>Feature sequence01 553 732 gene locus_tag LOCUS_00010 553 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2482 1151 gene locus_tag LOCUS_00020 2482 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3287 2640 gene locus_tag LOCUS_00030 3287 2640 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_00030 4815 3475 gene locus_tag LOCUS_00040 4815 3475 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_00040 5063 5497 gene locus_tag LOCUS_00050 5063 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6230 5544 gene locus_tag LOCUS_00060 6230 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8066 6537 gene locus_tag LOCUS_00070 8066 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9425 8244 gene locus_tag LOCUS_00080 9425 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10411 9488 gene locus_tag LOCUS_00090 10411 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11348 10428 gene locus_tag LOCUS_00100 11348 10428 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_00100 11528 12232 gene locus_tag LOCUS_00110 11528 12232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13744 12140 gene locus_tag LOCUS_00120 13744 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13656 13952 gene locus_tag LOCUS_00130 13656 13952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14235 14047 gene locus_tag LOCUS_00140 14235 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15920 14232 gene locus_tag LOCUS_00150 15920 14232 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_00150 16555 16310 gene locus_tag LOCUS_00160 16555 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18094 17486 gene locus_tag LOCUS_00170 18094 17486 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933650.1 protein_id gnl|my_center|LOCUS_00170 19327 18164 gene locus_tag LOCUS_00180 19327 18164 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933651.1 protein_id gnl|my_center|LOCUS_00180 20568 19420 gene locus_tag LOCUS_00190 20568 19420 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667821.1 protein_id gnl|my_center|LOCUS_00190 20971 20762 gene locus_tag LOCUS_00200 gene rpmE 20971 20762 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_00200 23180 21045 gene locus_tag LOCUS_00210 gene rho 23180 21045 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668994.1 protein_id gnl|my_center|LOCUS_00210 24716 23328 gene locus_tag LOCUS_00220 24716 23328 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_00220 26487 24709 gene locus_tag LOCUS_00230 gene lnt 26487 24709 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679415.1 protein_id gnl|my_center|LOCUS_00230 26813 26505 gene locus_tag LOCUS_00240 26813 26505 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655986.1 protein_id gnl|my_center|LOCUS_00240 27091 26834 gene locus_tag LOCUS_00250 gene rpsT 27091 26834 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_00250 27305 27583 gene locus_tag LOCUS_00260 27305 27583 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_00260 28759 27605 gene locus_tag LOCUS_00270 28759 27605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29055 28981 gene locus_tag LOCUS_t00010 29055 28981 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30434 29232 gene locus_tag LOCUS_00280 30434 29232 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_00280 31388 30438 gene locus_tag LOCUS_00290 31388 30438 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723154.1 protein_id gnl|my_center|LOCUS_00290 31707 32276 gene locus_tag LOCUS_00300 31707 32276 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_00300 32273 33337 gene locus_tag LOCUS_00310 gene prfA 32273 33337 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680455.1 protein_id gnl|my_center|LOCUS_00310 33334 34263 gene locus_tag LOCUS_00320 gene prmC 33334 34263 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_00320 34302 36347 gene locus_tag LOCUS_00330 34302 36347 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508136.1 protein_id gnl|my_center|LOCUS_00330 36433 36876 gene locus_tag LOCUS_00340 gene rpiB 36433 36876 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_00340 37391 37558 gene locus_tag LOCUS_00350 37391 37558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39110 37638 gene locus_tag LOCUS_00360 39110 37638 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068837.1 protein_id gnl|my_center|LOCUS_00360 39728 39171 gene locus_tag LOCUS_00370 39728 39171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 40290 39751 gene locus_tag LOCUS_00380 40290 39751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 41528 40293 gene locus_tag LOCUS_00390 41528 40293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41473 41667 gene locus_tag LOCUS_00400 41473 41667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42529 41654 gene locus_tag LOCUS_00410 42529 41654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43953 42559 gene locus_tag LOCUS_00420 gene hydA 43953 42559 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393493.1 protein_id gnl|my_center|LOCUS_00420 45492 44050 gene locus_tag LOCUS_00430 gene gcvPB 45492 44050 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_00430 46841 45489 gene locus_tag LOCUS_00440 gene gcvPA 46841 45489 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_00440 47230 46850 gene locus_tag LOCUS_00450 gene gcvH 47230 46850 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703428.1 protein_id gnl|my_center|LOCUS_00450 48795 47254 gene locus_tag LOCUS_00460 48795 47254 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680713.1 protein_id gnl|my_center|LOCUS_00460 48960 48829 gene locus_tag LOCUS_00470 48960 48829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 49202 49420 gene locus_tag LOCUS_00480 gene infA 49202 49420 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556767.1 protein_id gnl|my_center|LOCUS_00480 49757 51694 gene locus_tag LOCUS_00490 49757 51694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52470 51898 gene locus_tag LOCUS_00500 52470 51898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 53775 52483 gene locus_tag LOCUS_00510 53775 52483 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927762.1 protein_id gnl|my_center|LOCUS_00510 55170 53896 gene locus_tag LOCUS_00520 55170 53896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 56613 55186 gene locus_tag LOCUS_00530 56613 55186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 57465 56713 gene locus_tag LOCUS_00540 gene zupT 57465 56713 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811500.1 protein_id gnl|my_center|LOCUS_00540 58642 57494 gene locus_tag LOCUS_00550 58642 57494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072975.1 protein_id gnl|my_center|LOCUS_00550 59279 58716 gene locus_tag LOCUS_00560 59279 58716 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 protein_id gnl|my_center|LOCUS_00560 60592 59408 gene locus_tag LOCUS_00570 60592 59408 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966572.1 protein_id gnl|my_center|LOCUS_00570 61841 60747 gene locus_tag LOCUS_00580 gene ugpC 61841 60747 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_00580 62124 63296 gene locus_tag LOCUS_00590 62124 63296 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_00590 64858 63299 gene locus_tag LOCUS_00600 64858 63299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 65986 64883 gene locus_tag LOCUS_00610 65986 64883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_00610 67709 65988 gene locus_tag LOCUS_00620 67709 65988 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016301.1 protein_id gnl|my_center|LOCUS_00620 68788 67706 gene locus_tag LOCUS_00630 68788 67706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_00630 69968 68925 gene locus_tag LOCUS_00640 69968 68925 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626531.1 protein_id gnl|my_center|LOCUS_00640 70174 72423 gene locus_tag LOCUS_00650 70174 72423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 73465 72401 gene locus_tag LOCUS_00660 73465 72401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 73944 74129 gene locus_tag LOCUS_00670 73944 74129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 74543 74160 gene locus_tag LOCUS_00680 74543 74160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 76495 74837 gene locus_tag LOCUS_00690 76495 74837 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896074.1 protein_id gnl|my_center|LOCUS_00690 77591 76503 gene locus_tag LOCUS_00700 77591 76503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902588.1 protein_id gnl|my_center|LOCUS_00700 78756 77713 gene locus_tag LOCUS_00710 78756 77713 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636730.1 protein_id gnl|my_center|LOCUS_00710 79707 78793 gene locus_tag LOCUS_00720 79707 78793 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_00720 80664 79726 gene locus_tag LOCUS_00730 80664 79726 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_00730 81472 80654 gene locus_tag LOCUS_00740 81472 80654 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421354.1 protein_id gnl|my_center|LOCUS_00740 82376 81510 gene locus_tag LOCUS_00750 gene fba 82376 81510 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_00750 82546 83328 gene locus_tag LOCUS_00760 82546 83328 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_00760 83986 84198 gene locus_tag LOCUS_00770 83986 84198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 84264 85046 gene locus_tag LOCUS_00780 84264 85046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 85640 85335 gene locus_tag LOCUS_00790 85640 85335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 87252 85948 gene locus_tag LOCUS_00800 87252 85948 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_00800 87674 87408 gene locus_tag LOCUS_00810 87674 87408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 87908 87825 gene locus_tag LOCUS_t00020 87908 87825 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 88373 89725 gene locus_tag LOCUS_00820 88373 89725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 90759 90508 gene locus_tag LOCUS_00830 90759 90508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 90976 91236 gene locus_tag LOCUS_00840 90976 91236 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681231.1 protein_id gnl|my_center|LOCUS_00840 91229 91531 gene locus_tag LOCUS_00850 91229 91531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 91595 94189 gene locus_tag LOCUS_00860 gene pulA 91595 94189 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167510.1 protein_id gnl|my_center|LOCUS_00860 94400 95164 gene locus_tag LOCUS_00870 94400 95164 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_00870 95247 96068 gene locus_tag LOCUS_00880 95247 96068 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944016.1 protein_id gnl|my_center|LOCUS_00880 96061 96804 gene locus_tag LOCUS_00890 96061 96804 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137994.1 protein_id gnl|my_center|LOCUS_00890 97053 97646 gene locus_tag LOCUS_00900 97053 97646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 97658 98827 gene locus_tag LOCUS_00910 97658 98827 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_00910 99333 98944 gene locus_tag LOCUS_00920 99333 98944 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_00920 99635 99483 gene locus_tag LOCUS_00930 99635 99483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00930 101228 99672 gene locus_tag LOCUS_00940 101228 99672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00940 102504 101512 gene locus_tag LOCUS_00950 102504 101512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_00950 103562 102501 gene locus_tag LOCUS_00960 103562 102501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_00960 104684 103572 gene locus_tag LOCUS_00970 104684 103572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_00970 105605 104694 gene locus_tag LOCUS_00980 105605 104694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_00980 107210 105837 gene locus_tag LOCUS_00990 107210 105837 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_00990 107755 107285 gene locus_tag LOCUS_01000 107755 107285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 107862 108515 gene locus_tag LOCUS_01010 107862 108515 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_01010 108621 109244 gene locus_tag LOCUS_01020 108621 109244 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296332.1 protein_id gnl|my_center|LOCUS_01020 109251 109823 gene locus_tag LOCUS_01030 109251 109823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 110825 110301 gene locus_tag LOCUS_01040 110825 110301 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_01040 111238 111756 gene locus_tag LOCUS_01050 111238 111756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 113966 111750 gene locus_tag LOCUS_01060 113966 111750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 114470 114045 gene locus_tag LOCUS_01070 114470 114045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 115688 114474 gene locus_tag LOCUS_01080 115688 114474 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_01080 116559 115783 gene locus_tag LOCUS_01090 116559 115783 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_01090 116674 118092 gene locus_tag LOCUS_01100 116674 118092 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_01100 118070 119602 gene locus_tag LOCUS_01110 118070 119602 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681233.1 protein_id gnl|my_center|LOCUS_01110 121222 119774 gene locus_tag LOCUS_01120 121222 119774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 122267 121458 gene locus_tag LOCUS_01130 122267 121458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 123129 122272 gene locus_tag LOCUS_01140 123129 122272 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944383.1 protein_id gnl|my_center|LOCUS_01140 123287 123700 gene locus_tag LOCUS_01150 123287 123700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 123697 124338 gene locus_tag LOCUS_01160 123697 124338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 124331 125056 gene locus_tag LOCUS_01170 gene lptB 124331 125056 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681841.1 protein_id gnl|my_center|LOCUS_01170 125117 126565 gene locus_tag LOCUS_01180 gene rpoN 125117 126565 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054367.1 protein_id gnl|my_center|LOCUS_01180 127696 126659 gene locus_tag LOCUS_01190 127696 126659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 128328 127699 gene locus_tag LOCUS_01200 gene lexA 128328 127699 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_01200 128560 129903 gene locus_tag LOCUS_01210 128560 129903 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_01210 130022 130318 gene locus_tag LOCUS_01220 130022 130318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 130428 131882 gene locus_tag LOCUS_01230 130428 131882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 133198 132023 gene locus_tag LOCUS_01240 133198 132023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 135845 134007 gene locus_tag LOCUS_01250 135845 134007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 137773 135869 gene locus_tag LOCUS_01260 137773 135869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 138681 137770 gene locus_tag LOCUS_01270 138681 137770 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_01270 139757 138684 gene locus_tag LOCUS_01280 139757 138684 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476099.1 protein_id gnl|my_center|LOCUS_01280 140689 139754 gene locus_tag LOCUS_01290 140689 139754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 141653 140682 gene locus_tag LOCUS_01300 141653 140682 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_01300 142790 141660 gene locus_tag LOCUS_01310 142790 141660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 143727 142780 gene locus_tag LOCUS_01320 143727 142780 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101286.1 protein_id gnl|my_center|LOCUS_01320 143947 145053 gene locus_tag LOCUS_01330 143947 145053 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_01330 145904 145050 gene locus_tag LOCUS_01340 145904 145050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 146970 146596 gene locus_tag LOCUS_01350 146970 146596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 148904 147738 gene locus_tag LOCUS_01360 148904 147738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 149446 148892 gene locus_tag LOCUS_01370 149446 148892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 150595 149537 gene locus_tag LOCUS_01380 150595 149537 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_01380 150866 151051 gene locus_tag LOCUS_01390 150866 151051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 152325 150964 gene locus_tag LOCUS_01400 152325 150964 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_01400 153713 152457 gene locus_tag LOCUS_01410 153713 152457 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_01410 154389 155366 gene locus_tag LOCUS_01420 154389 155366 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262593.1 protein_id gnl|my_center|LOCUS_01420 156269 155433 gene locus_tag LOCUS_01430 156269 155433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 157099 156266 gene locus_tag LOCUS_01440 157099 156266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 158501 157110 gene locus_tag LOCUS_01450 158501 157110 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_01450 158616 160511 gene locus_tag LOCUS_01460 158616 160511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 162240 160678 gene locus_tag LOCUS_01470 162240 160678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 163892 162366 gene locus_tag LOCUS_01480 163892 162366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 165704 163953 gene locus_tag LOCUS_01490 165704 163953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 166636 165863 gene locus_tag LOCUS_01500 gene rlmB 166636 165863 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679077.1 protein_id gnl|my_center|LOCUS_01500 167807 166683 gene locus_tag LOCUS_01510 gene dnaJ 167807 166683 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002686888.1 protein_id gnl|my_center|LOCUS_01510 169966 168035 gene locus_tag LOCUS_01520 gene dnaK 169966 168035 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681815.1 protein_id gnl|my_center|LOCUS_01520 170704 170078 gene locus_tag LOCUS_01530 170704 170078 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681814.1 protein_id gnl|my_center|LOCUS_01530 171997 170777 gene locus_tag LOCUS_01540 171997 170777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 172707 171997 gene locus_tag LOCUS_01550 172707 171997 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 protein_id gnl|my_center|LOCUS_01550 174334 172718 gene locus_tag LOCUS_01560 gene der 174334 172718 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680939.1 protein_id gnl|my_center|LOCUS_01560 174456 175058 gene locus_tag LOCUS_01570 174456 175058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 175147 175839 gene locus_tag LOCUS_01580 175147 175839 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_01580 175805 176443 gene locus_tag LOCUS_01590 175805 176443 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_01590 177311 176496 gene locus_tag LOCUS_01600 177311 176496 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_01600 178113 177328 gene locus_tag LOCUS_01610 178113 177328 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_01610 179663 178131 gene locus_tag LOCUS_01620 gene rny 179663 178131 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681149.1 protein_id gnl|my_center|LOCUS_01620 180403 179999 gene locus_tag LOCUS_01630 180403 179999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 181445 180393 gene locus_tag LOCUS_01640 181445 180393 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682041.1 protein_id gnl|my_center|LOCUS_01640 182210 181569 gene locus_tag LOCUS_01650 gene rpsD 182210 181569 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_01650 182611 182228 gene locus_tag LOCUS_01660 gene rpsK 182611 182228 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670039.1 protein_id gnl|my_center|LOCUS_01660 182987 182622 gene locus_tag LOCUS_01670 gene rpsM 182987 182622 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670034.1 protein_id gnl|my_center|LOCUS_01670 184466 183135 gene locus_tag LOCUS_01680 gene secY 184466 183135 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670031.1 protein_id gnl|my_center|LOCUS_01680 184913 184482 gene locus_tag LOCUS_01690 gene rplO 184913 184482 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682039.1 protein_id gnl|my_center|LOCUS_01690 185097 184915 gene locus_tag LOCUS_01700 gene rpmD 185097 184915 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129921.1 protein_id gnl|my_center|LOCUS_01700 185619 185101 gene locus_tag LOCUS_01710 gene rpsE 185619 185101 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670027.1 protein_id gnl|my_center|LOCUS_01710 185989 185630 gene locus_tag LOCUS_01720 gene rplR 185989 185630 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670026.1 protein_id gnl|my_center|LOCUS_01720 186543 186004 gene locus_tag LOCUS_01730 gene rplF 186543 186004 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_01730 186954 186556 gene locus_tag LOCUS_01740 gene rpsH 186954 186556 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670022.1 protein_id gnl|my_center|LOCUS_01740 187150 186965 gene locus_tag LOCUS_01750 187150 186965 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557082.1 protein_id gnl|my_center|LOCUS_01750 187716 187162 gene locus_tag LOCUS_01760 gene rplE 187716 187162 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670018.1 protein_id gnl|my_center|LOCUS_01760 188024 187716 gene locus_tag LOCUS_01770 gene rplX 188024 187716 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_01770 188400 188035 gene locus_tag LOCUS_01780 gene rplN 188400 188035 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670011.1 protein_id gnl|my_center|LOCUS_01780 188663 188412 gene locus_tag LOCUS_01790 gene rpsQ 188663 188412 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670009.1 protein_id gnl|my_center|LOCUS_01790 188878 188675 gene locus_tag LOCUS_01800 gene rpmC 188878 188675 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557077.1 protein_id gnl|my_center|LOCUS_01800 189297 188875 gene locus_tag LOCUS_01810 gene rplP 189297 188875 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_01810 190024 189311 gene locus_tag LOCUS_01820 gene rpsC 190024 189311 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670002.1 protein_id gnl|my_center|LOCUS_01820 190379 190029 gene locus_tag LOCUS_01830 gene rplV 190379 190029 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670000.1 protein_id gnl|my_center|LOCUS_01830 190663 190391 gene locus_tag LOCUS_01840 gene rpsS 190663 190391 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669999.1 protein_id gnl|my_center|LOCUS_01840 191498 190674 gene locus_tag LOCUS_01850 gene rplB 191498 190674 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669998.1 protein_id gnl|my_center|LOCUS_01850 191812 191510 gene locus_tag LOCUS_01860 gene rplW 191812 191510 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_01860 192450 191824 gene locus_tag LOCUS_01870 gene rplD 192450 191824 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669996.1 protein_id gnl|my_center|LOCUS_01870 193075 192461 gene locus_tag LOCUS_01880 gene rplC 193075 192461 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669995.1 protein_id gnl|my_center|LOCUS_01880 193395 193087 gene locus_tag LOCUS_01890 gene rpsJ 193395 193087 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669994.1 protein_id gnl|my_center|LOCUS_01890 194650 193460 gene locus_tag LOCUS_01900 gene tuf 194650 193460 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669993.1 protein_id gnl|my_center|LOCUS_01900 195769 195065 gene locus_tag LOCUS_01910 195769 195065 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_01910 196944 196474 gene locus_tag LOCUS_01920 gene rpsG 196944 196474 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670537.1 protein_id gnl|my_center|LOCUS_01920 197334 196960 gene locus_tag LOCUS_01930 gene rpsL 197334 196960 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670535.1 protein_id gnl|my_center|LOCUS_01930 201853 197504 gene locus_tag LOCUS_01940 gene rpoC 201853 197504 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680359.1 protein_id gnl|my_center|LOCUS_01940 205356 201850 gene locus_tag LOCUS_01950 gene rpoB 205356 201850 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680361.1 protein_id gnl|my_center|LOCUS_01950 205852 205475 gene locus_tag LOCUS_01960 gene rplL 205852 205475 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707702.1 protein_id gnl|my_center|LOCUS_01960 206459 205923 gene locus_tag LOCUS_01970 206459 205923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 207155 206475 gene locus_tag LOCUS_01980 gene rplA 207155 206475 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667601.1 protein_id gnl|my_center|LOCUS_01980 207583 207152 gene locus_tag LOCUS_01990 gene rplK 207583 207152 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667599.1 protein_id gnl|my_center|LOCUS_01990 208421 207861 gene locus_tag LOCUS_02000 gene nusG 208421 207861 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667597.1 protein_id gnl|my_center|LOCUS_02000 208621 208442 gene locus_tag LOCUS_02010 208621 208442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 208721 208646 gene locus_tag LOCUS_t00030 208721 208646 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 208924 208748 gene locus_tag LOCUS_02020 gene rpmG 208924 208748 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667594.1 protein_id gnl|my_center|LOCUS_02020 209063 208991 gene locus_tag LOCUS_t00040 209063 208991 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 209388 211913 gene locus_tag LOCUS_02030 209388 211913 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 protein_id gnl|my_center|LOCUS_02030 211934 212578 gene locus_tag LOCUS_02040 gene mocA 211934 212578 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272828.1 protein_id gnl|my_center|LOCUS_02040 215136 212557 gene locus_tag LOCUS_02050 gene clpB 215136 212557 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680241.1 protein_id gnl|my_center|LOCUS_02050 215287 215877 gene locus_tag LOCUS_02060 215287 215877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 <216600 215891 gene locus_tag LOCUS_02070 <216600 215891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002358584.1:ABC transporter ATP-binding protein >Feature sequence02 1425 181 gene locus_tag LOCUS_02080 1425 181 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_02080 3277 1439 gene locus_tag LOCUS_02090 3277 1439 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_02090 3572 3297 gene locus_tag LOCUS_02100 3572 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 3795 4709 gene locus_tag LOCUS_02110 3795 4709 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_02110 4737 5369 gene locus_tag LOCUS_02120 4737 5369 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_02120 7990 5612 gene locus_tag LOCUS_02130 7990 5612 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679111.1 protein_id gnl|my_center|LOCUS_02130 8120 8193 gene locus_tag LOCUS_t00050 8120 8193 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10122 8686 gene locus_tag LOCUS_02140 10122 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 10585 11601 gene locus_tag LOCUS_02150 10585 11601 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339569.1 protein_id gnl|my_center|LOCUS_02150 11674 13173 gene locus_tag LOCUS_02160 11674 13173 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974214.1 protein_id gnl|my_center|LOCUS_02160 13186 14217 gene locus_tag LOCUS_02170 13186 14217 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974215.1 protein_id gnl|my_center|LOCUS_02170 14214 15197 gene locus_tag LOCUS_02180 14214 15197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389954.1 protein_id gnl|my_center|LOCUS_02180 15270 16271 gene locus_tag LOCUS_02190 gene cytR 15270 16271 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216730.1 protein_id gnl|my_center|LOCUS_02190 16283 17113 gene locus_tag LOCUS_02200 16283 17113 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339537.1 protein_id gnl|my_center|LOCUS_02200 17132 17635 gene locus_tag LOCUS_02210 17132 17635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 17652 18587 gene locus_tag LOCUS_02220 gene rbsK 17652 18587 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693668.1 protein_id gnl|my_center|LOCUS_02220 18778 19077 gene locus_tag LOCUS_02230 18778 19077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 19156 19857 gene locus_tag LOCUS_02240 19156 19857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 21315 19942 gene locus_tag LOCUS_02250 gene mgtE 21315 19942 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_02250 22222 21665 gene locus_tag LOCUS_02260 22222 21665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 22331 23596 gene locus_tag LOCUS_02270 22331 23596 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_02270 24551 23586 gene locus_tag LOCUS_02280 24551 23586 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949162.1 protein_id gnl|my_center|LOCUS_02280 25588 24548 gene locus_tag LOCUS_02290 25588 24548 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_02290 27332 25626 gene locus_tag LOCUS_02300 gene pheT 27332 25626 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957104.1 protein_id gnl|my_center|LOCUS_02300 28870 27332 gene locus_tag LOCUS_02310 28870 27332 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680967.1 protein_id gnl|my_center|LOCUS_02310 29122 31227 gene locus_tag LOCUS_02320 gene fusA 29122 31227 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_02320 31398 32105 gene locus_tag LOCUS_02330 31398 32105 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670541.1 protein_id gnl|my_center|LOCUS_02330 34076 32664 gene locus_tag LOCUS_02340 gene malQ 34076 32664 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941842.1 protein_id gnl|my_center|LOCUS_02340 34301 34801 gene locus_tag LOCUS_02350 34301 34801 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680200.1 protein_id gnl|my_center|LOCUS_02350 34807 35628 gene locus_tag LOCUS_02360 34807 35628 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680203.1 protein_id gnl|my_center|LOCUS_02360 35625 36119 gene locus_tag LOCUS_02370 gene ispF 35625 36119 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951155.1 protein_id gnl|my_center|LOCUS_02370 36667 37707 gene locus_tag LOCUS_02380 36667 37707 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964264.1 protein_id gnl|my_center|LOCUS_02380 39162 37726 gene locus_tag LOCUS_02390 39162 37726 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957136.1 protein_id gnl|my_center|LOCUS_02390 39230 40006 gene locus_tag LOCUS_02400 39230 40006 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680775.1 protein_id gnl|my_center|LOCUS_02400 40019 41242 gene locus_tag LOCUS_02410 gene arcA 40019 41242 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681549.1 protein_id gnl|my_center|LOCUS_02410 42262 41333 gene locus_tag LOCUS_02420 42262 41333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 43579 42374 gene locus_tag LOCUS_02430 43579 42374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 43724 45598 gene locus_tag LOCUS_02440 gene uvrC 43724 45598 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657940.1 protein_id gnl|my_center|LOCUS_02440 45860 46663 gene locus_tag LOCUS_02450 45860 46663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 46696 47943 gene locus_tag LOCUS_02460 46696 47943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 47944 49146 gene locus_tag LOCUS_02470 47944 49146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 49181 50905 gene locus_tag LOCUS_02480 49181 50905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 52196 50883 gene locus_tag LOCUS_02490 gene purD 52196 50883 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880448.1 protein_id gnl|my_center|LOCUS_02490 53222 52242 gene locus_tag LOCUS_02500 gene dusB 53222 52242 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680788.1 protein_id gnl|my_center|LOCUS_02500 54007 53231 gene locus_tag LOCUS_02510 54007 53231 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680785.1 protein_id gnl|my_center|LOCUS_02510 54316 54990 gene locus_tag LOCUS_02520 54316 54990 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_02520 55032 55820 gene locus_tag LOCUS_02530 gene nagB 55032 55820 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_02530 55960 57498 gene locus_tag LOCUS_02540 55960 57498 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803820.1 protein_id gnl|my_center|LOCUS_02540 57639 58583 gene locus_tag LOCUS_02550 57639 58583 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_02550 58600 59478 gene locus_tag LOCUS_02560 58600 59478 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_02560 59493 60632 gene locus_tag LOCUS_02570 gene anmK 59493 60632 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_02570 60690 61829 gene locus_tag LOCUS_02580 60690 61829 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_02580 61871 63427 gene locus_tag LOCUS_02590 gene nagZ 61871 63427 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_02590 63420 63902 gene locus_tag LOCUS_02600 63420 63902 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393956.1 protein_id gnl|my_center|LOCUS_02600 65149 63980 gene locus_tag LOCUS_02610 65149 63980 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_02610 65267 66748 gene locus_tag LOCUS_02620 65267 66748 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479097.1 protein_id gnl|my_center|LOCUS_02620 66913 67089 gene locus_tag LOCUS_02630 66913 67089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 67176 68666 gene locus_tag LOCUS_02640 67176 68666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 69237 68914 gene locus_tag LOCUS_02650 gene trxA 69237 68914 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_02650 69592 69978 gene locus_tag LOCUS_02660 69592 69978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 70370 71371 gene locus_tag LOCUS_02670 70370 71371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 71564 72841 gene locus_tag LOCUS_02680 71564 72841 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667047.1 protein_id gnl|my_center|LOCUS_02680 72890 74086 gene locus_tag LOCUS_02690 72890 74086 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_02690 74765 74211 gene locus_tag LOCUS_02700 74765 74211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 74867 76834 gene locus_tag LOCUS_02710 74867 76834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 76831 77460 gene locus_tag LOCUS_02720 76831 77460 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205944.1 protein_id gnl|my_center|LOCUS_02720 77973 77452 gene locus_tag LOCUS_02730 77973 77452 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_02730 78530 77988 gene locus_tag LOCUS_02740 78530 77988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 78709 80703 gene locus_tag LOCUS_02750 78709 80703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 80727 81296 gene locus_tag LOCUS_02760 80727 81296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 81299 82180 gene locus_tag LOCUS_02770 81299 82180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 82351 83148 gene locus_tag LOCUS_02780 82351 83148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 83881 83159 gene locus_tag LOCUS_02790 83881 83159 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088392.1 protein_id gnl|my_center|LOCUS_02790 84612 83878 gene locus_tag LOCUS_02800 84612 83878 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528577.1 protein_id gnl|my_center|LOCUS_02800 84922 85818 gene locus_tag LOCUS_02810 84922 85818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 85820 86776 gene locus_tag LOCUS_02820 85820 86776 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889314.1 protein_id gnl|my_center|LOCUS_02820 86801 87718 gene locus_tag LOCUS_02830 gene dapA 86801 87718 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933288.1 protein_id gnl|my_center|LOCUS_02830 87731 88693 gene locus_tag LOCUS_02840 87731 88693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 88690 89520 gene locus_tag LOCUS_02850 gene frlC 88690 89520 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847833.1 protein_id gnl|my_center|LOCUS_02850 89549 91051 gene locus_tag LOCUS_02860 89549 91051 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903566.1 protein_id gnl|my_center|LOCUS_02860 91126 92241 gene locus_tag LOCUS_02870 91126 92241 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269064.1 protein_id gnl|my_center|LOCUS_02870 92269 93057 gene locus_tag LOCUS_02880 92269 93057 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_02880 94820 93066 gene locus_tag LOCUS_02890 94820 93066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_02890 96613 94817 gene locus_tag LOCUS_02900 96613 94817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 protein_id gnl|my_center|LOCUS_02900 96685 97935 gene locus_tag LOCUS_02910 gene pepT 96685 97935 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 protein_id gnl|my_center|LOCUS_02910 97951 98598 gene locus_tag LOCUS_02920 97951 98598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 98595 100022 gene locus_tag LOCUS_02930 98595 100022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 100015 102948 gene locus_tag LOCUS_02940 100015 102948 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665373.1 protein_id gnl|my_center|LOCUS_02940 102994 104496 gene locus_tag LOCUS_02950 gene glpK 102994 104496 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_02950 104501 105307 gene locus_tag LOCUS_02960 gene cdaA 104501 105307 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669723.1 protein_id gnl|my_center|LOCUS_02960 105294 105713 gene locus_tag LOCUS_02970 105294 105713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 105710 106099 gene locus_tag LOCUS_02980 105710 106099 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_02980 106092 106940 gene locus_tag LOCUS_02990 gene truA 106092 106940 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_02990 106930 107757 gene locus_tag LOCUS_03000 106930 107757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 107839 109809 gene locus_tag LOCUS_03010 gene priA 107839 109809 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680463.1 protein_id gnl|my_center|LOCUS_03010 109823 110365 gene locus_tag LOCUS_03020 gene def 109823 110365 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669259.1 protein_id gnl|my_center|LOCUS_03020 110367 111368 gene locus_tag LOCUS_03030 gene fmt 110367 111368 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679327.1 protein_id gnl|my_center|LOCUS_03030 111490 112461 gene locus_tag LOCUS_03040 111490 112461 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_03040 112609 113376 gene locus_tag LOCUS_03050 gene fkpA 112609 113376 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_03050 113446 114057 gene locus_tag LOCUS_03060 113446 114057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 114902 114105 gene locus_tag LOCUS_03070 114902 114105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 115737 115006 gene locus_tag LOCUS_03080 gene radC 115737 115006 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682286.1 protein_id gnl|my_center|LOCUS_03080 116818 115829 gene locus_tag LOCUS_03090 116818 115829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 118279 116915 gene locus_tag LOCUS_03100 118279 116915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 120062 118272 gene locus_tag LOCUS_03110 120062 118272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 121436 120075 gene locus_tag LOCUS_03120 121436 120075 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430579.1 protein_id gnl|my_center|LOCUS_03120 121581 121510 gene locus_tag LOCUS_t00060 121581 121510 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 121662 122816 gene locus_tag LOCUS_03130 121662 122816 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295845.1 protein_id gnl|my_center|LOCUS_03130 122884 123792 gene locus_tag LOCUS_03140 122884 123792 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681782.1 protein_id gnl|my_center|LOCUS_03140 123846 124877 gene locus_tag LOCUS_03150 123846 124877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 124896 125288 gene locus_tag LOCUS_03160 gene mscL 124896 125288 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147388001.1 protein_id gnl|my_center|LOCUS_03160 127658 125403 gene locus_tag LOCUS_03170 gene rlmKL 127658 125403 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_03170 128637 127702 gene locus_tag LOCUS_03180 128637 127702 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680524.1 protein_id gnl|my_center|LOCUS_03180 128722 130194 gene locus_tag LOCUS_03190 128722 130194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 130191 131546 gene locus_tag LOCUS_03200 130191 131546 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_03200 131637 133484 gene locus_tag LOCUS_03210 131637 133484 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_03210 133491 134591 gene locus_tag LOCUS_03220 gene rlmD 133491 134591 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_03220 134975 135667 gene locus_tag LOCUS_03230 134975 135667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 135914 137167 gene locus_tag LOCUS_03240 135914 137167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 137247 138380 gene locus_tag LOCUS_03250 gene dcm 137247 138380 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203404.1 protein_id gnl|my_center|LOCUS_03250 138440 139108 gene locus_tag LOCUS_03260 138440 139108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 139195 139899 gene locus_tag LOCUS_03270 139195 139899 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369289.1 protein_id gnl|my_center|LOCUS_03270 141210 139933 gene locus_tag LOCUS_03280 141210 139933 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_03280 142538 141354 gene locus_tag LOCUS_03290 142538 141354 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_03290 142714 143277 gene locus_tag LOCUS_03300 142714 143277 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_03300 143340 144176 gene locus_tag LOCUS_03310 143340 144176 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808284.1 protein_id gnl|my_center|LOCUS_03310 144948 144178 gene locus_tag LOCUS_03320 144948 144178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 145775 144945 gene locus_tag LOCUS_03330 145775 144945 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 protein_id gnl|my_center|LOCUS_03330 146383 145763 gene locus_tag LOCUS_03340 146383 145763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_03340 147062 146577 gene locus_tag LOCUS_03350 147062 146577 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_03350 147217 147930 gene locus_tag LOCUS_03360 147217 147930 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_03360 147940 148857 gene locus_tag LOCUS_03370 gene rbsK 147940 148857 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548221.1 protein_id gnl|my_center|LOCUS_03370 148923 149456 gene locus_tag LOCUS_03380 148923 149456 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460553.1 protein_id gnl|my_center|LOCUS_03380 149530 151260 gene locus_tag LOCUS_03390 149530 151260 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460552.1 protein_id gnl|my_center|LOCUS_03390 151257 152042 gene locus_tag LOCUS_03400 151257 152042 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460551.1 protein_id gnl|my_center|LOCUS_03400 152057 153061 gene locus_tag LOCUS_03410 152057 153061 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530803.1 protein_id gnl|my_center|LOCUS_03410 153177 153605 gene locus_tag LOCUS_03420 153177 153605 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055942.1 protein_id gnl|my_center|LOCUS_03420 153816 153634 gene locus_tag LOCUS_03430 153816 153634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 153827 154312 gene locus_tag LOCUS_03440 gene nuoE 153827 154312 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_03440 154309 156207 gene locus_tag LOCUS_03450 gene nuoF 154309 156207 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_03450 156210 157898 gene locus_tag LOCUS_03460 156210 157898 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_03460 158045 158266 gene locus_tag LOCUS_03470 158045 158266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 158461 158667 gene locus_tag LOCUS_03480 158461 158667 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_03480 159514 158762 gene locus_tag LOCUS_03490 159514 158762 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107878.1 protein_id gnl|my_center|LOCUS_03490 159740 160084 gene locus_tag LOCUS_03500 159740 160084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 160087 160473 gene locus_tag LOCUS_03510 160087 160473 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_03510 161672 160482 gene locus_tag LOCUS_03520 161672 160482 CDS product cyclic nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990029.1 protein_id gnl|my_center|LOCUS_03520 162922 161669 gene locus_tag LOCUS_03530 162922 161669 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_03530 163842 163147 gene locus_tag LOCUS_03540 163842 163147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 164586 164750 gene locus_tag LOCUS_03550 164586 164750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 166033 164939 gene locus_tag LOCUS_03560 166033 164939 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_03560 166089 166724 gene locus_tag LOCUS_03570 166089 166724 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976287.1 protein_id gnl|my_center|LOCUS_03570 166756 167661 gene locus_tag LOCUS_03580 166756 167661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 167663 168955 gene locus_tag LOCUS_03590 167663 168955 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_03590 168961 169599 gene locus_tag LOCUS_03600 168961 169599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 171367 169697 gene locus_tag LOCUS_03610 171367 169697 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_03610 172038 171364 gene locus_tag LOCUS_03620 172038 171364 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_03620 172372 172980 gene locus_tag LOCUS_03630 172372 172980 CDS product DUF6305 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016768.1 protein_id gnl|my_center|LOCUS_03630 173023 174330 gene locus_tag LOCUS_03640 173023 174330 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016767.1 protein_id gnl|my_center|LOCUS_03640 174343 174516 gene locus_tag LOCUS_03650 174343 174516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 174525 175793 gene locus_tag LOCUS_03660 174525 175793 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779464.1 protein_id gnl|my_center|LOCUS_03660 175873 177477 gene locus_tag LOCUS_03670 175873 177477 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023304.1 protein_id gnl|my_center|LOCUS_03670 177493 179133 gene locus_tag LOCUS_03680 177493 179133 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023304.1 protein_id gnl|my_center|LOCUS_03680 179264 179626 gene locus_tag LOCUS_03690 179264 179626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 179748 181346 gene locus_tag LOCUS_03700 179748 181346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 181380 181745 gene locus_tag LOCUS_03710 181380 181745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 181922 183064 gene locus_tag LOCUS_03720 gene pgsB 181922 183064 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943108.1 protein_id gnl|my_center|LOCUS_03720 183064 183492 gene locus_tag LOCUS_03730 gene pgsC 183064 183492 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_03730 183519 184646 gene locus_tag LOCUS_03740 183519 184646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 184643 185650 gene locus_tag LOCUS_03750 184643 185650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 186425 185784 gene locus_tag LOCUS_03760 186425 185784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 186771 187241 gene locus_tag LOCUS_03770 186771 187241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 187256 189508 gene locus_tag LOCUS_03780 187256 189508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 190879 189578 gene locus_tag LOCUS_03790 190879 189578 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_03790 191223 190876 gene locus_tag LOCUS_03800 191223 190876 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_03800 192113 191289 gene locus_tag LOCUS_03810 192113 191289 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925959.1 protein_id gnl|my_center|LOCUS_03810 192689 192144 gene locus_tag LOCUS_03820 192689 192144 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811538.1 protein_id gnl|my_center|LOCUS_03820 193322 192705 gene locus_tag LOCUS_03830 193322 192705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 194416 193619 gene locus_tag LOCUS_03840 194416 193619 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063721.1 protein_id gnl|my_center|LOCUS_03840 195248 194496 gene locus_tag LOCUS_03850 195248 194496 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837550.1 protein_id gnl|my_center|LOCUS_03850 195925 195245 gene locus_tag LOCUS_03860 195925 195245 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027947.1 protein_id gnl|my_center|LOCUS_03860 197529 196102 gene locus_tag LOCUS_03870 197529 196102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 199071 197542 gene locus_tag LOCUS_03880 199071 197542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 202345 199073 gene locus_tag LOCUS_03890 202345 199073 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861545.1 protein_id gnl|my_center|LOCUS_03890 203556 202342 gene locus_tag LOCUS_03900 203556 202342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 203865 204500 gene locus_tag LOCUS_03910 203865 204500 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890784.1 protein_id gnl|my_center|LOCUS_03910 204497 204784 gene locus_tag LOCUS_03920 204497 204784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence03 766 329 gene locus_tag LOCUS_03930 766 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 1404 763 gene locus_tag LOCUS_03940 1404 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2367 1486 gene locus_tag LOCUS_03950 2367 1486 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_03950 2608 3264 gene locus_tag LOCUS_03960 gene eda 2608 3264 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775173.1 protein_id gnl|my_center|LOCUS_03960 3261 4280 gene locus_tag LOCUS_03970 3261 4280 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461002.1 protein_id gnl|my_center|LOCUS_03970 4305 5471 gene locus_tag LOCUS_03980 4305 5471 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_03980 5496 6494 gene locus_tag LOCUS_03990 5496 6494 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529042.1 protein_id gnl|my_center|LOCUS_03990 6595 7068 gene locus_tag LOCUS_04000 6595 7068 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259757.1 protein_id gnl|my_center|LOCUS_04000 7065 8354 gene locus_tag LOCUS_04010 7065 8354 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313207.1 protein_id gnl|my_center|LOCUS_04010 8541 8628 gene locus_tag LOCUS_t00070 8541 8628 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10543 9407 gene locus_tag LOCUS_04020 10543 9407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_04020 12258 10546 gene locus_tag LOCUS_04030 12258 10546 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626058.1 protein_id gnl|my_center|LOCUS_04030 13533 12412 gene locus_tag LOCUS_04040 13533 12412 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_04040 13665 15515 gene locus_tag LOCUS_04050 gene dnaX 13665 15515 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957269.1 protein_id gnl|my_center|LOCUS_04050 15512 15808 gene locus_tag LOCUS_04060 15512 15808 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527931.1 protein_id gnl|my_center|LOCUS_04060 15805 16395 gene locus_tag LOCUS_04070 gene recR 15805 16395 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956990.1 protein_id gnl|my_center|LOCUS_04070 17226 16399 gene locus_tag LOCUS_04080 gene djlA 17226 16399 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_04080 18644 17226 gene locus_tag LOCUS_04090 18644 17226 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_04090 19096 18836 gene locus_tag LOCUS_04100 19096 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 21075 19171 gene locus_tag LOCUS_04110 21075 19171 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_04110 21155 22324 gene locus_tag LOCUS_04120 gene nagA 21155 22324 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889694.1 protein_id gnl|my_center|LOCUS_04120 22337 23779 gene locus_tag LOCUS_04130 22337 23779 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436882.1 protein_id gnl|my_center|LOCUS_04130 24432 23815 gene locus_tag LOCUS_04140 24432 23815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 24664 25857 gene locus_tag LOCUS_04150 24664 25857 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680885.1 protein_id gnl|my_center|LOCUS_04150 27359 26016 gene locus_tag LOCUS_04160 gene radA 27359 26016 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680482.1 protein_id gnl|my_center|LOCUS_04160 28495 27548 gene locus_tag LOCUS_04170 28495 27548 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_04170 29465 28539 gene locus_tag LOCUS_04180 29465 28539 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681789.1 protein_id gnl|my_center|LOCUS_04180 30222 29455 gene locus_tag LOCUS_04190 30222 29455 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_04190 30309 30548 gene locus_tag LOCUS_04200 30309 30548 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545802.1 protein_id gnl|my_center|LOCUS_04200 33441 30922 gene locus_tag LOCUS_04210 gene gyrA 33441 30922 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681235.1 protein_id gnl|my_center|LOCUS_04210 35489 33456 gene locus_tag LOCUS_04220 gene gyrB 35489 33456 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666949.1 protein_id gnl|my_center|LOCUS_04220 35641 37062 gene locus_tag LOCUS_04230 gene dnaA 35641 37062 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680852.1 protein_id gnl|my_center|LOCUS_04230 37342 38445 gene locus_tag LOCUS_04240 gene dnaN 37342 38445 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681136.1 protein_id gnl|my_center|LOCUS_04240 38454 39560 gene locus_tag LOCUS_04250 gene recF 38454 39560 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681135.1 protein_id gnl|my_center|LOCUS_04250 39553 39945 gene locus_tag LOCUS_04260 39553 39945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 39947 40405 gene locus_tag LOCUS_04270 gene ndk 39947 40405 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391654.1 protein_id gnl|my_center|LOCUS_04270 40563 40730 gene locus_tag LOCUS_04280 gene rpmH 40563 40730 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557032.1 protein_id gnl|my_center|LOCUS_04280 40711 41058 gene locus_tag LOCUS_04290 40711 41058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 41150 42982 gene locus_tag LOCUS_04300 gene yidC 41150 42982 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680325.1 protein_id gnl|my_center|LOCUS_04300 42997 43758 gene locus_tag LOCUS_04310 42997 43758 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667657.1 protein_id gnl|my_center|LOCUS_04310 45146 43812 gene locus_tag LOCUS_04320 45146 43812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 46242 45232 gene locus_tag LOCUS_04330 46242 45232 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140793.1 protein_id gnl|my_center|LOCUS_04330 47930 46284 gene locus_tag LOCUS_04340 gene gpmI 47930 46284 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_04340 49773 48016 gene locus_tag LOCUS_04350 49773 48016 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_04350 50787 49789 gene locus_tag LOCUS_04360 gene lgt 50787 49789 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013967724.1 protein_id gnl|my_center|LOCUS_04360 50999 52459 gene locus_tag LOCUS_04370 50999 52459 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003289.1 protein_id gnl|my_center|LOCUS_04370 53673 52879 gene locus_tag LOCUS_04380 53673 52879 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679573.1 protein_id gnl|my_center|LOCUS_04380 53944 55650 gene locus_tag LOCUS_04390 53944 55650 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_04390 56907 55774 gene locus_tag LOCUS_04400 56907 55774 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_04400 58278 57109 gene locus_tag LOCUS_04410 58278 57109 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582704.1 protein_id gnl|my_center|LOCUS_04410 59059 58319 gene locus_tag LOCUS_04420 59059 58319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 60354 59086 gene locus_tag LOCUS_04430 60354 59086 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037726.1 protein_id gnl|my_center|LOCUS_04430 63688 60401 gene locus_tag LOCUS_04440 63688 60401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 64160 63696 gene locus_tag LOCUS_04450 64160 63696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 64339 64884 gene locus_tag LOCUS_04460 64339 64884 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_04460 65122 65754 gene locus_tag LOCUS_04470 65122 65754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 66032 67036 gene locus_tag LOCUS_04480 66032 67036 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_04480 67113 67811 gene locus_tag LOCUS_04490 67113 67811 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_04490 67828 68502 gene locus_tag LOCUS_04500 67828 68502 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389343.1 protein_id gnl|my_center|LOCUS_04500 68635 70464 gene locus_tag LOCUS_04510 68635 70464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_04510 70454 72364 gene locus_tag LOCUS_04520 70454 72364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671827.1 protein_id gnl|my_center|LOCUS_04520 72694 72539 gene locus_tag LOCUS_04530 72694 72539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 72853 74058 gene locus_tag LOCUS_04540 72853 74058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 74541 75587 gene locus_tag LOCUS_04550 74541 75587 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_04550 75632 76597 gene locus_tag LOCUS_04560 75632 76597 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582705.1 protein_id gnl|my_center|LOCUS_04560 76757 77254 gene locus_tag LOCUS_04570 76757 77254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 77265 78788 gene locus_tag LOCUS_04580 77265 78788 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_04580 78811 79983 gene locus_tag LOCUS_04590 78811 79983 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_04590 80070 81107 gene locus_tag LOCUS_04600 80070 81107 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886390.1 protein_id gnl|my_center|LOCUS_04600 81204 81725 gene locus_tag LOCUS_04610 81204 81725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 81719 82243 gene locus_tag LOCUS_04620 81719 82243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 84674 82323 gene locus_tag LOCUS_04630 gene feoB 84674 82323 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_04630 84877 86241 gene locus_tag LOCUS_04640 84877 86241 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618671.1 protein_id gnl|my_center|LOCUS_04640 86991 86485 gene locus_tag LOCUS_04650 86991 86485 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_04650 87080 87793 gene locus_tag LOCUS_04660 gene rsmI 87080 87793 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681097.1 protein_id gnl|my_center|LOCUS_04660 87803 88582 gene locus_tag LOCUS_04670 87803 88582 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673320.1 protein_id gnl|my_center|LOCUS_04670 88721 89404 gene locus_tag LOCUS_04680 88721 89404 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243047.1 protein_id gnl|my_center|LOCUS_04680 90500 89457 gene locus_tag LOCUS_04690 gene pspF 90500 89457 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764157.1 protein_id gnl|my_center|LOCUS_04690 90765 91487 gene locus_tag LOCUS_04700 gene pspA 90765 91487 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428804.1 protein_id gnl|my_center|LOCUS_04700 91521 91871 gene locus_tag LOCUS_04710 91521 91871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 94138 92132 gene locus_tag LOCUS_04720 94138 92132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 94196 94954 gene locus_tag LOCUS_04730 94196 94954 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680051.1 protein_id gnl|my_center|LOCUS_04730 94985 95497 gene locus_tag LOCUS_04740 gene lspA 94985 95497 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680623.1 protein_id gnl|my_center|LOCUS_04740 95494 95823 gene locus_tag LOCUS_04750 95494 95823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 95839 96831 gene locus_tag LOCUS_04760 95839 96831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 98035 96998 gene locus_tag LOCUS_04770 98035 96998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 98105 98626 gene locus_tag LOCUS_04780 98105 98626 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002785057.1 protein_id gnl|my_center|LOCUS_04780 98693 99715 gene locus_tag LOCUS_04790 gene galE 98693 99715 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527590.1 protein_id gnl|my_center|LOCUS_04790 99870 101993 gene locus_tag LOCUS_04800 99870 101993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 102134 103705 gene locus_tag LOCUS_04810 102134 103705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759901.1 protein_id gnl|my_center|LOCUS_04810 103702 104679 gene locus_tag LOCUS_04820 103702 104679 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_04820 104693 106498 gene locus_tag LOCUS_04830 104693 106498 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166384.1 protein_id gnl|my_center|LOCUS_04830 106509 107453 gene locus_tag LOCUS_04840 106509 107453 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893618.1 protein_id gnl|my_center|LOCUS_04840 107582 108850 gene locus_tag LOCUS_04850 107582 108850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 108850 109716 gene locus_tag LOCUS_04860 108850 109716 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682046.1 protein_id gnl|my_center|LOCUS_04860 110487 109825 gene locus_tag LOCUS_04870 110487 109825 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_04870 110866 111972 gene locus_tag LOCUS_04880 110866 111972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 111975 113489 gene locus_tag LOCUS_04890 111975 113489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 114520 113609 gene locus_tag LOCUS_04900 114520 113609 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426117.1 protein_id gnl|my_center|LOCUS_04900 114781 114711 gene locus_tag LOCUS_t00080 114781 114711 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 114924 115700 gene locus_tag LOCUS_04910 114924 115700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 116710 116267 gene locus_tag LOCUS_04920 116710 116267 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_04920 117984 116707 gene locus_tag LOCUS_04930 117984 116707 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680050.1 protein_id gnl|my_center|LOCUS_04930 120061 118007 gene locus_tag LOCUS_04940 120061 118007 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_04940 120243 121565 gene locus_tag LOCUS_04950 120243 121565 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_04950 121610 122317 gene locus_tag LOCUS_04960 gene deoD 121610 122317 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255010.1 protein_id gnl|my_center|LOCUS_04960 122329 123300 gene locus_tag LOCUS_04970 122329 123300 CDS product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042318072.1 protein_id gnl|my_center|LOCUS_04970 123384 124298 gene locus_tag LOCUS_04980 123384 124298 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_04980 124355 125554 gene locus_tag LOCUS_04990 gene rlmD 124355 125554 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_04990 125828 126052 gene locus_tag LOCUS_05000 125828 126052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 126134 127129 gene locus_tag LOCUS_05010 126134 127129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 129619 128585 gene locus_tag LOCUS_05020 129619 128585 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869708.1 protein_id gnl|my_center|LOCUS_05020 129831 129622 gene locus_tag LOCUS_05030 129831 129622 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205227.1 protein_id gnl|my_center|LOCUS_05030 130200 130658 gene locus_tag LOCUS_05040 130200 130658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 131161 132219 gene locus_tag LOCUS_05050 131161 132219 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_05050 132216 132734 gene locus_tag LOCUS_05060 132216 132734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 132913 133245 gene locus_tag LOCUS_05070 132913 133245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 133709 134776 gene locus_tag LOCUS_05080 133709 134776 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 protein_id gnl|my_center|LOCUS_05080 134919 136019 gene locus_tag LOCUS_05090 134919 136019 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_05090 136218 137252 gene locus_tag LOCUS_05100 136218 137252 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_05100 137466 137699 gene locus_tag LOCUS_05110 137466 137699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 137710 137946 gene locus_tag LOCUS_05120 137710 137946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 139229 137970 gene locus_tag LOCUS_05130 139229 137970 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_05130 139387 140121 gene locus_tag LOCUS_05140 139387 140121 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680712.1 protein_id gnl|my_center|LOCUS_05140 140346 141662 gene locus_tag LOCUS_05150 140346 141662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 143059 141674 gene locus_tag LOCUS_05160 143059 141674 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814537.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence04 1751 1305 gene locus_tag LOCUS_05170 1751 1305 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363476.1 protein_id gnl|my_center|LOCUS_05170 1942 1869 gene locus_tag LOCUS_t00090 1942 1869 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3434 2091 gene locus_tag LOCUS_05180 gene cpsG 3434 2091 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 protein_id gnl|my_center|LOCUS_05180 3964 3467 gene locus_tag LOCUS_05190 3964 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4065 5885 gene locus_tag LOCUS_05200 4065 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 7410 6118 gene locus_tag LOCUS_05210 7410 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 7714 7899 gene locus_tag LOCUS_05220 7714 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8161 9399 gene locus_tag LOCUS_05230 8161 9399 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_05230 11237 9510 gene locus_tag LOCUS_05240 11237 9510 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_05240 11387 12349 gene locus_tag LOCUS_05250 11387 12349 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310651.1 protein_id gnl|my_center|LOCUS_05250 12370 13653 gene locus_tag LOCUS_05260 12370 13653 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679693.1 protein_id gnl|my_center|LOCUS_05260 13670 15832 gene locus_tag LOCUS_05270 gene uvrB 13670 15832 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678935.1 protein_id gnl|my_center|LOCUS_05270 15901 16734 gene locus_tag LOCUS_05280 15901 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 17802 16738 gene locus_tag LOCUS_05290 17802 16738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867920.1 protein_id gnl|my_center|LOCUS_05290 19444 17795 gene locus_tag LOCUS_05300 19444 17795 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146673.1 protein_id gnl|my_center|LOCUS_05300 20513 19518 gene locus_tag LOCUS_05310 gene thiB 20513 19518 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067314.1 protein_id gnl|my_center|LOCUS_05310 20920 21309 gene locus_tag LOCUS_05320 20920 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 22660 21368 gene locus_tag LOCUS_05330 22660 21368 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_05330 24150 22699 gene locus_tag LOCUS_05340 gene glgA 24150 22699 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679256.1 protein_id gnl|my_center|LOCUS_05340 25222 24251 gene locus_tag LOCUS_05350 gene trxB 25222 24251 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_05350 26000 25224 gene locus_tag LOCUS_05360 gene tsaB 26000 25224 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_05360 26500 25997 gene locus_tag LOCUS_05370 gene tsaE 26500 25997 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_05370 27694 26501 gene locus_tag LOCUS_05380 27694 26501 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681112.1 protein_id gnl|my_center|LOCUS_05380 27789 28529 gene locus_tag LOCUS_05390 27789 28529 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 protein_id gnl|my_center|LOCUS_05390 28960 30621 gene locus_tag LOCUS_05400 28960 30621 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_05400 30923 33556 gene locus_tag LOCUS_05410 gene adhE 30923 33556 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_05410 33603 34355 gene locus_tag LOCUS_05420 33603 34355 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_05420 34433 35170 gene locus_tag LOCUS_05430 34433 35170 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_05430 35516 35259 gene locus_tag LOCUS_05440 35516 35259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 36039 35533 gene locus_tag LOCUS_05450 36039 35533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 36953 36273 gene locus_tag LOCUS_05460 36953 36273 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922723.1 protein_id gnl|my_center|LOCUS_05460 37149 38507 gene locus_tag LOCUS_05470 37149 38507 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_05470 38640 39941 gene locus_tag LOCUS_05480 38640 39941 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_05480 40051 40980 gene locus_tag LOCUS_05490 40051 40980 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_05490 40980 41834 gene locus_tag LOCUS_05500 40980 41834 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_05500 42263 42454 gene locus_tag LOCUS_05510 42263 42454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 42684 43184 gene locus_tag LOCUS_05520 42684 43184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 43962 43438 gene locus_tag LOCUS_05530 43962 43438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 44307 45893 gene locus_tag LOCUS_05540 44307 45893 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 protein_id gnl|my_center|LOCUS_05540 45934 46980 gene locus_tag LOCUS_05550 gene rlmN 45934 46980 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679871.1 protein_id gnl|my_center|LOCUS_05550 47633 47019 gene locus_tag LOCUS_05560 47633 47019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 48793 47630 gene locus_tag LOCUS_05570 gene hflX 48793 47630 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667011.1 protein_id gnl|my_center|LOCUS_05570 48895 49998 gene locus_tag LOCUS_05580 gene ychF 48895 49998 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666350.1 protein_id gnl|my_center|LOCUS_05580 49995 50690 gene locus_tag LOCUS_05590 49995 50690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 51463 50714 gene locus_tag LOCUS_05600 51463 50714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 51556 52167 gene locus_tag LOCUS_05610 51556 52167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 52780 52178 gene locus_tag LOCUS_05620 52780 52178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 53135 55666 gene locus_tag LOCUS_05630 gene topA 53135 55666 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_05630 55902 55827 gene locus_tag LOCUS_t00100 55902 55827 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 55962 56411 gene locus_tag LOCUS_05640 55962 56411 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678761.1 protein_id gnl|my_center|LOCUS_05640 57465 56548 gene locus_tag LOCUS_05650 57465 56548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 58188 57526 gene locus_tag LOCUS_05660 gene rspR 58188 57526 CDS product DNA-binding transcriptional regulator rspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215553.1 protein_id gnl|my_center|LOCUS_05660 58370 59836 gene locus_tag LOCUS_05670 gene uxaE 58370 59836 CDS product D-tagaturonate epimerase UxaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081526.1 protein_id gnl|my_center|LOCUS_05670 59919 61523 gene locus_tag LOCUS_05680 59919 61523 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_05680 61561 62634 gene locus_tag LOCUS_05690 61561 62634 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_05690 62652 64106 gene locus_tag LOCUS_05700 gene gnd 62652 64106 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688061.1 protein_id gnl|my_center|LOCUS_05700 64121 65356 gene locus_tag LOCUS_05710 64121 65356 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_05710 65415 66797 gene locus_tag LOCUS_05720 gene uxaC 65415 66797 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 protein_id gnl|my_center|LOCUS_05720 67958 67221 gene locus_tag LOCUS_05730 67958 67221 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_05730 69195 67996 gene locus_tag LOCUS_05740 gene nagA 69195 67996 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108898.1 protein_id gnl|my_center|LOCUS_05740 69917 69216 gene locus_tag LOCUS_05750 69917 69216 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868955.1 protein_id gnl|my_center|LOCUS_05750 70074 70964 gene locus_tag LOCUS_05760 70074 70964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 71359 72030 gene locus_tag LOCUS_05770 71359 72030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 72027 72848 gene locus_tag LOCUS_05780 gene phnC 72027 72848 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_05780 73000 73644 gene locus_tag LOCUS_05790 gene phnE 73000 73644 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_05790 73644 74456 gene locus_tag LOCUS_05800 gene phnE 73644 74456 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_05800 74493 75479 gene locus_tag LOCUS_05810 gene phnD 74493 75479 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_05810 75549 76292 gene locus_tag LOCUS_05820 75549 76292 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421595.1 protein_id gnl|my_center|LOCUS_05820 76402 77388 gene locus_tag LOCUS_05830 76402 77388 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808773.1 protein_id gnl|my_center|LOCUS_05830 77497 78618 gene locus_tag LOCUS_05840 77497 78618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_05840 78615 80351 gene locus_tag LOCUS_05850 78615 80351 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440013.1 protein_id gnl|my_center|LOCUS_05850 80901 81677 gene locus_tag LOCUS_05860 80901 81677 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381788.1 protein_id gnl|my_center|LOCUS_05860 81720 82259 gene locus_tag LOCUS_05870 81720 82259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 82393 83832 gene locus_tag LOCUS_05880 82393 83832 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_05880 83867 84199 gene locus_tag LOCUS_05890 83867 84199 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943224.1 protein_id gnl|my_center|LOCUS_05890 84259 84828 gene locus_tag LOCUS_05900 84259 84828 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673963.1 protein_id gnl|my_center|LOCUS_05900 84921 85640 gene locus_tag LOCUS_05910 84921 85640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 85812 86573 gene locus_tag LOCUS_05920 85812 86573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 86562 87125 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctttagatatctacaaaataacacgtctccaaagc 87837 87160 gene locus_tag LOCUS_05930 gene csn2 87837 87160 CDS product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681294.1 protein_id gnl|my_center|LOCUS_05930 88058 87834 gene locus_tag LOCUS_05940 88058 87834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 89019 88144 gene locus_tag LOCUS_05950 gene cas1 89019 88144 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_05950 93098 89016 gene locus_tag LOCUS_05960 gene cas9 93098 89016 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681289.1 protein_id gnl|my_center|LOCUS_05960 93358 93549 gene locus_tag LOCUS_05970 93358 93549 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_05970 93553 94035 gene locus_tag LOCUS_05980 93553 94035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 94935 94096 gene locus_tag LOCUS_05990 94935 94096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 95232 95020 gene locus_tag LOCUS_06000 95232 95020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 95454 96488 gene locus_tag LOCUS_06010 95454 96488 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_06010 96615 97751 gene locus_tag LOCUS_06020 96615 97751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902588.1 protein_id gnl|my_center|LOCUS_06020 97741 99444 gene locus_tag LOCUS_06030 97741 99444 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896074.1 protein_id gnl|my_center|LOCUS_06030 99509 101239 gene locus_tag LOCUS_06040 99509 101239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 101232 102041 gene locus_tag LOCUS_06050 101232 102041 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286068.1 protein_id gnl|my_center|LOCUS_06050 102074 102739 gene locus_tag LOCUS_06060 gene eda 102074 102739 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_06060 102866 103924 gene locus_tag LOCUS_06070 gene asnA 102866 103924 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_06070 104777 104421 gene locus_tag LOCUS_06080 104777 104421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 105051 104764 gene locus_tag LOCUS_06090 105051 104764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 105323 105661 gene locus_tag LOCUS_06100 105323 105661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 106428 106512 gene locus_tag LOCUS_t00110 106428 106512 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 106792 106965 gene locus_tag LOCUS_06110 106792 106965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 107408 107166 gene locus_tag LOCUS_06120 107408 107166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 107931 107461 gene locus_tag LOCUS_06130 107931 107461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 109267 108047 gene locus_tag LOCUS_06140 109267 108047 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_06140 110890 109421 gene locus_tag LOCUS_06150 110890 109421 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_06150 111188 114487 gene locus_tag LOCUS_06160 gene ygfK 111188 114487 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502365.1 protein_id gnl|my_center|LOCUS_06160 114491 115852 gene locus_tag LOCUS_06170 gene ssnA 114491 115852 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906298.1 protein_id gnl|my_center|LOCUS_06170 115986 118148 gene locus_tag LOCUS_06180 115986 118148 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869185.1 protein_id gnl|my_center|LOCUS_06180 118148 118639 gene locus_tag LOCUS_06190 118148 118639 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869169.1 protein_id gnl|my_center|LOCUS_06190 118627 119544 gene locus_tag LOCUS_06200 118627 119544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06200 119572 120954 gene locus_tag LOCUS_06210 119572 120954 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_06210 120947 121789 gene locus_tag LOCUS_06220 120947 121789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 121786 124665 gene locus_tag LOCUS_06230 121786 124665 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817476.1 protein_id gnl|my_center|LOCUS_06230 124848 126242 gene locus_tag LOCUS_06240 124848 126242 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 protein_id gnl|my_center|LOCUS_06240 126270 127463 gene locus_tag LOCUS_06250 gene ygeW 126270 127463 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385258.1 protein_id gnl|my_center|LOCUS_06250 127660 128865 gene locus_tag LOCUS_06260 127660 128865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681074.1 protein_id gnl|my_center|LOCUS_06260 128943 130748 gene locus_tag LOCUS_06270 128943 130748 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681067.1 protein_id gnl|my_center|LOCUS_06270 130750 131859 gene locus_tag LOCUS_06280 gene ugpC 130750 131859 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_06280 132506 133606 gene locus_tag LOCUS_06290 132506 133606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 133572 134243 gene locus_tag LOCUS_06300 gene rdgB 133572 134243 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence05 842 552 gene locus_tag LOCUS_06310 842 552 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667543.1 protein_id gnl|my_center|LOCUS_06310 965 1714 gene locus_tag LOCUS_06320 965 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 1814 2065 gene locus_tag LOCUS_06330 1814 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 2207 3241 gene locus_tag LOCUS_06340 2207 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3263 4372 gene locus_tag LOCUS_06350 3263 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5647 4472 gene locus_tag LOCUS_06360 gene dinB 5647 4472 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956849.1 protein_id gnl|my_center|LOCUS_06360 5646 5972 gene locus_tag LOCUS_06370 5646 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 6073 7005 gene locus_tag LOCUS_06380 6073 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 7484 7648 gene locus_tag LOCUS_06390 7484 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 7811 8689 gene locus_tag LOCUS_06400 7811 8689 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682397.1 protein_id gnl|my_center|LOCUS_06400 8686 9219 gene locus_tag LOCUS_06410 8686 9219 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682399.1 protein_id gnl|my_center|LOCUS_06410 9270 9470 gene locus_tag LOCUS_06420 9270 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 9484 10470 gene locus_tag LOCUS_06430 gene miaA 9484 10470 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680912.1 protein_id gnl|my_center|LOCUS_06430 11903 10413 gene locus_tag LOCUS_06440 11903 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 12551 11985 gene locus_tag LOCUS_06450 12551 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 13978 12548 gene locus_tag LOCUS_06460 13978 12548 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679249.1 protein_id gnl|my_center|LOCUS_06460 15390 13969 gene locus_tag LOCUS_06470 15390 13969 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682395.1 protein_id gnl|my_center|LOCUS_06470 15608 17344 gene locus_tag LOCUS_06480 15608 17344 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_06480 17334 17612 gene locus_tag LOCUS_06490 17334 17612 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256312.1 protein_id gnl|my_center|LOCUS_06490 17687 18520 gene locus_tag LOCUS_06500 17687 18520 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254023.1 protein_id gnl|my_center|LOCUS_06500 18960 19733 gene locus_tag LOCUS_06510 18960 19733 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_06510 19730 20545 gene locus_tag LOCUS_06520 gene sgcQ 19730 20545 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118614.1 protein_id gnl|my_center|LOCUS_06520 20559 21611 gene locus_tag LOCUS_06530 20559 21611 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869312.1 protein_id gnl|my_center|LOCUS_06530 21731 23251 gene locus_tag LOCUS_06540 21731 23251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330490.1 protein_id gnl|my_center|LOCUS_06540 23248 24324 gene locus_tag LOCUS_06550 23248 24324 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_06550 24317 25279 gene locus_tag LOCUS_06560 24317 25279 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530293.1 protein_id gnl|my_center|LOCUS_06560 25323 26636 gene locus_tag LOCUS_06570 25323 26636 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383858.1 protein_id gnl|my_center|LOCUS_06570 26636 28180 gene locus_tag LOCUS_06580 26636 28180 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537771.1 protein_id gnl|my_center|LOCUS_06580 28715 28640 gene locus_tag LOCUS_t00120 28715 28640 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 29568 28834 gene locus_tag LOCUS_06590 29568 28834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 30895 29822 gene locus_tag LOCUS_06600 30895 29822 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_06600 31443 30892 gene locus_tag LOCUS_06610 31443 30892 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_06610 32197 31433 gene locus_tag LOCUS_06620 32197 31433 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_06620 33264 32203 gene locus_tag LOCUS_06630 33264 32203 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_06630 33493 33275 gene locus_tag LOCUS_06640 33493 33275 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_06640 34175 33495 gene locus_tag LOCUS_06650 34175 33495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_06650 35263 34172 gene locus_tag LOCUS_06660 gene buk 35263 34172 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_06660 36176 35247 gene locus_tag LOCUS_06670 gene ptb 36176 35247 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420701.1 protein_id gnl|my_center|LOCUS_06670 37205 36558 gene locus_tag LOCUS_06680 37205 36558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 38017 37262 gene locus_tag LOCUS_06690 38017 37262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679334.1 protein_id gnl|my_center|LOCUS_06690 38603 38010 gene locus_tag LOCUS_06700 38603 38010 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679338.1 protein_id gnl|my_center|LOCUS_06700 39040 38600 gene locus_tag LOCUS_06710 39040 38600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 39170 40258 gene locus_tag LOCUS_06720 gene mnmA 39170 40258 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_06720 41680 40457 gene locus_tag LOCUS_06730 41680 40457 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 protein_id gnl|my_center|LOCUS_06730 42836 41712 gene locus_tag LOCUS_06740 42836 41712 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_06740 43769 42882 gene locus_tag LOCUS_06750 43769 42882 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_06750 43750 44940 gene locus_tag LOCUS_06760 43750 44940 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214278.1 protein_id gnl|my_center|LOCUS_06760 45251 45610 gene locus_tag LOCUS_06770 45251 45610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 46146 46349 gene locus_tag LOCUS_06780 46146 46349 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_06780 46377 49601 gene locus_tag LOCUS_06790 46377 49601 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_06790 49613 50263 gene locus_tag LOCUS_06800 49613 50263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 50385 52217 gene locus_tag LOCUS_06810 50385 52217 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_06810 52230 53345 gene locus_tag LOCUS_06820 52230 53345 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_06820 53342 56395 gene locus_tag LOCUS_06830 53342 56395 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_06830 56972 56385 gene locus_tag LOCUS_06840 56972 56385 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_06840 57465 56962 gene locus_tag LOCUS_06850 57465 56962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 57568 58689 gene locus_tag LOCUS_06860 57568 58689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 58729 59550 gene locus_tag LOCUS_06870 gene mscS 58729 59550 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_06870 59543 60031 gene locus_tag LOCUS_06880 59543 60031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 60051 62792 gene locus_tag LOCUS_06890 60051 62792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 62855 63328 gene locus_tag LOCUS_06900 62855 63328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 63452 64921 gene locus_tag LOCUS_06910 63452 64921 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_06910 64918 65148 gene locus_tag LOCUS_06920 64918 65148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 65247 66065 gene locus_tag LOCUS_06930 65247 66065 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_06930 66046 67008 gene locus_tag LOCUS_06940 gene pstC 66046 67008 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_06940 67005 67844 gene locus_tag LOCUS_06950 gene pstA 67005 67844 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_06950 67841 68632 gene locus_tag LOCUS_06960 gene pstB 67841 68632 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432349.1 protein_id gnl|my_center|LOCUS_06960 68634 69278 gene locus_tag LOCUS_06970 gene phoU 68634 69278 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_06970 69279 70028 gene locus_tag LOCUS_06980 69279 70028 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_06980 70032 71744 gene locus_tag LOCUS_06990 70032 71744 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_06990 71843 73207 gene locus_tag LOCUS_07000 71843 73207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 73223 74389 gene locus_tag LOCUS_07010 73223 74389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 74414 75127 gene locus_tag LOCUS_07020 74414 75127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439273.1 protein_id gnl|my_center|LOCUS_07020 75129 76301 gene locus_tag LOCUS_07030 75129 76301 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_07030 78000 76783 gene locus_tag LOCUS_07040 78000 76783 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_07040 78352 78882 gene locus_tag LOCUS_07050 78352 78882 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723402.1 protein_id gnl|my_center|LOCUS_07050 79343 78963 gene locus_tag LOCUS_07060 79343 78963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 79656 79336 gene locus_tag LOCUS_07070 79656 79336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 80098 79739 gene locus_tag LOCUS_07080 80098 79739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277639.1 protein_id gnl|my_center|LOCUS_07080 80527 80611 gene locus_tag LOCUS_t00130 80527 80611 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 80939 83026 gene locus_tag LOCUS_07090 80939 83026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 84239 83037 gene locus_tag LOCUS_07100 84239 83037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 85751 84243 gene locus_tag LOCUS_07110 85751 84243 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_07110 85901 86377 gene locus_tag LOCUS_07120 85901 86377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 86384 87613 gene locus_tag LOCUS_07130 86384 87613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 87624 89345 gene locus_tag LOCUS_07140 87624 89345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_07140 89338 91227 gene locus_tag LOCUS_07150 89338 91227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_07150 91227 92762 gene locus_tag LOCUS_07160 gene cls 91227 92762 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_07160 92827 93108 gene locus_tag LOCUS_07170 92827 93108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 93539 93384 gene locus_tag LOCUS_07180 93539 93384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 93977 93684 gene locus_tag LOCUS_07190 93977 93684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 94383 93970 gene locus_tag LOCUS_07200 94383 93970 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_07200 96063 94390 gene locus_tag LOCUS_07210 96063 94390 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_07210 96175 96525 gene locus_tag LOCUS_07220 96175 96525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 97565 96519 gene locus_tag LOCUS_07230 97565 96519 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678891.1 protein_id gnl|my_center|LOCUS_07230 99292 97718 gene locus_tag LOCUS_07240 99292 97718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 99478 99552 gene locus_tag LOCUS_t00140 99478 99552 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 100838 99690 gene locus_tag LOCUS_07250 100838 99690 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237280.1 protein_id gnl|my_center|LOCUS_07250 101880 100942 gene locus_tag LOCUS_07260 101880 100942 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_07260 103838 101925 gene locus_tag LOCUS_07270 103838 101925 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783169.1 protein_id gnl|my_center|LOCUS_07270 104020 105684 gene locus_tag LOCUS_07280 104020 105684 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence06 132 1913 gene locus_tag LOCUS_07290 gene pepF 132 1913 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971600.1 protein_id gnl|my_center|LOCUS_07290 1992 2738 gene locus_tag LOCUS_07300 gene fabG 1992 2738 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_07300 3937 2741 gene locus_tag LOCUS_07310 3937 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4944 3970 gene locus_tag LOCUS_07320 4944 3970 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_07320 5953 4937 gene locus_tag LOCUS_07330 5953 4937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_07330 6860 5964 gene locus_tag LOCUS_07340 6860 5964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_07340 7800 6871 gene locus_tag LOCUS_07350 7800 6871 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_07350 9670 8015 gene locus_tag LOCUS_07360 9670 8015 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830497.1 protein_id gnl|my_center|LOCUS_07360 10494 10580 gene locus_tag LOCUS_t00150 10494 10580 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11282 10986 gene locus_tag LOCUS_07370 11282 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 11428 11264 gene locus_tag LOCUS_07380 11428 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 12114 11716 gene locus_tag LOCUS_07390 12114 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 13895 12546 gene locus_tag LOCUS_07400 13895 12546 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_07400 15026 13905 gene locus_tag LOCUS_07410 gene nahK 15026 13905 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_07410 15127 16662 gene locus_tag LOCUS_07420 15127 16662 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880879.1 protein_id gnl|my_center|LOCUS_07420 16875 18383 gene locus_tag LOCUS_07430 16875 18383 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016819.1 protein_id gnl|my_center|LOCUS_07430 18518 19447 gene locus_tag LOCUS_07440 18518 19447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_07440 19459 20340 gene locus_tag LOCUS_07450 19459 20340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_07450 20354 21355 gene locus_tag LOCUS_07460 20354 21355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_07460 21352 22311 gene locus_tag LOCUS_07470 21352 22311 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_07470 22337 23104 gene locus_tag LOCUS_07480 22337 23104 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803873.1 protein_id gnl|my_center|LOCUS_07480 23148 24053 gene locus_tag LOCUS_07490 gene murQ 23148 24053 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098312.1 protein_id gnl|my_center|LOCUS_07490 24050 24964 gene locus_tag LOCUS_07500 24050 24964 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_07500 25018 26163 gene locus_tag LOCUS_07510 25018 26163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 26270 27019 gene locus_tag LOCUS_07520 26270 27019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 27029 27844 gene locus_tag LOCUS_07530 27029 27844 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_07530 27864 28718 gene locus_tag LOCUS_07540 27864 28718 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932949.1 protein_id gnl|my_center|LOCUS_07540 28748 29509 gene locus_tag LOCUS_07550 28748 29509 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_07550 30947 30126 gene locus_tag LOCUS_07560 30947 30126 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_07560 31099 31452 gene locus_tag LOCUS_07570 31099 31452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 33874 31454 gene locus_tag LOCUS_07580 33874 31454 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262593.1 protein_id gnl|my_center|LOCUS_07580 36441 33871 gene locus_tag LOCUS_07590 36441 33871 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263007.1 protein_id gnl|my_center|LOCUS_07590 37850 36438 gene locus_tag LOCUS_07600 37850 36438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 39288 37942 gene locus_tag LOCUS_07610 39288 37942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 40639 39788 gene locus_tag LOCUS_07620 40639 39788 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_07620 41562 40636 gene locus_tag LOCUS_07630 41562 40636 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161548.1 protein_id gnl|my_center|LOCUS_07630 42803 41637 gene locus_tag LOCUS_07640 42803 41637 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584154.1 protein_id gnl|my_center|LOCUS_07640 42980 44329 gene locus_tag LOCUS_07650 42980 44329 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_07650 44348 46801 gene locus_tag LOCUS_07660 44348 46801 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_07660 48209 47106 gene locus_tag LOCUS_07670 48209 47106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 49182 48430 gene locus_tag LOCUS_07680 49182 48430 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_07680 50786 49218 gene locus_tag LOCUS_07690 50786 49218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 51534 50788 gene locus_tag LOCUS_07700 51534 50788 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421595.1 protein_id gnl|my_center|LOCUS_07700 53059 51527 gene locus_tag LOCUS_07710 53059 51527 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_07710 53772 53074 gene locus_tag LOCUS_07720 53772 53074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 54914 53940 gene locus_tag LOCUS_07730 54914 53940 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395829.1 protein_id gnl|my_center|LOCUS_07730 56473 55892 gene locus_tag LOCUS_07740 gene pdxT 56473 55892 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113516.1 protein_id gnl|my_center|LOCUS_07740 57351 56470 gene locus_tag LOCUS_07750 gene pdxS 57351 56470 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113518.1 protein_id gnl|my_center|LOCUS_07750 57528 58940 gene locus_tag LOCUS_07760 57528 58940 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_07760 60693 59092 gene locus_tag LOCUS_07770 gene yqeB 60693 59092 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706024.1 protein_id gnl|my_center|LOCUS_07770 61447 60680 gene locus_tag LOCUS_07780 61447 60680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 61602 62021 gene locus_tag LOCUS_07790 61602 62021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 62014 62997 gene locus_tag LOCUS_07800 62014 62997 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460845.1 protein_id gnl|my_center|LOCUS_07800 62987 63814 gene locus_tag LOCUS_07810 62987 63814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933420.1 protein_id gnl|my_center|LOCUS_07810 63865 64560 gene locus_tag LOCUS_07820 63865 64560 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945134.1 protein_id gnl|my_center|LOCUS_07820 64619 65680 gene locus_tag LOCUS_07830 64619 65680 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816413.1 protein_id gnl|my_center|LOCUS_07830 66833 67528 gene locus_tag LOCUS_07840 gene pyrH 66833 67528 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_07840 68542 67604 gene locus_tag LOCUS_07850 68542 67604 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680474.1 protein_id gnl|my_center|LOCUS_07850 68648 69742 gene locus_tag LOCUS_07860 68648 69742 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_07860 69758 70156 gene locus_tag LOCUS_07870 69758 70156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 72950 70356 gene locus_tag LOCUS_07880 72950 70356 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_07880 74737 72962 gene locus_tag LOCUS_07890 74737 72962 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964265.1 protein_id gnl|my_center|LOCUS_07890 74976 76322 gene locus_tag LOCUS_07900 74976 76322 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_07900 77960 76593 gene locus_tag LOCUS_07910 77960 76593 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_07910 78715 78044 gene locus_tag LOCUS_07920 78715 78044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 80217 78802 gene locus_tag LOCUS_07930 gene sbcB 80217 78802 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 protein_id gnl|my_center|LOCUS_07930 80658 81692 gene locus_tag LOCUS_07940 80658 81692 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722514.1 protein_id gnl|my_center|LOCUS_07940 81750 83276 gene locus_tag LOCUS_07950 81750 83276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948025.1 protein_id gnl|my_center|LOCUS_07950 83269 84390 gene locus_tag LOCUS_07960 83269 84390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_07960 84402 85349 gene locus_tag LOCUS_07970 84402 85349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_07970 85346 88624 gene locus_tag LOCUS_07980 gene xdh 85346 88624 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_07980 88945 90198 gene locus_tag LOCUS_07990 88945 90198 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_07990 91962 90211 gene locus_tag LOCUS_08000 91962 90211 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036859483.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence07 363 447 gene locus_tag LOCUS_t00160 363 447 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 515 955 gene locus_tag LOCUS_08010 515 955 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671181.1 protein_id gnl|my_center|LOCUS_08010 956 2752 gene locus_tag LOCUS_08020 gene dnaG 956 2752 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678905.1 protein_id gnl|my_center|LOCUS_08020 2755 4761 gene locus_tag LOCUS_08030 2755 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4791 5627 gene locus_tag LOCUS_08040 4791 5627 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671470.1 protein_id gnl|my_center|LOCUS_08040 6019 6819 gene locus_tag LOCUS_08050 6019 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 6854 9304 gene locus_tag LOCUS_08060 6854 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 9301 10101 gene locus_tag LOCUS_08070 9301 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 10178 11290 gene locus_tag LOCUS_08080 10178 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 12051 11287 gene locus_tag LOCUS_08090 12051 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 12733 12065 gene locus_tag LOCUS_08100 12733 12065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 14440 12737 gene locus_tag LOCUS_08110 14440 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08110 15110 14466 gene locus_tag LOCUS_08120 15110 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08120 15832 15107 gene locus_tag LOCUS_08130 15832 15107 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682155.1 protein_id gnl|my_center|LOCUS_08130 16283 15822 gene locus_tag LOCUS_08140 gene scpB 16283 15822 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672067.1 protein_id gnl|my_center|LOCUS_08140 17266 16388 gene locus_tag LOCUS_08150 17266 16388 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670199.1 protein_id gnl|my_center|LOCUS_08150 18370 17297 gene locus_tag LOCUS_08160 gene recA 18370 17297 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682153.1 protein_id gnl|my_center|LOCUS_08160 18877 18419 gene locus_tag LOCUS_08170 gene dtd 18877 18419 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_08170 19442 18885 gene locus_tag LOCUS_08180 gene rpe 19442 18885 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933334.1 protein_id gnl|my_center|LOCUS_08180 19381 19557 gene locus_tag LOCUS_08190 19381 19557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 19889 22567 gene locus_tag LOCUS_08200 gene greA 19889 22567 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673498.1 protein_id gnl|my_center|LOCUS_08200 24102 22804 gene locus_tag LOCUS_08210 24102 22804 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398532.1 protein_id gnl|my_center|LOCUS_08210 24247 24492 gene locus_tag LOCUS_08220 24247 24492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 24562 24756 gene locus_tag LOCUS_08230 24562 24756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 25205 24783 gene locus_tag LOCUS_08240 25205 24783 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971899.1 protein_id gnl|my_center|LOCUS_08240 26380 25223 gene locus_tag LOCUS_08250 gene tgt 26380 25223 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681512.1 protein_id gnl|my_center|LOCUS_08250 27560 26412 gene locus_tag LOCUS_08260 27560 26412 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_08260 28844 27576 gene locus_tag LOCUS_08270 28844 27576 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670521.1 protein_id gnl|my_center|LOCUS_08270 29321 28860 gene locus_tag LOCUS_08280 gene dut 29321 28860 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_08280 31647 29359 gene locus_tag LOCUS_08290 gene pnp 31647 29359 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682350.1 protein_id gnl|my_center|LOCUS_08290 32093 31827 gene locus_tag LOCUS_08300 gene rpsO 32093 31827 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217790.1 protein_id gnl|my_center|LOCUS_08300 32886 32098 gene locus_tag LOCUS_08310 32886 32098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 33782 32886 gene locus_tag LOCUS_08320 33782 32886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 34158 33811 gene locus_tag LOCUS_08330 gene rbfA 34158 33811 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882966.1 protein_id gnl|my_center|LOCUS_08330 36968 34158 gene locus_tag LOCUS_08340 36968 34158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 38454 36979 gene locus_tag LOCUS_08350 gene nusA 38454 36979 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682413.1 protein_id gnl|my_center|LOCUS_08350 38944 38438 gene locus_tag LOCUS_08360 38944 38438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 39152 40213 gene locus_tag LOCUS_08370 39152 40213 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_08370 40978 40247 gene locus_tag LOCUS_08380 40978 40247 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526022.1 protein_id gnl|my_center|LOCUS_08380 43560 40975 gene locus_tag LOCUS_08390 gene mutS 43560 40975 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920616.1 protein_id gnl|my_center|LOCUS_08390 46117 43589 gene locus_tag LOCUS_08400 gene bamA 46117 43589 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667239.1 protein_id gnl|my_center|LOCUS_08400 50819 46140 gene locus_tag LOCUS_08410 50819 46140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 50908 51519 gene locus_tag LOCUS_08420 gene tmk 50908 51519 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957272.1 protein_id gnl|my_center|LOCUS_08420 51663 53204 gene locus_tag LOCUS_08430 51663 53204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_08430 53201 54295 gene locus_tag LOCUS_08440 53201 54295 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_08440 54292 55278 gene locus_tag LOCUS_08450 54292 55278 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_08450 55464 56687 gene locus_tag LOCUS_08460 55464 56687 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_08460 57457 56825 gene locus_tag LOCUS_08470 gene adk 57457 56825 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454556.1 protein_id gnl|my_center|LOCUS_08470 57581 58657 gene locus_tag LOCUS_08480 57581 58657 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671073.1 protein_id gnl|my_center|LOCUS_08480 58650 59264 gene locus_tag LOCUS_08490 58650 59264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 59783 59250 gene locus_tag LOCUS_08500 59783 59250 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_08500 60358 59780 gene locus_tag LOCUS_08510 60358 59780 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_08510 60801 60355 gene locus_tag LOCUS_08520 gene rnhA 60801 60355 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680554.1 protein_id gnl|my_center|LOCUS_08520 61115 61990 gene locus_tag LOCUS_08530 61115 61990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 62012 62992 gene locus_tag LOCUS_08540 62012 62992 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_08540 62982 63776 gene locus_tag LOCUS_08550 gene fepC 62982 63776 CDS product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140647.1 protein_id gnl|my_center|LOCUS_08550 64386 63799 gene locus_tag LOCUS_08560 64386 63799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 65200 64424 gene locus_tag LOCUS_08570 65200 64424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 65979 65242 gene locus_tag LOCUS_08580 65979 65242 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_08580 66140 67063 gene locus_tag LOCUS_08590 66140 67063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 67093 68847 gene locus_tag LOCUS_08600 67093 68847 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181877.1 protein_id gnl|my_center|LOCUS_08600 70292 68943 gene locus_tag LOCUS_08610 70292 68943 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_08610 72592 70490 gene locus_tag LOCUS_08620 72592 70490 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_08620 72844 74172 gene locus_tag LOCUS_08630 72844 74172 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_08630 74230 74838 gene locus_tag LOCUS_08640 74230 74838 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084077.1 protein_id gnl|my_center|LOCUS_08640 74882 76294 gene locus_tag LOCUS_08650 74882 76294 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_08650 76877 76440 gene locus_tag LOCUS_08660 76877 76440 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_08660 78409 77402 gene locus_tag LOCUS_08670 78409 77402 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_08670 79740 78424 gene locus_tag LOCUS_08680 79740 78424 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_08680 80876 79755 gene locus_tag LOCUS_08690 80876 79755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 81094 81531 gene locus_tag LOCUS_08700 81094 81531 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 protein_id gnl|my_center|LOCUS_08700 81544 83052 gene locus_tag LOCUS_08710 gene thrC 81544 83052 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_08710 83096 83704 gene locus_tag LOCUS_08720 gene thrH 83096 83704 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_08720 85323 83698 gene locus_tag LOCUS_08730 85323 83698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 85837 85622 gene locus_tag LOCUS_08740 85837 85622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 85924 86232 gene locus_tag LOCUS_08750 85924 86232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 87910 87506 gene locus_tag LOCUS_08760 87910 87506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08760 >Feature sequence08 18 197 gene locus_tag LOCUS_08770 18 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2081 453 gene locus_tag LOCUS_08780 gene groL 2081 453 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657108.1 protein_id gnl|my_center|LOCUS_08780 3063 2191 gene locus_tag LOCUS_08790 3063 2191 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_08790 3800 3051 gene locus_tag LOCUS_08800 3800 3051 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_08800 5715 3790 gene locus_tag LOCUS_08810 5715 3790 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392706.1 protein_id gnl|my_center|LOCUS_08810 6273 5719 gene locus_tag LOCUS_08820 6273 5719 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989628.1 protein_id gnl|my_center|LOCUS_08820 7950 6343 gene locus_tag LOCUS_08830 7950 6343 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_08830 8547 8077 gene locus_tag LOCUS_08840 8547 8077 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_08840 10513 8714 gene locus_tag LOCUS_08850 10513 8714 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_08850 11071 11220 gene locus_tag LOCUS_08860 11071 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 12471 11383 gene locus_tag LOCUS_08870 gene serC 12471 11383 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_08870 12741 14081 gene locus_tag LOCUS_08880 12741 14081 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_08880 15838 14825 gene locus_tag LOCUS_08890 gene mglC 15838 14825 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652434.1 protein_id gnl|my_center|LOCUS_08890 17381 15858 gene locus_tag LOCUS_08900 gene mglA 17381 15858 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652432.1 protein_id gnl|my_center|LOCUS_08900 18471 17470 gene locus_tag LOCUS_08910 gene mglB 18471 17470 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707762.1 protein_id gnl|my_center|LOCUS_08910 19398 19015 gene locus_tag LOCUS_08920 19398 19015 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_08920 19573 20265 gene locus_tag LOCUS_08930 19573 20265 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_08930 20277 21278 gene locus_tag LOCUS_08940 20277 21278 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_08940 21419 21709 gene locus_tag LOCUS_08950 21419 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 22418 22056 gene locus_tag LOCUS_08960 22418 22056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 24647 22431 gene locus_tag LOCUS_08970 gene ligA 24647 22431 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124831.1 protein_id gnl|my_center|LOCUS_08970 25221 24634 gene locus_tag LOCUS_08980 gene rsmD 25221 24634 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669684.1 protein_id gnl|my_center|LOCUS_08980 26172 25291 gene locus_tag LOCUS_08990 26172 25291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 26761 26156 gene locus_tag LOCUS_09000 26761 26156 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_09000 28866 26758 gene locus_tag LOCUS_09010 28866 26758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 29985 28930 gene locus_tag LOCUS_09020 29985 28930 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_09020 30208 29987 gene locus_tag LOCUS_09030 30208 29987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 32350 30281 gene locus_tag LOCUS_09040 gene recG 32350 30281 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680562.1 protein_id gnl|my_center|LOCUS_09040 33038 32379 gene locus_tag LOCUS_09050 33038 32379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 36569 33096 gene locus_tag LOCUS_09060 gene dnaE 36569 33096 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957315.1 protein_id gnl|my_center|LOCUS_09060 36814 38136 gene locus_tag LOCUS_09070 36814 38136 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_09070 38723 38493 gene locus_tag LOCUS_09080 38723 38493 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085189.1 protein_id gnl|my_center|LOCUS_09080 38843 39883 gene locus_tag LOCUS_09090 38843 39883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 40124 43642 gene locus_tag LOCUS_09100 gene nifJ 40124 43642 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_09100 43911 43723 gene locus_tag LOCUS_09110 43911 43723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 44314 44072 gene locus_tag LOCUS_09120 44314 44072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 46556 44328 gene locus_tag LOCUS_09130 46556 44328 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167180.1 protein_id gnl|my_center|LOCUS_09130 47591 46557 gene locus_tag LOCUS_09140 47591 46557 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363445.1 protein_id gnl|my_center|LOCUS_09140 48372 49208 gene locus_tag LOCUS_09150 48372 49208 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_09150 49367 50239 gene locus_tag LOCUS_09160 49367 50239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 50415 50254 gene locus_tag LOCUS_09170 50415 50254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 51512 50427 gene locus_tag LOCUS_09180 51512 50427 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566189.1 protein_id gnl|my_center|LOCUS_09180 53098 51761 gene locus_tag LOCUS_09190 gene gdhA 53098 51761 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_09190 54036 53278 gene locus_tag LOCUS_09200 54036 53278 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_09200 56117 54045 gene locus_tag LOCUS_09210 56117 54045 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_09210 57962 56130 gene locus_tag LOCUS_09220 57962 56130 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_09220 58739 58065 gene locus_tag LOCUS_09230 58739 58065 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_09230 58842 61370 gene locus_tag LOCUS_09240 gene leuS 58842 61370 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680258.1 protein_id gnl|my_center|LOCUS_09240 62575 63126 gene locus_tag LOCUS_09250 62575 63126 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_09250 63128 64738 gene locus_tag LOCUS_09260 gene guaA 63128 64738 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_09260 65295 64816 gene locus_tag LOCUS_09270 65295 64816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 66389 65952 gene locus_tag LOCUS_09280 66389 65952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 66636 66433 gene locus_tag LOCUS_09290 66636 66433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 67377 66847 gene locus_tag LOCUS_09300 67377 66847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 67836 68474 gene locus_tag LOCUS_09310 67836 68474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 68865 68683 gene locus_tag LOCUS_09320 68865 68683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 70109 69030 gene locus_tag LOCUS_09330 70109 69030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_09330 71736 70126 gene locus_tag LOCUS_09340 71736 70126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 72964 71945 gene locus_tag LOCUS_09350 72964 71945 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 protein_id gnl|my_center|LOCUS_09350 73088 73861 gene locus_tag LOCUS_09360 73088 73861 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679577.1 protein_id gnl|my_center|LOCUS_09360 73874 74056 gene locus_tag LOCUS_09370 73874 74056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09370 74069 74587 gene locus_tag LOCUS_09380 74069 74587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09380 74563 74835 gene locus_tag LOCUS_09390 74563 74835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence09 1029 139 gene locus_tag LOCUS_09400 1029 139 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_09400 2450 1026 gene locus_tag LOCUS_09410 2450 1026 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 protein_id gnl|my_center|LOCUS_09410 2877 3599 gene locus_tag LOCUS_09420 2877 3599 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429376.1 protein_id gnl|my_center|LOCUS_09420 4653 3658 gene locus_tag LOCUS_09430 4653 3658 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338207.1 protein_id gnl|my_center|LOCUS_09430 5027 6619 gene locus_tag LOCUS_09440 5027 6619 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_09440 7220 6768 gene locus_tag LOCUS_09450 7220 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 7368 8669 gene locus_tag LOCUS_09460 7368 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 10821 8695 gene locus_tag LOCUS_09470 gene recJ 10821 8695 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680035.1 protein_id gnl|my_center|LOCUS_09470 11672 10884 gene locus_tag LOCUS_09480 11672 10884 CDS product DNA repair protein RecO C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681503.1 protein_id gnl|my_center|LOCUS_09480 12155 11706 gene locus_tag LOCUS_09490 12155 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 13039 12155 gene locus_tag LOCUS_09500 13039 12155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 13358 13128 gene locus_tag LOCUS_09510 13358 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 13451 14443 gene locus_tag LOCUS_09520 13451 14443 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_09520 14487 15668 gene locus_tag LOCUS_09530 14487 15668 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480805.1 protein_id gnl|my_center|LOCUS_09530 15655 16122 gene locus_tag LOCUS_09540 15655 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 18057 16150 gene locus_tag LOCUS_09550 gene mutL 18057 16150 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495553.1 protein_id gnl|my_center|LOCUS_09550 20634 18076 gene locus_tag LOCUS_09560 20634 18076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 21589 20741 gene locus_tag LOCUS_09570 21589 20741 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764709.1 protein_id gnl|my_center|LOCUS_09570 21643 22179 gene locus_tag LOCUS_09580 21643 22179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 22238 22312 gene locus_tag LOCUS_t00170 22238 22312 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 22370 23146 gene locus_tag LOCUS_09590 22370 23146 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568187.1 protein_id gnl|my_center|LOCUS_09590 23225 24607 gene locus_tag LOCUS_09600 gene asnS 23225 24607 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682293.1 protein_id gnl|my_center|LOCUS_09600 24731 25291 gene locus_tag LOCUS_09610 24731 25291 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_09610 25279 26793 gene locus_tag LOCUS_09620 25279 26793 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902867.1 protein_id gnl|my_center|LOCUS_09620 27010 27708 gene locus_tag LOCUS_09630 27010 27708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 27982 27818 gene locus_tag LOCUS_09640 27982 27818 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018715.1 protein_id gnl|my_center|LOCUS_09640 28210 28875 gene locus_tag LOCUS_09650 28210 28875 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_09650 29884 28892 gene locus_tag LOCUS_09660 29884 28892 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529382.1 protein_id gnl|my_center|LOCUS_09660 30188 30766 gene locus_tag LOCUS_09670 30188 30766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 30898 31611 gene locus_tag LOCUS_09680 30898 31611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 31684 34605 gene locus_tag LOCUS_09690 31684 34605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 34623 34859 gene locus_tag LOCUS_09700 34623 34859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 36601 35276 gene locus_tag LOCUS_09710 36601 35276 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_09710 38019 36598 gene locus_tag LOCUS_09720 38019 36598 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_09720 38376 39356 gene locus_tag LOCUS_09730 38376 39356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 39393 40127 gene locus_tag LOCUS_09740 39393 40127 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_09740 40124 40363 gene locus_tag LOCUS_09750 40124 40363 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_09750 40509 40333 gene locus_tag LOCUS_09760 40509 40333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 40606 40860 gene locus_tag LOCUS_09770 40606 40860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 41228 42076 gene locus_tag LOCUS_09780 41228 42076 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_09780 42088 43497 gene locus_tag LOCUS_09790 gene gltA 42088 43497 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420072.1 protein_id gnl|my_center|LOCUS_09790 43917 45527 gene locus_tag LOCUS_09800 43917 45527 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_09800 45867 46193 gene locus_tag LOCUS_09810 45867 46193 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831459.1 protein_id gnl|my_center|LOCUS_09810 46215 47315 gene locus_tag LOCUS_09820 46215 47315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 47523 48647 gene locus_tag LOCUS_09830 47523 48647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 48651 49739 gene locus_tag LOCUS_09840 48651 49739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 49884 51176 gene locus_tag LOCUS_09850 gene rsxC 49884 51176 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_09850 51176 52141 gene locus_tag LOCUS_09860 51176 52141 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_09860 52131 53387 gene locus_tag LOCUS_09870 52131 53387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 53387 53971 gene locus_tag LOCUS_09880 53387 53971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 53971 54519 gene locus_tag LOCUS_09890 53971 54519 CDS product electron transport complex protein RnfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356420.1 protein_id gnl|my_center|LOCUS_09890 54519 54890 gene locus_tag LOCUS_09900 54519 54890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 54905 55465 gene locus_tag LOCUS_09910 54905 55465 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_09910 55469 55972 gene locus_tag LOCUS_09920 55469 55972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 55981 56898 gene locus_tag LOCUS_09930 55981 56898 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_09930 56891 57661 gene locus_tag LOCUS_09940 56891 57661 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_09940 57646 58467 gene locus_tag LOCUS_09950 57646 58467 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_09950 58575 58964 gene locus_tag LOCUS_09960 58575 58964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 59021 59719 gene locus_tag LOCUS_09970 59021 59719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 59733 61160 gene locus_tag LOCUS_09980 59733 61160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 61190 64684 gene locus_tag LOCUS_09990 61190 64684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 64690 65403 gene locus_tag LOCUS_10000 64690 65403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 65474 68641 gene locus_tag LOCUS_10010 65474 68641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 69224 68883 gene locus_tag LOCUS_10020 69224 68883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence10 2 241 gene locus_tag LOCUS_10030 2 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 905 342 gene locus_tag LOCUS_10040 905 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2068 938 gene locus_tag LOCUS_10050 gene selD 2068 938 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012159590.1 protein_id gnl|my_center|LOCUS_10050 2345 2037 gene locus_tag LOCUS_10060 2345 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2527 2321 gene locus_tag LOCUS_10070 2527 2321 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392950.1 protein_id gnl|my_center|LOCUS_10070 3649 2543 gene locus_tag LOCUS_10080 gene yedE 3649 2543 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_10080 3760 4926 gene locus_tag LOCUS_10090 3760 4926 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680415.1 protein_id gnl|my_center|LOCUS_10090 4919 5881 gene locus_tag LOCUS_10100 4919 5881 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_10100 6005 6619 gene locus_tag LOCUS_10110 6005 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 8592 7015 gene locus_tag LOCUS_10120 8592 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 9042 9746 gene locus_tag LOCUS_10130 9042 9746 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020681.1 protein_id gnl|my_center|LOCUS_10130 10147 9854 gene locus_tag LOCUS_10140 10147 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 10426 10163 gene locus_tag LOCUS_10150 10426 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10451 13135 gene locus_tag LOCUS_10160 gene lon 10451 13135 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681876.1 protein_id gnl|my_center|LOCUS_10160 13132 14445 gene locus_tag LOCUS_10170 13132 14445 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680143.1 protein_id gnl|my_center|LOCUS_10170 14442 15230 gene locus_tag LOCUS_10180 14442 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 15342 15518 gene locus_tag LOCUS_10190 15342 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 15859 17523 gene locus_tag LOCUS_10200 15859 17523 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_10200 17699 18889 gene locus_tag LOCUS_10210 17699 18889 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_10210 20203 18902 gene locus_tag LOCUS_10220 20203 18902 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_10220 22147 20282 gene locus_tag LOCUS_10230 22147 20282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 22753 22217 gene locus_tag LOCUS_10240 22753 22217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 23460 22882 gene locus_tag LOCUS_10250 23460 22882 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_10250 26024 23634 gene locus_tag LOCUS_10260 26024 23634 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_10260 26246 26905 gene locus_tag LOCUS_10270 26246 26905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 27701 26928 gene locus_tag LOCUS_10280 27701 26928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 27940 27716 gene locus_tag LOCUS_10290 27940 27716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 28618 27995 gene locus_tag LOCUS_10300 28618 27995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 29631 28624 gene locus_tag LOCUS_10310 29631 28624 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498680.1 protein_id gnl|my_center|LOCUS_10310 29851 31161 gene locus_tag LOCUS_10320 29851 31161 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727005.1 protein_id gnl|my_center|LOCUS_10320 31392 32285 gene locus_tag LOCUS_10330 31392 32285 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213188.1 protein_id gnl|my_center|LOCUS_10330 32298 33140 gene locus_tag LOCUS_10340 32298 33140 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459730.1 protein_id gnl|my_center|LOCUS_10340 33137 35023 gene locus_tag LOCUS_10350 33137 35023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 35024 36127 gene locus_tag LOCUS_10360 35024 36127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_10360 36153 37076 gene locus_tag LOCUS_10370 36153 37076 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767097.1 protein_id gnl|my_center|LOCUS_10370 37104 37784 gene locus_tag LOCUS_10380 gene gmhA 37104 37784 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_10380 38039 38686 gene locus_tag LOCUS_10390 38039 38686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 38840 39409 gene locus_tag LOCUS_10400 38840 39409 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_10400 40311 39601 gene locus_tag LOCUS_10410 40311 39601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 40534 40352 gene locus_tag LOCUS_10420 40534 40352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 40810 40640 gene locus_tag LOCUS_10430 40810 40640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 41850 40837 gene locus_tag LOCUS_10440 41850 40837 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_10440 42026 43369 gene locus_tag LOCUS_10450 42026 43369 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673282.1 protein_id gnl|my_center|LOCUS_10450 44308 43412 gene locus_tag LOCUS_10460 44308 43412 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680147.1 protein_id gnl|my_center|LOCUS_10460 44441 45757 gene locus_tag LOCUS_10470 gene citG 44441 45757 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_10470 45750 46796 gene locus_tag LOCUS_10480 gene citC 45750 46796 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016310.1 protein_id gnl|my_center|LOCUS_10480 46938 48242 gene locus_tag LOCUS_10490 46938 48242 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_10490 48345 50078 gene locus_tag LOCUS_10500 gene ade 48345 50078 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_10500 50446 50607 gene locus_tag LOCUS_10510 50446 50607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 51399 50899 gene locus_tag LOCUS_10520 51399 50899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 51948 51418 gene locus_tag LOCUS_10530 51948 51418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 53002 52094 gene locus_tag LOCUS_10540 53002 52094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 53688 54101 gene locus_tag LOCUS_10550 53688 54101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 54796 54176 gene locus_tag LOCUS_10560 gene udk 54796 54176 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655979.1 protein_id gnl|my_center|LOCUS_10560 55880 54798 gene locus_tag LOCUS_10570 55880 54798 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_10570 57734 55917 gene locus_tag LOCUS_10580 gene lepA 57734 55917 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_10580 60150 57883 gene locus_tag LOCUS_10590 gene ftsH 60150 57883 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656600.1 protein_id gnl|my_center|LOCUS_10590 61600 60158 gene locus_tag LOCUS_10600 61600 60158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 62171 61557 gene locus_tag LOCUS_10610 gene pth 62171 61557 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_10610 62460 62179 gene locus_tag LOCUS_10620 62460 62179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 62645 63838 gene locus_tag LOCUS_10630 62645 63838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 64106 64849 gene locus_tag LOCUS_10640 64106 64849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 64862 64935 gene locus_tag LOCUS_t00180 64862 64935 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 65794 64994 gene locus_tag LOCUS_10650 gene ispE 65794 64994 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678892.1 protein_id gnl|my_center|LOCUS_10650 66516 65782 gene locus_tag LOCUS_10660 66516 65782 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_10660 66651 66580 gene locus_tag LOCUS_t00190 66651 66580 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 67306 66704 gene locus_tag LOCUS_10670 67306 66704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence11 1271 99 gene locus_tag LOCUS_10680 1271 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1830 1381 gene locus_tag LOCUS_10690 1830 1381 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556692.1 protein_id gnl|my_center|LOCUS_10690 3671 1863 gene locus_tag LOCUS_10700 3671 1863 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_10700 4288 3668 gene locus_tag LOCUS_10710 4288 3668 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_10710 5582 4290 gene locus_tag LOCUS_10720 5582 4290 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_10720 7327 5585 gene locus_tag LOCUS_10730 7327 5585 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_10730 8047 7514 gene locus_tag LOCUS_10740 8047 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 8600 8058 gene locus_tag LOCUS_10750 8600 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538528.1 protein_id gnl|my_center|LOCUS_10750 9379 8807 gene locus_tag LOCUS_10760 9379 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 10052 9342 gene locus_tag LOCUS_10770 10052 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 10312 11103 gene locus_tag LOCUS_10780 gene udp 10312 11103 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_10780 11419 11135 gene locus_tag LOCUS_10790 11419 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 13858 11429 gene locus_tag LOCUS_10800 13858 11429 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679109.1 protein_id gnl|my_center|LOCUS_10800 14778 13840 gene locus_tag LOCUS_10810 gene rsgA 14778 13840 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679106.1 protein_id gnl|my_center|LOCUS_10810 15832 14789 gene locus_tag LOCUS_10820 15832 14789 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_10820 16130 15822 gene locus_tag LOCUS_10830 16130 15822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 16912 16127 gene locus_tag LOCUS_10840 16912 16127 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020542.1 protein_id gnl|my_center|LOCUS_10840 17099 17170 gene locus_tag LOCUS_t00200 17099 17170 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17239 17871 gene locus_tag LOCUS_10850 17239 17871 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775255.1 protein_id gnl|my_center|LOCUS_10850 18947 17943 gene locus_tag LOCUS_10860 18947 17943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 20287 18998 gene locus_tag LOCUS_10870 20287 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 21740 20493 gene locus_tag LOCUS_10880 21740 20493 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_10880 22343 22008 gene locus_tag LOCUS_10890 22343 22008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 22802 22386 gene locus_tag LOCUS_10900 22802 22386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 25950 23221 gene locus_tag LOCUS_10910 25950 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 27124 26069 gene locus_tag LOCUS_10920 gene queA 27124 26069 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957235.1 protein_id gnl|my_center|LOCUS_10920 28297 27197 gene locus_tag LOCUS_10930 gene ruvB 28297 27197 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679608.1 protein_id gnl|my_center|LOCUS_10930 29016 28387 gene locus_tag LOCUS_10940 gene ruvA 29016 28387 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772102.1 protein_id gnl|my_center|LOCUS_10940 29510 29013 gene locus_tag LOCUS_10950 gene ruvC 29510 29013 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679556.1 protein_id gnl|my_center|LOCUS_10950 30254 29514 gene locus_tag LOCUS_10960 30254 29514 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_10960 31484 30318 gene locus_tag LOCUS_10970 gene hemW 31484 30318 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_10970 32481 31477 gene locus_tag LOCUS_10980 gene lepB 32481 31477 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661914.1 protein_id gnl|my_center|LOCUS_10980 32546 33961 gene locus_tag LOCUS_10990 32546 33961 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658342.1 protein_id gnl|my_center|LOCUS_10990 33984 34457 gene locus_tag LOCUS_11000 gene smpB 33984 34457 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_11000 36185 34623 gene locus_tag LOCUS_11010 36185 34623 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_11010 37627 36254 gene locus_tag LOCUS_11020 37627 36254 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_11020 37794 38252 gene locus_tag LOCUS_11030 37794 38252 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_11030 38318 38527 gene locus_tag LOCUS_11040 38318 38527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 39123 38620 gene locus_tag LOCUS_11050 39123 38620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 39363 39154 gene locus_tag LOCUS_11060 39363 39154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 40262 39393 gene locus_tag LOCUS_11070 40262 39393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 40396 40680 gene locus_tag LOCUS_11080 40396 40680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 40947 41129 gene locus_tag LOCUS_11090 40947 41129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 42882 41119 gene locus_tag LOCUS_11100 42882 41119 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_11100 43647 44303 gene locus_tag LOCUS_11110 43647 44303 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_11110 44938 44309 gene locus_tag LOCUS_11120 44938 44309 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_11120 45849 44950 gene locus_tag LOCUS_11130 45849 44950 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921878.1 protein_id gnl|my_center|LOCUS_11130 46542 45853 gene locus_tag LOCUS_11140 46542 45853 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_11140 46630 47049 gene locus_tag LOCUS_11150 46630 47049 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890423.1 protein_id gnl|my_center|LOCUS_11150 47978 47055 gene locus_tag LOCUS_11160 47978 47055 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654136.1 protein_id gnl|my_center|LOCUS_11160 48903 48019 gene locus_tag LOCUS_11170 48903 48019 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730582.1 protein_id gnl|my_center|LOCUS_11170 51047 49911 gene locus_tag LOCUS_11180 51047 49911 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672105.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11180 51197 51072 gene locus_tag LOCUS_11190 51197 51072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 51850 51477 gene locus_tag LOCUS_tm00010 51850 51477 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 52539 51937 gene locus_tag LOCUS_11200 52539 51937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 52822 54153 gene locus_tag LOCUS_11210 52822 54153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 54990 54202 gene locus_tag LOCUS_11220 54990 54202 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_11220 56273 55368 gene locus_tag LOCUS_11230 gene rbsK 56273 55368 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702891.1 protein_id gnl|my_center|LOCUS_11230 56625 57596 gene locus_tag LOCUS_11240 56625 57596 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_11240 57703 58626 gene locus_tag LOCUS_11250 57703 58626 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_11250 58619 59413 gene locus_tag LOCUS_11260 58619 59413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_11260 61129 59537 gene locus_tag LOCUS_11270 61129 59537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036818.1 protein_id gnl|my_center|LOCUS_11270 61842 61129 gene locus_tag LOCUS_11280 61842 61129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_11280 62014 62691 gene locus_tag LOCUS_11290 62014 62691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 63000 63911 gene locus_tag LOCUS_11300 63000 63911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 64152 64475 gene locus_tag LOCUS_11310 64152 64475 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845276.1 protein_id gnl|my_center|LOCUS_11310 64472 65722 gene locus_tag LOCUS_11320 64472 65722 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_11320 66544 66191 gene locus_tag LOCUS_11330 66544 66191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence12 482 1417 gene locus_tag LOCUS_11340 gene arcC 482 1417 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037995.1 protein_id gnl|my_center|LOCUS_11340 1452 2078 gene locus_tag LOCUS_11350 gene rnhB 1452 2078 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 protein_id gnl|my_center|LOCUS_11350 2343 2092 gene locus_tag LOCUS_11360 2343 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2506 2436 gene locus_tag LOCUS_t00210 2506 2436 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2630 5431 gene locus_tag LOCUS_11370 2630 5431 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679154.1 protein_id gnl|my_center|LOCUS_11370 5491 6525 gene locus_tag LOCUS_11380 5491 6525 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836873.1 protein_id gnl|my_center|LOCUS_11380 6560 7897 gene locus_tag LOCUS_11390 gene ffh 6560 7897 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668253.1 protein_id gnl|my_center|LOCUS_11390 7920 8189 gene locus_tag LOCUS_11400 gene rpsP 7920 8189 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557282.1 protein_id gnl|my_center|LOCUS_11400 8194 8427 gene locus_tag LOCUS_11410 8194 8427 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557283.1 protein_id gnl|my_center|LOCUS_11410 8434 8940 gene locus_tag LOCUS_11420 gene rimM 8434 8940 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670218.1 protein_id gnl|my_center|LOCUS_11420 8937 9668 gene locus_tag LOCUS_11430 gene trmD 8937 9668 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670221.1 protein_id gnl|my_center|LOCUS_11430 9670 10029 gene locus_tag LOCUS_11440 gene rplS 9670 10029 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670222.1 protein_id gnl|my_center|LOCUS_11440 10102 10440 gene locus_tag LOCUS_11450 10102 10440 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_11450 10440 10835 gene locus_tag LOCUS_11460 10440 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680218.1 protein_id gnl|my_center|LOCUS_11460 10832 11317 gene locus_tag LOCUS_11470 gene coaD 10832 11317 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678956.1 protein_id gnl|my_center|LOCUS_11470 11408 11590 gene locus_tag LOCUS_11480 11408 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 11594 11833 gene locus_tag LOCUS_11490 11594 11833 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405458.1 protein_id gnl|my_center|LOCUS_11490 11836 12576 gene locus_tag LOCUS_11500 gene rnc 11836 12576 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_11500 14117 12765 gene locus_tag LOCUS_11510 14117 12765 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_11510 14198 17326 gene locus_tag LOCUS_11520 gene ileS 14198 17326 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_11520 17347 18285 gene locus_tag LOCUS_11530 17347 18285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 18287 19303 gene locus_tag LOCUS_11540 gene trpS 18287 19303 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393419.1 protein_id gnl|my_center|LOCUS_11540 19315 20325 gene locus_tag LOCUS_11550 19315 20325 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986847.1 protein_id gnl|my_center|LOCUS_11550 20427 21488 gene locus_tag LOCUS_11560 20427 21488 CDS product HindVP family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038499775.1 protein_id gnl|my_center|LOCUS_11560 21497 22465 gene locus_tag LOCUS_11570 21497 22465 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114936010.1 protein_id gnl|my_center|LOCUS_11570 22983 22441 gene locus_tag LOCUS_11580 gene thpR 22983 22441 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082411.1 protein_id gnl|my_center|LOCUS_11580 24232 23030 gene locus_tag LOCUS_11590 gene thiI 24232 23030 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680552.1 protein_id gnl|my_center|LOCUS_11590 25343 24222 gene locus_tag LOCUS_11600 25343 24222 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680952.1 protein_id gnl|my_center|LOCUS_11600 26474 25464 gene locus_tag LOCUS_11610 26474 25464 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680953.1 protein_id gnl|my_center|LOCUS_11610 29095 26540 gene locus_tag LOCUS_11620 29095 26540 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971578.1 protein_id gnl|my_center|LOCUS_11620 30422 29103 gene locus_tag LOCUS_11630 gene hisS 30422 29103 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679075.1 protein_id gnl|my_center|LOCUS_11630 30571 31764 gene locus_tag LOCUS_11640 gene pcnB 30571 31764 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669419.1 protein_id gnl|my_center|LOCUS_11640 32641 31787 gene locus_tag LOCUS_11650 32641 31787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_11650 32745 34049 gene locus_tag LOCUS_11660 gene rsxC 32745 34049 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082948.1 protein_id gnl|my_center|LOCUS_11660 34046 35110 gene locus_tag LOCUS_11670 34046 35110 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583454.1 protein_id gnl|my_center|LOCUS_11670 35107 35667 gene locus_tag LOCUS_11680 35107 35667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 35664 36347 gene locus_tag LOCUS_11690 35664 36347 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_11690 36344 36937 gene locus_tag LOCUS_11700 gene rsxA 36344 36937 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_11700 36950 37750 gene locus_tag LOCUS_11710 36950 37750 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_11710 37810 39621 gene locus_tag LOCUS_11720 37810 39621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 39618 40697 gene locus_tag LOCUS_11730 gene prfB 39618 40697 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881199.1 protein_id gnl|my_center|LOCUS_11730 40698 41972 gene locus_tag LOCUS_11740 40698 41972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 41983 42837 gene locus_tag LOCUS_11750 gene ftsY 41983 42837 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668333.1 protein_id gnl|my_center|LOCUS_11750 42842 43612 gene locus_tag LOCUS_11760 42842 43612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 43626 44840 gene locus_tag LOCUS_11770 43626 44840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679815.1 protein_id gnl|my_center|LOCUS_11770 44827 45591 gene locus_tag LOCUS_11780 gene lolD 44827 45591 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947993.1 protein_id gnl|my_center|LOCUS_11780 45606 46790 gene locus_tag LOCUS_11790 45606 46790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 46810 47733 gene locus_tag LOCUS_11800 46810 47733 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_11800 49043 47775 gene locus_tag LOCUS_11810 49043 47775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 49153 49647 gene locus_tag LOCUS_11820 49153 49647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 49592 50158 gene locus_tag LOCUS_11830 49592 50158 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679118.1 protein_id gnl|my_center|LOCUS_11830 50527 52092 gene locus_tag LOCUS_11840 50527 52092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 52588 52232 gene locus_tag LOCUS_11850 gene aroH 52588 52232 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_11850 52929 52585 gene locus_tag LOCUS_11860 52929 52585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 53059 54363 gene locus_tag LOCUS_11870 53059 54363 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_11870 54417 55814 gene locus_tag LOCUS_11880 54417 55814 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808893.1 protein_id gnl|my_center|LOCUS_11880 56093 57487 gene locus_tag LOCUS_11890 56093 57487 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 protein_id gnl|my_center|LOCUS_11890 57618 57691 gene locus_tag LOCUS_t00220 57618 57691 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence13 1075 275 gene locus_tag LOCUS_11900 1075 275 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682054.1 protein_id gnl|my_center|LOCUS_11900 1153 1890 gene locus_tag LOCUS_11910 1153 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2452 1856 gene locus_tag LOCUS_11920 gene pgsA 2452 1856 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667297.1 protein_id gnl|my_center|LOCUS_11920 4028 2514 gene locus_tag LOCUS_11930 4028 2514 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_11930 5882 4134 gene locus_tag LOCUS_11940 gene thrS 5882 4134 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665762.1 protein_id gnl|my_center|LOCUS_11940 6895 6014 gene locus_tag LOCUS_11950 gene ispH 6895 6014 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682405.1 protein_id gnl|my_center|LOCUS_11950 7476 6994 gene locus_tag LOCUS_11960 7476 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 8999 7701 gene locus_tag LOCUS_11970 8999 7701 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678796.1 protein_id gnl|my_center|LOCUS_11970 10397 9012 gene locus_tag LOCUS_11980 10397 9012 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_11980 11526 10900 gene locus_tag LOCUS_11990 11526 10900 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775452.1 protein_id gnl|my_center|LOCUS_11990 11670 12632 gene locus_tag LOCUS_12000 11670 12632 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_12000 14031 12925 gene locus_tag LOCUS_12010 14031 12925 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965544.1 protein_id gnl|my_center|LOCUS_12010 14190 14264 gene locus_tag LOCUS_t00230 14190 14264 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14330 14992 gene locus_tag LOCUS_12020 14330 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 15117 15662 gene locus_tag LOCUS_12030 15117 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 16496 15708 gene locus_tag LOCUS_12040 16496 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 16903 17349 gene locus_tag LOCUS_12050 16903 17349 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073962.1 protein_id gnl|my_center|LOCUS_12050 17414 18418 gene locus_tag LOCUS_12060 17414 18418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12060 19802 18906 gene locus_tag LOCUS_12070 19802 18906 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_12070 20538 19804 gene locus_tag LOCUS_12080 20538 19804 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670690.1 protein_id gnl|my_center|LOCUS_12080 20840 22105 gene locus_tag LOCUS_12090 20840 22105 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972818.1 protein_id gnl|my_center|LOCUS_12090 22193 23074 gene locus_tag LOCUS_12100 22193 23074 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329342.1 protein_id gnl|my_center|LOCUS_12100 23071 23919 gene locus_tag LOCUS_12110 23071 23919 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288133.1 protein_id gnl|my_center|LOCUS_12110 23972 25162 gene locus_tag LOCUS_12120 gene aar 23972 25162 CDS product bifunctional L-alanine/L-glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_12120 25172 28153 gene locus_tag LOCUS_12130 25172 28153 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_12130 29476 28190 gene locus_tag LOCUS_12140 29476 28190 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_12140 29563 30681 gene locus_tag LOCUS_12150 29563 30681 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_12150 30865 30665 gene locus_tag LOCUS_12160 30865 30665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 33575 30882 gene locus_tag LOCUS_12170 33575 30882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 35174 33588 gene locus_tag LOCUS_12180 35174 33588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 37998 35188 gene locus_tag LOCUS_12190 37998 35188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 38335 38039 gene locus_tag LOCUS_12200 38335 38039 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_12200 39662 38544 gene locus_tag LOCUS_12210 39662 38544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 40492 39677 gene locus_tag LOCUS_12220 40492 39677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 41691 40537 gene locus_tag LOCUS_12230 41691 40537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 42410 41688 gene locus_tag LOCUS_12240 gene tcyL 42410 41688 CDS product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158223.1 protein_id gnl|my_center|LOCUS_12240 43838 42561 gene locus_tag LOCUS_12250 43838 42561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 44575 43832 gene locus_tag LOCUS_12260 gene rgaR 44575 43832 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_12260 46899 44593 gene locus_tag LOCUS_12270 46899 44593 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 protein_id gnl|my_center|LOCUS_12270 47051 47138 gene locus_tag LOCUS_t00240 47051 47138 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 48509 47505 gene locus_tag LOCUS_12280 48509 47505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 49830 48805 gene locus_tag LOCUS_12290 49830 48805 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_12290 50594 49854 gene locus_tag LOCUS_12300 50594 49854 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475861.1 protein_id gnl|my_center|LOCUS_12300 51865 51014 gene locus_tag LOCUS_12310 51865 51014 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_12310 52809 51862 gene locus_tag LOCUS_12320 52809 51862 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_12320 54076 52823 gene locus_tag LOCUS_12330 54076 52823 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947114.1 protein_id gnl|my_center|LOCUS_12330 55767 54073 gene locus_tag LOCUS_12340 55767 54073 CDS product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471779.1 protein_id gnl|my_center|LOCUS_12340 56759 55764 gene locus_tag LOCUS_12350 gene malR 56759 55764 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219042.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence14 173 1711 gene locus_tag LOCUS_12360 173 1711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_12360 1708 2838 gene locus_tag LOCUS_12370 1708 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2835 3776 gene locus_tag LOCUS_12380 2835 3776 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_12380 3859 4947 gene locus_tag LOCUS_12390 3859 4947 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964021.1 protein_id gnl|my_center|LOCUS_12390 5031 6566 gene locus_tag LOCUS_12400 5031 6566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920612.1 protein_id gnl|my_center|LOCUS_12400 6566 7675 gene locus_tag LOCUS_12410 6566 7675 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723915.1 protein_id gnl|my_center|LOCUS_12410 7672 8574 gene locus_tag LOCUS_12420 gene nupQ 7672 8574 CDS product guanosine ABC transporter permease NupQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228827.1 protein_id gnl|my_center|LOCUS_12420 9706 8786 gene locus_tag LOCUS_12430 9706 8786 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925117.1 protein_id gnl|my_center|LOCUS_12430 10329 9727 gene locus_tag LOCUS_12440 10329 9727 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485245.1 protein_id gnl|my_center|LOCUS_12440 11094 10330 gene locus_tag LOCUS_12450 gene deoD 11094 10330 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_12450 11293 12330 gene locus_tag LOCUS_12460 gene ispG 11293 12330 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678768.1 protein_id gnl|my_center|LOCUS_12460 12327 15161 gene locus_tag LOCUS_12470 gene uvrA 12327 15161 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956862.1 protein_id gnl|my_center|LOCUS_12470 15164 18391 gene locus_tag LOCUS_12480 15164 18391 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682325.1 protein_id gnl|my_center|LOCUS_12480 18399 19373 gene locus_tag LOCUS_12490 18399 19373 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678733.1 protein_id gnl|my_center|LOCUS_12490 19360 21537 gene locus_tag LOCUS_12500 19360 21537 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678734.1 protein_id gnl|my_center|LOCUS_12500 21567 22034 gene locus_tag LOCUS_12510 gene ybeY 21567 22034 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668517.1 protein_id gnl|my_center|LOCUS_12510 23135 22029 gene locus_tag LOCUS_12520 23135 22029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 23164 24525 gene locus_tag LOCUS_12530 23164 24525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 24549 25007 gene locus_tag LOCUS_12540 24549 25007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 25293 25108 gene locus_tag LOCUS_12550 25293 25108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 26388 25354 gene locus_tag LOCUS_12560 26388 25354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 27007 26402 gene locus_tag LOCUS_12570 27007 26402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 27210 28109 gene locus_tag LOCUS_12580 gene folD 27210 28109 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404576.1 protein_id gnl|my_center|LOCUS_12580 28106 29425 gene locus_tag LOCUS_12590 gene miaB 28106 29425 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679246.1 protein_id gnl|my_center|LOCUS_12590 29446 30213 gene locus_tag LOCUS_12600 29446 30213 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675715.1 protein_id gnl|my_center|LOCUS_12600 30311 32149 gene locus_tag LOCUS_12610 gene typA 30311 32149 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_12610 32301 32978 gene locus_tag LOCUS_12620 32301 32978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 33333 33785 gene locus_tag LOCUS_12630 gene mraZ 33333 33785 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678680.1 protein_id gnl|my_center|LOCUS_12630 33788 34735 gene locus_tag LOCUS_12640 gene rsmH 33788 34735 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678681.1 protein_id gnl|my_center|LOCUS_12640 34746 35081 gene locus_tag LOCUS_12650 34746 35081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 35116 36336 gene locus_tag LOCUS_12660 gene ftsW 35116 36336 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677685.1 protein_id gnl|my_center|LOCUS_12660 36317 37063 gene locus_tag LOCUS_12670 36317 37063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 37075 38319 gene locus_tag LOCUS_12680 gene ftsA 37075 38319 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_12680 38345 39607 gene locus_tag LOCUS_12690 38345 39607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 39591 40541 gene locus_tag LOCUS_12700 gene xerD 39591 40541 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294386.1 protein_id gnl|my_center|LOCUS_12700 41112 40576 gene locus_tag LOCUS_12710 41112 40576 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_12710 41252 42241 gene locus_tag LOCUS_12720 41252 42241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 42238 43209 gene locus_tag LOCUS_12730 42238 43209 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678705.1 protein_id gnl|my_center|LOCUS_12730 43206 43739 gene locus_tag LOCUS_12740 gene hslV 43206 43739 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668456.1 protein_id gnl|my_center|LOCUS_12740 43741 45168 gene locus_tag LOCUS_12750 gene hslU 43741 45168 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677705.1 protein_id gnl|my_center|LOCUS_12750 45259 46635 gene locus_tag LOCUS_12760 45259 46635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 46784 47791 gene locus_tag LOCUS_12770 gene gap 46784 47791 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_12770 47888 49069 gene locus_tag LOCUS_12780 47888 49069 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010255334.1 protein_id gnl|my_center|LOCUS_12780 49079 49831 gene locus_tag LOCUS_12790 gene tpiA 49079 49831 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_12790 49860 50162 gene locus_tag LOCUS_12800 49860 50162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 50227 50652 gene locus_tag LOCUS_12810 50227 50652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 50663 51694 gene locus_tag LOCUS_12820 50663 51694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 51731 52177 gene locus_tag LOCUS_12830 gene nusB 51731 52177 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_12830 52155 52910 gene locus_tag LOCUS_12840 gene map 52155 52910 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670900.1 protein_id gnl|my_center|LOCUS_12840 52928 53545 gene locus_tag LOCUS_12850 52928 53545 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657101.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence15 1623 202 gene locus_tag LOCUS_12860 1623 202 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 protein_id gnl|my_center|LOCUS_12860 1821 2480 gene locus_tag LOCUS_12870 1821 2480 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108273.1 protein_id gnl|my_center|LOCUS_12870 2477 2779 gene locus_tag LOCUS_12880 2477 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2772 3593 gene locus_tag LOCUS_12890 2772 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3605 4489 gene locus_tag LOCUS_12900 3605 4489 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460597.1 protein_id gnl|my_center|LOCUS_12900 4538 5575 gene locus_tag LOCUS_12910 4538 5575 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679269.1 protein_id gnl|my_center|LOCUS_12910 5640 6494 gene locus_tag LOCUS_12920 5640 6494 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_12920 6487 8133 gene locus_tag LOCUS_12930 gene recN 6487 8133 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_12930 8474 10171 gene locus_tag LOCUS_12940 8474 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 10244 11470 gene locus_tag LOCUS_12950 10244 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 11563 16380 gene locus_tag LOCUS_12960 11563 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 16826 16437 gene locus_tag LOCUS_12970 16826 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 17164 17871 gene locus_tag LOCUS_12980 17164 17871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 17868 19499 gene locus_tag LOCUS_12990 17868 19499 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965710.1 protein_id gnl|my_center|LOCUS_12990 19532 21355 gene locus_tag LOCUS_13000 gene malZ 19532 21355 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257409.1 protein_id gnl|my_center|LOCUS_13000 22926 21676 gene locus_tag LOCUS_13010 22926 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 23103 23474 gene locus_tag LOCUS_13020 23103 23474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 23685 24539 gene locus_tag LOCUS_13030 23685 24539 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670326.1 protein_id gnl|my_center|LOCUS_13030 24929 25147 gene locus_tag LOCUS_13040 24929 25147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 26293 25400 gene locus_tag LOCUS_13050 26293 25400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 26931 29627 gene locus_tag LOCUS_13060 gene ppdK 26931 29627 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_13060 30608 29787 gene locus_tag LOCUS_13070 30608 29787 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092770593.1 protein_id gnl|my_center|LOCUS_13070 31470 30610 gene locus_tag LOCUS_13080 31470 30610 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085515.1 protein_id gnl|my_center|LOCUS_13080 32859 31594 gene locus_tag LOCUS_13090 32859 31594 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213190.1 protein_id gnl|my_center|LOCUS_13090 34055 32967 gene locus_tag LOCUS_13100 34055 32967 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925278.1 protein_id gnl|my_center|LOCUS_13100 35347 34217 gene locus_tag LOCUS_13110 35347 34217 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_13110 36393 35347 gene locus_tag LOCUS_13120 36393 35347 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_13120 36657 37349 gene locus_tag LOCUS_13130 36657 37349 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287585.1 protein_id gnl|my_center|LOCUS_13130 38586 37513 gene locus_tag LOCUS_13140 38586 37513 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939569.1 protein_id gnl|my_center|LOCUS_13140 38989 40296 gene locus_tag LOCUS_13150 38989 40296 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_13150 40268 40663 gene locus_tag LOCUS_13160 40268 40663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 40883 40810 gene locus_tag LOCUS_t00250 40883 40810 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 41080 41346 gene locus_tag LOCUS_13170 41080 41346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 41343 42353 gene locus_tag LOCUS_13180 gene tsaD 41343 42353 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680472.1 protein_id gnl|my_center|LOCUS_13180 42446 42518 gene locus_tag LOCUS_t00260 42446 42518 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 42532 42603 gene locus_tag LOCUS_t00270 42532 42603 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 42729 44363 gene locus_tag LOCUS_13190 42729 44363 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669145.1 protein_id gnl|my_center|LOCUS_13190 44360 45109 gene locus_tag LOCUS_13200 44360 45109 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_13200 45693 45217 gene locus_tag LOCUS_13210 45693 45217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 46868 45825 gene locus_tag LOCUS_13220 46868 45825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 46975 47184 gene locus_tag LOCUS_13230 gene rpsU 46975 47184 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673965.1 protein_id gnl|my_center|LOCUS_13230 48475 47420 gene locus_tag LOCUS_13240 48475 47420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence16 1411 116 gene locus_tag LOCUS_13250 1411 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2505 1594 gene locus_tag LOCUS_13260 2505 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2679 4049 gene locus_tag LOCUS_13270 2679 4049 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994247.1 protein_id gnl|my_center|LOCUS_13270 4439 4194 gene locus_tag LOCUS_13280 4439 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4461 4625 gene locus_tag LOCUS_13290 4461 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 5141 4731 gene locus_tag LOCUS_13300 gene rpsI 5141 4731 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682117.1 protein_id gnl|my_center|LOCUS_13300 5581 5153 gene locus_tag LOCUS_13310 gene rplM 5581 5153 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682116.1 protein_id gnl|my_center|LOCUS_13310 8311 5798 gene locus_tag LOCUS_13320 8311 5798 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680253.1 protein_id gnl|my_center|LOCUS_13320 9788 8328 gene locus_tag LOCUS_13330 gene rimO 9788 8328 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680609.1 protein_id gnl|my_center|LOCUS_13330 10641 9916 gene locus_tag LOCUS_13340 10641 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 10842 12167 gene locus_tag LOCUS_13350 gene aroA 10842 12167 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883672.1 protein_id gnl|my_center|LOCUS_13350 12195 12665 gene locus_tag LOCUS_13360 12195 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 12667 13530 gene locus_tag LOCUS_13370 12667 13530 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244361.1 protein_id gnl|my_center|LOCUS_13370 16700 13488 gene locus_tag LOCUS_13380 16700 13488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 19531 16697 gene locus_tag LOCUS_13390 19531 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 19618 20742 gene locus_tag LOCUS_13400 19618 20742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 22067 20739 gene locus_tag LOCUS_13410 22067 20739 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_13410 22179 22109 gene locus_tag LOCUS_t00280 22179 22109 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22325 22573 gene locus_tag LOCUS_13420 22325 22573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 22573 23430 gene locus_tag LOCUS_13430 22573 23430 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_13430 23433 24080 gene locus_tag LOCUS_13440 23433 24080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 25317 24028 gene locus_tag LOCUS_13450 25317 24028 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508232.1 protein_id gnl|my_center|LOCUS_13450 26597 25332 gene locus_tag LOCUS_13460 26597 25332 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273825.1 protein_id gnl|my_center|LOCUS_13460 27294 26590 gene locus_tag LOCUS_13470 27294 26590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_13470 28118 27306 gene locus_tag LOCUS_13480 28118 27306 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_13480 28341 29063 gene locus_tag LOCUS_13490 28341 29063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 29366 29205 gene locus_tag LOCUS_13500 29366 29205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 29679 29344 gene locus_tag LOCUS_13510 29679 29344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 30628 29702 gene locus_tag LOCUS_13520 30628 29702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 31453 30692 gene locus_tag LOCUS_13530 31453 30692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 32261 31455 gene locus_tag LOCUS_13540 32261 31455 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_13540 33107 32265 gene locus_tag LOCUS_13550 gene kduI 33107 32265 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098576.1 protein_id gnl|my_center|LOCUS_13550 33286 33417 gene locus_tag LOCUS_13560 33286 33417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 33585 34604 gene locus_tag LOCUS_13570 33585 34604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 34620 35522 gene locus_tag LOCUS_13580 34620 35522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 35649 36419 gene locus_tag LOCUS_13590 35649 36419 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_13590 36667 36939 gene locus_tag LOCUS_13600 36667 36939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 36921 37526 gene locus_tag LOCUS_13610 36921 37526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 37647 37728 gene locus_tag LOCUS_t00290 37647 37728 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38516 37875 gene locus_tag LOCUS_13620 38516 37875 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_13620 39351 38572 gene locus_tag LOCUS_13630 39351 38572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185649.1 protein_id gnl|my_center|LOCUS_13630 40136 39351 gene locus_tag LOCUS_13640 40136 39351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_13640 41125 40133 gene locus_tag LOCUS_13650 41125 40133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 42045 41125 gene locus_tag LOCUS_13660 42045 41125 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941427.1 protein_id gnl|my_center|LOCUS_13660 43371 42208 gene locus_tag LOCUS_13670 43371 42208 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_13670 43551 44975 gene locus_tag LOCUS_13680 43551 44975 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence17 500 1801 gene locus_tag LOCUS_13690 500 1801 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_13690 4732 1952 gene locus_tag LOCUS_13700 gene secA 4732 1952 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679596.1 protein_id gnl|my_center|LOCUS_13700 4905 5396 gene locus_tag LOCUS_13710 4905 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 5436 6533 gene locus_tag LOCUS_13720 5436 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 6530 7786 gene locus_tag LOCUS_13730 6530 7786 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_13730 7783 9171 gene locus_tag LOCUS_13740 7783 9171 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_13740 9164 11281 gene locus_tag LOCUS_13750 9164 11281 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679730.1 protein_id gnl|my_center|LOCUS_13750 11313 12038 gene locus_tag LOCUS_13760 11313 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 12194 12454 gene locus_tag LOCUS_13770 12194 12454 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670325.1 protein_id gnl|my_center|LOCUS_13770 13663 12500 gene locus_tag LOCUS_13780 13663 12500 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865312.1 protein_id gnl|my_center|LOCUS_13780 14770 13676 gene locus_tag LOCUS_13790 14770 13676 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146790.1 protein_id gnl|my_center|LOCUS_13790 15885 14767 gene locus_tag LOCUS_13800 15885 14767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 16205 16459 gene locus_tag LOCUS_13810 16205 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 17726 17049 gene locus_tag LOCUS_13820 17726 17049 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_13820 17848 19017 gene locus_tag LOCUS_13830 17848 19017 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670664.1 protein_id gnl|my_center|LOCUS_13830 20962 19307 gene locus_tag LOCUS_13840 20962 19307 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_13840 21137 21682 gene locus_tag LOCUS_13850 21137 21682 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037432.1 protein_id gnl|my_center|LOCUS_13850 22528 21704 gene locus_tag LOCUS_13860 22528 21704 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_13860 23314 22787 gene locus_tag LOCUS_13870 23314 22787 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_13870 24927 23515 gene locus_tag LOCUS_13880 gene citF 24927 23515 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 protein_id gnl|my_center|LOCUS_13880 25807 24941 gene locus_tag LOCUS_13890 25807 24941 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679317.1 protein_id gnl|my_center|LOCUS_13890 26085 25804 gene locus_tag LOCUS_13900 gene citD 26085 25804 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669237.1 protein_id gnl|my_center|LOCUS_13900 27326 26082 gene locus_tag LOCUS_13910 27326 26082 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_13910 28876 27395 gene locus_tag LOCUS_13920 28876 27395 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460941.1 protein_id gnl|my_center|LOCUS_13920 30248 28878 gene locus_tag LOCUS_13930 gene glmL 30248 28878 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_13930 30726 30256 gene locus_tag LOCUS_13940 gene glmS 30726 30256 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670492.1 protein_id gnl|my_center|LOCUS_13940 31286 30723 gene locus_tag LOCUS_13950 31286 30723 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_13950 32128 31286 gene locus_tag LOCUS_13960 32128 31286 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_13960 32331 33305 gene locus_tag LOCUS_13970 32331 33305 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_13970 33484 34704 gene locus_tag LOCUS_13980 33484 34704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 34775 36655 gene locus_tag LOCUS_13990 gene ggt 34775 36655 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_13990 36756 38030 gene locus_tag LOCUS_14000 36756 38030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 38041 38187 gene locus_tag LOCUS_14010 38041 38187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 38198 39349 gene locus_tag LOCUS_14020 38198 39349 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779464.1 protein_id gnl|my_center|LOCUS_14020 39364 40020 gene locus_tag LOCUS_14030 39364 40020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 40030 41307 gene locus_tag LOCUS_14040 40030 41307 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016767.1 protein_id gnl|my_center|LOCUS_14040 41321 41470 gene locus_tag LOCUS_14050 41321 41470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 41478 42605 gene locus_tag LOCUS_14060 41478 42605 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779464.1 protein_id gnl|my_center|LOCUS_14060 42716 43588 gene locus_tag LOCUS_14070 42716 43588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 43592 43849 gene locus_tag LOCUS_14080 43592 43849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 43846 44379 gene locus_tag LOCUS_14090 gene cobO 43846 44379 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546229.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence18 813 2486 gene locus_tag LOCUS_14100 813 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2389 3648 gene locus_tag LOCUS_14110 gene galK 2389 3648 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263235.1 protein_id gnl|my_center|LOCUS_14110 4138 3908 gene locus_tag LOCUS_14120 gene rpmB 4138 3908 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556947.1 protein_id gnl|my_center|LOCUS_14120 4859 4206 gene locus_tag LOCUS_14130 4859 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4919 4991 gene locus_tag LOCUS_t00300 4919 4991 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5369 5932 gene locus_tag LOCUS_14140 5369 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 6691 6398 gene locus_tag LOCUS_14150 6691 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 7758 6700 gene locus_tag LOCUS_14160 7758 6700 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_14160 8474 7761 gene locus_tag LOCUS_14170 8474 7761 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_14170 9531 8467 gene locus_tag LOCUS_14180 9531 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 9831 10604 gene locus_tag LOCUS_14190 9831 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 10650 12011 gene locus_tag LOCUS_14200 10650 12011 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666804.1 protein_id gnl|my_center|LOCUS_14200 12133 12208 gene locus_tag LOCUS_t00310 12133 12208 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12593 13477 gene locus_tag LOCUS_14210 12593 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 13643 13434 gene locus_tag LOCUS_14220 13643 13434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 13961 13734 gene locus_tag LOCUS_14230 13961 13734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 14519 15220 gene locus_tag LOCUS_14240 14519 15220 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068586618.1 protein_id gnl|my_center|LOCUS_14240 15217 15522 gene locus_tag LOCUS_14250 15217 15522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 16493 15600 gene locus_tag LOCUS_14260 16493 15600 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014849.1 protein_id gnl|my_center|LOCUS_14260 17404 16490 gene locus_tag LOCUS_14270 17404 16490 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_14270 18450 18037 gene locus_tag LOCUS_14280 18450 18037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 19078 18629 gene locus_tag LOCUS_14290 19078 18629 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575454.1 protein_id gnl|my_center|LOCUS_14290 20012 19083 gene locus_tag LOCUS_14300 20012 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 20071 21000 gene locus_tag LOCUS_14310 20071 21000 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_14310 21140 21673 gene locus_tag LOCUS_14320 21140 21673 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_14320 21734 22501 gene locus_tag LOCUS_14330 21734 22501 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948970.1 protein_id gnl|my_center|LOCUS_14330 22498 23184 gene locus_tag LOCUS_14340 22498 23184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944870.1 protein_id gnl|my_center|LOCUS_14340 24478 23246 gene locus_tag LOCUS_14350 gene tyrS 24478 23246 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682133.1 protein_id gnl|my_center|LOCUS_14350 25809 24481 gene locus_tag LOCUS_14360 25809 24481 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_14360 27280 25802 gene locus_tag LOCUS_14370 gene gltX 27280 25802 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681104.1 protein_id gnl|my_center|LOCUS_14370 29145 27379 gene locus_tag LOCUS_14380 29145 27379 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_14380 30298 29189 gene locus_tag LOCUS_14390 30298 29189 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901552.1 protein_id gnl|my_center|LOCUS_14390 31689 30295 gene locus_tag LOCUS_14400 31689 30295 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_14400 32501 31686 gene locus_tag LOCUS_14410 32501 31686 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_14410 33397 32501 gene locus_tag LOCUS_14420 33397 32501 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_14420 34760 33483 gene locus_tag LOCUS_14430 34760 33483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 35739 34774 gene locus_tag LOCUS_14440 gene cytR 35739 34774 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815292.1 protein_id gnl|my_center|LOCUS_14440 36826 35933 gene locus_tag LOCUS_14450 36826 35933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 37465 36836 gene locus_tag LOCUS_14460 37465 36836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 38723 37467 gene locus_tag LOCUS_14470 38723 37467 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_14470 40054 38915 gene locus_tag LOCUS_14480 40054 38915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 40167 40424 gene locus_tag LOCUS_14490 40167 40424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 41440 40418 gene locus_tag LOCUS_14500 gene lplA 41440 40418 CDS product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209755.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence19 <1 1287 gene locus_tag LOCUS_14510 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272440.1:tRNA (guanosine(37)-N1)-methyltransferase TrmD 2676 1336 gene locus_tag LOCUS_14520 2676 1336 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_14520 2899 3597 gene locus_tag LOCUS_14530 2899 3597 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_14530 3746 4450 gene locus_tag LOCUS_14540 3746 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 5386 4541 gene locus_tag LOCUS_14550 5386 4541 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766212.1 protein_id gnl|my_center|LOCUS_14550 5437 6150 gene locus_tag LOCUS_14560 gene yfcE 5437 6150 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772458.1 protein_id gnl|my_center|LOCUS_14560 6693 6103 gene locus_tag LOCUS_14570 6693 6103 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262803.1 protein_id gnl|my_center|LOCUS_14570 6989 7369 gene locus_tag LOCUS_14580 6989 7369 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_14580 7520 8380 gene locus_tag LOCUS_14590 7520 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 8444 9178 gene locus_tag LOCUS_14600 8444 9178 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_14600 9175 9663 gene locus_tag LOCUS_14610 9175 9663 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045611364.1 protein_id gnl|my_center|LOCUS_14610 9775 10635 gene locus_tag LOCUS_14620 9775 10635 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965836.1 protein_id gnl|my_center|LOCUS_14620 10659 11903 gene locus_tag LOCUS_14630 10659 11903 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948689.1 protein_id gnl|my_center|LOCUS_14630 11900 13297 gene locus_tag LOCUS_14640 11900 13297 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_14640 13428 13895 gene locus_tag LOCUS_14650 13428 13895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14650 13896 14633 gene locus_tag LOCUS_14660 13896 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 15337 16998 gene locus_tag LOCUS_14670 15337 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 17063 18028 gene locus_tag LOCUS_14680 17063 18028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867267.1 protein_id gnl|my_center|LOCUS_14680 18025 18882 gene locus_tag LOCUS_14690 18025 18882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_14690 18897 19898 gene locus_tag LOCUS_14700 18897 19898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_14700 19898 20932 gene locus_tag LOCUS_14710 19898 20932 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_14710 20946 21944 gene locus_tag LOCUS_14720 20946 21944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 23221 24141 gene locus_tag LOCUS_14730 23221 24141 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966220.1 protein_id gnl|my_center|LOCUS_14730 24143 24829 gene locus_tag LOCUS_14740 24143 24829 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862963.1 protein_id gnl|my_center|LOCUS_14740 24829 25290 gene locus_tag LOCUS_14750 24829 25290 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587470.1 protein_id gnl|my_center|LOCUS_14750 25298 25648 gene locus_tag LOCUS_14760 25298 25648 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072849092.1 protein_id gnl|my_center|LOCUS_14760 25775 26773 gene locus_tag LOCUS_14770 25775 26773 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_14770 26908 28119 gene locus_tag LOCUS_14780 26908 28119 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 protein_id gnl|my_center|LOCUS_14780 28257 29552 gene locus_tag LOCUS_14790 28257 29552 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_14790 29630 31039 gene locus_tag LOCUS_14800 29630 31039 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_14800 31179 31631 gene locus_tag LOCUS_14810 31179 31631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 31633 32091 gene locus_tag LOCUS_14820 31633 32091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 32342 32112 gene locus_tag LOCUS_14830 32342 32112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 32863 32345 gene locus_tag LOCUS_14840 32863 32345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 33069 32860 gene locus_tag LOCUS_14850 33069 32860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 33260 34615 gene locus_tag LOCUS_14860 33260 34615 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213190.1 protein_id gnl|my_center|LOCUS_14860 34661 35581 gene locus_tag LOCUS_14870 34661 35581 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972367.1 protein_id gnl|my_center|LOCUS_14870 35571 36428 gene locus_tag LOCUS_14880 35571 36428 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 protein_id gnl|my_center|LOCUS_14880 36454 37287 gene locus_tag LOCUS_14890 36454 37287 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_14890 37312 38313 gene locus_tag LOCUS_14900 37312 38313 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868853.1 protein_id gnl|my_center|LOCUS_14900 39529 38294 gene locus_tag LOCUS_14910 39529 38294 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence20 1130 222 gene locus_tag LOCUS_14920 1130 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 2186 1143 gene locus_tag LOCUS_14930 gene araR 2186 1143 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_14930 4610 2442 gene locus_tag LOCUS_14940 4610 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 4780 6342 gene locus_tag LOCUS_14950 4780 6342 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287286.1 protein_id gnl|my_center|LOCUS_14950 6344 7057 gene locus_tag LOCUS_14960 6344 7057 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286765.1 protein_id gnl|my_center|LOCUS_14960 7054 8517 gene locus_tag LOCUS_14970 gene araA 7054 8517 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082981.1 protein_id gnl|my_center|LOCUS_14970 9454 8510 gene locus_tag LOCUS_14980 gene pfkB 9454 8510 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_14980 9984 9478 gene locus_tag LOCUS_14990 9984 9478 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_14990 12201 10375 gene locus_tag LOCUS_15000 12201 10375 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401212.1 protein_id gnl|my_center|LOCUS_15000 12414 14552 gene locus_tag LOCUS_15010 12414 14552 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943959.1 protein_id gnl|my_center|LOCUS_15010 14549 16015 gene locus_tag LOCUS_15020 14549 16015 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679112.1 protein_id gnl|my_center|LOCUS_15020 16129 16713 gene locus_tag LOCUS_15030 16129 16713 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564519.1 protein_id gnl|my_center|LOCUS_15030 16719 17483 gene locus_tag LOCUS_15040 16719 17483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681925.1 protein_id gnl|my_center|LOCUS_15040 17480 18214 gene locus_tag LOCUS_15050 17480 18214 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_15050 18488 18940 gene locus_tag LOCUS_15060 18488 18940 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 protein_id gnl|my_center|LOCUS_15060 20039 19269 gene locus_tag LOCUS_15070 20039 19269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 21140 20052 gene locus_tag LOCUS_15080 21140 20052 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803813.1 protein_id gnl|my_center|LOCUS_15080 22633 21137 gene locus_tag LOCUS_15090 22633 21137 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_15090 23151 22642 gene locus_tag LOCUS_15100 23151 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 24487 23474 gene locus_tag LOCUS_15110 24487 23474 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368541.1 protein_id gnl|my_center|LOCUS_15110 25511 24504 gene locus_tag LOCUS_15120 25511 24504 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_15120 25788 26744 gene locus_tag LOCUS_15130 25788 26744 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819224.1 protein_id gnl|my_center|LOCUS_15130 27582 26767 gene locus_tag LOCUS_15140 27582 26767 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_15140 30543 27589 gene locus_tag LOCUS_15150 gene ebgA 30543 27589 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706828.1 protein_id gnl|my_center|LOCUS_15150 30764 31594 gene locus_tag LOCUS_15160 30764 31594 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_15160 31623 32150 gene locus_tag LOCUS_15170 31623 32150 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043263.1 protein_id gnl|my_center|LOCUS_15170 32143 33129 gene locus_tag LOCUS_15180 32143 33129 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989747.1 protein_id gnl|my_center|LOCUS_15180 33126 34109 gene locus_tag LOCUS_15190 33126 34109 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287135.1 protein_id gnl|my_center|LOCUS_15190 34106 34837 gene locus_tag LOCUS_15200 gene surE 34106 34837 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880503.1 protein_id gnl|my_center|LOCUS_15200 35332 34892 gene locus_tag LOCUS_15210 35332 34892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 36171 35644 gene locus_tag LOCUS_15220 36171 35644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 37070 36168 gene locus_tag LOCUS_15230 37070 36168 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_15230 38227 37262 gene locus_tag LOCUS_15240 gene msrB 38227 37262 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866624.1 protein_id gnl|my_center|LOCUS_15240 38843 38364 gene locus_tag LOCUS_15250 38843 38364 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052318.1 protein_id gnl|my_center|LOCUS_15250 39190 39020 gene locus_tag LOCUS_15260 39190 39020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence21 907 323 gene locus_tag LOCUS_15270 907 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1037 1405 gene locus_tag LOCUS_15280 gene rplU 1037 1405 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_15280 1418 1672 gene locus_tag LOCUS_15290 gene rpmA 1418 1672 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412574.1 protein_id gnl|my_center|LOCUS_15290 1691 2758 gene locus_tag LOCUS_15300 gene obgE 1691 2758 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679468.1 protein_id gnl|my_center|LOCUS_15300 2763 3389 gene locus_tag LOCUS_15310 2763 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15310 3361 4050 gene locus_tag LOCUS_15320 3361 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4044 4631 gene locus_tag LOCUS_15330 4044 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 4631 4972 gene locus_tag LOCUS_15340 gene rsfS 4631 4972 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679464.1 protein_id gnl|my_center|LOCUS_15340 6558 4990 gene locus_tag LOCUS_15350 6558 4990 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_15350 7378 6560 gene locus_tag LOCUS_15360 7378 6560 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116510.1 protein_id gnl|my_center|LOCUS_15360 7630 8922 gene locus_tag LOCUS_15370 7630 8922 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975844.1 protein_id gnl|my_center|LOCUS_15370 9003 9932 gene locus_tag LOCUS_15380 9003 9932 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_15380 9945 10826 gene locus_tag LOCUS_15390 9945 10826 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_15390 10836 11414 gene locus_tag LOCUS_15400 gene yihX 10836 11414 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209011.1 protein_id gnl|my_center|LOCUS_15400 12313 11465 gene locus_tag LOCUS_15410 12313 11465 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_15410 12384 13460 gene locus_tag LOCUS_15420 12384 13460 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 protein_id gnl|my_center|LOCUS_15420 13541 14320 gene locus_tag LOCUS_15430 13541 14320 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258296.1 protein_id gnl|my_center|LOCUS_15430 14317 15861 gene locus_tag LOCUS_15440 14317 15861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 18206 15891 gene locus_tag LOCUS_15450 18206 15891 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 protein_id gnl|my_center|LOCUS_15450 18357 21155 gene locus_tag LOCUS_15460 18357 21155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 21172 23292 gene locus_tag LOCUS_15470 21172 23292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 23398 24231 gene locus_tag LOCUS_15480 23398 24231 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_15480 24763 25671 gene locus_tag LOCUS_15490 24763 25671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 25742 25906 gene locus_tag LOCUS_15500 25742 25906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 26161 26757 gene locus_tag LOCUS_15510 26161 26757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 26894 28687 gene locus_tag LOCUS_15520 26894 28687 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380507.1 protein_id gnl|my_center|LOCUS_15520 28684 29604 gene locus_tag LOCUS_15530 28684 29604 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462918.1 protein_id gnl|my_center|LOCUS_15530 29641 30480 gene locus_tag LOCUS_15540 29641 30480 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804394.1 protein_id gnl|my_center|LOCUS_15540 30497 31345 gene locus_tag LOCUS_15550 30497 31345 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896272.1 protein_id gnl|my_center|LOCUS_15550 31350 32300 gene locus_tag LOCUS_15560 31350 32300 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232624.1 protein_id gnl|my_center|LOCUS_15560 32302 32793 gene locus_tag LOCUS_15570 32302 32793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 33731 32844 gene locus_tag LOCUS_15580 33731 32844 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931305.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence22 1248 670 gene locus_tag LOCUS_15590 1248 670 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603095.1 protein_id gnl|my_center|LOCUS_15590 1956 1884 gene locus_tag LOCUS_t00320 1956 1884 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2101 3366 gene locus_tag LOCUS_15600 2101 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 3385 4602 gene locus_tag LOCUS_15610 3385 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4654 6225 gene locus_tag LOCUS_15620 gene lysS 4654 6225 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680521.1 protein_id gnl|my_center|LOCUS_15620 7046 6483 gene locus_tag LOCUS_15630 7046 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 8415 7114 gene locus_tag LOCUS_15640 8415 7114 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_15640 9492 8599 gene locus_tag LOCUS_15650 gene era 9492 8599 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679589.1 protein_id gnl|my_center|LOCUS_15650 9598 10179 gene locus_tag LOCUS_15660 9598 10179 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667667.1 protein_id gnl|my_center|LOCUS_15660 10229 12463 gene locus_tag LOCUS_15670 10229 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 12464 12646 gene locus_tag LOCUS_15680 12464 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 12693 13697 gene locus_tag LOCUS_15690 12693 13697 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680574.1 protein_id gnl|my_center|LOCUS_15690 13840 14943 gene locus_tag LOCUS_15700 gene gcvT 13840 14943 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_15700 15214 16554 gene locus_tag LOCUS_15710 15214 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 16594 18891 gene locus_tag LOCUS_15720 16594 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 19091 20629 gene locus_tag LOCUS_15730 19091 20629 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_15730 20610 21218 gene locus_tag LOCUS_15740 20610 21218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 21255 22475 gene locus_tag LOCUS_15750 21255 22475 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_15750 22615 23613 gene locus_tag LOCUS_15760 gene pta 22615 23613 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666863.1 protein_id gnl|my_center|LOCUS_15760 25259 24045 gene locus_tag LOCUS_15770 25259 24045 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498593.1 protein_id gnl|my_center|LOCUS_15770 26557 25280 gene locus_tag LOCUS_15780 26557 25280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 26556 26870 gene locus_tag LOCUS_15790 26556 26870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 27011 27904 gene locus_tag LOCUS_15800 gene rsmA 27011 27904 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682389.1 protein_id gnl|my_center|LOCUS_15800 27901 29280 gene locus_tag LOCUS_15810 gene mtaB 27901 29280 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679581.1 protein_id gnl|my_center|LOCUS_15810 29378 30304 gene locus_tag LOCUS_15820 29378 30304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 30273 31172 gene locus_tag LOCUS_15830 30273 31172 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_15830 31169 33007 gene locus_tag LOCUS_15840 gene argS 31169 33007 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence23 1904 120 gene locus_tag LOCUS_15850 gene aspS 1904 120 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679265.1 protein_id gnl|my_center|LOCUS_15850 2031 2675 gene locus_tag LOCUS_15860 2031 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2672 3388 gene locus_tag LOCUS_15870 2672 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 4492 3548 gene locus_tag LOCUS_15880 4492 3548 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_15880 5322 4489 gene locus_tag LOCUS_15890 5322 4489 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_15890 5547 7268 gene locus_tag LOCUS_15900 5547 7268 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_15900 7398 8057 gene locus_tag LOCUS_15910 7398 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 8662 8153 gene locus_tag LOCUS_15920 8662 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 8863 9954 gene locus_tag LOCUS_15930 8863 9954 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_15930 10655 9978 gene locus_tag LOCUS_15940 10655 9978 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666681.1 protein_id gnl|my_center|LOCUS_15940 11160 11759 gene locus_tag LOCUS_15950 11160 11759 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669797.1 protein_id gnl|my_center|LOCUS_15950 13747 11888 gene locus_tag LOCUS_15960 gene htpG 13747 11888 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957241.1 protein_id gnl|my_center|LOCUS_15960 14964 13849 gene locus_tag LOCUS_15970 14964 13849 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975296.1 protein_id gnl|my_center|LOCUS_15970 15542 14961 gene locus_tag LOCUS_15980 15542 14961 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_15980 16648 15569 gene locus_tag LOCUS_15990 16648 15569 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166346.1 protein_id gnl|my_center|LOCUS_15990 18789 16645 gene locus_tag LOCUS_16000 18789 16645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 20318 18786 gene locus_tag LOCUS_16010 20318 18786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 21288 20305 gene locus_tag LOCUS_16020 21288 20305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566708.1 protein_id gnl|my_center|LOCUS_16020 23921 21453 gene locus_tag LOCUS_16030 23921 21453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 24595 24119 gene locus_tag LOCUS_16040 24595 24119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 26138 24639 gene locus_tag LOCUS_16050 26138 24639 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_16050 26326 26916 gene locus_tag LOCUS_16060 26326 26916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 28374 27076 gene locus_tag LOCUS_16070 28374 27076 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_16070 29558 28416 gene locus_tag LOCUS_16080 29558 28416 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657215.1 protein_id gnl|my_center|LOCUS_16080 30280 29621 gene locus_tag LOCUS_16090 gene deoC 30280 29621 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 protein_id gnl|my_center|LOCUS_16090 30365 30979 gene locus_tag LOCUS_16100 30365 30979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 31081 31902 gene locus_tag LOCUS_16110 31081 31902 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675041.1 protein_id gnl|my_center|LOCUS_16110 31951 32544 gene locus_tag LOCUS_16120 31951 32544 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678865.1 protein_id gnl|my_center|LOCUS_16120 32631 32717 gene locus_tag LOCUS_t00330 32631 32717 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32729 32817 gene locus_tag LOCUS_t00340 32729 32817 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32822 32897 gene locus_tag LOCUS_t00350 32822 32897 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence24 87 1424 gene locus_tag LOCUS_16130 87 1424 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_16130 1698 2231 gene locus_tag LOCUS_16140 1698 2231 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902046.1 protein_id gnl|my_center|LOCUS_16140 2250 3134 gene locus_tag LOCUS_16150 2250 3134 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_16150 3264 4676 gene locus_tag LOCUS_16160 3264 4676 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_16160 4705 5235 gene locus_tag LOCUS_16170 4705 5235 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666766.1 protein_id gnl|my_center|LOCUS_16170 5225 5959 gene locus_tag LOCUS_16180 5225 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 6282 7625 gene locus_tag LOCUS_16190 gene lpdA 6282 7625 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786461.1 protein_id gnl|my_center|LOCUS_16190 7868 7656 gene locus_tag LOCUS_16200 7868 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 7887 10538 gene locus_tag LOCUS_16210 7887 10538 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678931.1 protein_id gnl|my_center|LOCUS_16210 10647 11561 gene locus_tag LOCUS_16220 10647 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 11803 12480 gene locus_tag LOCUS_16230 11803 12480 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010257677.1 protein_id gnl|my_center|LOCUS_16230 12505 12744 gene locus_tag LOCUS_16240 12505 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 13383 12901 gene locus_tag LOCUS_16250 13383 12901 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_16250 14533 13388 gene locus_tag LOCUS_16260 14533 13388 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_16260 15450 14530 gene locus_tag LOCUS_16270 15450 14530 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679999.1 protein_id gnl|my_center|LOCUS_16270 16346 15450 gene locus_tag LOCUS_16280 16346 15450 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906390.1 protein_id gnl|my_center|LOCUS_16280 16400 16732 gene locus_tag LOCUS_16290 16400 16732 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_16290 16725 17186 gene locus_tag LOCUS_16300 16725 17186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 17378 18445 gene locus_tag LOCUS_16310 17378 18445 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994395.1 protein_id gnl|my_center|LOCUS_16310 18557 19624 gene locus_tag LOCUS_16320 gene hflK 18557 19624 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_16320 19621 20595 gene locus_tag LOCUS_16330 gene hflC 19621 20595 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_16330 20710 23022 gene locus_tag LOCUS_16340 gene metG 20710 23022 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682373.1 protein_id gnl|my_center|LOCUS_16340 23704 23399 gene locus_tag LOCUS_16350 23704 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 25117 23822 gene locus_tag LOCUS_16360 25117 23822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 25385 26647 gene locus_tag LOCUS_16370 25385 26647 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_16370 27679 26867 gene locus_tag LOCUS_16380 27679 26867 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 protein_id gnl|my_center|LOCUS_16380 28411 27746 gene locus_tag LOCUS_16390 28411 27746 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016564.1 protein_id gnl|my_center|LOCUS_16390 29412 28408 gene locus_tag LOCUS_16400 gene metN 29412 28408 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704855.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence25 1828 1577 gene locus_tag LOCUS_16410 1828 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3190 1850 gene locus_tag LOCUS_16420 gene rseP 3190 1850 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680259.1 protein_id gnl|my_center|LOCUS_16420 4353 3187 gene locus_tag LOCUS_16430 gene dxr 4353 3187 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680260.1 protein_id gnl|my_center|LOCUS_16430 5197 4358 gene locus_tag LOCUS_16440 5197 4358 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667742.1 protein_id gnl|my_center|LOCUS_16440 5871 5197 gene locus_tag LOCUS_16450 gene uppS 5871 5197 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675801.1 protein_id gnl|my_center|LOCUS_16450 6425 5871 gene locus_tag LOCUS_16460 gene frr 6425 5871 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675802.1 protein_id gnl|my_center|LOCUS_16460 7383 6541 gene locus_tag LOCUS_16470 gene tsf 7383 6541 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674264.1 protein_id gnl|my_center|LOCUS_16470 8199 7387 gene locus_tag LOCUS_16480 gene rpsB 8199 7387 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680262.1 protein_id gnl|my_center|LOCUS_16480 8854 9006 gene locus_tag LOCUS_16490 8854 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 9483 10871 gene locus_tag LOCUS_16500 9483 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 12463 11009 gene locus_tag LOCUS_16510 12463 11009 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679324.1 protein_id gnl|my_center|LOCUS_16510 12571 14667 gene locus_tag LOCUS_16520 12571 14667 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678989.1 protein_id gnl|my_center|LOCUS_16520 16576 14675 gene locus_tag LOCUS_16530 16576 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 18256 16601 gene locus_tag LOCUS_16540 18256 16601 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_16540 19215 18259 gene locus_tag LOCUS_16550 gene aroC 19215 18259 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_16550 19802 19245 gene locus_tag LOCUS_16560 19802 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 20328 19792 gene locus_tag LOCUS_16570 20328 19792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 20391 21539 gene locus_tag LOCUS_16580 20391 21539 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_16580 22052 21588 gene locus_tag LOCUS_16590 gene nrdR 22052 21588 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678882.1 protein_id gnl|my_center|LOCUS_16590 22473 23135 gene locus_tag LOCUS_16600 22473 23135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 23132 23839 gene locus_tag LOCUS_16610 23132 23839 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879601.1 protein_id gnl|my_center|LOCUS_16610 24774 23875 gene locus_tag LOCUS_16620 24774 23875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 25039 28278 gene locus_tag LOCUS_16630 gene mfd 25039 28278 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678792.1 protein_id gnl|my_center|LOCUS_16630 28321 29127 gene locus_tag LOCUS_16640 gene trmB 28321 29127 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956879.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence26 163 705 gene locus_tag LOCUS_16650 163 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 692 1177 gene locus_tag LOCUS_16660 692 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2252 1629 gene locus_tag LOCUS_16670 2252 1629 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_16670 2835 2236 gene locus_tag LOCUS_16680 2835 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3047 4942 gene locus_tag LOCUS_16690 3047 4942 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_16690 5104 5706 gene locus_tag LOCUS_16700 5104 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 5814 6509 gene locus_tag LOCUS_16710 5814 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 6519 6824 gene locus_tag LOCUS_16720 6519 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 6824 9694 gene locus_tag LOCUS_16730 gene polA 6824 9694 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679321.1 protein_id gnl|my_center|LOCUS_16730 9694 10326 gene locus_tag LOCUS_16740 gene coaE 9694 10326 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679322.1 protein_id gnl|my_center|LOCUS_16740 10313 11479 gene locus_tag LOCUS_16750 10313 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 13164 12112 gene locus_tag LOCUS_16760 13164 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 13836 13273 gene locus_tag LOCUS_16770 gene efp 13836 13273 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671939.1 protein_id gnl|my_center|LOCUS_16770 14917 13928 gene locus_tag LOCUS_16780 14917 13928 CDS product tRNA synthetase, class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680171.1 protein_id gnl|my_center|LOCUS_16780 15054 16499 gene locus_tag LOCUS_16790 gene mnmE 15054 16499 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680027.1 protein_id gnl|my_center|LOCUS_16790 16553 18358 gene locus_tag LOCUS_16800 gene mnmG 16553 18358 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657592.1 protein_id gnl|my_center|LOCUS_16800 18373 19047 gene locus_tag LOCUS_16810 gene rsmG 18373 19047 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121443.1 protein_id gnl|my_center|LOCUS_16810 19091 22126 gene locus_tag LOCUS_16820 19091 22126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 22209 23966 gene locus_tag LOCUS_16830 22209 23966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 23963 25684 gene locus_tag LOCUS_16840 23963 25684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_16840 25711 26451 gene locus_tag LOCUS_16850 25711 26451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence27 649 924 gene locus_tag LOCUS_16860 649 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 952 1464 gene locus_tag LOCUS_16870 gene ssb 952 1464 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669349.1 protein_id gnl|my_center|LOCUS_16870 1484 1768 gene locus_tag LOCUS_16880 gene rpsR 1484 1768 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669347.1 protein_id gnl|my_center|LOCUS_16880 1810 2739 gene locus_tag LOCUS_16890 1810 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2777 3400 gene locus_tag LOCUS_16900 2777 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3487 4878 gene locus_tag LOCUS_16910 gene dnaB 3487 4878 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721677.1 protein_id gnl|my_center|LOCUS_16910 4959 5624 gene locus_tag LOCUS_16920 4959 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 7577 6240 gene locus_tag LOCUS_16930 7577 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 8990 7602 gene locus_tag LOCUS_16940 8990 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 10420 9005 gene locus_tag LOCUS_16950 10420 9005 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355146.1 protein_id gnl|my_center|LOCUS_16950 11419 10529 gene locus_tag LOCUS_16960 11419 10529 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_16960 12375 11431 gene locus_tag LOCUS_16970 12375 11431 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355143.1 protein_id gnl|my_center|LOCUS_16970 13495 12389 gene locus_tag LOCUS_16980 13495 12389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_16980 14276 13515 gene locus_tag LOCUS_16990 14276 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 15514 14363 gene locus_tag LOCUS_17000 15514 14363 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_17000 16183 16001 gene locus_tag LOCUS_17010 16183 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 18982 16487 gene locus_tag LOCUS_17020 18982 16487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 19298 19074 gene locus_tag LOCUS_17030 19298 19074 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_17030 19560 19348 gene locus_tag LOCUS_17040 19560 19348 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_17040 19841 20227 gene locus_tag LOCUS_17050 19841 20227 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_17050 21838 20285 gene locus_tag LOCUS_17060 21838 20285 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957021.1 protein_id gnl|my_center|LOCUS_17060 22695 21835 gene locus_tag LOCUS_17070 22695 21835 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172331.1 protein_id gnl|my_center|LOCUS_17070 22854 24293 gene locus_tag LOCUS_17080 22854 24293 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_17080 24315 25079 gene locus_tag LOCUS_17090 24315 25079 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130487.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence28 663 283 gene locus_tag LOCUS_17100 663 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1088 729 gene locus_tag LOCUS_17110 gene rplT 1088 729 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081652.1 protein_id gnl|my_center|LOCUS_17110 1306 1106 gene locus_tag LOCUS_17120 gene rpmI 1306 1106 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556787.1 protein_id gnl|my_center|LOCUS_17120 1924 1379 gene locus_tag LOCUS_17130 gene infC 1924 1379 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668127.1 protein_id gnl|my_center|LOCUS_17130 3177 2185 gene locus_tag LOCUS_17140 3177 2185 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_17140 3314 4204 gene locus_tag LOCUS_17150 3314 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 4194 4859 gene locus_tag LOCUS_17160 4194 4859 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_17160 5635 4856 gene locus_tag LOCUS_17170 5635 4856 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_17170 6965 5679 gene locus_tag LOCUS_17180 gene clpX 6965 5679 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679368.1 protein_id gnl|my_center|LOCUS_17180 7573 6968 gene locus_tag LOCUS_17190 gene clpP 7573 6968 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679367.1 protein_id gnl|my_center|LOCUS_17190 9115 7724 gene locus_tag LOCUS_17200 gene tig 9115 7724 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679366.1 protein_id gnl|my_center|LOCUS_17200 9333 9812 gene locus_tag LOCUS_17210 gene ybaK 9333 9812 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723804.1 protein_id gnl|my_center|LOCUS_17210 9894 10241 gene locus_tag LOCUS_17220 9894 10241 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440244.1 protein_id gnl|my_center|LOCUS_17220 10547 10476 gene locus_tag LOCUS_t00360 10547 10476 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10785 11837 gene locus_tag LOCUS_17230 gene metK 10785 11837 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_17230 12051 13367 gene locus_tag LOCUS_17240 12051 13367 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_17240 13797 15152 gene locus_tag LOCUS_17250 13797 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 15321 15491 gene locus_tag LOCUS_17260 15321 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657037.1 protein_id gnl|my_center|LOCUS_17260 15682 15945 gene locus_tag LOCUS_17270 15682 15945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence29 315 46 gene locus_tag LOCUS_17280 315 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 510 1763 gene locus_tag LOCUS_17290 510 1763 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_17290 3857 2346 gene locus_tag LOCUS_17300 3857 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 4123 5220 gene locus_tag LOCUS_17310 4123 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 5330 6148 gene locus_tag LOCUS_17320 5330 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 6923 6171 gene locus_tag LOCUS_17330 6923 6171 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_17330 7563 6877 gene locus_tag LOCUS_17340 7563 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 7505 8299 gene locus_tag LOCUS_17350 7505 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 8296 9312 gene locus_tag LOCUS_17360 8296 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 9326 9577 gene locus_tag LOCUS_17370 9326 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 9696 9623 gene locus_tag LOCUS_t00370 9696 9623 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9955 10506 gene locus_tag LOCUS_17380 9955 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 10503 11213 gene locus_tag LOCUS_17390 10503 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 11210 11839 gene locus_tag LOCUS_17400 11210 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 11851 13101 gene locus_tag LOCUS_17410 11851 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 14435 13161 gene locus_tag LOCUS_17420 14435 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence30 528 247 gene locus_tag LOCUS_17430 528 247 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583423.1 protein_id gnl|my_center|LOCUS_17430 1010 540 gene locus_tag LOCUS_17440 1010 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1051 1236 gene locus_tag LOCUS_17450 1051 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1975 1196 gene locus_tag LOCUS_17460 1975 1196 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_17460 2155 3612 gene locus_tag LOCUS_17470 2155 3612 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047860.1 protein_id gnl|my_center|LOCUS_17470 3711 3783 gene locus_tag LOCUS_t00380 3711 3783 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3798 3871 gene locus_tag LOCUS_t00390 3798 3871 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4272 4607 gene locus_tag LOCUS_17480 4272 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4628 4837 gene locus_tag LOCUS_17490 4628 4837 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860795.1 protein_id gnl|my_center|LOCUS_17490 4942 5841 gene locus_tag LOCUS_17500 4942 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 6225 8288 gene locus_tag LOCUS_17510 6225 8288 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 protein_id gnl|my_center|LOCUS_17510 8371 10410 gene locus_tag LOCUS_17520 gene fusA 8371 10410 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681223.1 protein_id gnl|my_center|LOCUS_17520 10625 12715 gene locus_tag LOCUS_17530 gene fusA 10625 12715 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682245.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence31 2052 265 gene locus_tag LOCUS_17540 2052 265 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_17540 2219 2644 gene locus_tag LOCUS_17550 2219 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3620 2676 gene locus_tag LOCUS_17560 3620 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 4282 3617 gene locus_tag LOCUS_17570 4282 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4802 4371 gene locus_tag LOCUS_17580 4802 4371 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_17580 4990 5922 gene locus_tag LOCUS_17590 gene cysK 4990 5922 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_17590 6532 5975 gene locus_tag LOCUS_17600 6532 5975 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_17600 7179 6823 gene locus_tag LOCUS_17610 7179 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 8174 7236 gene locus_tag LOCUS_17620 8174 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence32 99 1499 gene locus_tag LOCUS_17630 99 1499 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_17630 1533 2807 gene locus_tag LOCUS_17640 gene rmuC 1533 2807 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_17640 2810 3835 gene locus_tag LOCUS_17650 gene argF 2810 3835 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_17650 3988 4791 gene locus_tag LOCUS_17660 3988 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660