>Feature sequence001 2089 833 gene locus_tag LOCUS_00010 2089 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3070 2099 gene locus_tag LOCUS_00020 3070 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3969 3139 gene locus_tag LOCUS_00030 3969 3139 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_00030 4550 4065 gene locus_tag LOCUS_00040 4550 4065 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_00040 6151 4571 gene locus_tag LOCUS_00050 6151 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6510 6367 gene locus_tag LOCUS_00060 6510 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6859 9045 gene locus_tag LOCUS_00070 6859 9045 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_00070 10521 9082 gene locus_tag LOCUS_00080 10521 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12484 10670 gene locus_tag LOCUS_00090 12484 10670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14316 12649 gene locus_tag LOCUS_00100 14316 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15096 14581 gene locus_tag LOCUS_00110 gene cysE 15096 14581 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948016.1 protein_id gnl|my_center|LOCUS_00110 16864 15155 gene locus_tag LOCUS_00120 gene mutL 16864 15155 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583440.1 protein_id gnl|my_center|LOCUS_00120 >Feature sequence002 515 168 gene locus_tag LOCUS_00130 515 168 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_00130 1166 558 gene locus_tag LOCUS_00140 1166 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 2158 1196 gene locus_tag LOCUS_00150 gene dusB 2158 1196 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_00150 3279 2176 gene locus_tag LOCUS_00160 gene rodA 3279 2176 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_00160 3930 3292 gene locus_tag LOCUS_00170 3930 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 4746 3952 gene locus_tag LOCUS_00180 gene minD 4746 3952 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_00180 5605 4892 gene locus_tag LOCUS_00190 5605 4892 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_00190 5913 5734 gene locus_tag LOCUS_00200 5913 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 6473 6054 gene locus_tag LOCUS_00210 6473 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 7262 6486 gene locus_tag LOCUS_00220 gene murI 7262 6486 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_00220 7804 7349 gene locus_tag LOCUS_00230 7804 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 7994 7854 gene locus_tag LOCUS_00240 7994 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 8435 8067 gene locus_tag LOCUS_00250 8435 8067 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437529.1 protein_id gnl|my_center|LOCUS_00250 8813 8457 gene locus_tag LOCUS_00260 8813 8457 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437532.1 protein_id gnl|my_center|LOCUS_00260 9249 8869 gene locus_tag LOCUS_00270 9249 8869 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545915.1 protein_id gnl|my_center|LOCUS_00270 9641 9249 gene locus_tag LOCUS_00280 9641 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 11110 9908 gene locus_tag LOCUS_00290 11110 9908 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399688.1 protein_id gnl|my_center|LOCUS_00290 14001 11563 gene locus_tag LOCUS_00300 gene clpC 14001 11563 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_00300 15021 14005 gene locus_tag LOCUS_00310 15021 14005 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_00310 15536 15021 gene locus_tag LOCUS_00320 15536 15021 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 protein_id gnl|my_center|LOCUS_00320 16011 15568 gene locus_tag LOCUS_00330 16011 15568 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966469.1 protein_id gnl|my_center|LOCUS_00330 >Feature sequence003 99 1409 gene locus_tag LOCUS_00340 99 1409 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804282.1 protein_id gnl|my_center|LOCUS_00340 1418 2854 gene locus_tag LOCUS_00350 1418 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804283.1 protein_id gnl|my_center|LOCUS_00350 2880 3359 gene locus_tag LOCUS_00360 2880 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 3399 4724 gene locus_tag LOCUS_00370 3399 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 4901 5650 gene locus_tag LOCUS_00380 4901 5650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_00380 5634 5978 gene locus_tag LOCUS_00390 5634 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 5902 6453 gene locus_tag LOCUS_00400 5902 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00400 6474 7487 gene locus_tag LOCUS_00410 6474 7487 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_00410 7815 7567 gene locus_tag LOCUS_00420 7815 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 7976 8956 gene locus_tag LOCUS_00430 7976 8956 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_00430 9053 10006 gene locus_tag LOCUS_00440 9053 10006 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_00440 10015 11658 gene locus_tag LOCUS_00450 10015 11658 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_00450 12781 11729 gene locus_tag LOCUS_00460 12781 11729 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_00460 14629 12818 gene locus_tag LOCUS_00470 14629 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 <16083 14640 gene locus_tag LOCUS_00480 <16083 14640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074615.1:mutanobactin A non-ribosomal peptide synthetase MubD >Feature sequence004 1694 1173 gene locus_tag LOCUS_00490 1694 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 2633 1776 gene locus_tag LOCUS_00500 2633 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 3113 2655 gene locus_tag LOCUS_00510 3113 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 3611 3186 gene locus_tag LOCUS_00520 3611 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 4315 3707 gene locus_tag LOCUS_00530 4315 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 4915 4340 gene locus_tag LOCUS_00540 4915 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 7009 4934 gene locus_tag LOCUS_00550 7009 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 8933 7032 gene locus_tag LOCUS_00560 8933 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 9802 8954 gene locus_tag LOCUS_00570 9802 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 10495 9815 gene locus_tag LOCUS_00580 10495 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 11614 10523 gene locus_tag LOCUS_00590 11614 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 12917 11757 gene locus_tag LOCUS_00600 12917 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 13497 13024 gene locus_tag LOCUS_00610 13497 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 13623 14546 gene locus_tag LOCUS_00620 13623 14546 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437173.1 protein_id gnl|my_center|LOCUS_00620 14966 14601 gene locus_tag LOCUS_00630 14966 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00630 15477 14848 gene locus_tag LOCUS_00640 15477 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00640 >Feature sequence005 1169 537 gene locus_tag LOCUS_00650 1169 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 1314 1523 gene locus_tag LOCUS_00660 1314 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 1569 2351 gene locus_tag LOCUS_00670 1569 2351 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148557.1 protein_id gnl|my_center|LOCUS_00670 2387 2650 gene locus_tag LOCUS_00680 2387 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 2873 3082 gene locus_tag LOCUS_00690 2873 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 3227 3637 gene locus_tag LOCUS_00700 3227 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 3637 4809 gene locus_tag LOCUS_00710 3637 4809 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_00710 4854 5093 gene locus_tag LOCUS_00720 4854 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 5121 5843 gene locus_tag LOCUS_00730 5121 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 5847 6932 gene locus_tag LOCUS_00740 5847 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00740 7114 7812 gene locus_tag LOCUS_00750 7114 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00750 7817 8236 gene locus_tag LOCUS_00760 7817 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 8251 8499 gene locus_tag LOCUS_00770 8251 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 8503 8871 gene locus_tag LOCUS_00780 8503 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 9027 9158 gene locus_tag LOCUS_00790 9027 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 9222 9467 gene locus_tag LOCUS_00800 9222 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 9403 11652 gene locus_tag LOCUS_00810 9403 11652 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_00810 11960 12325 gene locus_tag LOCUS_00820 11960 12325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 12315 12470 gene locus_tag LOCUS_00830 12315 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 12496 13701 gene locus_tag LOCUS_00840 12496 13701 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_00840 13698 14108 gene locus_tag LOCUS_00850 13698 14108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 14124 14267 gene locus_tag LOCUS_00860 14124 14267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 >Feature sequence006 1340 2248 gene locus_tag LOCUS_00870 1340 2248 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584158.1 protein_id gnl|my_center|LOCUS_00870 2263 2991 gene locus_tag LOCUS_00880 2263 2991 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986387.1 protein_id gnl|my_center|LOCUS_00880 3103 3795 gene locus_tag LOCUS_00890 3103 3795 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_00890 3905 4366 gene locus_tag LOCUS_00900 3905 4366 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389647.1 protein_id gnl|my_center|LOCUS_00900 4437 5102 gene locus_tag LOCUS_00910 gene rnc 4437 5102 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_00910 5167 6204 gene locus_tag LOCUS_00920 5167 6204 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_00920 6217 7074 gene locus_tag LOCUS_00930 6217 7074 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_00930 7099 10320 gene locus_tag LOCUS_00940 gene addB 7099 10320 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_00940 10317 10877 gene locus_tag LOCUS_00950 gene pth 10317 10877 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_00950 10926 12095 gene locus_tag LOCUS_00960 10926 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 <13840 12189 gene locus_tag LOCUS_00970 <13840 12189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682243.1:AMP-binding protein >Feature sequence007 1084 368 gene locus_tag LOCUS_00980 1084 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 1904 1101 gene locus_tag LOCUS_00990 gene rsmA 1904 1101 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_00990 3262 1922 gene locus_tag LOCUS_01000 3262 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01000 4187 3234 gene locus_tag LOCUS_01010 4187 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01010 6179 4380 gene locus_tag LOCUS_01020 gene ftsH 6179 4380 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_01020 7303 6305 gene locus_tag LOCUS_01030 7303 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 8639 7314 gene locus_tag LOCUS_01040 8639 7314 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_01040 9122 8676 gene locus_tag LOCUS_01050 gene rplI 9122 8676 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048442.1 protein_id gnl|my_center|LOCUS_01050 11162 9138 gene locus_tag LOCUS_01060 11162 9138 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_01060 <12718 11306 gene locus_tag LOCUS_01070 <12718 11306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048356.1:DNA-directed RNA polymerase subunit beta' >Feature sequence008 <1 1305 gene locus_tag LOCUS_01080 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545339.1:ATP-binding protein note possible pseudo, frameshifted 1295 2260 gene locus_tag LOCUS_01090 1295 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01090 2591 3298 gene locus_tag LOCUS_01100 gene pyrH 2591 3298 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430597.1 protein_id gnl|my_center|LOCUS_01100 3362 3898 gene locus_tag LOCUS_01110 gene frr 3362 3898 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531501.1 protein_id gnl|my_center|LOCUS_01110 3911 4618 gene locus_tag LOCUS_01120 3911 4618 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_01120 4660 5493 gene locus_tag LOCUS_01130 4660 5493 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_01130 5536 6291 gene locus_tag LOCUS_01140 5536 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 6319 10725 gene locus_tag LOCUS_01150 gene polC 6319 10725 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_01150 10782 11066 gene locus_tag LOCUS_01160 10782 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 11182 12150 gene locus_tag LOCUS_01170 11182 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 >Feature sequence009 8228 8713 gene locus_tag LOCUS_01180 8228 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 9053 8829 gene locus_tag LOCUS_01190 9053 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 11225 9141 gene locus_tag LOCUS_01200 11225 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 11808 12017 gene locus_tag LOCUS_01210 11808 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 12171 12086 gene locus_tag LOCUS_t00010 12171 12086 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 901 4143 gene locus_tag LOCUS_01220 901 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 4169 4684 gene locus_tag LOCUS_01230 4169 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 4653 4793 gene locus_tag LOCUS_01240 4653 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4798 5334 gene locus_tag LOCUS_01250 4798 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 5359 6312 gene locus_tag LOCUS_01260 5359 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 6355 7605 gene locus_tag LOCUS_01270 gene dacF 6355 7605 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_01270 8160 7714 gene locus_tag LOCUS_01280 8160 7714 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964672.1 protein_id gnl|my_center|LOCUS_01280 8246 9064 gene locus_tag LOCUS_01290 8246 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 9368 10078 gene locus_tag LOCUS_01300 9368 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 10253 10328 gene locus_tag LOCUS_t00020 10253 10328 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10394 10467 gene locus_tag LOCUS_t00030 10394 10467 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 1825 914 gene locus_tag LOCUS_01310 1825 914 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_01310 1944 2699 gene locus_tag LOCUS_01320 1944 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3622 3200 gene locus_tag LOCUS_01330 3622 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01330 4990 3674 gene locus_tag LOCUS_01340 4990 3674 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582440.1 protein_id gnl|my_center|LOCUS_01340 6261 5008 gene locus_tag LOCUS_01350 gene hisS 6261 5008 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_01350 8493 6301 gene locus_tag LOCUS_01360 gene relA 8493 6301 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_01360 8981 8520 gene locus_tag LOCUS_01370 8981 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01370 10203 8968 gene locus_tag LOCUS_01380 10203 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01380 10978 10268 gene locus_tag LOCUS_01390 gene recO 10978 10268 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403930.1 protein_id gnl|my_center|LOCUS_01390 11142 10966 gene locus_tag LOCUS_01400 11142 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 11305 11162 gene locus_tag LOCUS_01410 11305 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 >Feature sequence012 1356 475 gene locus_tag LOCUS_01420 1356 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 2319 1417 gene locus_tag LOCUS_01430 gene gpr 2319 1417 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 protein_id gnl|my_center|LOCUS_01430 3332 2394 gene locus_tag LOCUS_01440 3332 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3703 3353 gene locus_tag LOCUS_01450 3703 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01450 5863 3854 gene locus_tag LOCUS_01460 5863 3854 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_01460 7430 5892 gene locus_tag LOCUS_01470 7430 5892 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963834.1 protein_id gnl|my_center|LOCUS_01470 8332 7433 gene locus_tag LOCUS_01480 gene murB 8332 7433 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_01480 8887 8495 gene locus_tag LOCUS_01490 8887 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 9528 8926 gene locus_tag LOCUS_01500 9528 8926 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964993.1 protein_id gnl|my_center|LOCUS_01500 <11054 9518 gene locus_tag LOCUS_01510 <11054 9518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964991.1:translational GTPase TypA >Feature sequence013 <1 635 gene locus_tag LOCUS_01520 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357980.1:molecular chaperone DnaK 668 1834 gene locus_tag LOCUS_01530 gene dnaJ 668 1834 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468806.1 protein_id gnl|my_center|LOCUS_01530 1969 2196 gene locus_tag LOCUS_01540 1969 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 2196 2924 gene locus_tag LOCUS_01550 2196 2924 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_01550 2941 3693 gene locus_tag LOCUS_01560 2941 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 3781 4005 gene locus_tag LOCUS_01570 3781 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 4167 4727 gene locus_tag LOCUS_01580 4167 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01580 4917 7580 gene locus_tag LOCUS_01590 4917 7580 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_01590 7617 9002 gene locus_tag LOCUS_01600 gene cysS 7617 9002 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_01600 9047 10063 gene locus_tag LOCUS_01610 9047 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 >Feature sequence014 552 331 gene locus_tag LOCUS_01620 552 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 956 570 gene locus_tag LOCUS_01630 gene spoIIIAD 956 570 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_01630 1163 969 gene locus_tag LOCUS_01640 gene spoIIIAC 1163 969 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_01640 1700 1185 gene locus_tag LOCUS_01650 1700 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 2178 1768 gene locus_tag LOCUS_01660 2178 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01660 2656 2183 gene locus_tag LOCUS_01670 2656 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01670 3503 2778 gene locus_tag LOCUS_01680 3503 2778 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_01680 6933 3703 gene locus_tag LOCUS_01690 6933 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 7414 6992 gene locus_tag LOCUS_01700 7414 6992 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_01700 8051 7434 gene locus_tag LOCUS_01710 8051 7434 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964964.1 protein_id gnl|my_center|LOCUS_01710 8259 9074 gene locus_tag LOCUS_01720 8259 9074 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966513.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01720 <10453 9143 gene locus_tag LOCUS_01730 <10453 9143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814582.1:ABC transporter ATP-binding protein >Feature sequence015 119 1069 gene locus_tag LOCUS_01740 119 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 1151 1474 gene locus_tag LOCUS_01750 1151 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 1832 1757 gene locus_tag LOCUS_t00040 1832 1757 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2515 1865 gene locus_tag LOCUS_01760 gene sigH 2515 1865 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 protein_id gnl|my_center|LOCUS_01760 2692 4401 gene locus_tag LOCUS_01770 2692 4401 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 protein_id gnl|my_center|LOCUS_01770 4935 4519 gene locus_tag LOCUS_01780 4935 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 5210 4971 gene locus_tag LOCUS_01790 5210 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 7221 5233 gene locus_tag LOCUS_01800 gene ligA 7221 5233 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_01800 7838 7239 gene locus_tag LOCUS_01810 gene pgsA 7838 7239 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 protein_id gnl|my_center|LOCUS_01810 <10272 7881 gene locus_tag LOCUS_01820 <10272 7881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963339.1:UPF0182 family protein >Feature sequence016 1540 602 gene locus_tag LOCUS_01830 1540 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 1733 2356 gene locus_tag LOCUS_01840 1733 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2383 5925 gene locus_tag LOCUS_01850 gene smc 2383 5925 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_01850 5988 7265 gene locus_tag LOCUS_01860 gene murA 5988 7265 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_01860 7280 8389 gene locus_tag LOCUS_01870 7280 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8451 9164 gene locus_tag LOCUS_01880 8451 9164 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965421.1 protein_id gnl|my_center|LOCUS_01880 9187 9912 gene locus_tag LOCUS_01890 9187 9912 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965421.1 protein_id gnl|my_center|LOCUS_01890 >Feature sequence017 2436 1147 gene locus_tag LOCUS_01900 2436 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 3672 2464 gene locus_tag LOCUS_01910 3672 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 3876 4082 gene locus_tag LOCUS_01920 3876 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 4097 4582 gene locus_tag LOCUS_01930 4097 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 4554 5423 gene locus_tag LOCUS_01940 4554 5423 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965236.1 protein_id gnl|my_center|LOCUS_01940 5778 6398 gene locus_tag LOCUS_01950 5778 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 6499 6816 gene locus_tag LOCUS_01960 6499 6816 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_01960 6842 8788 gene locus_tag LOCUS_01970 6842 8788 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858944.1 protein_id gnl|my_center|LOCUS_01970 >Feature sequence018 2427 799 gene locus_tag LOCUS_01980 2427 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 2885 2445 gene locus_tag LOCUS_01990 2885 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 3296 2895 gene locus_tag LOCUS_02000 3296 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 4108 3305 gene locus_tag LOCUS_02010 4108 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 4439 4209 gene locus_tag LOCUS_02020 4439 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 4901 4500 gene locus_tag LOCUS_02030 4901 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 5605 4910 gene locus_tag LOCUS_02040 5605 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 7255 5624 gene locus_tag LOCUS_02050 7255 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 8287 7481 gene locus_tag LOCUS_02060 gene dpsA 8287 7481 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_02060 9510 8332 gene locus_tag LOCUS_02070 9510 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 9747 10004 gene locus_tag LOCUS_02080 9747 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence019 <1 1090 gene locus_tag LOCUS_02090 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003421622.1:DNA polymerase III subunit gamma/tau 1103 1432 gene locus_tag LOCUS_02100 1103 1432 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_02100 1436 2035 gene locus_tag LOCUS_02110 gene recR 1436 2035 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_02110 3155 2037 gene locus_tag LOCUS_02120 3155 2037 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_02120 3292 3666 gene locus_tag LOCUS_02130 3292 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 3689 4681 gene locus_tag LOCUS_02140 3689 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02140 4808 6145 gene locus_tag LOCUS_02150 4808 6145 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_02150 6142 7119 gene locus_tag LOCUS_02160 6142 7119 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_02160 7128 7700 gene locus_tag LOCUS_02170 gene yqeK 7128 7700 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_02170 7749 8627 gene locus_tag LOCUS_02180 7749 8627 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259101.1 protein_id gnl|my_center|LOCUS_02180 8719 9231 gene locus_tag LOCUS_02190 8719 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 9253 9513 gene locus_tag LOCUS_02200 9253 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 >Feature sequence020 1561 1286 gene locus_tag LOCUS_02210 1561 1286 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_02210 3278 1737 gene locus_tag LOCUS_02220 3278 1737 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966489.1 protein_id gnl|my_center|LOCUS_02220 3431 5743 gene locus_tag LOCUS_02230 3431 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 6732 5803 gene locus_tag LOCUS_02240 6732 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 7523 6810 gene locus_tag LOCUS_02250 7523 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 8652 7507 gene locus_tag LOCUS_02260 8652 7507 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237280.1 protein_id gnl|my_center|LOCUS_02260 <9574 8677 gene locus_tag LOCUS_02270 <9574 8677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986784.1:30S ribosomal protein S12 methylthiotransferase RimO >Feature sequence021 1845 382 gene locus_tag LOCUS_02280 gene gatB 1845 382 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048223.1 protein_id gnl|my_center|LOCUS_02280 3331 1859 gene locus_tag LOCUS_02290 gene gatA 3331 1859 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048224.1 protein_id gnl|my_center|LOCUS_02290 3662 3363 gene locus_tag LOCUS_02300 gene gatC 3662 3363 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143272.1 protein_id gnl|my_center|LOCUS_02300 3853 3677 gene locus_tag LOCUS_02310 3853 3677 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966985.1 protein_id gnl|my_center|LOCUS_02310 5504 3876 gene locus_tag LOCUS_02320 5504 3876 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_02320 7405 5519 gene locus_tag LOCUS_02330 7405 5519 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_02330 7832 8665 gene locus_tag LOCUS_02340 7832 8665 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_02340 8894 9112 gene locus_tag LOCUS_02350 8894 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 >Feature sequence022 363 88 gene locus_tag LOCUS_02360 363 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 556 425 gene locus_tag LOCUS_02370 556 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 1091 558 gene locus_tag LOCUS_02380 1091 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 1773 1432 gene locus_tag LOCUS_02390 1773 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 2526 2356 gene locus_tag LOCUS_02400 2526 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2961 2842 gene locus_tag LOCUS_02410 2961 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3438 3115 gene locus_tag LOCUS_02420 3438 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 5675 4053 gene locus_tag LOCUS_02430 5675 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 7082 6201 gene locus_tag LOCUS_02440 7082 6201 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389876.1 protein_id gnl|my_center|LOCUS_02440 7606 7103 gene locus_tag LOCUS_02450 7606 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 8020 7643 gene locus_tag LOCUS_02460 8020 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 8995 8456 gene locus_tag LOCUS_02470 8995 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 9366 9163 gene locus_tag LOCUS_02480 9366 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence023 135 1784 gene locus_tag LOCUS_02490 135 1784 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_02490 2589 1900 gene locus_tag LOCUS_02500 2589 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 4230 2836 gene locus_tag LOCUS_02510 4230 2836 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_02510 4597 4403 gene locus_tag LOCUS_02520 4597 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 4965 5831 gene locus_tag LOCUS_02530 4965 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 5854 7512 gene locus_tag LOCUS_02540 5854 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 7701 8207 gene locus_tag LOCUS_02550 7701 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775377.1 protein_id gnl|my_center|LOCUS_02550 >Feature sequence024 <1 984 gene locus_tag LOCUS_02560 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986984.1:LCP family protein 1004 2308 gene locus_tag LOCUS_02570 1004 2308 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_02570 2358 3560 gene locus_tag LOCUS_02580 2358 3560 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261147.1 protein_id gnl|my_center|LOCUS_02580 3560 4738 gene locus_tag LOCUS_02590 3560 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 5065 5871 gene locus_tag LOCUS_02600 5065 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5868 6992 gene locus_tag LOCUS_02610 5868 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 6982 7959 gene locus_tag LOCUS_02620 6982 7959 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203004.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02620 >Feature sequence025 159 512 gene locus_tag LOCUS_02630 159 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 689 1057 gene locus_tag LOCUS_02640 689 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 1182 1568 gene locus_tag LOCUS_02650 1182 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 1587 2030 gene locus_tag LOCUS_02660 1587 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2032 3204 gene locus_tag LOCUS_02670 2032 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 3229 5187 gene locus_tag LOCUS_02680 3229 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 5202 6377 gene locus_tag LOCUS_02690 5202 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 6384 7862 gene locus_tag LOCUS_02700 6384 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 7879 8787 gene locus_tag LOCUS_02710 7879 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 >Feature sequence026 385 1734 gene locus_tag LOCUS_02720 gene pilG 385 1734 CDS product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216405.1 protein_id gnl|my_center|LOCUS_02720 1813 2046 gene locus_tag LOCUS_02730 1813 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 2270 2725 gene locus_tag LOCUS_02740 2270 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02740 3007 2837 gene locus_tag LOCUS_02750 3007 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 3220 3849 gene locus_tag LOCUS_02760 gene scpB 3220 3849 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_02760 3899 5167 gene locus_tag LOCUS_02770 3899 5167 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597559.1 protein_id gnl|my_center|LOCUS_02770 5736 5203 gene locus_tag LOCUS_02780 5736 5203 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891708.1 protein_id gnl|my_center|LOCUS_02780 5934 6527 gene locus_tag LOCUS_02790 5934 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02790 6511 7110 gene locus_tag LOCUS_02800 6511 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02800 >Feature sequence027 1258 371 gene locus_tag LOCUS_02810 gene ftsX 1258 371 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_02810 1942 1262 gene locus_tag LOCUS_02820 gene ftsE 1942 1262 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_02820 3153 2092 gene locus_tag LOCUS_02830 3153 2092 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042889.1 protein_id gnl|my_center|LOCUS_02830 3944 3210 gene locus_tag LOCUS_02840 3944 3210 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583389.1 protein_id gnl|my_center|LOCUS_02840 4442 3945 gene locus_tag LOCUS_02850 4442 3945 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765311.1 protein_id gnl|my_center|LOCUS_02850 6628 4478 gene locus_tag LOCUS_02860 6628 4478 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_02860 7271 6642 gene locus_tag LOCUS_02870 7271 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence028 725 144 gene locus_tag LOCUS_02880 725 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 1245 784 gene locus_tag LOCUS_02890 1245 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 2607 1471 gene locus_tag LOCUS_02900 2607 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02900 3396 2614 gene locus_tag LOCUS_02910 3396 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 4272 3706 gene locus_tag LOCUS_02920 4272 3706 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_02920 5754 4309 gene locus_tag LOCUS_02930 5754 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02930 6265 5798 gene locus_tag LOCUS_02940 6265 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02940 7198 6473 gene locus_tag LOCUS_02950 gene pflA 7198 6473 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860950.1 protein_id gnl|my_center|LOCUS_02950 <8370 7208 gene locus_tag LOCUS_02960 <8370 7208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485526.1:formate C-acetyltransferase >Feature sequence029 <1 1001 gene locus_tag LOCUS_02970 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108384.1:TraG family conjugative transposon ATPase 1294 2160 gene locus_tag LOCUS_02980 1294 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2144 2863 gene locus_tag LOCUS_02990 2144 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3189 2953 gene locus_tag LOCUS_03000 3189 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3463 5928 gene locus_tag LOCUS_03010 gene gyrA 3463 5928 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_03010 6973 5969 gene locus_tag LOCUS_03020 6973 5969 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_03020 7951 6995 gene locus_tag LOCUS_03030 7951 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence030 833 450 gene locus_tag LOCUS_03040 833 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 1198 1491 gene locus_tag LOCUS_03050 1198 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 2692 1646 gene locus_tag LOCUS_03060 2692 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 3062 2649 gene locus_tag LOCUS_03070 3062 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 4245 3040 gene locus_tag LOCUS_03080 4245 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 5204 4248 gene locus_tag LOCUS_03090 5204 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 5866 5294 gene locus_tag LOCUS_03100 5866 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010056.1 protein_id gnl|my_center|LOCUS_03100 7217 5850 gene locus_tag LOCUS_03110 7217 5850 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462147.1 protein_id gnl|my_center|LOCUS_03110 7682 7467 gene locus_tag LOCUS_03120 7682 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence031 <1 1488 gene locus_tag LOCUS_03130 <1 1488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436264.1:excinuclease ABC subunit UvrC 1704 2579 gene locus_tag LOCUS_03140 1704 2579 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_03140 2597 3253 gene locus_tag LOCUS_03150 2597 3253 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_03150 3480 3761 gene locus_tag LOCUS_03160 3480 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3867 6464 gene locus_tag LOCUS_03170 gene adhE 3867 6464 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035380749.1 protein_id gnl|my_center|LOCUS_03170 6556 6723 gene locus_tag LOCUS_03180 6556 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 6760 7119 gene locus_tag LOCUS_03190 gene rpsJ 6760 7119 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_03190 7167 7796 gene locus_tag LOCUS_03200 gene rplC 7167 7796 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_03200 >Feature sequence032 1698 469 gene locus_tag LOCUS_03210 1698 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 3707 1935 gene locus_tag LOCUS_03220 3707 1935 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_03220 4259 3780 gene locus_tag LOCUS_03230 4259 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 5198 4266 gene locus_tag LOCUS_03240 gene rsmH 5198 4266 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_03240 5956 5516 gene locus_tag LOCUS_03250 gene mraZ 5956 5516 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_03250 7081 6110 gene locus_tag LOCUS_03260 7081 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 >Feature sequence033 429 58 gene locus_tag LOCUS_03270 429 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 753 601 gene locus_tag LOCUS_03280 753 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 2270 1011 gene locus_tag LOCUS_03290 2270 1011 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_03290 3496 2297 gene locus_tag LOCUS_03300 3496 2297 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_03300 4997 3522 gene locus_tag LOCUS_03310 4997 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 5235 5405 gene locus_tag LOCUS_03320 5235 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 6110 5556 gene locus_tag LOCUS_03330 gene nrdG 6110 5556 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_03330 <7725 6141 gene locus_tag LOCUS_03340 <7725 6141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000187770.1:anaerobic ribonucleoside-triphosphate reductase >Feature sequence034 2389 2610 gene locus_tag LOCUS_03350 2389 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 3034 3510 gene locus_tag LOCUS_03360 3034 3510 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762311.1 protein_id gnl|my_center|LOCUS_03360 3538 4041 gene locus_tag LOCUS_03370 3538 4041 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_03370 4699 4199 gene locus_tag LOCUS_03380 4699 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 5070 4717 gene locus_tag LOCUS_03390 5070 4717 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903552.1 protein_id gnl|my_center|LOCUS_03390 5358 6095 gene locus_tag LOCUS_03400 gene cwlD 5358 6095 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_03400 6342 6172 gene locus_tag LOCUS_03410 6342 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 6617 6357 gene locus_tag LOCUS_03420 6617 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 <7576 6746 gene locus_tag LOCUS_03430 <7576 6746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002386882.1:AI-2E family transporter >Feature sequence035 658 422 gene locus_tag LOCUS_03440 gene acpP 658 422 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_03440 1450 680 gene locus_tag LOCUS_03450 1450 680 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_03450 1927 1466 gene locus_tag LOCUS_03460 1927 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03460 2280 1945 gene locus_tag LOCUS_03470 2280 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03470 3164 2328 gene locus_tag LOCUS_03480 gene accD 3164 2328 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048422.1 protein_id gnl|my_center|LOCUS_03480 4517 3165 gene locus_tag LOCUS_03490 4517 3165 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_03490 4744 4538 gene locus_tag LOCUS_03500 4744 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03500 4961 4725 gene locus_tag LOCUS_03510 4961 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03510 5397 4963 gene locus_tag LOCUS_03520 gene accB 5397 4963 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966835.1 protein_id gnl|my_center|LOCUS_03520 6638 5397 gene locus_tag LOCUS_03530 gene fabF 6638 5397 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_03530 7414 6680 gene locus_tag LOCUS_03540 gene fabG 7414 6680 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence036 684 466 gene locus_tag LOCUS_03550 gene infA 684 466 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421127.1 protein_id gnl|my_center|LOCUS_03550 1543 773 gene locus_tag LOCUS_03560 gene map 1543 773 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_03560 2231 1569 gene locus_tag LOCUS_03570 2231 1569 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021468.1 protein_id gnl|my_center|LOCUS_03570 2814 2452 gene locus_tag LOCUS_03580 2814 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 4275 2950 gene locus_tag LOCUS_03590 gene secY 4275 2950 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_03590 4710 4276 gene locus_tag LOCUS_03600 gene rplO 4710 4276 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_03600 5248 4760 gene locus_tag LOCUS_03610 gene rpsE 5248 4760 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_03610 5626 5267 gene locus_tag LOCUS_03620 gene rplR 5626 5267 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705309.1 protein_id gnl|my_center|LOCUS_03620 6196 5663 gene locus_tag LOCUS_03630 gene rplF 6196 5663 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_03630 6659 6261 gene locus_tag LOCUS_03640 gene rpsH 6659 6261 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_03640 6872 6687 gene locus_tag LOCUS_03650 6872 6687 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_03650 <7445 6899 gene locus_tag LOCUS_03660 <7445 6899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357534.1:50S ribosomal protein L5 >Feature sequence037 <1 832 gene locus_tag LOCUS_03670 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861592.1:MBOAT family protein 842 1924 gene locus_tag LOCUS_03680 842 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2073 3377 gene locus_tag LOCUS_03690 2073 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3515 4987 gene locus_tag LOCUS_03700 3515 4987 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_03700 5011 5988 gene locus_tag LOCUS_03710 gene mraY 5011 5988 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_03710 6001 7173 gene locus_tag LOCUS_03720 gene ftsW 6001 7173 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence038 2434 647 gene locus_tag LOCUS_03730 gene dnaG 2434 647 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_03730 3174 2599 gene locus_tag LOCUS_03740 3174 2599 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_03740 3996 3331 gene locus_tag LOCUS_03750 3996 3331 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_03750 4497 4012 gene locus_tag LOCUS_03760 4497 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03760 5263 4469 gene locus_tag LOCUS_03770 5263 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03770 5412 6884 gene locus_tag LOCUS_03780 gene spoIVA 5412 6884 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_03780 >Feature sequence039 1820 669 gene locus_tag LOCUS_03790 1820 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 2952 1933 gene locus_tag LOCUS_03800 gene fmt 2952 1933 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_03800 3496 3008 gene locus_tag LOCUS_03810 gene def 3496 3008 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986757.1 protein_id gnl|my_center|LOCUS_03810 5734 3515 gene locus_tag LOCUS_03820 gene priA 5734 3515 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_03820 6600 5758 gene locus_tag LOCUS_03830 gene folD 6600 5758 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence040 1142 219 gene locus_tag LOCUS_03840 1142 219 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943378.1 protein_id gnl|my_center|LOCUS_03840 2021 1245 gene locus_tag LOCUS_03850 2021 1245 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_03850 2841 2389 gene locus_tag LOCUS_03860 2841 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3111 2902 gene locus_tag LOCUS_03870 3111 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3380 3294 gene locus_tag LOCUS_t00050 3380 3294 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3512 3682 gene locus_tag LOCUS_03880 3512 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3721 4308 gene locus_tag LOCUS_03890 3721 4308 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813668.1 protein_id gnl|my_center|LOCUS_03890 4330 5244 gene locus_tag LOCUS_03900 4330 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence041 686 168 gene locus_tag LOCUS_03910 686 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 972 829 gene locus_tag LOCUS_03920 972 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1470 1117 gene locus_tag LOCUS_03930 1470 1117 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989958.1 protein_id gnl|my_center|LOCUS_03930 1933 1481 gene locus_tag LOCUS_03940 1933 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2329 1943 gene locus_tag LOCUS_03950 2329 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 2584 2342 gene locus_tag LOCUS_03960 2584 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2798 2625 gene locus_tag LOCUS_03970 2798 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 3685 2804 gene locus_tag LOCUS_03980 3685 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4087 3827 gene locus_tag LOCUS_03990 4087 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4673 4098 gene locus_tag LOCUS_04000 4673 4098 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071621397.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04000 4842 4678 gene locus_tag LOCUS_04010 4842 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 5846 4842 gene locus_tag LOCUS_04020 5846 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 6120 5851 gene locus_tag LOCUS_04030 6120 5851 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082838.1 protein_id gnl|my_center|LOCUS_04030 6418 6113 gene locus_tag LOCUS_04040 6418 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 6614 6405 gene locus_tag LOCUS_04050 6614 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence042 116 1222 gene locus_tag LOCUS_04060 gene metK 116 1222 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_04060 1234 2001 gene locus_tag LOCUS_04070 1234 2001 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_04070 2025 2576 gene locus_tag LOCUS_04080 2025 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 2536 2817 gene locus_tag LOCUS_04090 2536 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 2801 3565 gene locus_tag LOCUS_04100 2801 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 4135 3620 gene locus_tag LOCUS_04110 4135 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 4436 4113 gene locus_tag LOCUS_04120 4436 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 6391 4601 gene locus_tag LOCUS_04130 6391 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence043 2053 116 gene locus_tag LOCUS_04140 2053 116 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700554.1 protein_id gnl|my_center|LOCUS_04140 2300 2022 gene locus_tag LOCUS_04150 2300 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2670 2383 gene locus_tag LOCUS_04160 2670 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2900 2754 gene locus_tag LOCUS_04170 2900 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3295 3095 gene locus_tag LOCUS_04180 3295 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3562 3368 gene locus_tag LOCUS_04190 3562 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3788 3591 gene locus_tag LOCUS_04200 3788 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 3949 4257 gene locus_tag LOCUS_04210 3949 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4278 5072 gene locus_tag LOCUS_04220 4278 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5230 6123 gene locus_tag LOCUS_04230 5230 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 6395 6700 gene locus_tag LOCUS_04240 6395 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence044 264 1430 gene locus_tag LOCUS_04250 264 1430 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705473.1 protein_id gnl|my_center|LOCUS_04250 1473 2906 gene locus_tag LOCUS_04260 1473 2906 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_04260 3052 6519 gene locus_tag LOCUS_04270 3052 6519 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence045 1 792 gene locus_tag LOCUS_04280 1 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 808 1374 gene locus_tag LOCUS_04290 808 1374 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_04290 1387 1911 gene locus_tag LOCUS_04300 1387 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04300 2027 2656 gene locus_tag LOCUS_04310 2027 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04310 3772 2678 gene locus_tag LOCUS_04320 3772 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3966 6359 gene locus_tag LOCUS_04330 gene leuS 3966 6359 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence046 320 709 gene locus_tag LOCUS_04340 320 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 802 1683 gene locus_tag LOCUS_04350 802 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 1955 3244 gene locus_tag LOCUS_04360 gene tig 1955 3244 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965929.1 protein_id gnl|my_center|LOCUS_04360 3395 4009 gene locus_tag LOCUS_04370 gene clpP 3395 4009 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_04370 4031 5329 gene locus_tag LOCUS_04380 gene clpX 4031 5329 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_04380 5424 6086 gene locus_tag LOCUS_04390 5424 6086 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence047 3149 1698 gene locus_tag LOCUS_04400 gene trmFO 3149 1698 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_04400 6505 3230 gene locus_tag LOCUS_04410 6505 3230 CDS product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence048 279 455 gene locus_tag LOCUS_04420 279 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 631 1224 gene locus_tag LOCUS_04430 631 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 1245 2267 gene locus_tag LOCUS_04440 1245 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2283 2678 gene locus_tag LOCUS_04450 2283 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2713 3246 gene locus_tag LOCUS_04460 2713 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3248 3592 gene locus_tag LOCUS_04470 3248 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3585 4061 gene locus_tag LOCUS_04480 3585 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4062 4424 gene locus_tag LOCUS_04490 4062 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4430 5095 gene locus_tag LOCUS_04500 4430 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5088 5648 gene locus_tag LOCUS_04510 5088 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 5675 5980 gene locus_tag LOCUS_04520 5675 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 5980 6426 gene locus_tag LOCUS_04530 5980 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence049 <1 3277 gene locus_tag LOCUS_04540 <1 3277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475518.1:type II CRISPR RNA-guided endonuclease Cas9 3249 4115 gene locus_tag LOCUS_04550 gene cas1 3249 4115 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_04550 4120 4425 gene locus_tag LOCUS_04560 gene cas2 4120 4425 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989951.1 protein_id gnl|my_center|LOCUS_04560 4422 5102 gene locus_tag LOCUS_04570 4422 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 5160 5856 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttagaattatgttattttagatagaaataaaac 5957 6412 gene locus_tag LOCUS_04580 5957 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence050 696 1367 gene locus_tag LOCUS_04590 696 1367 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_04590 1474 1683 gene locus_tag LOCUS_04600 1474 1683 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_04600 1860 2255 gene locus_tag LOCUS_04610 1860 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2411 2941 gene locus_tag LOCUS_04620 gene raiA 2411 2941 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_04620 3429 3004 gene locus_tag LOCUS_04630 3429 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence051 191 631 gene locus_tag LOCUS_04640 191 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 714 1274 gene locus_tag LOCUS_04650 714 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 1276 1557 gene locus_tag LOCUS_04660 1276 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 1574 2767 gene locus_tag LOCUS_04670 1574 2767 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246128.1 protein_id gnl|my_center|LOCUS_04670 2825 3448 gene locus_tag LOCUS_04680 2825 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 3566 4447 gene locus_tag LOCUS_04690 gene xerD 3566 4447 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_04690 4627 6168 gene locus_tag LOCUS_04700 gene rny 4627 6168 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence052 <1 657 gene locus_tag LOCUS_04710 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898860.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE 836 2719 gene locus_tag LOCUS_04720 gene mnmG 836 2719 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_04720 2716 3429 gene locus_tag LOCUS_04730 gene rsmG 2716 3429 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_04730 3524 4285 gene locus_tag LOCUS_04740 3524 4285 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_04740 4302 5165 gene locus_tag LOCUS_04750 4302 5165 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_04750 5178 5675 gene locus_tag LOCUS_04760 5178 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 5760 5851 gene locus_tag LOCUS_t00060 5760 5851 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5892 5983 gene locus_tag LOCUS_t00070 5892 5983 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence053 143 1801 gene locus_tag LOCUS_04770 143 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3321 1942 gene locus_tag LOCUS_04780 gene murC 3321 1942 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_04780 3527 3826 gene locus_tag LOCUS_04790 gene spoVG 3527 3826 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_04790 3960 4598 gene locus_tag LOCUS_04800 3960 4598 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987073.1 protein_id gnl|my_center|LOCUS_04800 5634 4678 gene locus_tag LOCUS_04810 5634 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 >Feature sequence054 544 813 gene locus_tag LOCUS_04820 544 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3095 870 gene locus_tag LOCUS_04830 3095 870 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 protein_id gnl|my_center|LOCUS_04830 3351 3142 gene locus_tag LOCUS_04840 3351 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 5468 3351 gene locus_tag LOCUS_04850 5468 3351 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436320.1 protein_id gnl|my_center|LOCUS_04850 <6305 5517 gene locus_tag LOCUS_04860 <6305 5517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964854.1:pyrimidine-nucleoside phosphorylase >Feature sequence055 777 355 gene locus_tag LOCUS_04870 777 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 1497 778 gene locus_tag LOCUS_04880 1497 778 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_04880 2074 1562 gene locus_tag LOCUS_04890 2074 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 >Feature sequence056 <1 920 gene locus_tag LOCUS_04900 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048300.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 941 1513 gene locus_tag LOCUS_04910 941 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 1519 2049 gene locus_tag LOCUS_04920 1519 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 2175 2801 gene locus_tag LOCUS_04930 2175 2801 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107864.1 protein_id gnl|my_center|LOCUS_04930 2817 3638 gene locus_tag LOCUS_04940 2817 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3661 4791 gene locus_tag LOCUS_04950 3661 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 4842 5453 gene locus_tag LOCUS_04960 4842 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459317.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence057 849 19 gene locus_tag LOCUS_04970 849 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 1263 910 gene locus_tag LOCUS_04980 1263 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04980 1405 1232 gene locus_tag LOCUS_04990 1405 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04990 2277 1420 gene locus_tag LOCUS_05000 2277 1420 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_05000 2874 2299 gene locus_tag LOCUS_05010 gene pgsA 2874 2299 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_05010 5281 2948 gene locus_tag LOCUS_05020 5281 2948 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_05020 5997 5398 gene locus_tag LOCUS_05030 5997 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 >Feature sequence058 710 498 gene locus_tag LOCUS_05040 710 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 1086 742 gene locus_tag LOCUS_05050 1086 742 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355518.1 protein_id gnl|my_center|LOCUS_05050 2419 1127 gene locus_tag LOCUS_05060 2419 1127 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964371.1 protein_id gnl|my_center|LOCUS_05060 2641 3540 gene locus_tag LOCUS_05070 2641 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3604 5202 gene locus_tag LOCUS_05080 3604 5202 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965710.1 protein_id gnl|my_center|LOCUS_05080 <6064 5245 gene locus_tag LOCUS_05090 <6064 5245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435012.1:chaperonin GroEL >Feature sequence059 1220 735 gene locus_tag LOCUS_05100 gene pssE 1220 735 CDS product PssE/Cps14G family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990828.1 protein_id gnl|my_center|LOCUS_05100 1720 1217 gene locus_tag LOCUS_05110 1720 1217 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_05110 3489 1792 gene locus_tag LOCUS_05120 gene argS 3489 1792 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_05120 4662 3523 gene locus_tag LOCUS_05130 4662 3523 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_05130 5498 4695 gene locus_tag LOCUS_05140 5498 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence060 542 237 gene locus_tag LOCUS_05150 542 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1811 657 gene locus_tag LOCUS_05160 1811 657 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891865.1 protein_id gnl|my_center|LOCUS_05160 2479 1934 gene locus_tag LOCUS_05170 2479 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3698 2505 gene locus_tag LOCUS_05180 3698 2505 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_05180 4929 3733 gene locus_tag LOCUS_05190 gene ackA 4929 3733 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_05190 <5871 4953 gene locus_tag LOCUS_05200 <5871 4953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047869.1:phosphate acetyltransferase >Feature sequence061 544 2040 gene locus_tag LOCUS_05210 544 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 2033 2263 gene locus_tag LOCUS_05220 2033 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2265 2516 gene locus_tag LOCUS_05230 2265 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 2858 3607 gene locus_tag LOCUS_05240 2858 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3634 4527 gene locus_tag LOCUS_05250 3634 4527 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861029.1 protein_id gnl|my_center|LOCUS_05250 4542 4844 gene locus_tag LOCUS_05260 4542 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4857 5234 gene locus_tag LOCUS_05270 4857 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 5231 5611 gene locus_tag LOCUS_05280 5231 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence062 94 906 gene locus_tag LOCUS_05290 94 906 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931856.1 protein_id gnl|my_center|LOCUS_05290 950 1606 gene locus_tag LOCUS_05300 950 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05300 1527 2312 gene locus_tag LOCUS_05310 1527 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05310 2407 2814 gene locus_tag LOCUS_05320 2407 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 2999 3949 gene locus_tag LOCUS_05330 2999 3949 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715326.1 protein_id gnl|my_center|LOCUS_05330 4006 4941 gene locus_tag LOCUS_05340 gene fba 4006 4941 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948010.1 protein_id gnl|my_center|LOCUS_05340 5113 5580 gene locus_tag LOCUS_05350 5113 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence063 1069 20 gene locus_tag LOCUS_05360 gene vanG 1069 20 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_05360 2959 1217 gene locus_tag LOCUS_05370 2959 1217 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_05370 3690 3118 gene locus_tag LOCUS_05380 3690 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence064 32 406 gene locus_tag LOCUS_05390 32 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 604 1302 gene locus_tag LOCUS_05400 604 1302 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_05400 1318 1791 gene locus_tag LOCUS_05410 1318 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 1802 3322 gene locus_tag LOCUS_05420 1802 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3549 4724 gene locus_tag LOCUS_05430 3549 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4747 5394 gene locus_tag LOCUS_05440 4747 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence065 1448 432 gene locus_tag LOCUS_05450 1448 432 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130890.1 protein_id gnl|my_center|LOCUS_05450 2897 1464 gene locus_tag LOCUS_05460 2897 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3365 2946 gene locus_tag LOCUS_05470 3365 2946 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877618.1 protein_id gnl|my_center|LOCUS_05470 4028 3489 gene locus_tag LOCUS_05480 4028 3489 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_05480 4564 4025 gene locus_tag LOCUS_05490 4564 4025 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_05490 4774 4589 gene locus_tag LOCUS_05500 4774 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence066 456 187 gene locus_tag LOCUS_05510 456 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1732 446 gene locus_tag LOCUS_05520 gene mobV 1732 446 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119405.1 protein_id gnl|my_center|LOCUS_05520 2459 3340 gene locus_tag LOCUS_05530 2459 3340 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_05530 3382 3927 gene locus_tag LOCUS_05540 gene def 3382 3927 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016949.1 protein_id gnl|my_center|LOCUS_05540 3931 4644 gene locus_tag LOCUS_05550 3931 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05550 4727 5011 gene locus_tag LOCUS_05560 4727 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05560 >Feature sequence067 <1 1835 gene locus_tag LOCUS_05570 <1 1835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963929.1:glucoamylase family protein 2044 2793 gene locus_tag LOCUS_05580 gene yycF 2044 2793 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_05580 2821 4221 gene locus_tag LOCUS_05590 2821 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 4218 4850 gene locus_tag LOCUS_05600 gene lepB 4218 4850 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811571.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence068 2297 768 gene locus_tag LOCUS_05610 2297 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3595 2360 gene locus_tag LOCUS_05620 3595 2360 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386376.1 protein_id gnl|my_center|LOCUS_05620 <5351 3787 gene locus_tag LOCUS_05630 <5351 3787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000076750.1:polyribonucleotide nucleotidyltransferase >Feature sequence069 252 686 gene locus_tag LOCUS_05640 252 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 694 1584 gene locus_tag LOCUS_05650 694 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 1648 2346 gene locus_tag LOCUS_05660 1648 2346 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_05660 2416 3516 gene locus_tag LOCUS_05670 gene prfB 2416 3516 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 protein_id gnl|my_center|LOCUS_05670 3582 4184 gene locus_tag LOCUS_05680 3582 4184 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288181.1 protein_id gnl|my_center|LOCUS_05680 4809 4231 gene locus_tag LOCUS_05690 4809 4231 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence070 1647 442 gene locus_tag LOCUS_05700 1647 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2014 1772 gene locus_tag LOCUS_05710 gene acpP 2014 1772 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_05710 3168 2098 gene locus_tag LOCUS_05720 gene plsX 3168 2098 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_05720 3713 3345 gene locus_tag LOCUS_05730 gene rplL 3713 3345 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081509.1 protein_id gnl|my_center|LOCUS_05730 4363 3809 gene locus_tag LOCUS_05740 gene rplJ 4363 3809 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 protein_id gnl|my_center|LOCUS_05740 5215 4532 gene locus_tag LOCUS_05750 gene rplA 5215 4532 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence071 454 1851 gene locus_tag LOCUS_05760 gene sufB 454 1851 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_05760 1851 2876 gene locus_tag LOCUS_05770 gene sufD 1851 2876 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_05770 2923 4128 gene locus_tag LOCUS_05780 2923 4128 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_05780 4162 4587 gene locus_tag LOCUS_05790 4162 4587 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_05790 4786 4861 gene locus_tag LOCUS_t00080 4786 4861 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence072 <1 863 gene locus_tag LOCUS_05800 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003420697.1:diadenylate cyclase CdaA 916 1671 gene locus_tag LOCUS_05810 gene truA 916 1671 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_05810 1773 2198 gene locus_tag LOCUS_05820 1773 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4509 2299 gene locus_tag LOCUS_05830 4509 2299 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_05830 5099 4689 gene locus_tag LOCUS_05840 5099 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence073 577 143 gene locus_tag LOCUS_05850 577 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1499 687 gene locus_tag LOCUS_05860 gene mreC 1499 687 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_05860 2575 1544 gene locus_tag LOCUS_05870 2575 1544 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_05870 3261 2572 gene locus_tag LOCUS_05880 gene radC 3261 2572 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360029.1 protein_id gnl|my_center|LOCUS_05880 3544 3287 gene locus_tag LOCUS_05890 3544 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3697 4314 gene locus_tag LOCUS_05900 3697 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5090 4440 gene locus_tag LOCUS_05910 5090 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence074 1291 587 gene locus_tag LOCUS_05920 1291 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 3585 1495 gene locus_tag LOCUS_05930 3585 1495 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986644.1 protein_id gnl|my_center|LOCUS_05930 4342 3575 gene locus_tag LOCUS_05940 4342 3575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_05940 4540 5007 gene locus_tag LOCUS_05950 4540 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence075 172 855 gene locus_tag LOCUS_05960 172 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 1126 956 gene locus_tag LOCUS_05970 1126 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 1378 1130 gene locus_tag LOCUS_05980 1378 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 1563 2939 gene locus_tag LOCUS_05990 1563 2939 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_05990 3507 3028 gene locus_tag LOCUS_06000 3507 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 4203 3769 gene locus_tag LOCUS_06010 4203 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4509 4988 gene locus_tag LOCUS_06020 4509 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence076 390 869 gene locus_tag LOCUS_06030 390 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06030 802 1050 gene locus_tag LOCUS_06040 802 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06040 1225 1824 gene locus_tag LOCUS_06050 1225 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2005 2784 gene locus_tag LOCUS_06060 2005 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2924 3529 gene locus_tag LOCUS_06070 2924 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06070 3579 3722 gene locus_tag LOCUS_06080 3579 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 3781 4422 gene locus_tag LOCUS_06090 3781 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4491 5024 gene locus_tag LOCUS_06100 4491 5024 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355209.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence077 272 1135 gene locus_tag LOCUS_06110 272 1135 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_06110 3292 1586 gene locus_tag LOCUS_06120 3292 1586 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_06120 4060 3389 gene locus_tag LOCUS_06130 4060 3389 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_06130 4702 4154 gene locus_tag LOCUS_06140 4702 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence078 2603 3004 gene locus_tag LOCUS_06150 2603 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence079 415 125 gene locus_tag LOCUS_06160 gene yhbY 415 125 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_06160 541 614 gene locus_tag LOCUS_t00090 541 614 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 918 751 gene locus_tag LOCUS_06170 918 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 1954 893 gene locus_tag LOCUS_06180 1954 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3635 2076 gene locus_tag LOCUS_06190 3635 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 4234 3803 gene locus_tag LOCUS_06200 4234 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 <4925 4252 gene locus_tag LOCUS_06210 <4925 4252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965293.1:GTP 3',8-cyclase MoaA >Feature sequence080 1337 921 gene locus_tag LOCUS_06220 1337 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3803 1398 gene locus_tag LOCUS_06230 3803 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 4102 4221 gene locus_tag LOCUS_06240 4102 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4878 4321 gene locus_tag LOCUS_06250 4878 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence081 2793 493 gene locus_tag LOCUS_06260 2793 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3648 2875 gene locus_tag LOCUS_06270 3648 2875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_06270 4410 3670 gene locus_tag LOCUS_06280 4410 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4616 4461 gene locus_tag LOCUS_06290 4616 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence082 957 631 gene locus_tag LOCUS_06300 957 631 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391740.1 protein_id gnl|my_center|LOCUS_06300 1096 1785 gene locus_tag LOCUS_06310 1096 1785 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_06310 1782 2174 gene locus_tag LOCUS_06320 1782 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 3231 2323 gene locus_tag LOCUS_06330 gene dapA 3231 2323 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965674.1 protein_id gnl|my_center|LOCUS_06330 3447 4202 gene locus_tag LOCUS_06340 3447 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06340 4261 4803 gene locus_tag LOCUS_06350 4261 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06350 >Feature sequence083 <1 867 gene locus_tag LOCUS_06360 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066666688.1:NADH-quinone oxidoreductase subunit NuoF 888 2627 gene locus_tag LOCUS_06370 888 2627 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986411.1 protein_id gnl|my_center|LOCUS_06370 2647 3528 gene locus_tag LOCUS_06380 2647 3528 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_06380 3806 4105 gene locus_tag LOCUS_06390 3806 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence084 <1 688 gene locus_tag LOCUS_06400 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807842.1:glycosyltransferase family 4 protein 699 1154 gene locus_tag LOCUS_06410 699 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1351 1929 gene locus_tag LOCUS_06420 1351 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2217 3584 gene locus_tag LOCUS_06430 2217 3584 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_06430 3614 4651 gene locus_tag LOCUS_06440 3614 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence085 2830 3924 gene locus_tag LOCUS_06450 2830 3924 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947948.1 protein_id gnl|my_center|LOCUS_06450 3956 4210 gene locus_tag LOCUS_06460 3956 4210 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_06460 4203 4625 gene locus_tag LOCUS_06470 gene ruvX 4203 4625 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964987.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence086 159 1013 gene locus_tag LOCUS_06480 gene dprA 159 1013 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262883.1 protein_id gnl|my_center|LOCUS_06480 1096 2094 gene locus_tag LOCUS_06490 1096 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810730.1 protein_id gnl|my_center|LOCUS_06490 2281 3900 gene locus_tag LOCUS_06500 2281 3900 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964505.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence087 177 1451 gene locus_tag LOCUS_06510 177 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 1852 1598 gene locus_tag LOCUS_06520 gene spoIIID 1852 1598 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_06520 1965 2672 gene locus_tag LOCUS_06530 gene trmB 1965 2672 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965915.1 protein_id gnl|my_center|LOCUS_06530 3005 2748 gene locus_tag LOCUS_06540 3005 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06540 4215 2971 gene locus_tag LOCUS_06550 gene amyS 4215 2971 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06550 >Feature sequence088 78 851 gene locus_tag LOCUS_06560 gene sigG 78 851 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_06560 886 1125 gene locus_tag LOCUS_06570 886 1125 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 protein_id gnl|my_center|LOCUS_06570 1902 1180 gene locus_tag LOCUS_06580 gene sigE 1902 1180 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_06580 2779 1841 gene locus_tag LOCUS_06590 gene spoIIGA 2779 1841 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965001.1 protein_id gnl|my_center|LOCUS_06590 4613 2898 gene locus_tag LOCUS_06600 4613 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence089 1035 136 gene locus_tag LOCUS_06610 1035 136 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160552.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06610 1422 1111 gene locus_tag LOCUS_06620 1422 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06620 1506 1901 gene locus_tag LOCUS_06630 1506 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 1908 2591 gene locus_tag LOCUS_06640 1908 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2582 2725 gene locus_tag LOCUS_06650 2582 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2709 3530 gene locus_tag LOCUS_06660 2709 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3502 4344 gene locus_tag LOCUS_06670 3502 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence090 426 1661 gene locus_tag LOCUS_06680 426 1661 CDS product IS30-like element ISSmi3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160547.1 protein_id gnl|my_center|LOCUS_06680 2046 3101 gene locus_tag LOCUS_06690 2046 3101 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_06690 3248 3430 gene locus_tag LOCUS_06700 gene rpmF 3248 3430 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774376.1 protein_id gnl|my_center|LOCUS_06700 3463 3663 gene locus_tag LOCUS_06710 gene rpmE 3463 3663 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328932.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence091 1866 916 gene locus_tag LOCUS_06720 1866 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2245 1817 gene locus_tag LOCUS_06730 2245 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 4591 2264 gene locus_tag LOCUS_06740 4591 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence092 2109 448 gene locus_tag LOCUS_06750 2109 448 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_06750 2562 2131 gene locus_tag LOCUS_06760 2562 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 2781 2563 gene locus_tag LOCUS_06770 2781 2563 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 protein_id gnl|my_center|LOCUS_06770 4012 2813 gene locus_tag LOCUS_06780 gene xseA 4012 2813 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965382.1 protein_id gnl|my_center|LOCUS_06780 4470 4042 gene locus_tag LOCUS_06790 gene nusB 4470 4042 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286662.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence093 2973 1447 gene locus_tag LOCUS_06800 2973 1447 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896350.1 protein_id gnl|my_center|LOCUS_06800 3115 3690 gene locus_tag LOCUS_06810 3115 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3800 4270 gene locus_tag LOCUS_06820 3800 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 >Feature sequence094 153 899 gene locus_tag LOCUS_06830 153 899 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_06830 1139 948 gene locus_tag LOCUS_06840 1139 948 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_06840 1234 1404 gene locus_tag LOCUS_06850 1234 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1611 1462 gene locus_tag LOCUS_06860 1611 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1745 3097 gene locus_tag LOCUS_06870 1745 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3081 3416 gene locus_tag LOCUS_06880 3081 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3425 4282 gene locus_tag LOCUS_06890 3425 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence095 2373 1519 gene locus_tag LOCUS_06900 2373 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3477 2413 gene locus_tag LOCUS_06910 gene disA 3477 2413 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 protein_id gnl|my_center|LOCUS_06910 <4263 3490 gene locus_tag LOCUS_06920 <4263 3490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004453976.1:DNA repair protein RadA >Feature sequence096 2385 3476 gene locus_tag LOCUS_06930 2385 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3753 3532 gene locus_tag LOCUS_06940 3753 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence097 697 1683 gene locus_tag LOCUS_06950 697 1683 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897656.1 protein_id gnl|my_center|LOCUS_06950 1760 3058 gene locus_tag LOCUS_06960 1760 3058 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103654.1 protein_id gnl|my_center|LOCUS_06960 3124 3780 gene locus_tag LOCUS_06970 3124 3780 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905527.1 protein_id gnl|my_center|LOCUS_06970 3755 4189 gene locus_tag LOCUS_06980 gene gtcA 3755 4189 CDS product cell wall teichoic acid glycosylation protein GtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724105.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence098 976 713 gene locus_tag LOCUS_06990 gene rpsO 976 713 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_06990 2028 1105 gene locus_tag LOCUS_07000 2028 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3287 2079 gene locus_tag LOCUS_07010 gene tyrS 3287 2079 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_07010 3774 3322 gene locus_tag LOCUS_07020 3774 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence099 1179 412 gene locus_tag LOCUS_07030 1179 412 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_07030 2237 1296 gene locus_tag LOCUS_07040 2237 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2501 3052 gene locus_tag LOCUS_07050 2501 3052 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_07050 3895 3116 gene locus_tag LOCUS_07060 3895 3116 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence100 2304 925 gene locus_tag LOCUS_07070 gene mtaB 2304 925 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048000.1 protein_id gnl|my_center|LOCUS_07070 <4152 2367 gene locus_tag LOCUS_07080 <4152 2367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036944238.1:leucine-rich repeat domain-containing protein >Feature sequence101 34 210 gene locus_tag LOCUS_07090 34 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 238 1953 gene locus_tag LOCUS_07100 238 1953 CDS product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069635112.1 protein_id gnl|my_center|LOCUS_07100 1928 2881 gene locus_tag LOCUS_07110 1928 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2850 3554 gene locus_tag LOCUS_07120 2850 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 3505 3675 gene locus_tag LOCUS_07130 3505 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence102 1428 250 gene locus_tag LOCUS_07140 gene yqfD 1428 250 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861554.1 protein_id gnl|my_center|LOCUS_07140 1701 1441 gene locus_tag LOCUS_07150 1701 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2549 1710 gene locus_tag LOCUS_07160 gene pdaA 2549 1710 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875972.1 protein_id gnl|my_center|LOCUS_07160 3396 2893 gene locus_tag LOCUS_07170 3396 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3495 3782 gene locus_tag LOCUS_07180 3495 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence103 1172 3607 gene locus_tag LOCUS_07190 gene spoIIE 1172 3607 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898719.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence104 355 1128 gene locus_tag LOCUS_07200 355 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1125 1286 gene locus_tag LOCUS_07210 1125 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 2009 1395 gene locus_tag LOCUS_07220 2009 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 <4007 2061 gene locus_tag LOCUS_07230 <4007 2061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 >Feature sequence105 1577 1966 gene locus_tag LOCUS_07240 1577 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07240 2359 2063 gene locus_tag LOCUS_07250 2359 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2720 2959 gene locus_tag LOCUS_07260 2720 2959 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_07260 3087 3011 gene locus_tag LOCUS_t00100 3087 3011 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3879 3154 gene locus_tag LOCUS_07270 3879 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence106 932 276 gene locus_tag LOCUS_07280 gene rpe 932 276 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_07280 1797 943 gene locus_tag LOCUS_07290 gene rsgA 1797 943 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965036.1 protein_id gnl|my_center|LOCUS_07290 3798 1810 gene locus_tag LOCUS_07300 gene pknB 3798 1810 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence107 2073 100 gene locus_tag LOCUS_07310 2073 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 3744 2089 gene locus_tag LOCUS_07320 3744 2089 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence108 1362 925 gene locus_tag LOCUS_07330 1362 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1940 1389 gene locus_tag LOCUS_07340 gene rsmD 1940 1389 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_07340 2560 2108 gene locus_tag LOCUS_07350 2560 2108 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392381.1 protein_id gnl|my_center|LOCUS_07350 3053 2580 gene locus_tag LOCUS_07360 3053 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence109 1102 419 gene locus_tag LOCUS_07370 1102 419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_07370 2325 1102 gene locus_tag LOCUS_07380 2325 1102 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655975.1 protein_id gnl|my_center|LOCUS_07380 3903 2518 gene locus_tag LOCUS_07390 3903 2518 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667252.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence110 17 469 gene locus_tag LOCUS_07400 gene rimP 17 469 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965104.1 protein_id gnl|my_center|LOCUS_07400 473 1648 gene locus_tag LOCUS_07410 473 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence111 317 1180 gene locus_tag LOCUS_07420 317 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1192 1992 gene locus_tag LOCUS_07430 gene prmC 1192 1992 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_07430 1968 2804 gene locus_tag LOCUS_07440 1968 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence112 <1 1003 gene locus_tag LOCUS_07450 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905210.1:glycosyltransferase family 4 protein 1027 2277 gene locus_tag LOCUS_07460 1027 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2300 3262 gene locus_tag LOCUS_07470 2300 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence113 1942 83 gene locus_tag LOCUS_07480 gene asnB 1942 83 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 protein_id gnl|my_center|LOCUS_07480 3378 1996 gene locus_tag LOCUS_07490 3378 1996 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence114 33 923 gene locus_tag LOCUS_07500 33 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 948 2150 gene locus_tag LOCUS_07510 948 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2267 2518 gene locus_tag LOCUS_07520 2267 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence115 1909 395 gene locus_tag LOCUS_07530 gene lysS 1909 395 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966473.1 protein_id gnl|my_center|LOCUS_07530 3617 1998 gene locus_tag LOCUS_07540 gene recN 3617 1998 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence116 761 3430 gene locus_tag LOCUS_07550 761 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence117 2270 1329 gene locus_tag LOCUS_07560 2270 1329 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 3253 2792 gene locus_tag LOCUS_07570 3253 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 3539 3264 gene locus_tag LOCUS_07580 3539 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07580 >Feature sequence118 1506 91 gene locus_tag LOCUS_07590 1506 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 1954 1574 gene locus_tag LOCUS_07600 1954 1574 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_07600 2815 2249 gene locus_tag LOCUS_07610 2815 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07610 3500 2805 gene locus_tag LOCUS_07620 3500 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07620 >Feature sequence119 666 1145 gene locus_tag LOCUS_07630 gene ybeY 666 1145 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_07630 1182 1925 gene locus_tag LOCUS_07640 1182 1925 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416641.1 protein_id gnl|my_center|LOCUS_07640 1945 2991 gene locus_tag LOCUS_07650 1945 2991 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence120 <1 1244 gene locus_tag LOCUS_07660 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962355.1:leucine-rich repeat domain-containing protein 1373 1730 gene locus_tag LOCUS_tm00010 1373 1730 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1848 2942 gene locus_tag LOCUS_07670 1848 2942 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_07670 3089 3502 gene locus_tag LOCUS_07680 3089 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence121 1249 3606 gene locus_tag LOCUS_07690 gene polA 1249 3606 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896068.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence122 1068 778 gene locus_tag LOCUS_07700 1068 778 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_07700 1674 1093 gene locus_tag LOCUS_07710 1674 1093 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_07710 2426 2247 gene locus_tag LOCUS_07720 2426 2247 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_07720 3378 2452 gene locus_tag LOCUS_07730 3378 2452 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence123 <1 514 gene locus_tag LOCUS_07740 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963361.1:TetR/AcrR family transcriptional regulator 732 2426 gene locus_tag LOCUS_07750 732 2426 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_07750 2413 2988 gene locus_tag LOCUS_07760 2413 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence124 <1 2201 gene locus_tag LOCUS_07770 <1 2201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_055166304.1:tape measure protein 2218 3072 gene locus_tag LOCUS_07780 2218 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence125 3402 2308 gene locus_tag LOCUS_07790 3402 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence126 3051 1126 gene locus_tag LOCUS_07800 3051 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence127 <1 1322 gene locus_tag LOCUS_07810 <1 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein 1462 2487 gene locus_tag LOCUS_07820 gene queA 1462 2487 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence128 >Feature sequence129 12 1760 gene locus_tag LOCUS_07830 12 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07830 1782 2651 gene locus_tag LOCUS_07840 1782 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07840 2708 3508 gene locus_tag LOCUS_07850 2708 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence130 <3545 1330 gene locus_tag LOCUS_07860 <3545 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965118.1:DNA translocase FtsK >Feature sequence131 979 1701 gene locus_tag LOCUS_07870 979 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2010 1717 gene locus_tag LOCUS_07880 2010 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2143 2216 gene locus_tag LOCUS_t00110 2143 2216 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2896 2336 gene locus_tag LOCUS_07890 2896 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence132 172 23 gene locus_tag LOCUS_07900 172 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 941 186 gene locus_tag LOCUS_07910 941 186 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_07910 1945 950 gene locus_tag LOCUS_07920 1945 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2652 1945 gene locus_tag LOCUS_07930 gene tkmA 2652 1945 CDS product protein-tyrosine kinase activator TkmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227811.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence133 3238 1259 gene locus_tag LOCUS_07940 3238 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07940 >Feature sequence134 481 3246 gene locus_tag LOCUS_07950 gene ileS 481 3246 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence135 1977 409 gene locus_tag LOCUS_07960 1977 409 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727704.1 protein_id gnl|my_center|LOCUS_07960 2572 2312 gene locus_tag LOCUS_07970 gene spoVS 2572 2312 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_07970 <3395 2708 gene locus_tag LOCUS_07980 <3395 2708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245138.1:2',3'-cyclic-nucleotide 2'-phosphodiesterase >Feature sequence136 605 1690 gene locus_tag LOCUS_07990 605 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence137 1219 572 gene locus_tag LOCUS_08000 1219 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 2447 1275 gene locus_tag LOCUS_08010 2447 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence138 <1 1319 gene locus_tag LOCUS_08020 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948029.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 1334 1960 gene locus_tag LOCUS_08030 1334 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence139 <1 2091 gene locus_tag LOCUS_08040 <1 2091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930970.1:MMPL family transporter 2307 2122 gene locus_tag LOCUS_08050 2307 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2436 2813 gene locus_tag LOCUS_08060 2436 2813 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047976.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence140 >Feature sequence141 303 968 gene locus_tag LOCUS_08070 303 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1549 977 gene locus_tag LOCUS_08080 1549 977 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262803.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence142 1553 1401 gene locus_tag LOCUS_08090 1553 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08090 2433 1537 gene locus_tag LOCUS_08100 2433 1537 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422061.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08100 >Feature sequence143 <1 1155 gene locus_tag LOCUS_08110 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022342.1:helix-turn-helix domain-containing protein 1308 2198 gene locus_tag LOCUS_08120 1308 2198 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262529.1 protein_id gnl|my_center|LOCUS_08120 2213 2842 gene locus_tag LOCUS_08130 2213 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence144 1427 156 gene locus_tag LOCUS_08140 1427 156 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965728.1 protein_id gnl|my_center|LOCUS_08140 1668 2123 gene locus_tag LOCUS_08150 1668 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 2142 2780 gene locus_tag LOCUS_08160 2142 2780 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence145 <1 789 gene locus_tag LOCUS_08170 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130864481.1:translation initiation factor IF-2 789 1157 gene locus_tag LOCUS_08180 gene rbfA 789 1157 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_08180 1225 2178 gene locus_tag LOCUS_08190 1225 2178 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986790.1 protein_id gnl|my_center|LOCUS_08190 2178 2993 gene locus_tag LOCUS_08200 gene truB 2178 2993 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022450.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence146 <1 978 gene locus_tag LOCUS_08210 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001156535.1:UDP-glucose 4-epimerase GalE 1034 1228 gene locus_tag LOCUS_08220 1034 1228 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964294.1 protein_id gnl|my_center|LOCUS_08220 1299 3038 gene locus_tag LOCUS_08230 1299 3038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence147 1200 760 gene locus_tag LOCUS_08240 1200 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 <3195 1218 gene locus_tag LOCUS_08250 <3195 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966492.1:transcription-repair coupling factor >Feature sequence148 1122 184 gene locus_tag LOCUS_08260 1122 184 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226902.1 protein_id gnl|my_center|LOCUS_08260 1715 1269 gene locus_tag LOCUS_08270 1715 1269 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 protein_id gnl|my_center|LOCUS_08270 2428 1799 gene locus_tag LOCUS_08280 2428 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence149 544 1386 gene locus_tag LOCUS_08290 544 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1471 1947 gene locus_tag LOCUS_08300 gene greA 1471 1947 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_08300 2095 2967 gene locus_tag LOCUS_08310 2095 2967 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_08310 2984 3160 gene locus_tag LOCUS_08320 2984 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence150 >Feature sequence151 1186 380 gene locus_tag LOCUS_08330 1186 380 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963877.1 protein_id gnl|my_center|LOCUS_08330 1506 1243 gene locus_tag LOCUS_08340 1506 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1795 1547 gene locus_tag LOCUS_08350 1795 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2489 1908 gene locus_tag LOCUS_08360 gene yihA 2489 1908 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357155.1 protein_id gnl|my_center|LOCUS_08360 <3152 2506 gene locus_tag LOCUS_08370 <3152 2506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948259.1:serine--tRNA ligase >Feature sequence152 1824 487 gene locus_tag LOCUS_08380 1824 487 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08380 2047 1850 gene locus_tag LOCUS_08390 2047 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08390 2273 2145 gene locus_tag LOCUS_08400 2273 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence153 161 616 gene locus_tag LOCUS_08410 161 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence154 118 1059 gene locus_tag LOCUS_08420 118 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1043 1705 gene locus_tag LOCUS_08430 1043 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1820 2110 gene locus_tag LOCUS_08440 1820 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3021 2182 gene locus_tag LOCUS_08450 3021 2182 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence155 912 1475 gene locus_tag LOCUS_08460 912 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1514 1897 gene locus_tag LOCUS_08470 1514 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2145 2606 gene locus_tag LOCUS_08480 gene tsaE 2145 2606 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence156 801 100 gene locus_tag LOCUS_08490 801 100 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315226.1 protein_id gnl|my_center|LOCUS_08490 1912 824 gene locus_tag LOCUS_08500 1912 824 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986984.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence157 1060 140 gene locus_tag LOCUS_08510 1060 140 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_08510 1925 1053 gene locus_tag LOCUS_08520 1925 1053 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_08520 2857 1970 gene locus_tag LOCUS_08530 2857 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence158 >Feature sequence159 887 63 gene locus_tag LOCUS_08540 gene spo0A 887 63 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_08540 1651 1058 gene locus_tag LOCUS_08550 1651 1058 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965593.1 protein_id gnl|my_center|LOCUS_08550 2820 1651 gene locus_tag LOCUS_08560 2820 1651 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence160 <1 806 gene locus_tag LOCUS_08570 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460982.1:ATP-binding protein 875 1156 gene locus_tag LOCUS_08580 875 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence161 125 1417 gene locus_tag LOCUS_08590 125 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1466 2530 gene locus_tag LOCUS_08600 1466 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence162 <1 1331 gene locus_tag LOCUS_08610 <1 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000880748.1:O-antigen ligase family protein 1352 2476 gene locus_tag LOCUS_08620 1352 2476 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017013.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence163 <1 547 gene locus_tag LOCUS_08630 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393419.1:tryptophan--tRNA ligase 566 1840 gene locus_tag LOCUS_08640 gene obgE 566 1840 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048021.1 protein_id gnl|my_center|LOCUS_08640 1920 2723 gene locus_tag LOCUS_08650 1920 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence164 441 157 gene locus_tag LOCUS_08660 gene rpmA 441 157 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_08660 804 487 gene locus_tag LOCUS_08670 gene rplU 804 487 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_08670 1263 952 gene locus_tag LOCUS_08680 1263 952 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_08680 1590 1294 gene locus_tag LOCUS_08690 1590 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2014 1556 gene locus_tag LOCUS_08700 2014 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 <2909 2061 gene locus_tag LOCUS_08710 <2909 2061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949019.1:RluA family pseudouridine synthase >Feature sequence165 904 77 gene locus_tag LOCUS_08720 904 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1478 969 gene locus_tag LOCUS_08730 1478 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2518 1514 gene locus_tag LOCUS_08740 gene hrcA 2518 1514 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence166 >Feature sequence167 1651 608 gene locus_tag LOCUS_08750 gene rlmN 1651 608 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 protein_id gnl|my_center|LOCUS_08750 <2859 1748 gene locus_tag LOCUS_08760 <2859 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029239.1:aspartate--tRNA ligase >Feature sequence168 1044 469 gene locus_tag LOCUS_08770 1044 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1362 2303 gene locus_tag LOCUS_08780 1362 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08780 >Feature sequence169 222 1262 gene locus_tag LOCUS_08790 222 1262 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775610.1 protein_id gnl|my_center|LOCUS_08790 1402 2109 gene locus_tag LOCUS_08800 1402 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2253 2582 gene locus_tag LOCUS_08810 2253 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 2576 2737 gene locus_tag LOCUS_08820 2576 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence170 125 397 gene locus_tag LOCUS_08830 125 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 587 1030 gene locus_tag LOCUS_08840 gene tadA 587 1030 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287154.1 protein_id gnl|my_center|LOCUS_08840 1049 1142 gene locus_tag LOCUS_t00120 1049 1142 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1226 1969 gene locus_tag LOCUS_08850 1226 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence171 1169 1639 gene locus_tag LOCUS_08860 1169 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1677 2114 gene locus_tag LOCUS_08870 1677 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2053 2319 gene locus_tag LOCUS_08880 2053 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence172 2678 822 gene locus_tag LOCUS_08890 2678 822 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence173 875 78 gene locus_tag LOCUS_08900 875 78 CDS product SpoIIIAH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888947.1 protein_id gnl|my_center|LOCUS_08900 1474 887 gene locus_tag LOCUS_08910 gene spoIIIAG 1474 887 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358958.1 protein_id gnl|my_center|LOCUS_08910 2091 1528 gene locus_tag LOCUS_08920 2091 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence174 131 1642 gene locus_tag LOCUS_08930 131 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1667 1999 gene locus_tag LOCUS_08940 1667 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2056 2451 gene locus_tag LOCUS_08950 2056 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence175 <2671 909 gene locus_tag LOCUS_08960 <2671 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861117.1:type IV secretory system conjugative DNA transfer family protein >Feature sequence176 614 315 gene locus_tag LOCUS_08970 614 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 957 1544 gene locus_tag LOCUS_08980 957 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2153 1545 gene locus_tag LOCUS_08990 2153 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence177 1684 983 gene locus_tag LOCUS_09000 1684 983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811528.1 protein_id gnl|my_center|LOCUS_09000 2558 1920 gene locus_tag LOCUS_09010 2558 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence178 3 1031 gene locus_tag LOCUS_09020 gene murG 3 1031 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence179 2 256 gene locus_tag LOCUS_09030 2 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 425 1069 gene locus_tag LOCUS_09040 gene rpiA 425 1069 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761124.1 protein_id gnl|my_center|LOCUS_09040 1095 2192 gene locus_tag LOCUS_09050 1095 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence180 295 447 gene locus_tag LOCUS_09060 295 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 461 652 gene locus_tag LOCUS_09070 461 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 691 867 gene locus_tag LOCUS_09080 691 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 948 1112 gene locus_tag LOCUS_09090 948 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1133 1597 gene locus_tag LOCUS_09100 1133 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1767 1892 gene locus_tag LOCUS_09110 1767 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence181 981 265 gene locus_tag LOCUS_09120 gene yunB 981 265 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021812.1 protein_id gnl|my_center|LOCUS_09120 2506 974 gene locus_tag LOCUS_09130 2506 974 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966186.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence182 <1 1240 gene locus_tag LOCUS_09140 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010714187.1:phage portal protein >Feature sequence183 474 121 gene locus_tag LOCUS_09150 gene rplT 474 121 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_09150 699 496 gene locus_tag LOCUS_09160 699 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1273 734 gene locus_tag LOCUS_09170 gene infC 1273 734 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808206.1 protein_id gnl|my_center|LOCUS_09170 2008 1538 gene locus_tag LOCUS_09180 2008 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2407 2102 gene locus_tag LOCUS_09190 2407 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence184 1090 71 gene locus_tag LOCUS_09200 1090 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2206 1094 gene locus_tag LOCUS_09210 2206 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence185 89 637 gene locus_tag LOCUS_09220 gene gmk 89 637 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699957.1 protein_id gnl|my_center|LOCUS_09220 650 1480 gene locus_tag LOCUS_09230 650 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1506 1646 gene locus_tag LOCUS_09240 1506 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1676 2038 gene locus_tag LOCUS_09250 1676 2038 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_09250 2066 2287 gene locus_tag LOCUS_09260 2066 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence186 343 125 gene locus_tag LOCUS_09270 343 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1459 614 gene locus_tag LOCUS_09280 1459 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 <2462 1691 gene locus_tag LOCUS_09290 <2462 1691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947990.1:stage II sporulation protein D note possible pseudo, frameshifted >Feature sequence187 1229 681 gene locus_tag LOCUS_09300 1229 681 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864729.1 protein_id gnl|my_center|LOCUS_09300 2175 1243 gene locus_tag LOCUS_09310 2175 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence188 914 195 gene locus_tag LOCUS_09320 gene deoD 914 195 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 protein_id gnl|my_center|LOCUS_09320 2142 1213 gene locus_tag LOCUS_09330 gene nifS 2142 1213 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09330 >Feature sequence189 1265 510 gene locus_tag LOCUS_09340 1265 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 1548 1318 gene locus_tag LOCUS_09350 1548 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1900 1526 gene locus_tag LOCUS_09360 1900 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2367 1897 gene locus_tag LOCUS_09370 2367 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence190 <1 843 gene locus_tag LOCUS_09380 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765893.1:SP_1767 family glycosyltransferase 862 2046 gene locus_tag LOCUS_09390 862 2046 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476423.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence191 1292 135 gene locus_tag LOCUS_09400 1292 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 <2426 1373 gene locus_tag LOCUS_09410 <2426 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357628.1:S41 family peptidase >Feature sequence192 2257 83 gene locus_tag LOCUS_09420 2257 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence193 <1 845 gene locus_tag LOCUS_09430 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047675.1:DNA mismatch repair protein MutS >Feature sequence194 1283 222 gene locus_tag LOCUS_09440 gene prfA 1283 222 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_09440 1545 2402 gene locus_tag LOCUS_09450 1545 2402 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409743.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence195 >Feature sequence196 >Feature sequence197 2105 1227 gene locus_tag LOCUS_09460 2105 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence198 330 1553 gene locus_tag LOCUS_09470 gene mobV 330 1553 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122374.1 protein_id gnl|my_center|LOCUS_09470 <2352 1608 gene locus_tag LOCUS_09480 <2352 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680150.1:ABC transporter ATP-binding protein >Feature sequence199 903 217 gene locus_tag LOCUS_09490 903 217 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_09490 1769 909 gene locus_tag LOCUS_09500 1769 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2001 1783 gene locus_tag LOCUS_09510 gene yidD 2001 1783 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence200 667 146 gene locus_tag LOCUS_09520 gene rplQ 667 146 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130558.1 protein_id gnl|my_center|LOCUS_09520 1642 695 gene locus_tag LOCUS_09530 1642 695 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_09530 2323 1697 gene locus_tag LOCUS_09540 gene rpsD 2323 1697 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence201 952 311 gene locus_tag LOCUS_09550 952 311 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_09550 1958 969 gene locus_tag LOCUS_09560 gene tsaD 1958 969 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964219.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence202 <1 1583 gene locus_tag LOCUS_09570 <1 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461398.1:ABC transporter ATP-binding protein >Feature sequence203 910 284 gene locus_tag LOCUS_09580 gene gpmB 910 284 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209230.1 protein_id gnl|my_center|LOCUS_09580 2199 1090 gene locus_tag LOCUS_09590 gene ftsZ 2199 1090 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence204 845 147 gene locus_tag LOCUS_09600 gene sigK 845 147 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_09600 2159 930 gene locus_tag LOCUS_09610 2159 930 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence205 37 270 gene locus_tag LOCUS_09620 gene rpsP 37 270 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_09620 284 511 gene locus_tag LOCUS_09630 284 511 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_09630 525 1016 gene locus_tag LOCUS_09640 gene rimM 525 1016 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_09640 1016 1717 gene locus_tag LOCUS_09650 gene trmD 1016 1717 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_09650 1731 2216 gene locus_tag LOCUS_09660 1731 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence206 503 357 gene locus_tag LOCUS_09670 503 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1005 868 gene locus_tag LOCUS_09680 1005 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 <2288 1171 gene locus_tag LOCUS_09690 <2288 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895216.1:preprotein translocase subunit SecA >Feature sequence207 >Feature sequence208 1397 183 gene locus_tag LOCUS_09700 1397 183 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_09700 2200 1424 gene locus_tag LOCUS_09710 2200 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence209 <1 547 gene locus_tag LOCUS_09720 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435252.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence210 231 353 gene locus_tag LOCUS_09730 231 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 379 726 gene locus_tag LOCUS_09740 379 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1046 1366 gene locus_tag LOCUS_09750 1046 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1801 1538 gene locus_tag LOCUS_09760 1801 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence211 357 1892 gene locus_tag LOCUS_09770 357 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence212 <2264 942 gene locus_tag LOCUS_09780 <2264 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001060462.1:MSCRAMM family adhesin SdrC >Feature sequence213 1546 539 gene locus_tag LOCUS_09790 1546 539 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_09790 <2262 1735 gene locus_tag LOCUS_09800 <2262 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788259.1:LL-diaminopimelate aminotransferase >Feature sequence214 974 492 gene locus_tag LOCUS_09810 974 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09810 1485 991 gene locus_tag LOCUS_09820 1485 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence215 >Feature sequence216 1476 373 gene locus_tag LOCUS_09830 1476 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1719 1585 gene locus_tag LOCUS_09840 1719 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence217 93 335 gene locus_tag LOCUS_09850 93 335 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815105.1 protein_id gnl|my_center|LOCUS_09850 1368 385 gene locus_tag LOCUS_09860 1368 385 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048433.1 protein_id gnl|my_center|LOCUS_09860 <2197 1521 gene locus_tag LOCUS_09870 <2197 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966830.1:DNA topoisomerase 3 >Feature sequence218 76 1050 gene locus_tag LOCUS_09880 gene bsh 76 1050 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723950.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence219 736 26 gene locus_tag LOCUS_09890 736 26 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_09890 2176 740 gene locus_tag LOCUS_09900 2176 740 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence220 163 1278 gene locus_tag LOCUS_09910 163 1278 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence221 795 226 gene locus_tag LOCUS_09920 795 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2083 977 gene locus_tag LOCUS_09930 2083 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence222 1960 317 gene locus_tag LOCUS_09940 1960 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 2143 1964 gene locus_tag LOCUS_09950 2143 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence223 847 1638 gene locus_tag LOCUS_09960 847 1638 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence224 137 541 gene locus_tag LOCUS_09970 137 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 541 993 gene locus_tag LOCUS_09980 541 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1045 1356 gene locus_tag LOCUS_09990 1045 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1304 1693 gene locus_tag LOCUS_10000 1304 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1690 1842 gene locus_tag LOCUS_10010 1690 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence225 1550 693 gene locus_tag LOCUS_10020 gene dapF 1550 693 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157609.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence226 1008 472 gene locus_tag LOCUS_10030 gene nusG 1008 472 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_10030 1600 1052 gene locus_tag LOCUS_10040 1600 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1787 1623 gene locus_tag LOCUS_10050 gene rpmG 1787 1623 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810204.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence227 969 91 gene locus_tag LOCUS_10060 gene tsf 969 91 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965094.1 protein_id gnl|my_center|LOCUS_10060 1767 988 gene locus_tag LOCUS_10070 gene rpsB 1767 988 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence228 1881 493 gene locus_tag LOCUS_10080 gene asnS 1881 493 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430444.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence229 313 131 gene locus_tag LOCUS_10090 313 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 651 337 gene locus_tag LOCUS_10100 gene trxA 651 337 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852918.1 protein_id gnl|my_center|LOCUS_10100 1595 732 gene locus_tag LOCUS_10110 1595 732 CDS product anti-sigma-V factor rsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436661.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence230 506 309 gene locus_tag LOCUS_10120 gene rpmB 506 309 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_10120 1073 888 gene locus_tag LOCUS_10130 1073 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 <1920 1078 gene locus_tag LOCUS_10140 <1920 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881269.1:S8 family serine peptidase >Feature sequence231 628 458 gene locus_tag LOCUS_10150 628 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 <1919 769 gene locus_tag LOCUS_10160 <1919 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003020707.1:glycosyltransferase >Feature sequence232 1052 405 gene locus_tag LOCUS_10170 gene plsY 1052 405 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_10170 1801 1052 gene locus_tag LOCUS_10180 1801 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence233 <1 1017 gene locus_tag LOCUS_10190 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454794.1:D-alanyl-D-alanine carboxypeptidase family protein <1896 1056 gene locus_tag LOCUS_10200 <1896 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048020.1:LCP family protein >Feature sequence234 >Feature sequence235 339 82 gene locus_tag LOCUS_10210 339 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 536 339 gene locus_tag LOCUS_10220 536 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 967 539 gene locus_tag LOCUS_10230 967 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence236 345 121 gene locus_tag LOCUS_10240 345 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 <1850 430 gene locus_tag LOCUS_10250 <1850 430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454871.1:ATP-dependent DNA helicase RecG >Feature sequence237 <1 622 gene locus_tag LOCUS_10260 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000073726.1:cation-translocating P-type ATPase 850 1737 gene locus_tag LOCUS_10270 850 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence238 1455 487 gene locus_tag LOCUS_10280 1455 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1603 1442 gene locus_tag LOCUS_10290 1603 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence239 1019 273 gene locus_tag LOCUS_10300 1019 273 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044986.1 protein_id gnl|my_center|LOCUS_10300 <1829 1032 gene locus_tag LOCUS_10310 <1829 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964590.1:translation elongation factor 4 >Feature sequence240 1134 133 gene locus_tag LOCUS_10320 1134 133 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_10320 <1811 1200 gene locus_tag LOCUS_10330 <1811 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986640.1:response regulator transcription factor >Feature sequence241 >Feature sequence242 174 443 gene locus_tag LOCUS_10340 174 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 463 1158 gene locus_tag LOCUS_10350 463 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1503 1754 gene locus_tag LOCUS_10360 1503 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence243 234 902 gene locus_tag LOCUS_10370 234 902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438655.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence244 <1780 764 gene locus_tag LOCUS_10380 <1780 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048375.1:formate--tetrahydrofolate ligase >Feature sequence245 131 1540 gene locus_tag LOCUS_10390 131 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence246 29 178 gene locus_tag LOCUS_10400 29 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 198 1601 gene locus_tag LOCUS_10410 gene murD 198 1601 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966471.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence247 888 166 gene locus_tag LOCUS_10420 888 166 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015842.1 protein_id gnl|my_center|LOCUS_10420 <1758 932 gene locus_tag LOCUS_10430 <1758 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002913975.1:zinc ABC transporter substrate-binding protein >Feature sequence248 994 68 gene locus_tag LOCUS_10440 994 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 <1754 1160 gene locus_tag LOCUS_10450 <1754 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426955.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence249 499 1011 gene locus_tag LOCUS_10460 499 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1670 1107 gene locus_tag LOCUS_10470 1670 1107 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083238.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence250 126 446 gene locus_tag LOCUS_10480 gene spoIIAA 126 446 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_10480 443 898 gene locus_tag LOCUS_10490 gene spoIIAB 443 898 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_10490 914 1627 gene locus_tag LOCUS_10500 gene sigF 914 1627 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence251 186 665 gene locus_tag LOCUS_10510 186 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 985 719 gene locus_tag LOCUS_10520 985 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 <1733 1103 gene locus_tag LOCUS_10530 <1733 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358516.1:hemolysin III family protein >Feature sequence252 <1 1251 gene locus_tag LOCUS_10540 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858032.1:AMP-binding protein 1268 1516 gene locus_tag LOCUS_10550 1268 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence253 24 1250 gene locus_tag LOCUS_10560 24 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence254 >Feature sequence255 <1685 355 gene locus_tag LOCUS_10570 <1685 355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036944238.1:leucine-rich repeat domain-containing protein >Feature sequence256 239 1651 gene locus_tag LOCUS_10580 239 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence257 1027 275 gene locus_tag LOCUS_10590 gene tpiA 1027 275 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_10590 <1638 1101 gene locus_tag LOCUS_10600 <1638 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964029.1:phosphoglycerate kinase >Feature sequence258 291 55 gene locus_tag LOCUS_10610 291 55 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_10610 <1636 307 gene locus_tag LOCUS_10620 <1636 307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948198.1:helicase-exonuclease AddAB subunit AddA >Feature sequence259 <1 1011 gene locus_tag LOCUS_10630 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461855.1:Ger(x)C family spore germination protein <1632 1098 gene locus_tag LOCUS_10640 <1632 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964034.1:ribonuclease R >Feature sequence260 <1 1462 gene locus_tag LOCUS_10650 <1 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989583.1:cation-translocating P-type ATPase >Feature sequence261 <1586 652 gene locus_tag LOCUS_10660 <1586 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943874.1:excinuclease ABC subunit UvrB >Feature sequence262 27 509 gene locus_tag LOCUS_10670 27 509 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence263 <1522 265 gene locus_tag LOCUS_10680 <1522 265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043943600.1:ABC transporter ATP-binding protein >Feature sequence264 <1506 347 gene locus_tag LOCUS_10690 <1506 347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000884735.1:UDPGP type 1 family protein >Feature sequence265 35 1342 gene locus_tag LOCUS_10700 35 1342 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896573.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence266 465 734 gene locus_tag LOCUS_10710 465 734 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109531.1 protein_id gnl|my_center|LOCUS_10710 <1494 911 gene locus_tag LOCUS_10720 <1494 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986434.1:SpoIVB peptidase >Feature sequence267 878 582 gene locus_tag LOCUS_10730 878 582 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964646.1 protein_id gnl|my_center|LOCUS_10730 1182 868 gene locus_tag LOCUS_10740 1182 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence268 991 77 gene locus_tag LOCUS_10750 991 77 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence269 <1 688 gene locus_tag LOCUS_10760 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807926.1:mechanosensitive ion channel family protein >Feature sequence270 229 849 gene locus_tag LOCUS_10770 229 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 868 1068 gene locus_tag LOCUS_10780 868 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1074 1313 gene locus_tag LOCUS_10790 1074 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence271 >Feature sequence272 443 847 gene locus_tag LOCUS_10800 gene rpsI 443 847 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence273 <1305 408 gene locus_tag LOCUS_10810 <1305 408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861463.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase >Feature sequence274 <1 1068 gene locus_tag LOCUS_10820 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903674.1:folylpolyglutamate synthase/dihydrofolate synthase family protein >Feature sequence275 282 70 gene locus_tag LOCUS_10830 282 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 514 251 gene locus_tag LOCUS_10840 514 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1132 533 gene locus_tag LOCUS_10850 gene rdgB 1132 533 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880078.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence276 <1233 604 gene locus_tag LOCUS_10860 <1233 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545170.1:segregation/condensation protein A >Feature sequence277 >Feature sequence278 <1192 152 gene locus_tag LOCUS_10870 <1192 152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016265.1:heavy metal translocating P-type ATPase >Feature sequence279 <1153 323 gene locus_tag LOCUS_10880 <1153 323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438277.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence280 837 532 gene locus_tag LOCUS_10890 837 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence281 >Feature sequence282 >Feature sequence283 <1 647 gene locus_tag LOCUS_10900 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009890867.1:cell division protein FtsZ 628 789 gene locus_tag LOCUS_10910 628 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910