus_tag LOCUS_13300 31060 31938 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_13300 31960 32229 gene locus_tag LOCUS_13310 31960 32229 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_13310 32354 32962 gene locus_tag LOCUS_13320 gene gmk 32354 32962 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_13320 32955 33167 gene locus_tag LOCUS_13330 32955 33167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 33186 35624 gene locus_tag LOCUS_13340 gene priA 33186 35624 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_13340 35648 36127 gene locus_tag LOCUS_13350 gene def 35648 36127 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_13350 36124 37041 gene locus_tag LOCUS_13360 gene fmt 36124 37041 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_13360 37043 38374 gene locus_tag LOCUS_13370 gene rsmB 37043 38374 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206580826.1 protein_id gnl|my_center|LOCUS_13370 38379 39434 gene locus_tag LOCUS_13380 gene rlmN 38379 39434 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 protein_id gnl|my_center|LOCUS_13380 39422 40153 gene locus_tag LOCUS_13390 39422 40153 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_13390 40208 42262 gene locus_tag LOCUS_13400 gene pknB 40208 42262 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_13400 42271 43173 gene locus_tag LOCUS_13410 gene rsgA 42271 43173 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972439.1 protein_id gnl|my_center|LOCUS_13410 43170 43793 gene locus_tag LOCUS_13420 43170 43793 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112993.1 protein_id gnl|my_center|LOCUS_13420 43918 44094 gene locus_tag LOCUS_13430 43918 44094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 44467 45990 gene locus_tag LOCUS_13440 44467 45990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 46033 47508 gene locus_tag LOCUS_13450 gene spoIVA 46033 47508 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_13450 47592 47840 gene locus_tag LOCUS_13460 47592 47840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 47821 48408 gene locus_tag LOCUS_13470 47821 48408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 50438 48528 gene locus_tag LOCUS_13480 50438 48528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_13480 52176 50428 gene locus_tag LOCUS_13490 52176 50428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_13490 52979 55066 gene locus_tag LOCUS_13500 52979 55066 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_13500 55385 57235 gene locus_tag LOCUS_13510 55385 57235 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_13510 57219 57872 gene locus_tag LOCUS_13520 57219 57872 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_13520 57935 58159 gene locus_tag LOCUS_13530 57935 58159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 58283 58627 gene locus_tag LOCUS_13540 gene rplS 58283 58627 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_13540 58699 59274 gene locus_tag LOCUS_13550 gene lepB 58699 59274 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_13550 59296 60183 gene locus_tag LOCUS_13560 gene ylqF 59296 60183 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_13560 60211 60807 gene locus_tag LOCUS_13570 60211 60807 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_13570 60817 61173 gene locus_tag LOCUS_13580 60817 61173 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965070.1 protein_id gnl|my_center|LOCUS_13580 61202 62137 gene locus_tag LOCUS_13590 61202 62137 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_13590 62197 63687 gene locus_tag LOCUS_13600 gene thrC 62197 63687 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774945.1 protein_id gnl|my_center|LOCUS_13600 63693 64400 gene locus_tag LOCUS_13610 63693 64400 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228242.1 protein_id gnl|my_center|LOCUS_13610 64515 65804 gene locus_tag LOCUS_13620 gene tig 64515 65804 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_13620 65910 66497 gene locus_tag LOCUS_13630 gene clpP 65910 66497 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_13630 66515 67840 gene locus_tag LOCUS_13640 gene clpX 66515 67840 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_13640 67914 70331 gene locus_tag LOCUS_13650 gene lon 67914 70331 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460911.1 protein_id gnl|my_center|LOCUS_13650 70341 70946 gene locus_tag LOCUS_13660 gene ysxC 70341 70946 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869116.1 protein_id gnl|my_center|LOCUS_13660 70976 72274 gene locus_tag LOCUS_13670 gene lysA 70976 72274 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_13670 72383 72691 gene locus_tag LOCUS_13680 72383 72691 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965963.1 protein_id gnl|my_center|LOCUS_13680 72691 73461 gene locus_tag LOCUS_13690 72691 73461 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_13690 73496 74401 gene locus_tag LOCUS_13700 gene hslO 73496 74401 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_13700 74502 74578 gene locus_tag LOCUS_t00220 74502 74578 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 74585 74661 gene locus_tag LOCUS_t00230 74585 74661 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 74667 74742 gene locus_tag LOCUS_t00240 74667 74742 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 74746 74821 gene locus_tag LOCUS_t00250 74746 74821 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 74860 74934 gene locus_tag LOCUS_t00260 74860 74934 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 75493 76227 gene locus_tag LOCUS_13710 gene sigI 75493 76227 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815544.1 protein_id gnl|my_center|LOCUS_13710 76230 77063 gene locus_tag LOCUS_13720 76230 77063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 77221 78459 gene locus_tag LOCUS_13730 77221 78459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 79494 78673 gene locus_tag LOCUS_13740 79494 78673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 80577 79576 gene locus_tag LOCUS_13750 80577 79576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 81438 80593 gene locus_tag LOCUS_13760 81438 80593 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776846.1 protein_id gnl|my_center|LOCUS_13760 83171 81438 gene locus_tag LOCUS_13770 83171 81438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776847.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence10 542 366 gene locus_tag LOCUS_13780 542 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2637 727 gene locus_tag LOCUS_13790 2637 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 5160 2722 gene locus_tag LOCUS_13800 5160 2722 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081712308.1 protein_id gnl|my_center|LOCUS_13800 5623 6099 gene locus_tag LOCUS_13810 5623 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 6105 8189 gene locus_tag LOCUS_13820 6105 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 8364 8813 gene locus_tag LOCUS_13830 gene dut 8364 8813 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_13830 9010 10089 gene locus_tag LOCUS_13840 9010 10089 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_13840 10170 11084 gene locus_tag LOCUS_13850 10170 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 11132 11641 gene locus_tag LOCUS_13860 11132 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 11703 13799 gene locus_tag LOCUS_13870 11703 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 13925 14692 gene locus_tag LOCUS_13880 gene minD 13925 14692 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141991.1 protein_id gnl|my_center|LOCUS_13880 14772 15173 gene locus_tag LOCUS_13890 gene mgsA 14772 15173 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_13890 15544 15663 gene locus_tag LOCUS_13900 15544 15663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 15749 17038 gene locus_tag LOCUS_13910 gene hisS 15749 17038 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_13910 17100 17663 gene locus_tag LOCUS_13920 17100 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 17722 19506 gene locus_tag LOCUS_13930 gene aspS 17722 19506 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_13930 19503 20111 gene locus_tag LOCUS_13940 19503 20111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 20393 22687 gene locus_tag LOCUS_13950 20393 22687 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_13950 22843 23013 gene locus_tag LOCUS_13960 22843 23013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 23104 23604 gene locus_tag LOCUS_13970 gene nrdG 23104 23604 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_13970 23866 25644 gene locus_tag LOCUS_13980 23866 25644 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_13980 27379 25784 gene locus_tag LOCUS_13990 27379 25784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 27544 28818 gene locus_tag LOCUS_14000 27544 28818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 28818 29687 gene locus_tag LOCUS_14010 gene ant(6) 28818 29687 CDS product aminoglycoside nucleotidyltransferase ANT(6)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255864.1 protein_id gnl|my_center|LOCUS_14010 30825 29776 gene locus_tag LOCUS_14020 30825 29776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816022.1 protein_id gnl|my_center|LOCUS_14020 31319 30846 gene locus_tag LOCUS_14030 31319 30846 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_14030 32697 31516 gene locus_tag LOCUS_14040 32697 31516 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_14040 33593 32739 gene locus_tag LOCUS_14050 33593 32739 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 protein_id gnl|my_center|LOCUS_14050 34370 33606 gene locus_tag LOCUS_14060 34370 33606 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383265.1 protein_id gnl|my_center|LOCUS_14060 35230 34415 gene locus_tag LOCUS_14070 35230 34415 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668002.1 protein_id gnl|my_center|LOCUS_14070 36691 35333 gene locus_tag LOCUS_14080 gene uxaC 36691 35333 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187445.1 protein_id gnl|my_center|LOCUS_14080 36824 37651 gene locus_tag LOCUS_14090 36824 37651 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861630.1 protein_id gnl|my_center|LOCUS_14090 38399 37758 gene locus_tag LOCUS_14100 38399 37758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 38913 39806 gene locus_tag LOCUS_14110 38913 39806 CDS product TolB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969512.1 protein_id gnl|my_center|LOCUS_14110 39861 40346 gene locus_tag LOCUS_14120 39861 40346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 41191 40385 gene locus_tag LOCUS_14130 41191 40385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 41468 41878 gene locus_tag LOCUS_14140 41468 41878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 42188 42775 gene locus_tag LOCUS_14150 42188 42775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 42867 43007 gene locus_tag LOCUS_14160 42867 43007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 43267 44337 gene locus_tag LOCUS_14170 43267 44337 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_14170 44389 45123 gene locus_tag LOCUS_14180 44389 45123 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_14180 45782 45330 gene locus_tag LOCUS_14190 45782 45330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 46017 45814 gene locus_tag LOCUS_14200 46017 45814 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966596.1 protein_id gnl|my_center|LOCUS_14200 46816 46193 gene locus_tag LOCUS_14210 46816 46193 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_14210 47095 48975 gene locus_tag LOCUS_14220 47095 48975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 49434 49051 gene locus_tag LOCUS_14230 49434 49051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 49958 49446 gene locus_tag LOCUS_14240 49958 49446 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775452.1 protein_id gnl|my_center|LOCUS_14240 50293 51276 gene locus_tag LOCUS_14250 50293 51276 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529475.1 protein_id gnl|my_center|LOCUS_14250 52857 51355 gene locus_tag LOCUS_14260 gene pap 52857 51355 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_14260 54626 53016 gene locus_tag LOCUS_14270 54626 53016 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869253.1 protein_id gnl|my_center|LOCUS_14270 54845 55702 gene locus_tag LOCUS_14280 54845 55702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 55843 56850 gene locus_tag LOCUS_14290 55843 56850 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048302.1 protein_id gnl|my_center|LOCUS_14290 56967 59986 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggatcacccccgcgtgtgcggggagaag 60885 60016 gene locus_tag LOCUS_14300 gene cas2e 60885 60016 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_14300 61844 60897 gene locus_tag LOCUS_14310 gene cas1e 61844 60897 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440418.1 protein_id gnl|my_center|LOCUS_14310 62481 61837 gene locus_tag LOCUS_14320 gene cas6e 62481 61837 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_14320 63178 62483 gene locus_tag LOCUS_14330 63178 62483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 64248 63178 gene locus_tag LOCUS_14340 gene cas7e 64248 63178 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_14340 64850 64245 gene locus_tag LOCUS_14350 gene casB 64850 64245 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 protein_id gnl|my_center|LOCUS_14350 66452 64863 gene locus_tag LOCUS_14360 66452 64863 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674071.1 protein_id gnl|my_center|LOCUS_14360 69153 66439 gene locus_tag LOCUS_14370 69153 66439 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 protein_id gnl|my_center|LOCUS_14370 69394 70233 gene locus_tag LOCUS_14380 gene xerD 69394 70233 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583825.1 protein_id gnl|my_center|LOCUS_14380 71095 70664 gene locus_tag LOCUS_14390 71095 70664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 71235 72557 gene locus_tag LOCUS_14400 71235 72557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 72602 72874 gene locus_tag LOCUS_14410 72602 72874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 72855 73409 gene locus_tag LOCUS_14420 gene lepB 72855 73409 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965934.1 protein_id gnl|my_center|LOCUS_14420 73501 74517 gene locus_tag LOCUS_14430 73501 74517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 74623 75417 gene locus_tag LOCUS_14440 gene srtB 74623 75417 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989918.1 protein_id gnl|my_center|LOCUS_14440 75414 76109 gene locus_tag LOCUS_14450 75414 76109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 76750 76451 gene locus_tag LOCUS_14460 76750 76451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 77597 78202 gene locus_tag LOCUS_14470 77597 78202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 78202 78501 gene locus_tag LOCUS_14480 78202 78501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 78688 78891 gene locus_tag LOCUS_14490 78688 78891 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence11 1772 705 gene locus_tag LOCUS_14500 1772 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3313 1772 gene locus_tag LOCUS_14510 3313 1772 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_14510 5310 3310 gene locus_tag LOCUS_14520 5310 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 6125 6352 gene locus_tag LOCUS_14530 6125 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 7687 6830 gene locus_tag LOCUS_14540 gene epsE 7687 6830 CDS product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 protein_id gnl|my_center|LOCUS_14540 7904 8251 gene locus_tag LOCUS_14550 7904 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 8218 9096 gene locus_tag LOCUS_14560 8218 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14560 9297 9103 gene locus_tag LOCUS_14570 9297 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 9425 9264 gene locus_tag LOCUS_14580 9425 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 9800 9606 gene locus_tag LOCUS_14590 9800 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 9982 9818 gene locus_tag LOCUS_14600 9982 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 10356 10015 gene locus_tag LOCUS_14610 10356 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 10723 10397 gene locus_tag LOCUS_14620 10723 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 12291 11149 gene locus_tag LOCUS_14630 12291 11149 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_14630 13166 12288 gene locus_tag LOCUS_14640 13166 12288 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902062.1 protein_id gnl|my_center|LOCUS_14640 13792 13163 gene locus_tag LOCUS_14650 13792 13163 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_14650 15727 13847 gene locus_tag LOCUS_14660 15727 13847 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_14660 17079 15955 gene locus_tag LOCUS_14670 17079 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 18783 17629 gene locus_tag LOCUS_14680 gene dnaJ 18783 17629 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_14680 20717 18867 gene locus_tag LOCUS_14690 gene dnaK 20717 18867 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_14690 21414 20836 gene locus_tag LOCUS_14700 21414 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 22455 21430 gene locus_tag LOCUS_14710 gene hrcA 22455 21430 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_14710 22986 22822 gene locus_tag LOCUS_14720 22986 22822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 25337 22986 gene locus_tag LOCUS_14730 gene feoB 25337 22986 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_14730 25631 25413 gene locus_tag LOCUS_14740 25631 25413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 25740 25664 gene locus_tag LOCUS_t00270 25740 25664 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27203 25824 gene locus_tag LOCUS_14750 27203 25824 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_14750 27827 27378 gene locus_tag LOCUS_14760 27827 27378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393046.1 protein_id gnl|my_center|LOCUS_14760 28470 27913 gene locus_tag LOCUS_14770 gene efp 28470 27913 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_14770 29650 28571 gene locus_tag LOCUS_14780 gene papA 29650 28571 CDS product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 protein_id gnl|my_center|LOCUS_14780 30182 29634 gene locus_tag LOCUS_14790 30182 29634 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_14790 30483 30307 gene locus_tag LOCUS_14800 30483 30307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 30908 31300 gene locus_tag LOCUS_14810 30908 31300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 32350 31349 gene locus_tag LOCUS_14820 gene ansA 32350 31349 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_14820 33115 32633 gene locus_tag LOCUS_14830 33115 32633 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_14830 33860 33108 gene locus_tag LOCUS_14840 33860 33108 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101648.1 protein_id gnl|my_center|LOCUS_14840 34180 33857 gene locus_tag LOCUS_14850 gene hisE 34180 33857 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837137.1 protein_id gnl|my_center|LOCUS_14850 35331 34306 gene locus_tag LOCUS_14860 35331 34306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 36027 35440 gene locus_tag LOCUS_14870 gene hisB 36027 35440 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209295.1 protein_id gnl|my_center|LOCUS_14870 37118 36048 gene locus_tag LOCUS_14880 gene hisC 37118 36048 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_14880 38514 37222 gene locus_tag LOCUS_14890 gene hisD 38514 37222 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_14890 39164 38511 gene locus_tag LOCUS_14900 gene hisG 39164 38511 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_14900 40339 39161 gene locus_tag LOCUS_14910 40339 39161 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_14910 41699 40491 gene locus_tag LOCUS_14920 41699 40491 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460662.1 protein_id gnl|my_center|LOCUS_14920 46042 41726 gene locus_tag LOCUS_14930 46042 41726 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_14930 47126 46083 gene locus_tag LOCUS_14940 gene ispG 47126 46083 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_14940 48307 47216 gene locus_tag LOCUS_14950 gene rseP 48307 47216 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_14950 49486 48320 gene locus_tag LOCUS_14960 49486 48320 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_14960 50327 49506 gene locus_tag LOCUS_14970 50327 49506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 51084 50359 gene locus_tag LOCUS_14980 51084 50359 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231925.1 protein_id gnl|my_center|LOCUS_14980 51681 51127 gene locus_tag LOCUS_14990 gene frr 51681 51127 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293875.1 protein_id gnl|my_center|LOCUS_14990 52471 51761 gene locus_tag LOCUS_15000 gene pyrH 52471 51761 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_15000 52940 54157 gene locus_tag LOCUS_15010 52940 54157 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_15010 54396 55238 gene locus_tag LOCUS_15020 54396 55238 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_15020 55307 56728 gene locus_tag LOCUS_15030 gene gltA 55307 56728 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_15030 57129 56815 gene locus_tag LOCUS_15040 57129 56815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 57300 57896 gene locus_tag LOCUS_15050 57300 57896 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_15050 57920 58372 gene locus_tag LOCUS_15060 gene ybaK 57920 58372 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_15060 58945 58475 gene locus_tag LOCUS_15070 58945 58475 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014326606.1 protein_id gnl|my_center|LOCUS_15070 59447 59040 gene locus_tag LOCUS_15080 gene tagD 59447 59040 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643222.1 protein_id gnl|my_center|LOCUS_15080 61970 59505 gene locus_tag LOCUS_15090 61970 59505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 63202 61967 gene locus_tag LOCUS_15100 63202 61967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 64352 63135 gene locus_tag LOCUS_15110 64352 63135 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143333.1 protein_id gnl|my_center|LOCUS_15110 64846 65118 gene locus_tag LOCUS_15120 64846 65118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 65142 66233 gene locus_tag LOCUS_15130 65142 66233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 66324 66524 gene locus_tag LOCUS_15140 66324 66524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 66521 66775 gene locus_tag LOCUS_15150 66521 66775 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964646.1 protein_id gnl|my_center|LOCUS_15150 66775 67374 gene locus_tag LOCUS_15160 66775 67374 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_15160 67645 69438 gene locus_tag LOCUS_15170 gene fucI 67645 69438 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_15170 69460 70164 gene locus_tag LOCUS_15180 69460 70164 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_15180 71860 70262 gene locus_tag LOCUS_15190 71860 70262 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964653.1 protein_id gnl|my_center|LOCUS_15190 72928 72131 gene locus_tag LOCUS_15200 72928 72131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 73044 73856 gene locus_tag LOCUS_15210 73044 73856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 73958 74752 gene locus_tag LOCUS_15220 73958 74752 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_15220 75893 74895 gene locus_tag LOCUS_15230 75893 74895 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_15230 76092 76673 gene locus_tag LOCUS_15240 76092 76673 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811525.1 protein_id gnl|my_center|LOCUS_15240 76758 76831 gene locus_tag LOCUS_t00280 76758 76831 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 1236 94 gene locus_tag LOCUS_15250 1236 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 2442 1366 gene locus_tag LOCUS_15260 2442 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 5909 2580 gene locus_tag LOCUS_15270 5909 2580 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_15270 6149 5934 gene locus_tag LOCUS_15280 6149 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 6202 6360 gene locus_tag LOCUS_15290 6202 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 7739 6963 gene locus_tag LOCUS_15300 7739 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 8862 7726 gene locus_tag LOCUS_15310 8862 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 10453 8849 gene locus_tag LOCUS_15320 10453 8849 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_15320 10875 10669 gene locus_tag LOCUS_15330 10875 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 11074 10886 gene locus_tag LOCUS_15340 11074 10886 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_15340 11525 12091 gene locus_tag LOCUS_15350 11525 12091 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252838.1 protein_id gnl|my_center|LOCUS_15350 12078 12593 gene locus_tag LOCUS_15360 12078 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 12631 12897 gene locus_tag LOCUS_15370 12631 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 12891 13682 gene locus_tag LOCUS_15380 12891 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 13833 13745 gene locus_tag LOCUS_t00290 13833 13745 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14064 15425 gene locus_tag LOCUS_15390 14064 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 15630 16997 gene locus_tag LOCUS_15400 15630 16997 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_15400 17083 18000 gene locus_tag LOCUS_15410 17083 18000 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_15410 18103 18819 gene locus_tag LOCUS_15420 gene nagB 18103 18819 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_15420 19879 18887 gene locus_tag LOCUS_15430 19879 18887 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435617.1 protein_id gnl|my_center|LOCUS_15430 20157 23099 gene locus_tag LOCUS_15440 20157 23099 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_15440 23237 24517 gene locus_tag LOCUS_15450 23237 24517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 24591 25547 gene locus_tag LOCUS_15460 24591 25547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 26172 25669 gene locus_tag LOCUS_15470 26172 25669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 26585 26208 gene locus_tag LOCUS_15480 26585 26208 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583966.1 protein_id gnl|my_center|LOCUS_15480 27151 26582 gene locus_tag LOCUS_15490 27151 26582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 28252 27173 gene locus_tag LOCUS_15500 28252 27173 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_15500 28503 28952 gene locus_tag LOCUS_15510 28503 28952 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323417.1 protein_id gnl|my_center|LOCUS_15510 29661 29044 gene locus_tag LOCUS_15520 29661 29044 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_15520 30000 30683 gene locus_tag LOCUS_15530 30000 30683 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_15530 30680 32122 gene locus_tag LOCUS_15540 30680 32122 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822525.1 protein_id gnl|my_center|LOCUS_15540 32613 33410 gene locus_tag LOCUS_15550 32613 33410 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_15550 33407 33796 gene locus_tag LOCUS_15560 33407 33796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 33801 35789 gene locus_tag LOCUS_15570 33801 35789 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_15570 35780 36223 gene locus_tag LOCUS_15580 35780 36223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 36211 37188 gene locus_tag LOCUS_15590 36211 37188 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_15590 37192 38232 gene locus_tag LOCUS_15600 37192 38232 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_15600 38229 39089 gene locus_tag LOCUS_15610 38229 39089 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_15610 39107 39781 gene locus_tag LOCUS_15620 39107 39781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 39794 41395 gene locus_tag LOCUS_15630 39794 41395 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 protein_id gnl|my_center|LOCUS_15630 41519 42361 gene locus_tag LOCUS_15640 41519 42361 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_15640 42363 42920 gene locus_tag LOCUS_15650 42363 42920 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_15650 43018 43332 gene locus_tag LOCUS_15660 43018 43332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 43406 43573 gene locus_tag LOCUS_15670 43406 43573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 43830 44525 gene locus_tag LOCUS_15680 43830 44525 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_15680 44617 45456 gene locus_tag LOCUS_15690 44617 45456 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_15690 45841 48156 gene locus_tag LOCUS_15700 45841 48156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 48338 49267 gene locus_tag LOCUS_15710 48338 49267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 49348 50190 gene locus_tag LOCUS_15720 49348 50190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389753.1 protein_id gnl|my_center|LOCUS_15720 50201 50923 gene locus_tag LOCUS_15730 50201 50923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812647.1 protein_id gnl|my_center|LOCUS_15730 50949 51428 gene locus_tag LOCUS_15740 50949 51428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 51559 52284 gene locus_tag LOCUS_15750 51559 52284 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_15750 52340 53353 gene locus_tag LOCUS_15760 gene pgl 52340 53353 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_15760 53530 54288 gene locus_tag LOCUS_15770 53530 54288 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083169.1 protein_id gnl|my_center|LOCUS_15770 54471 55280 gene locus_tag LOCUS_15780 54471 55280 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687382.1 protein_id gnl|my_center|LOCUS_15780 55277 56404 gene locus_tag LOCUS_15790 55277 56404 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392538.1 protein_id gnl|my_center|LOCUS_15790 56430 57398 gene locus_tag LOCUS_15800 56430 57398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 57423 58205 gene locus_tag LOCUS_15810 gene phnC 57423 58205 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258841.1 protein_id gnl|my_center|LOCUS_15810 58198 58998 gene locus_tag LOCUS_15820 58198 58998 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682230.1 protein_id gnl|my_center|LOCUS_15820 58995 59864 gene locus_tag LOCUS_15830 58995 59864 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682228.1 protein_id gnl|my_center|LOCUS_15830 61057 59990 gene locus_tag LOCUS_15840 61057 59990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 61739 61122 gene locus_tag LOCUS_15850 61739 61122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 63340 61739 gene locus_tag LOCUS_15860 63340 61739 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223376.1 protein_id gnl|my_center|LOCUS_15860 63828 63607 gene locus_tag LOCUS_15870 63828 63607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 63709 64215 gene locus_tag LOCUS_15880 63709 64215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 64571 64495 gene locus_tag LOCUS_t00300 64571 64495 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 64730 65269 gene locus_tag LOCUS_15890 64730 65269 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_15890 65894 65319 gene locus_tag LOCUS_15900 65894 65319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 65895 66095 gene locus_tag LOCUS_15910 65895 66095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 66736 66080 gene locus_tag LOCUS_15920 66736 66080 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_15920 68116 66743 gene locus_tag LOCUS_15930 68116 66743 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_15930 69897 68116 gene locus_tag LOCUS_15940 69897 68116 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_15940 70235 69912 gene locus_tag LOCUS_15950 70235 69912 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_15950 71308 70346 gene locus_tag LOCUS_15960 71308 70346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 71906 71340 gene locus_tag LOCUS_15970 71906 71340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 72437 71943 gene locus_tag LOCUS_15980 72437 71943 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_15980 74454 72439 gene locus_tag LOCUS_15990 74454 72439 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_15990 74815 74504 gene locus_tag LOCUS_16000 74815 74504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence13 208 133 gene locus_tag LOCUS_t00310 208 133 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1697 363 gene locus_tag LOCUS_16010 1697 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3084 1876 gene locus_tag LOCUS_16020 3084 1876 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_16020 3400 3197 gene locus_tag LOCUS_16030 3400 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 4858 3440 gene locus_tag LOCUS_16040 4858 3440 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_16040 5669 4884 gene locus_tag LOCUS_16050 5669 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 6394 5738 gene locus_tag LOCUS_16060 6394 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 6666 7400 gene locus_tag LOCUS_16070 6666 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 7597 8889 gene locus_tag LOCUS_16080 7597 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 8913 10064 gene locus_tag LOCUS_16090 8913 10064 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_16090 10145 10696 gene locus_tag LOCUS_16100 10145 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 10718 11662 gene locus_tag LOCUS_16110 10718 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 11659 12324 gene locus_tag LOCUS_16120 11659 12324 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_16120 12471 13055 gene locus_tag LOCUS_16130 12471 13055 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879756.1 protein_id gnl|my_center|LOCUS_16130 14171 13098 gene locus_tag LOCUS_16140 14171 13098 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_16140 15984 14599 gene locus_tag LOCUS_16150 15984 14599 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_16150 16526 16272 gene locus_tag LOCUS_16160 16526 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 17103 16699 gene locus_tag LOCUS_16170 17103 16699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 17518 17093 gene locus_tag LOCUS_16180 17518 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 19567 18209 gene locus_tag LOCUS_16190 19567 18209 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_16190 19822 20889 gene locus_tag LOCUS_16200 19822 20889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 20946 21257 gene locus_tag LOCUS_16210 20946 21257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 22084 21320 gene locus_tag LOCUS_16220 22084 21320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 22311 24191 gene locus_tag LOCUS_16230 gene htpG 22311 24191 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986521.1 protein_id gnl|my_center|LOCUS_16230 24223 24966 gene locus_tag LOCUS_16240 24223 24966 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721237.1 protein_id gnl|my_center|LOCUS_16240 25007 26062 gene locus_tag LOCUS_16250 25007 26062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 26100 26528 gene locus_tag LOCUS_16260 26100 26528 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390371.1 protein_id gnl|my_center|LOCUS_16260 26589 27530 gene locus_tag LOCUS_16270 26589 27530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 28544 27606 gene locus_tag LOCUS_16280 28544 27606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 28861 30348 gene locus_tag LOCUS_16290 28861 30348 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096659.1 protein_id gnl|my_center|LOCUS_16290 30496 32427 gene locus_tag LOCUS_16300 gene tet 30496 32427 CDS product tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_16300 32511 33767 gene locus_tag LOCUS_16310 gene hflX 32511 33767 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_16310 34029 35258 gene locus_tag LOCUS_16320 34029 35258 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_16320 35426 36799 gene locus_tag LOCUS_16330 gene argH 35426 36799 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_16330 36820 37860 gene locus_tag LOCUS_16340 gene argC 36820 37860 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861435.1 protein_id gnl|my_center|LOCUS_16340 38210 39424 gene locus_tag LOCUS_16350 gene argJ 38210 39424 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_16350 39421 40296 gene locus_tag LOCUS_16360 gene argB 39421 40296 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_16360 40427 41593 gene locus_tag LOCUS_16370 40427 41593 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_16370 41642 42547 gene locus_tag LOCUS_16380 gene argF 41642 42547 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_16380 42765 43775 gene locus_tag LOCUS_16390 42765 43775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 43853 45181 gene locus_tag LOCUS_16400 43853 45181 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_16400 45381 45875 gene locus_tag LOCUS_16410 gene ruvC 45381 45875 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_16410 45942 46556 gene locus_tag LOCUS_16420 gene ruvA 45942 46556 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_16420 46575 47636 gene locus_tag LOCUS_16430 gene ruvB 46575 47636 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_16430 47717 49066 gene locus_tag LOCUS_16440 gene glmM 47717 49066 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048332.1 protein_id gnl|my_center|LOCUS_16440 49066 49947 gene locus_tag LOCUS_16450 49066 49947 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_16450 50015 50869 gene locus_tag LOCUS_16460 50015 50869 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_16460 50963 51841 gene locus_tag LOCUS_16470 50963 51841 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_16470 51838 52656 gene locus_tag LOCUS_16480 51838 52656 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_16480 52682 53455 gene locus_tag LOCUS_16490 gene truA 52682 53455 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_16490 53462 54784 gene locus_tag LOCUS_16500 53462 54784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 54825 55514 gene locus_tag LOCUS_16510 54825 55514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 55539 56210 gene locus_tag LOCUS_16520 55539 56210 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_16520 56247 58523 gene locus_tag LOCUS_16530 56247 58523 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_16530 59456 58614 gene locus_tag LOCUS_16540 59456 58614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 60195 59482 gene locus_tag LOCUS_16550 60195 59482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 61377 60427 gene locus_tag LOCUS_16560 61377 60427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 62312 61374 gene locus_tag LOCUS_16570 62312 61374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 63814 62309 gene locus_tag LOCUS_16580 63814 62309 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_16580 64506 63844 gene locus_tag LOCUS_16590 64506 63844 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_16590 65168 64710 gene locus_tag LOCUS_16600 65168 64710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence14 697 158 gene locus_tag LOCUS_16610 697 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1542 796 gene locus_tag LOCUS_16620 1542 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_16620 2663 1572 gene locus_tag LOCUS_16630 2663 1572 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978530.1 protein_id gnl|my_center|LOCUS_16630 5137 2975 gene locus_tag LOCUS_16640 5137 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 7310 5169 gene locus_tag LOCUS_16650 7310 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 10777 7310 gene locus_tag LOCUS_16660 10777 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064932.1 protein_id gnl|my_center|LOCUS_16660 11976 10981 gene locus_tag LOCUS_16670 11976 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 12571 12239 gene locus_tag LOCUS_16680 12571 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 12803 13891 gene locus_tag LOCUS_16690 12803 13891 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_16690 13986 14798 gene locus_tag LOCUS_16700 gene murI 13986 14798 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_16700 14875 15327 gene locus_tag LOCUS_16710 14875 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 15375 17063 gene locus_tag LOCUS_16720 gene argS 15375 17063 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_16720 18272 17148 gene locus_tag LOCUS_16730 18272 17148 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356149.1 protein_id gnl|my_center|LOCUS_16730 18995 18333 gene locus_tag LOCUS_16740 18995 18333 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099097343.1 protein_id gnl|my_center|LOCUS_16740 21226 18992 gene locus_tag LOCUS_16750 21226 18992 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_16750 21604 21260 gene locus_tag LOCUS_16760 21604 21260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 22905 21721 gene locus_tag LOCUS_16770 gene metK 22905 21721 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_16770 23809 23201 gene locus_tag LOCUS_16780 23809 23201 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_16780 25269 24067 gene locus_tag LOCUS_16790 gene tuf 25269 24067 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_16790 27453 25360 gene locus_tag LOCUS_16800 gene fusA 27453 25360 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_16800 27954 27484 gene locus_tag LOCUS_16810 gene rpsG 27954 27484 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137493.1 protein_id gnl|my_center|LOCUS_16810 28557 28129 gene locus_tag LOCUS_16820 gene rpsL 28557 28129 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_16820 32356 28757 gene locus_tag LOCUS_16830 gene rpoC 32356 28757 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_16830 36093 32374 gene locus_tag LOCUS_16840 gene rpoB 36093 32374 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_16840 36991 36575 gene locus_tag LOCUS_16850 36991 36575 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_16850 38106 37012 gene locus_tag LOCUS_16860 gene rpoD 38106 37012 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_16860 39935 38163 gene locus_tag LOCUS_16870 gene dnaG 39935 38163 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_16870 40965 39961 gene locus_tag LOCUS_16880 40965 39961 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_16880 41785 41162 gene locus_tag LOCUS_16890 41785 41162 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_16890 42075 41875 gene locus_tag LOCUS_16900 gene rpmE 42075 41875 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_16900 42923 42189 gene locus_tag LOCUS_16910 42923 42189 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 protein_id gnl|my_center|LOCUS_16910 43799 42936 gene locus_tag LOCUS_16920 gene vanY 43799 42936 CDS product D-Ala-D-Ala carboxypeptidase VanY-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368695.1 protein_id gnl|my_center|LOCUS_16920 44552 43917 gene locus_tag LOCUS_16930 44552 43917 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_16930 45187 44555 gene locus_tag LOCUS_16940 45187 44555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 46130 45207 gene locus_tag LOCUS_16950 46130 45207 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262588.1 protein_id gnl|my_center|LOCUS_16950 47795 46374 gene locus_tag LOCUS_16960 47795 46374 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775347.1 protein_id gnl|my_center|LOCUS_16960 48683 48015 gene locus_tag LOCUS_16970 gene upp 48683 48015 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_16970 48823 49257 gene locus_tag LOCUS_16980 48823 49257 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083256.1 protein_id gnl|my_center|LOCUS_16980 51063 49312 gene locus_tag LOCUS_16990 51063 49312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 52574 51165 gene locus_tag LOCUS_17000 52574 51165 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_17000 53121 52567 gene locus_tag LOCUS_17010 53121 52567 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438043.1 protein_id gnl|my_center|LOCUS_17010 54788 53157 gene locus_tag LOCUS_17020 54788 53157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 55864 54785 gene locus_tag LOCUS_17030 gene prfA 55864 54785 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_17030 56204 56007 gene locus_tag LOCUS_17040 56204 56007 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_17040 56861 56313 gene locus_tag LOCUS_17050 56861 56313 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391691.1 protein_id gnl|my_center|LOCUS_17050 57924 56968 gene locus_tag LOCUS_17060 57924 56968 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680895.1 protein_id gnl|my_center|LOCUS_17060 59839 58154 gene locus_tag LOCUS_17070 gene glnS 59839 58154 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287115.1 protein_id gnl|my_center|LOCUS_17070 61315 59864 gene locus_tag LOCUS_17080 gene gltX 61315 59864 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_17080 62223 61432 gene locus_tag LOCUS_17090 62223 61432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 62612 63265 gene locus_tag LOCUS_17100 62612 63265 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681526.1 protein_id gnl|my_center|LOCUS_17100 63704 63967 gene locus_tag LOCUS_17110 63704 63967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 64869 64093 gene locus_tag LOCUS_17120 64869 64093 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727676.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence15 <1 682 gene locus_tag LOCUS_17130 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002610375.1:site-specific integrase 1278 1712 gene locus_tag LOCUS_17140 1278 1712 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060880.1 protein_id gnl|my_center|LOCUS_17140 1756 2685 gene locus_tag LOCUS_17150 1756 2685 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_17150 3226 2750 gene locus_tag LOCUS_17160 3226 2750 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804034.1 protein_id gnl|my_center|LOCUS_17160 3868 3287 gene locus_tag LOCUS_17170 gene lexA 3868 3287 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 protein_id gnl|my_center|LOCUS_17170 4338 5168 gene locus_tag LOCUS_17180 4338 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 5370 6692 gene locus_tag LOCUS_17190 5370 6692 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_17190 7644 6949 gene locus_tag LOCUS_17200 7644 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 9132 7672 gene locus_tag LOCUS_17210 9132 7672 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_17210 9089 9238 gene locus_tag LOCUS_17220 9089 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 9454 10245 gene locus_tag LOCUS_17230 9454 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 11103 10405 gene locus_tag LOCUS_17240 gene pflA 11103 10405 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048195.1 protein_id gnl|my_center|LOCUS_17240 13331 11103 gene locus_tag LOCUS_17250 gene pflB 13331 11103 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964298.1 protein_id gnl|my_center|LOCUS_17250 14596 13673 gene locus_tag LOCUS_17260 14596 13673 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_17260 14839 15402 gene locus_tag LOCUS_17270 14839 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 15797 17374 gene locus_tag LOCUS_17280 15797 17374 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837625.1 protein_id gnl|my_center|LOCUS_17280 17605 18105 gene locus_tag LOCUS_17290 17605 18105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 18111 19397 gene locus_tag LOCUS_17300 18111 19397 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_17300 19437 20369 gene locus_tag LOCUS_17310 gene pyrF 19437 20369 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_17310 20391 21149 gene locus_tag LOCUS_17320 20391 21149 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345572.1 protein_id gnl|my_center|LOCUS_17320 21149 22060 gene locus_tag LOCUS_17330 21149 22060 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_17330 22143 22805 gene locus_tag LOCUS_17340 gene cobC 22143 22805 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_17340 22864 23523 gene locus_tag LOCUS_17350 gene cobC 22864 23523 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_17350 23738 24160 gene locus_tag LOCUS_17360 gene ruvX 23738 24160 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_17360 24261 25130 gene locus_tag LOCUS_17370 24261 25130 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_17370 25150 27210 gene locus_tag LOCUS_17380 25150 27210 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_17380 27214 27624 gene locus_tag LOCUS_17390 27214 27624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 27637 28275 gene locus_tag LOCUS_17400 27637 28275 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254380.1 protein_id gnl|my_center|LOCUS_17400 29544 28495 gene locus_tag LOCUS_17410 29544 28495 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_17410 29844 30905 gene locus_tag LOCUS_17420 gene uxuA 29844 30905 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_17420 31564 32901 gene locus_tag LOCUS_17430 gene mgtE 31564 32901 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_17430 32914 34284 gene locus_tag LOCUS_17440 32914 34284 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_17440 34483 36321 gene locus_tag LOCUS_17450 gene recQ 34483 36321 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272332.1 protein_id gnl|my_center|LOCUS_17450 37007 36306 gene locus_tag LOCUS_17460 gene sigK 37007 36306 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_17460 37192 37590 gene locus_tag LOCUS_17470 37192 37590 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_17470 37627 38172 gene locus_tag LOCUS_17480 37627 38172 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_17480 38426 39232 gene locus_tag LOCUS_17490 38426 39232 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_17490 39265 40581 gene locus_tag LOCUS_17500 39265 40581 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829550.1 protein_id gnl|my_center|LOCUS_17500 40661 41632 gene locus_tag LOCUS_17510 40661 41632 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_17510 42176 41736 gene locus_tag LOCUS_17520 42176 41736 CDS product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202596.1 protein_id gnl|my_center|LOCUS_17520 43457 42315 gene locus_tag LOCUS_17530 43457 42315 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_17530 43562 43933 gene locus_tag LOCUS_17540 43562 43933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 44125 45165 gene locus_tag LOCUS_17550 gene hydE 44125 45165 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_17550 45710 45249 gene locus_tag LOCUS_17560 45710 45249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 45935 46010 gene locus_tag LOCUS_t00320 45935 46010 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 46258 46929 gene locus_tag LOCUS_17570 46258 46929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_17570 46945 47151 gene locus_tag LOCUS_17580 46945 47151 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_17580 47174 48229 gene locus_tag LOCUS_17590 47174 48229 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_17590 48250 49005 gene locus_tag LOCUS_17600 48250 49005 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_17600 49002 49535 gene locus_tag LOCUS_17610 49002 49535 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_17610 49834 52629 gene locus_tag LOCUS_17620 49834 52629 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414652.1 protein_id gnl|my_center|LOCUS_17620 52756 53343 gene locus_tag LOCUS_17630 gene cobB 52756 53343 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_17630 53997 53455 gene locus_tag LOCUS_17640 53997 53455 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 protein_id gnl|my_center|LOCUS_17640 54188 56863 gene locus_tag LOCUS_17650 54188 56863 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence16 784 260 gene locus_tag LOCUS_17660 784 260 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462052.1 protein_id gnl|my_center|LOCUS_17660 1616 990 gene locus_tag LOCUS_17670 1616 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3158 1650 gene locus_tag LOCUS_17680 3158 1650 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_17680 3292 4323 gene locus_tag LOCUS_17690 3292 4323 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_17690 4654 4568 gene locus_tag LOCUS_t00330 4654 4568 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4846 6396 gene locus_tag LOCUS_17700 4846 6396 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 protein_id gnl|my_center|LOCUS_17700 6422 8539 gene locus_tag LOCUS_17710 6422 8539 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_17710 8563 9639 gene locus_tag LOCUS_17720 8563 9639 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_17720 9677 10558 gene locus_tag LOCUS_17730 9677 10558 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_17730 10670 11881 gene locus_tag LOCUS_17740 gene pepT 10670 11881 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_17740 11899 12891 gene locus_tag LOCUS_17750 gene iolU 11899 12891 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_17750 13041 13355 gene locus_tag LOCUS_17760 13041 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 13355 14014 gene locus_tag LOCUS_17770 13355 14014 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459567.1 protein_id gnl|my_center|LOCUS_17770 14130 14699 gene locus_tag LOCUS_17780 14130 14699 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459566.1 protein_id gnl|my_center|LOCUS_17780 14710 15162 gene locus_tag LOCUS_17790 gene bcp 14710 15162 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_17790 15522 15439 gene locus_tag LOCUS_t00340 15522 15439 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15684 18179 gene locus_tag LOCUS_17800 15684 18179 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_17800 19203 18232 gene locus_tag LOCUS_17810 19203 18232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 20816 19215 gene locus_tag LOCUS_17820 20816 19215 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_17820 21048 20818 gene locus_tag LOCUS_17830 21048 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 22279 21095 gene locus_tag LOCUS_17840 gene lysA 22279 21095 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880764.1 protein_id gnl|my_center|LOCUS_17840 23786 22248 gene locus_tag LOCUS_17850 23786 22248 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_17850 25533 23938 gene locus_tag LOCUS_17860 25533 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 26230 25520 gene locus_tag LOCUS_17870 26230 25520 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261248.1 protein_id gnl|my_center|LOCUS_17870 27345 26389 gene locus_tag LOCUS_17880 27345 26389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 28020 27412 gene locus_tag LOCUS_17890 28020 27412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 28525 28079 gene locus_tag LOCUS_17900 28525 28079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 28946 28862 gene locus_tag LOCUS_t00350 28946 28862 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 31368 29092 gene locus_tag LOCUS_17910 31368 29092 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027130.1 protein_id gnl|my_center|LOCUS_17910 31543 31373 gene locus_tag LOCUS_17920 31543 31373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 31767 33659 gene locus_tag LOCUS_17930 31767 33659 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459965.1 protein_id gnl|my_center|LOCUS_17930 33853 33929 gene locus_tag LOCUS_t00360 33853 33929 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 34308 34009 gene locus_tag LOCUS_17940 34308 34009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 34429 35349 gene locus_tag LOCUS_17950 34429 35349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 35346 35621 gene locus_tag LOCUS_17960 35346 35621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 35767 36228 gene locus_tag LOCUS_17970 35767 36228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 36372 37484 gene locus_tag LOCUS_17980 36372 37484 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861009.1 protein_id gnl|my_center|LOCUS_17980 37519 38433 gene locus_tag LOCUS_17990 37519 38433 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461907.1 protein_id gnl|my_center|LOCUS_17990 38487 39032 gene locus_tag LOCUS_18000 38487 39032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 39044 39232 gene locus_tag LOCUS_18010 39044 39232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 39147 43547 gene locus_tag LOCUS_18020 39147 43547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 43718 43963 gene locus_tag LOCUS_18030 43718 43963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 43968 45128 gene locus_tag LOCUS_18040 gene metK 43968 45128 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163123.1 protein_id gnl|my_center|LOCUS_18040 45147 46115 gene locus_tag LOCUS_18050 45147 46115 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_18050 46254 46877 gene locus_tag LOCUS_18060 46254 46877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 46898 47713 gene locus_tag LOCUS_18070 46898 47713 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038090.1 protein_id gnl|my_center|LOCUS_18070 47834 48160 gene locus_tag LOCUS_18080 47834 48160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 48271 48648 gene locus_tag LOCUS_18090 48271 48648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 48648 48938 gene locus_tag LOCUS_18100 48648 48938 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300557.1 protein_id gnl|my_center|LOCUS_18100 49046 49369 gene locus_tag LOCUS_18110 49046 49369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 49366 49674 gene locus_tag LOCUS_18120 49366 49674 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971035.1 protein_id gnl|my_center|LOCUS_18120 49851 50159 gene locus_tag LOCUS_18130 49851 50159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 50645 50226 gene locus_tag LOCUS_18140 50645 50226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 50604 51593 gene locus_tag LOCUS_18150 50604 51593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 51659 52408 gene locus_tag LOCUS_18160 51659 52408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 52430 53365 gene locus_tag LOCUS_18170 52430 53365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 53465 53776 gene locus_tag LOCUS_18180 53465 53776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 53996 54880 gene locus_tag LOCUS_18190 53996 54880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence17 743 108 gene locus_tag LOCUS_18200 743 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1165 1241 gene locus_tag LOCUS_t00370 1165 1241 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1524 2786 gene locus_tag LOCUS_18210 1524 2786 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 protein_id gnl|my_center|LOCUS_18210 3013 6780 gene locus_tag LOCUS_18220 3013 6780 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_18220 6852 8045 gene locus_tag LOCUS_18230 gene alr 6852 8045 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_18230 8072 8674 gene locus_tag LOCUS_18240 8072 8674 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_18240 8771 9970 gene locus_tag LOCUS_18250 8771 9970 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_18250 10764 10126 gene locus_tag LOCUS_18260 10764 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 13534 10793 gene locus_tag LOCUS_18270 gene secA 13534 10793 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_18270 14360 13890 gene locus_tag LOCUS_18280 14360 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 15465 14413 gene locus_tag LOCUS_18290 15465 14413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 15773 16351 gene locus_tag LOCUS_18300 15773 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115564.1 protein_id gnl|my_center|LOCUS_18300 16369 17202 gene locus_tag LOCUS_18310 16369 17202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 17199 18005 gene locus_tag LOCUS_18320 17199 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 18002 18760 gene locus_tag LOCUS_18330 18002 18760 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399515.1 protein_id gnl|my_center|LOCUS_18330 18783 20012 gene locus_tag LOCUS_18340 18783 20012 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_18340 20156 20941 gene locus_tag LOCUS_18350 20156 20941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 21040 21876 gene locus_tag LOCUS_18360 21040 21876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 21892 23127 gene locus_tag LOCUS_18370 21892 23127 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_18370 23311 23988 gene locus_tag LOCUS_18380 23311 23988 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_18380 24035 25039 gene locus_tag LOCUS_18390 24035 25039 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_18390 25241 26029 gene locus_tag LOCUS_18400 25241 26029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_18400 26043 28037 gene locus_tag LOCUS_18410 26043 28037 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_18410 29377 29511 gene locus_tag LOCUS_18420 29377 29511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 30940 29585 gene locus_tag LOCUS_18430 30940 29585 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_18430 31930 30965 gene locus_tag LOCUS_18440 31930 30965 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803779.1 protein_id gnl|my_center|LOCUS_18440 32358 31960 gene locus_tag LOCUS_18450 32358 31960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_18450 32617 33864 gene locus_tag LOCUS_18460 32617 33864 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_18460 33878 35182 gene locus_tag LOCUS_18470 33878 35182 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_18470 35161 35919 gene locus_tag LOCUS_18480 35161 35919 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_18480 37818 36214 gene locus_tag LOCUS_18490 37818 36214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 38156 39766 gene locus_tag LOCUS_18500 38156 39766 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896350.1 protein_id gnl|my_center|LOCUS_18500 39863 41767 gene locus_tag LOCUS_18510 39863 41767 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_18510 41922 42872 gene locus_tag LOCUS_18520 41922 42872 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_18520 42889 44028 gene locus_tag LOCUS_18530 42889 44028 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_18530 44117 45283 gene locus_tag LOCUS_18540 gene thiI 44117 45283 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_18540 45308 46561 gene locus_tag LOCUS_18550 45308 46561 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_18550 46598 47632 gene locus_tag LOCUS_18560 46598 47632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 48403 47738 gene locus_tag LOCUS_18570 48403 47738 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_18570 48753 49331 gene locus_tag LOCUS_18580 48753 49331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 49543 50694 gene locus_tag LOCUS_18590 49543 50694 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_18590 50919 52310 gene locus_tag LOCUS_18600 50919 52310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 52900 53085 gene locus_tag LOCUS_18610 52900 53085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18610 >Feature sequence18 861 397 gene locus_tag LOCUS_18620 861 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1572 1054 gene locus_tag LOCUS_18630 1572 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1767 2087 gene locus_tag LOCUS_18640 1767 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2767 2168 gene locus_tag LOCUS_18650 2767 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 3906 3379 gene locus_tag LOCUS_18660 3906 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 4266 4652 gene locus_tag LOCUS_18670 4266 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 5013 4822 gene locus_tag LOCUS_18680 5013 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5012 5206 gene locus_tag LOCUS_18690 5012 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 5755 5420 gene locus_tag LOCUS_18700 5755 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 7371 5950 gene locus_tag LOCUS_18710 7371 5950 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399787.1 protein_id gnl|my_center|LOCUS_18710 8075 7374 gene locus_tag LOCUS_18720 8075 7374 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012994104.1 protein_id gnl|my_center|LOCUS_18720 8226 8981 gene locus_tag LOCUS_18730 8226 8981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138603.1 protein_id gnl|my_center|LOCUS_18730 8978 9703 gene locus_tag LOCUS_18740 8978 9703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994320.1 protein_id gnl|my_center|LOCUS_18740 9700 10470 gene locus_tag LOCUS_18750 9700 10470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114222.1 protein_id gnl|my_center|LOCUS_18750 10476 10757 gene locus_tag LOCUS_18760 10476 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 10769 11230 gene locus_tag LOCUS_18770 10769 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 12620 11265 gene locus_tag LOCUS_18780 12620 11265 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_18780 12788 13246 gene locus_tag LOCUS_18790 12788 13246 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_18790 14388 13348 gene locus_tag LOCUS_18800 gene queA 14388 13348 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_18800 14798 15877 gene locus_tag LOCUS_18810 gene asd 14798 15877 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_18810 15902 16792 gene locus_tag LOCUS_18820 gene dapA 15902 16792 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965674.1 protein_id gnl|my_center|LOCUS_18820 16872 17624 gene locus_tag LOCUS_18830 gene dapB 16872 17624 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_18830 17643 18107 gene locus_tag LOCUS_18840 17643 18107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 18216 18298 gene locus_tag LOCUS_t00380 18216 18298 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18662 19762 gene locus_tag LOCUS_18850 18662 19762 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054224.1 protein_id gnl|my_center|LOCUS_18850 20693 19869 gene locus_tag LOCUS_18860 20693 19869 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101871.1 protein_id gnl|my_center|LOCUS_18860 20810 21130 gene locus_tag LOCUS_18870 20810 21130 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_18870 22100 21186 gene locus_tag LOCUS_18880 22100 21186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 23118 22174 gene locus_tag LOCUS_18890 23118 22174 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868018.1 protein_id gnl|my_center|LOCUS_18890 23162 23749 gene locus_tag LOCUS_18900 23162 23749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 23832 24287 gene locus_tag LOCUS_18910 23832 24287 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725020.1 protein_id gnl|my_center|LOCUS_18910 25257 24358 gene locus_tag LOCUS_18920 25257 24358 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814617.1 protein_id gnl|my_center|LOCUS_18920 26126 25254 gene locus_tag LOCUS_18930 26126 25254 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_18930 26336 26130 gene locus_tag LOCUS_18940 gene xseB 26336 26130 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428423.1 protein_id gnl|my_center|LOCUS_18940 27735 26527 gene locus_tag LOCUS_18950 gene xseA 27735 26527 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_18950 28673 27723 gene locus_tag LOCUS_18960 28673 27723 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393029.1 protein_id gnl|my_center|LOCUS_18960 29088 28666 gene locus_tag LOCUS_18970 gene nusB 29088 28666 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965384.1 protein_id gnl|my_center|LOCUS_18970 29889 29272 gene locus_tag LOCUS_18980 29889 29272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 30480 29917 gene locus_tag LOCUS_18990 30480 29917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 30966 30499 gene locus_tag LOCUS_19000 30966 30499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 32053 30959 gene locus_tag LOCUS_19010 32053 30959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 32454 32065 gene locus_tag LOCUS_19020 gene spoIIIAD 32454 32065 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_19020 32645 32451 gene locus_tag LOCUS_19030 gene spoIIIAC 32645 32451 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358967.1 protein_id gnl|my_center|LOCUS_19030 33110 32670 gene locus_tag LOCUS_19040 33110 32670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 34032 33079 gene locus_tag LOCUS_19050 gene spoIIIAA 34032 33079 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 protein_id gnl|my_center|LOCUS_19050 35682 34177 gene locus_tag LOCUS_19060 35682 34177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 36647 35769 gene locus_tag LOCUS_19070 36647 35769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 37135 36644 gene locus_tag LOCUS_19080 37135 36644 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_19080 37257 38306 gene locus_tag LOCUS_19090 gene ytvI 37257 38306 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048447.1 protein_id gnl|my_center|LOCUS_19090 39620 38340 gene locus_tag LOCUS_19100 39620 38340 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_19100 41210 39816 gene locus_tag LOCUS_19110 gene asnS 41210 39816 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432177.1 protein_id gnl|my_center|LOCUS_19110 41821 41387 gene locus_tag LOCUS_19120 41821 41387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 43278 41902 gene locus_tag LOCUS_19130 43278 41902 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_19130 44350 43538 gene locus_tag LOCUS_19140 44350 43538 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_19140 44978 44334 gene locus_tag LOCUS_19150 44978 44334 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_19150 45237 45713 gene locus_tag LOCUS_19160 45237 45713 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228454.1 protein_id gnl|my_center|LOCUS_19160 46385 45879 gene locus_tag LOCUS_19170 46385 45879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 46603 46436 gene locus_tag LOCUS_19180 46603 46436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 47130 46600 gene locus_tag LOCUS_19190 47130 46600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 47279 48868 gene locus_tag LOCUS_19200 47279 48868 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_19200 49728 48904 gene locus_tag LOCUS_19210 49728 48904 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_19210 49899 51221 gene locus_tag LOCUS_19220 gene melA 49899 51221 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence19 130 1062 gene locus_tag LOCUS_19230 130 1062 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938071.1 protein_id gnl|my_center|LOCUS_19230 1388 2164 gene locus_tag LOCUS_19240 1388 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2341 3366 gene locus_tag LOCUS_19250 2341 3366 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_19250 4292 3528 gene locus_tag LOCUS_19260 4292 3528 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_19260 4607 4311 gene locus_tag LOCUS_19270 4607 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19270 5144 4776 gene locus_tag LOCUS_19280 5144 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19280 6405 5308 gene locus_tag LOCUS_19290 6405 5308 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_19290 7603 6470 gene locus_tag LOCUS_19300 7603 6470 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066524.1 protein_id gnl|my_center|LOCUS_19300 8271 7687 gene locus_tag LOCUS_19310 8271 7687 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_19310 8541 9422 gene locus_tag LOCUS_19320 8541 9422 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_19320 10245 9628 gene locus_tag LOCUS_19330 10245 9628 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_19330 11381 10263 gene locus_tag LOCUS_19340 11381 10263 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868783.1 protein_id gnl|my_center|LOCUS_19340 12336 11395 gene locus_tag LOCUS_19350 12336 11395 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_19350 13255 12329 gene locus_tag LOCUS_19360 gene pfkB 13255 12329 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640844.1 protein_id gnl|my_center|LOCUS_19360 14800 13457 gene locus_tag LOCUS_19370 14800 13457 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948839.1 protein_id gnl|my_center|LOCUS_19370 16810 14819 gene locus_tag LOCUS_19380 16810 14819 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775735.1 protein_id gnl|my_center|LOCUS_19380 18540 16975 gene locus_tag LOCUS_19390 18540 16975 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010729380.1 protein_id gnl|my_center|LOCUS_19390 19505 18591 gene locus_tag LOCUS_19400 19505 18591 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_19400 20450 19524 gene locus_tag LOCUS_19410 20450 19524 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_19410 22606 20777 gene locus_tag LOCUS_19420 22606 20777 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_19420 24177 22603 gene locus_tag LOCUS_19430 24177 22603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 25501 24410 gene locus_tag LOCUS_19440 25501 24410 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901552.1 protein_id gnl|my_center|LOCUS_19440 27250 25670 gene locus_tag LOCUS_19450 27250 25670 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_19450 27963 27247 gene locus_tag LOCUS_19460 27963 27247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_19460 28251 29888 gene locus_tag LOCUS_19470 28251 29888 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510938.1 protein_id gnl|my_center|LOCUS_19470 30000 31229 gene locus_tag LOCUS_19480 30000 31229 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461803.1 protein_id gnl|my_center|LOCUS_19480 32334 31294 gene locus_tag LOCUS_19490 32334 31294 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 protein_id gnl|my_center|LOCUS_19490 34293 32485 gene locus_tag LOCUS_19500 gene malL 34293 32485 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_19500 35251 34493 gene locus_tag LOCUS_19510 35251 34493 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_19510 35850 35332 gene locus_tag LOCUS_19520 35850 35332 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946311.1 protein_id gnl|my_center|LOCUS_19520 36478 35909 gene locus_tag LOCUS_19530 36478 35909 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963791.1 protein_id gnl|my_center|LOCUS_19530 36637 38004 gene locus_tag LOCUS_19540 gene pepV 36637 38004 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016277.1 protein_id gnl|my_center|LOCUS_19540 38038 38712 gene locus_tag LOCUS_19550 38038 38712 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810750.1 protein_id gnl|my_center|LOCUS_19550 40165 38930 gene locus_tag LOCUS_19560 40165 38930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_19560 40867 40235 gene locus_tag LOCUS_19570 gene upp 40867 40235 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_19570 41116 40913 gene locus_tag LOCUS_19580 41116 40913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 41634 41215 gene locus_tag LOCUS_19590 41634 41215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 42134 41688 gene locus_tag LOCUS_19600 gene rpiB 42134 41688 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_19600 42838 42131 gene locus_tag LOCUS_19610 gene tsaB 42838 42131 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_19610 43311 42886 gene locus_tag LOCUS_19620 gene tsaE 43311 42886 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_19620 44983 43313 gene locus_tag LOCUS_19630 44983 43313 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_19630 45293 46489 gene locus_tag LOCUS_19640 gene rodA 45293 46489 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_19640 46491 46625 gene locus_tag LOCUS_19650 46491 46625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence20 217 798 gene locus_tag LOCUS_19660 217 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2467 941 gene locus_tag LOCUS_19670 2467 941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682071.1 protein_id gnl|my_center|LOCUS_19670 2966 3238 gene locus_tag LOCUS_19680 2966 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3359 3637 gene locus_tag LOCUS_19690 3359 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 6857 3756 gene locus_tag LOCUS_19700 6857 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 7637 7179 gene locus_tag LOCUS_19710 gene mscL 7637 7179 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_19710 7987 9585 gene locus_tag LOCUS_19720 7987 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 10584 9739 gene locus_tag LOCUS_19730 10584 9739 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355660.1 protein_id gnl|my_center|LOCUS_19730 12217 10715 gene locus_tag LOCUS_19740 gene galT 12217 10715 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_19740 12759 12313 gene locus_tag LOCUS_19750 gene rimI 12759 12313 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_19750 13218 12796 gene locus_tag LOCUS_19760 13218 12796 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583173.1 protein_id gnl|my_center|LOCUS_19760 14262 13450 gene locus_tag LOCUS_19770 gene rlmA 14262 13450 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_19770 16855 14267 gene locus_tag LOCUS_19780 gene polA 16855 14267 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_19780 17901 16915 gene locus_tag LOCUS_19790 gene dusB 17901 16915 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_19790 18608 18009 gene locus_tag LOCUS_19800 gene yfbR 18608 18009 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210283.1 protein_id gnl|my_center|LOCUS_19800 18762 21311 gene locus_tag LOCUS_19810 18762 21311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 21301 22293 gene locus_tag LOCUS_19820 21301 22293 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_19820 23337 22447 gene locus_tag LOCUS_19830 23337 22447 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_19830 24327 23356 gene locus_tag LOCUS_19840 24327 23356 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_19840 26066 24495 gene locus_tag LOCUS_19850 26066 24495 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_19850 27243 26464 gene locus_tag LOCUS_19860 27243 26464 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101759.1 protein_id gnl|my_center|LOCUS_19860 28985 27240 gene locus_tag LOCUS_19870 28985 27240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 29229 31022 gene locus_tag LOCUS_19880 29229 31022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 31009 32304 gene locus_tag LOCUS_19890 31009 32304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 32589 32389 gene locus_tag LOCUS_19900 32589 32389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 32702 33208 gene locus_tag LOCUS_19910 gene trmL 32702 33208 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_19910 33365 34663 gene locus_tag LOCUS_19920 33365 34663 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_19920 34750 35520 gene locus_tag LOCUS_19930 gene tpiA 34750 35520 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_19930 35553 37064 gene locus_tag LOCUS_19940 gene gpmI 35553 37064 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_19940 37315 37893 gene locus_tag LOCUS_19950 37315 37893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 38005 38793 gene locus_tag LOCUS_19960 38005 38793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 38843 39700 gene locus_tag LOCUS_19970 38843 39700 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551371.1 protein_id gnl|my_center|LOCUS_19970 39954 40400 gene locus_tag LOCUS_19980 39954 40400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 40397 41791 gene locus_tag LOCUS_19990 40397 41791 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_19990 41805 42464 gene locus_tag LOCUS_20000 41805 42464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 43160 42543 gene locus_tag LOCUS_20010 43160 42543 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_20010 45982 43352 gene locus_tag LOCUS_20020 45982 43352 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence21 1931 504 gene locus_tag LOCUS_20030 1931 504 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_20030 2088 2393 gene locus_tag LOCUS_20040 2088 2393 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143661.1 protein_id gnl|my_center|LOCUS_20040 3273 2512 gene locus_tag LOCUS_20050 gene hisF 3273 2512 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_20050 3896 3273 gene locus_tag LOCUS_20060 gene hisH 3896 3273 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_20060 5530 4028 gene locus_tag LOCUS_20070 gene glpK 5530 4028 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_20070 6094 5576 gene locus_tag LOCUS_20080 6094 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 6935 6150 gene locus_tag LOCUS_20090 6935 6150 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_20090 7141 7797 gene locus_tag LOCUS_20100 7141 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 9272 7878 gene locus_tag LOCUS_20110 9272 7878 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_20110 11610 9511 gene locus_tag LOCUS_20120 11610 9511 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_20120 12154 11651 gene locus_tag LOCUS_20130 12154 11651 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034532906.1 protein_id gnl|my_center|LOCUS_20130 13653 12301 gene locus_tag LOCUS_20140 13653 12301 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_20140 14373 13666 gene locus_tag LOCUS_20150 14373 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 15401 14370 gene locus_tag LOCUS_20160 15401 14370 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_20160 16436 15405 gene locus_tag LOCUS_20170 16436 15405 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_20170 16776 16528 gene locus_tag LOCUS_20180 16776 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 17357 18055 gene locus_tag LOCUS_20190 17357 18055 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668240.1 protein_id gnl|my_center|LOCUS_20190 20385 18151 gene locus_tag LOCUS_20200 gene gyrA 20385 18151 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_20200 22452 20467 gene locus_tag LOCUS_20210 gene gyrB 22452 20467 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_20210 24586 22619 gene locus_tag LOCUS_20220 gene ftsH 24586 22619 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_20220 25196 24645 gene locus_tag LOCUS_20230 gene hpt 25196 24645 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_20230 26548 25217 gene locus_tag LOCUS_20240 gene tilS 26548 25217 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_20240 27917 26538 gene locus_tag LOCUS_20250 27917 26538 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_20250 28435 27989 gene locus_tag LOCUS_20260 gene rplI 28435 27989 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_20260 30455 28479 gene locus_tag LOCUS_20270 30455 28479 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966978.1 protein_id gnl|my_center|LOCUS_20270 32523 30484 gene locus_tag LOCUS_20280 32523 30484 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_20280 32982 33770 gene locus_tag LOCUS_20290 32982 33770 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071679.1 protein_id gnl|my_center|LOCUS_20290 34187 35386 gene locus_tag LOCUS_20300 gene nifS 34187 35386 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_20300 35424 35855 gene locus_tag LOCUS_20310 gene nifU 35424 35855 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_20310 36258 36857 gene locus_tag LOCUS_20320 36258 36857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence22 1224 184 gene locus_tag LOCUS_20330 1224 184 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523473.1 protein_id gnl|my_center|LOCUS_20330 2708 1221 gene locus_tag LOCUS_20340 gene rbsA 2708 1221 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244379.1 protein_id gnl|my_center|LOCUS_20340 3849 2803 gene locus_tag LOCUS_20350 3849 2803 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533130.1 protein_id gnl|my_center|LOCUS_20350 4955 4116 gene locus_tag LOCUS_20360 4955 4116 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_20360 5635 4955 gene locus_tag LOCUS_20370 5635 4955 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582678.1 protein_id gnl|my_center|LOCUS_20370 6951 5653 gene locus_tag LOCUS_20380 6951 5653 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582679.1 protein_id gnl|my_center|LOCUS_20380 7736 7002 gene locus_tag LOCUS_20390 7736 7002 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461351.1 protein_id gnl|my_center|LOCUS_20390 8784 7723 gene locus_tag LOCUS_20400 8784 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 9072 8997 gene locus_tag LOCUS_t00390 9072 8997 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10878 9136 gene locus_tag LOCUS_20410 10878 9136 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_20410 11752 10988 gene locus_tag LOCUS_20420 11752 10988 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_20420 12473 11766 gene locus_tag LOCUS_20430 12473 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 12591 12770 gene locus_tag LOCUS_20440 12591 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 13134 12856 gene locus_tag LOCUS_20450 13134 12856 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_20450 13828 13244 gene locus_tag LOCUS_20460 gene sigH 13828 13244 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357363.1 protein_id gnl|my_center|LOCUS_20460 14026 15555 gene locus_tag LOCUS_20470 14026 15555 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_20470 19147 15635 gene locus_tag LOCUS_20480 19147 15635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 20681 19476 gene locus_tag LOCUS_20490 gene ackA 20681 19476 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_20490 20830 22020 gene locus_tag LOCUS_20500 20830 22020 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_20500 22430 22089 gene locus_tag LOCUS_20510 22430 22089 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864690.1 protein_id gnl|my_center|LOCUS_20510 23593 22523 gene locus_tag LOCUS_20520 23593 22523 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_20520 25205 23871 gene locus_tag LOCUS_20530 25205 23871 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_20530 25295 25453 gene locus_tag LOCUS_20540 25295 25453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 26464 25478 gene locus_tag LOCUS_20550 26464 25478 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592064.1 protein_id gnl|my_center|LOCUS_20550 26923 26513 gene locus_tag LOCUS_20560 26923 26513 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_20560 28206 26935 gene locus_tag LOCUS_20570 gene obgE 28206 26935 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_20570 28621 28337 gene locus_tag LOCUS_20580 gene rpmA 28621 28337 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_20580 28971 28648 gene locus_tag LOCUS_20590 28971 28648 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438074.1 protein_id gnl|my_center|LOCUS_20590 29284 28976 gene locus_tag LOCUS_20600 gene rplU 29284 28976 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048023.1 protein_id gnl|my_center|LOCUS_20600 29917 29447 gene locus_tag LOCUS_20610 29917 29447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence23 667 188 gene locus_tag LOCUS_20620 667 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1012 1929 gene locus_tag LOCUS_20630 1012 1929 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861474.1 protein_id gnl|my_center|LOCUS_20630 1926 2432 gene locus_tag LOCUS_20640 1926 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2603 3079 gene locus_tag LOCUS_20650 2603 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3098 3829 gene locus_tag LOCUS_20660 3098 3829 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229226.1 protein_id gnl|my_center|LOCUS_20660 4004 5113 gene locus_tag LOCUS_20670 gene ugpC 4004 5113 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_20670 6047 5397 gene locus_tag LOCUS_20680 6047 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 6378 7463 gene locus_tag LOCUS_20690 6378 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 7654 8514 gene locus_tag LOCUS_20700 gene ftsE 7654 8514 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_20700 8543 9454 gene locus_tag LOCUS_20710 gene ftsX 8543 9454 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_20710 9447 10571 gene locus_tag LOCUS_20720 9447 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 11611 10649 gene locus_tag LOCUS_20730 11611 10649 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_20730 12081 11608 gene locus_tag LOCUS_20740 12081 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20740 12869 12078 gene locus_tag LOCUS_20750 12869 12078 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_20750 15213 12970 gene locus_tag LOCUS_20760 15213 12970 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_20760 15327 16952 gene locus_tag LOCUS_20770 15327 16952 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_20770 16972 17457 gene locus_tag LOCUS_20780 gene ilvN 16972 17457 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_20780 17476 17652 gene locus_tag LOCUS_20790 17476 17652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 17731 18576 gene locus_tag LOCUS_20800 17731 18576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 18602 19210 gene locus_tag LOCUS_20810 18602 19210 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_20810 19288 20190 gene locus_tag LOCUS_20820 19288 20190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 20266 21090 gene locus_tag LOCUS_20830 20266 21090 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_20830 21275 23896 gene locus_tag LOCUS_20840 21275 23896 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_20840 24040 24489 gene locus_tag LOCUS_20850 24040 24489 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620148.1 protein_id gnl|my_center|LOCUS_20850 24543 25823 gene locus_tag LOCUS_20860 24543 25823 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_20860 26029 26358 gene locus_tag LOCUS_20870 gene spoIIAA 26029 26358 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_20870 26355 26798 gene locus_tag LOCUS_20880 gene spoIIAB 26355 26798 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_20880 26788 27435 gene locus_tag LOCUS_20890 gene sigF 26788 27435 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393005.1 protein_id gnl|my_center|LOCUS_20890 28126 27500 gene locus_tag LOCUS_20900 28126 27500 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943184.1 protein_id gnl|my_center|LOCUS_20900 29109 28186 gene locus_tag LOCUS_20910 gene metA 29109 28186 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121523.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence24 987 376 gene locus_tag LOCUS_20920 987 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 1261 974 gene locus_tag LOCUS_20930 1261 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 1431 2612 gene locus_tag LOCUS_20940 1431 2612 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_20940 2740 4080 gene locus_tag LOCUS_20950 2740 4080 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965968.1 protein_id gnl|my_center|LOCUS_20950 4134 4547 gene locus_tag LOCUS_20960 4134 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_20960 4723 5220 gene locus_tag LOCUS_20970 4723 5220 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 protein_id gnl|my_center|LOCUS_20970 5266 5448 gene locus_tag LOCUS_20980 gene rpmF 5266 5448 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_20980 5564 6886 gene locus_tag LOCUS_20990 5564 6886 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_20990 6900 8228 gene locus_tag LOCUS_21000 gene der 6900 8228 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965018.1 protein_id gnl|my_center|LOCUS_21000 8233 8928 gene locus_tag LOCUS_21010 gene plsY 8233 8928 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_21010 9175 10467 gene locus_tag LOCUS_21020 9175 10467 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_21020 10558 11349 gene locus_tag LOCUS_21030 10558 11349 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_21030 11358 11834 gene locus_tag LOCUS_21040 gene rlmH 11358 11834 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_21040 11853 12482 gene locus_tag LOCUS_21050 11853 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_21050 12647 13060 gene locus_tag LOCUS_21060 12647 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 14129 13284 gene locus_tag LOCUS_21070 14129 13284 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_21070 15300 14242 gene locus_tag LOCUS_21080 15300 14242 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_21080 15642 17390 gene locus_tag LOCUS_21090 15642 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 17426 18373 gene locus_tag LOCUS_21100 17426 18373 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_21100 18502 19872 gene locus_tag LOCUS_21110 18502 19872 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 protein_id gnl|my_center|LOCUS_21110 21421 20090 gene locus_tag LOCUS_21120 gene gdhA 21421 20090 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_21120 21842 23272 gene locus_tag LOCUS_21130 gene purB 21842 23272 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_21130 23357 24637 gene locus_tag LOCUS_21140 23357 24637 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921827.1 protein_id gnl|my_center|LOCUS_21140 24732 26558 gene locus_tag LOCUS_21150 gene glmS 24732 26558 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_21150 26583 28130 gene locus_tag LOCUS_21160 gene guaA 26583 28130 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence25 314 1735 gene locus_tag LOCUS_21170 314 1735 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964872.1 protein_id gnl|my_center|LOCUS_21170 1755 3275 gene locus_tag LOCUS_21180 1755 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 3308 5101 gene locus_tag LOCUS_21190 3308 5101 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_21190 5162 5407 gene locus_tag LOCUS_21200 5162 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 6403 5465 gene locus_tag LOCUS_21210 6403 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 8870 6507 gene locus_tag LOCUS_21220 8870 6507 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_21220 9699 8953 gene locus_tag LOCUS_21230 gene recO 9699 8953 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460852.1 protein_id gnl|my_center|LOCUS_21230 9886 9668 gene locus_tag LOCUS_21240 9886 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 10970 10050 gene locus_tag LOCUS_21250 gene era 10970 10050 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_21250 11554 11039 gene locus_tag LOCUS_21260 11554 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 12050 11556 gene locus_tag LOCUS_21270 gene ybeY 12050 11556 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_21270 13088 12135 gene locus_tag LOCUS_21280 13088 12135 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_21280 14594 13404 gene locus_tag LOCUS_21290 14594 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 14836 14591 gene locus_tag LOCUS_21300 14836 14591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 14924 16069 gene locus_tag LOCUS_21310 14924 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 16213 16443 gene locus_tag LOCUS_21320 16213 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 16440 17540 gene locus_tag LOCUS_21330 16440 17540 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_21330 18435 17650 gene locus_tag LOCUS_21340 18435 17650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 19217 18600 gene locus_tag LOCUS_21350 19217 18600 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_21350 20098 19232 gene locus_tag LOCUS_21360 20098 19232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_21360 20546 20172 gene locus_tag LOCUS_21370 20546 20172 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_21370 22238 20847 gene locus_tag LOCUS_21380 22238 20847 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_21380 22989 22393 gene locus_tag LOCUS_21390 gene thiT 22989 22393 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence26 77 1 gene locus_tag LOCUS_t00400 77 1 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1375 284 gene locus_tag LOCUS_21400 1375 284 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_21400 2696 1410 gene locus_tag LOCUS_21410 2696 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2956 3279 gene locus_tag LOCUS_21420 2956 3279 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 protein_id gnl|my_center|LOCUS_21420 3349 4035 gene locus_tag LOCUS_21430 3349 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 4057 5040 gene locus_tag LOCUS_21440 4057 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 5622 5143 gene locus_tag LOCUS_21450 5622 5143 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814552.1 protein_id gnl|my_center|LOCUS_21450 5933 6781 gene locus_tag LOCUS_21460 5933 6781 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287072.1 protein_id gnl|my_center|LOCUS_21460 6864 7628 gene locus_tag LOCUS_21470 6864 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 7674 9263 gene locus_tag LOCUS_21480 7674 9263 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633864.1 protein_id gnl|my_center|LOCUS_21480 9462 10019 gene locus_tag LOCUS_21490 9462 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 10073 10792 gene locus_tag LOCUS_21500 10073 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 10812 11048 gene locus_tag LOCUS_21510 10812 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 11246 11782 gene locus_tag LOCUS_21520 11246 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 12475 11906 gene locus_tag LOCUS_21530 12475 11906 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_21530 13044 12472 gene locus_tag LOCUS_21540 13044 12472 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_21540 13188 14075 gene locus_tag LOCUS_21550 13188 14075 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268352.1 protein_id gnl|my_center|LOCUS_21550 14441 15580 gene locus_tag LOCUS_21560 14441 15580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_21560 15570 16391 gene locus_tag LOCUS_21570 15570 16391 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_21570 16388 17209 gene locus_tag LOCUS_21580 16388 17209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_21580 17206 18417 gene locus_tag LOCUS_21590 17206 18417 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_21590 18649 19263 gene locus_tag LOCUS_21600 18649 19263 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_21600 19331 20872 gene locus_tag LOCUS_21610 19331 20872 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_21610 20933 22063 gene locus_tag LOCUS_21620 20933 22063 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_21620 22360 22854 gene locus_tag LOCUS_21630 22360 22854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 22854 23336 gene locus_tag LOCUS_21640 22854 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence27 23 925 gene locus_tag LOCUS_21650 23 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 1071 2282 gene locus_tag LOCUS_21660 1071 2282 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287705.1 protein_id gnl|my_center|LOCUS_21660 2645 2764 gene locus_tag LOCUS_21670 2645 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2866 5085 gene locus_tag LOCUS_21680 2866 5085 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_21680 5244 6404 gene locus_tag LOCUS_21690 5244 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 6535 6617 gene locus_tag LOCUS_r00020 6535 6617 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 69 percent of the 5S ribosomal RNA 6888 8846 gene locus_tag LOCUS_21700 6888 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 9032 9919 gene locus_tag LOCUS_21710 9032 9919 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21710 9926 10189 gene locus_tag LOCUS_21720 9926 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21720 10296 11183 gene locus_tag LOCUS_21730 10296 11183 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948434.1 protein_id gnl|my_center|LOCUS_21730 12547 11663 gene locus_tag LOCUS_21740 12547 11663 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227823.1 protein_id gnl|my_center|LOCUS_21740 12978 12544 gene locus_tag LOCUS_21750 12978 12544 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_21750 13680 13009 gene locus_tag LOCUS_21760 13680 13009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 14548 13646 gene locus_tag LOCUS_21770 14548 13646 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 protein_id gnl|my_center|LOCUS_21770 14686 14762 gene locus_tag LOCUS_t00410 14686 14762 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14766 14840 gene locus_tag LOCUS_t00420 14766 14840 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15421 15002 gene locus_tag LOCUS_21780 15421 15002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 16739 15519 gene locus_tag LOCUS_21790 16739 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 17029 17589 gene locus_tag LOCUS_21800 17029 17589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 17672 18343 gene locus_tag LOCUS_21810 17672 18343 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948496.1 protein_id gnl|my_center|LOCUS_21810 18333 19787 gene locus_tag LOCUS_21820 18333 19787 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_21820 19995 19876 gene locus_tag LOCUS_21830 19995 19876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence28 321 2957 gene locus_tag LOCUS_21840 gene ppdK 321 2957 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_21840 3133 3801 gene locus_tag LOCUS_21850 3133 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3951 4547 gene locus_tag LOCUS_21860 3951 4547 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_21860 5499 4648 gene locus_tag LOCUS_21870 5499 4648 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965690.1 protein_id gnl|my_center|LOCUS_21870 5629 7386 gene locus_tag LOCUS_21880 5629 7386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 protein_id gnl|my_center|LOCUS_21880 7383 9155 gene locus_tag LOCUS_21890 7383 9155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_21890 9411 10322 gene locus_tag LOCUS_21900 9411 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 10412 11089 gene locus_tag LOCUS_21910 10412 11089 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_21910 11086 12489 gene locus_tag LOCUS_21920 11086 12489 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_21920 12476 14014 gene locus_tag LOCUS_21930 12476 14014 CDS product DUF5605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080612.1 protein_id gnl|my_center|LOCUS_21930 14350 15387 gene locus_tag LOCUS_21940 14350 15387 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_21940 15411 16034 gene locus_tag LOCUS_21950 15411 16034 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812798.1 protein_id gnl|my_center|LOCUS_21950 17365 16187 gene locus_tag LOCUS_21960 17365 16187 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_21960 18590 17511 gene locus_tag LOCUS_21970 18590 17511 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659266.1 protein_id gnl|my_center|LOCUS_21970 19018 19416 gene locus_tag LOCUS_21980 19018 19416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 19460 19726 gene locus_tag LOCUS_21990 19460 19726 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_21990 19719 20045 gene locus_tag LOCUS_22000 19719 20045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence29 200 1150 gene locus_tag LOCUS_22010 200 1150 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_22010 1528 2886 gene locus_tag LOCUS_22020 gene rlmD 1528 2886 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 protein_id gnl|my_center|LOCUS_22020 2922 3830 gene locus_tag LOCUS_22030 2922 3830 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837152.1 protein_id gnl|my_center|LOCUS_22030 3923 4294 gene locus_tag LOCUS_22040 3923 4294 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_22040 4299 5078 gene locus_tag LOCUS_22050 4299 5078 CDS product DUF4111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100880.1 protein_id gnl|my_center|LOCUS_22050 5075 5866 gene locus_tag LOCUS_22060 5075 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 5856 7061 gene locus_tag LOCUS_22070 5856 7061 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_22070 7162 8532 gene locus_tag LOCUS_22080 7162 8532 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786787.1 protein_id gnl|my_center|LOCUS_22080 8646 9149 gene locus_tag LOCUS_22090 8646 9149 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_22090 9308 10048 gene locus_tag LOCUS_22100 9308 10048 CDS product aminoglycoside N(3)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965495.1 protein_id gnl|my_center|LOCUS_22100 10175 10816 gene locus_tag LOCUS_22110 10175 10816 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414378.1 protein_id gnl|my_center|LOCUS_22110 11494 10925 gene locus_tag LOCUS_22120 11494 10925 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080246.1 protein_id gnl|my_center|LOCUS_22120 13040 11613 gene locus_tag LOCUS_22130 gene glgA 13040 11613 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_22130 14244 13135 gene locus_tag LOCUS_22140 gene glgD 14244 13135 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_22140 15428 14244 gene locus_tag LOCUS_22150 gene glgC 15428 14244 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_22150 17500 15512 gene locus_tag LOCUS_22160 gene glgB 17500 15512 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_22160 17959 18035 gene locus_tag LOCUS_t00430 17959 18035 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence30 603 1019 gene locus_tag LOCUS_22170 603 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1209 2552 gene locus_tag LOCUS_22180 1209 2552 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_22180 2587 3000 gene locus_tag LOCUS_22190 2587 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 3585 3139 gene locus_tag LOCUS_22200 3585 3139 CDS product DUF4234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389910.1 protein_id gnl|my_center|LOCUS_22200 5039 3873 gene locus_tag LOCUS_22210 5039 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 8615 5142 gene locus_tag LOCUS_22220 gene mfd 8615 5142 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_22220 9238 8636 gene locus_tag LOCUS_22230 gene pth 9238 8636 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence31 1579 65 gene locus_tag LOCUS_22240 gene lysS 1579 65 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_22240 2130 1648 gene locus_tag LOCUS_22250 gene greA 2130 1648 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_22250 2419 3051 gene locus_tag LOCUS_22260 2419 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 3067 3840 gene locus_tag LOCUS_22270 3067 3840 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_22270 5237 3909 gene locus_tag LOCUS_22280 5237 3909 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350172.1 protein_id gnl|my_center|LOCUS_22280 6586 5255 gene locus_tag LOCUS_22290 6586 5255 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_22290 7301 6564 gene locus_tag LOCUS_22300 7301 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 8592 7441 gene locus_tag LOCUS_22310 8592 7441 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_22310 8966 8891 gene locus_tag LOCUS_t00440 8966 8891 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9047 8973 gene locus_tag LOCUS_t00450 9047 8973 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9128 9053 gene locus_tag LOCUS_t00460 9128 9053 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 198 1061 gene locus_tag LOCUS_22320 gene fba 198 1061 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_22320 1393 3009 gene locus_tag LOCUS_22330 1393 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330