>Feature sequence001 170 1171 gene locus_tag LOCUS_00010 170 1171 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167627999.1 protein_id gnl|my_center|LOCUS_00010 1275 1952 gene locus_tag LOCUS_00020 1275 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2002 2430 gene locus_tag LOCUS_00030 2002 2430 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361048.1 protein_id gnl|my_center|LOCUS_00030 2524 3705 gene locus_tag LOCUS_00040 2524 3705 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074782808.1 protein_id gnl|my_center|LOCUS_00040 3840 4118 gene locus_tag LOCUS_00050 3840 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5310 4138 gene locus_tag LOCUS_00060 5310 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5488 6633 gene locus_tag LOCUS_00070 gene nagA 5488 6633 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386286.1 protein_id gnl|my_center|LOCUS_00070 6626 7153 gene locus_tag LOCUS_00080 6626 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8059 7208 gene locus_tag LOCUS_00090 8059 7208 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_00090 8246 9565 gene locus_tag LOCUS_00100 gene kbaZ 8246 9565 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209876.1 protein_id gnl|my_center|LOCUS_00100 11163 9796 gene locus_tag LOCUS_00110 11163 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11822 12394 gene locus_tag LOCUS_00120 11822 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00120 12407 12643 gene locus_tag LOCUS_00130 12407 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12636 13625 gene locus_tag LOCUS_00140 12636 13625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13704 14117 gene locus_tag LOCUS_00150 13704 14117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14338 15351 gene locus_tag LOCUS_00160 14338 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15471 19709 gene locus_tag LOCUS_00170 15471 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 >Feature sequence002 2897 2430 gene locus_tag LOCUS_00180 2897 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 3193 2903 gene locus_tag LOCUS_00190 3193 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 4360 3326 gene locus_tag LOCUS_00200 4360 3326 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_00200 5195 4386 gene locus_tag LOCUS_00210 5195 4386 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425096.1 protein_id gnl|my_center|LOCUS_00210 5747 5256 gene locus_tag LOCUS_00220 5747 5256 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_00220 7881 5776 gene locus_tag LOCUS_00230 7881 5776 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963445.1 protein_id gnl|my_center|LOCUS_00230 8004 9422 gene locus_tag LOCUS_00240 8004 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 9409 9732 gene locus_tag LOCUS_00250 9409 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 9732 10328 gene locus_tag LOCUS_00260 9732 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 10362 15257 gene locus_tag LOCUS_00270 10362 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 15617 18694 gene locus_tag LOCUS_00280 15617 18694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 >Feature sequence003 <1 676 gene locus_tag LOCUS_00290 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030897.1:ATP-dependent Clp protease ATP-binding subunit 2387 1308 gene locus_tag LOCUS_00300 2387 1308 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_00300 3073 2378 gene locus_tag LOCUS_00310 gene modB 3073 2378 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_00310 3951 3097 gene locus_tag LOCUS_00320 gene modA 3951 3097 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 protein_id gnl|my_center|LOCUS_00320 5013 4045 gene locus_tag LOCUS_00330 5013 4045 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929692.1 protein_id gnl|my_center|LOCUS_00330 5574 5137 gene locus_tag LOCUS_00340 5574 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 6028 5663 gene locus_tag LOCUS_00350 6028 5663 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 protein_id gnl|my_center|LOCUS_00350 6533 6039 gene locus_tag LOCUS_00360 6533 6039 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_00360 6985 6530 gene locus_tag LOCUS_00370 6985 6530 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986477.1 protein_id gnl|my_center|LOCUS_00370 7941 6991 gene locus_tag LOCUS_00380 gene moaA 7941 6991 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986479.1 protein_id gnl|my_center|LOCUS_00380 8970 7960 gene locus_tag LOCUS_00390 8970 7960 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392449.1 protein_id gnl|my_center|LOCUS_00390 9854 8973 gene locus_tag LOCUS_00400 9854 8973 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204617516.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00400 10811 10023 gene locus_tag LOCUS_00410 10811 10023 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902575.1 protein_id gnl|my_center|LOCUS_00410 11191 10847 gene locus_tag LOCUS_00420 11191 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 12125 11274 gene locus_tag LOCUS_00430 12125 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 13149 12283 gene locus_tag LOCUS_00440 13149 12283 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_00440 13658 13152 gene locus_tag LOCUS_00450 gene cutC 13658 13152 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_00450 16060 13658 gene locus_tag LOCUS_00460 16060 13658 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_00460 17099 16089 gene locus_tag LOCUS_00470 17099 16089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399801.1 protein_id gnl|my_center|LOCUS_00470 18110 17103 gene locus_tag LOCUS_00480 18110 17103 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399804.1 protein_id gnl|my_center|LOCUS_00480 >Feature sequence004 475 1926 gene locus_tag LOCUS_00490 475 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 2320 3258 gene locus_tag LOCUS_00500 2320 3258 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104333.1 protein_id gnl|my_center|LOCUS_00500 3616 4638 gene locus_tag LOCUS_00510 3616 4638 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973889.1 protein_id gnl|my_center|LOCUS_00510 4659 5549 gene locus_tag LOCUS_00520 gene iolE 4659 5549 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_00520 5643 7178 gene locus_tag LOCUS_00530 gene gguA 5643 7178 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_00530 7189 8148 gene locus_tag LOCUS_00540 gene rbsC 7189 8148 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891150.1 protein_id gnl|my_center|LOCUS_00540 8215 9186 gene locus_tag LOCUS_00550 8215 9186 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668256.1 protein_id gnl|my_center|LOCUS_00550 9252 10037 gene locus_tag LOCUS_00560 9252 10037 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256274.1 protein_id gnl|my_center|LOCUS_00560 10068 11084 gene locus_tag LOCUS_00570 gene iolG 10068 11084 CDS product bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244482.1 protein_id gnl|my_center|LOCUS_00570 11356 11790 gene locus_tag LOCUS_00580 11356 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00580 11945 12073 gene locus_tag LOCUS_00590 11945 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 12821 13279 gene locus_tag LOCUS_00600 12821 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 13313 14101 gene locus_tag LOCUS_00610 13313 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 14244 14648 gene locus_tag LOCUS_00620 14244 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 >Feature sequence005 1450 329 gene locus_tag LOCUS_00630 1450 329 CDS product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964882.1 protein_id gnl|my_center|LOCUS_00630 2254 1463 gene locus_tag LOCUS_00640 2254 1463 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_00640 4453 2501 gene locus_tag LOCUS_00650 gene iolD 4453 2501 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 protein_id gnl|my_center|LOCUS_00650 6221 5304 gene locus_tag LOCUS_00660 6221 5304 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811658.1 protein_id gnl|my_center|LOCUS_00660 6926 7825 gene locus_tag LOCUS_00670 gene iolE 6926 7825 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_00670 7872 8888 gene locus_tag LOCUS_00680 7872 8888 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102247.1 protein_id gnl|my_center|LOCUS_00680 9646 9038 gene locus_tag LOCUS_00690 9646 9038 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016701.1 protein_id gnl|my_center|LOCUS_00690 <10476 9885 gene locus_tag LOCUS_00700 <10476 9885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965152.1:bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 >Feature sequence006 1947 346 gene locus_tag LOCUS_00710 1947 346 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435782.1 protein_id gnl|my_center|LOCUS_00710 2934 2167 gene locus_tag LOCUS_00720 gene dapB 2934 2167 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_00720 3854 2964 gene locus_tag LOCUS_00730 gene dapA 3854 2964 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_00730 4961 3870 gene locus_tag LOCUS_00740 gene asd 4961 3870 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963889.1 protein_id gnl|my_center|LOCUS_00740 5348 7030 gene locus_tag LOCUS_00750 5348 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 7091 8116 gene locus_tag LOCUS_00760 gene queA 7091 8116 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_00760 9196 8552 gene locus_tag LOCUS_00770 9196 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 9355 9280 gene locus_tag LOCUS_t00010 9355 9280 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9433 9359 gene locus_tag LOCUS_t00020 9433 9359 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9518 9442 gene locus_tag LOCUS_t00030 9518 9442 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10376 9612 gene locus_tag LOCUS_00780 10376 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 >Feature sequence007 1338 319 gene locus_tag LOCUS_00790 gene aroF 1338 319 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_00790 2219 1530 gene locus_tag LOCUS_00800 2219 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 2877 3641 gene locus_tag LOCUS_00810 gene speD 2877 3641 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_00810 3864 5315 gene locus_tag LOCUS_00820 3864 5315 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_00820 5306 6163 gene locus_tag LOCUS_00830 gene speE 5306 6163 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_00830 6321 7580 gene locus_tag LOCUS_00840 6321 7580 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_00840 7582 8712 gene locus_tag LOCUS_00850 gene nspC 7582 8712 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_00850 8902 8750 gene locus_tag LOCUS_00860 8902 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 9007 9204 gene locus_tag LOCUS_00870 9007 9204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 10247 9426 gene locus_tag LOCUS_00880 gene pdaA 10247 9426 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_00880 >Feature sequence008 550 281 gene locus_tag LOCUS_00890 550 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 1349 618 gene locus_tag LOCUS_00900 gene atpB 1349 618 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_00900 1733 1353 gene locus_tag LOCUS_00910 1733 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 1990 1733 gene locus_tag LOCUS_00920 1990 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 2687 2277 gene locus_tag LOCUS_00930 2687 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_00930 3920 2796 gene locus_tag LOCUS_00940 3920 2796 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811039.1 protein_id gnl|my_center|LOCUS_00940 4406 4011 gene locus_tag LOCUS_00950 4406 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 5155 4406 gene locus_tag LOCUS_00960 5155 4406 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_00960 5624 5241 gene locus_tag LOCUS_00970 5624 5241 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723119.1 protein_id gnl|my_center|LOCUS_00970 6798 5632 gene locus_tag LOCUS_00980 6798 5632 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272338.1 protein_id gnl|my_center|LOCUS_00980 7529 6804 gene locus_tag LOCUS_00990 7529 6804 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_00990 7767 7675 gene locus_tag LOCUS_t00040 7767 7675 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8885 8235 gene locus_tag LOCUS_01000 8885 8235 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_01000 >Feature sequence009 416 742 gene locus_tag LOCUS_01010 416 742 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813947.1 protein_id gnl|my_center|LOCUS_01010 895 1347 gene locus_tag LOCUS_01020 895 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 1351 2256 gene locus_tag LOCUS_01030 1351 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 2269 2589 gene locus_tag LOCUS_01040 2269 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 2660 4051 gene locus_tag LOCUS_01050 2660 4051 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048415.1 protein_id gnl|my_center|LOCUS_01050 4251 4445 gene locus_tag LOCUS_01060 4251 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 4992 5168 gene locus_tag LOCUS_01070 4992 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 5270 5860 gene locus_tag LOCUS_01080 5270 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 protein_id gnl|my_center|LOCUS_01080 5893 7770 gene locus_tag LOCUS_01090 gene dxs 5893 7770 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460263.1 protein_id gnl|my_center|LOCUS_01090 7751 8548 gene locus_tag LOCUS_01100 7751 8548 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence010 125 2053 gene locus_tag LOCUS_01110 125 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 2029 2406 gene locus_tag LOCUS_01120 2029 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01120 2519 3259 gene locus_tag LOCUS_01130 gene minD 2519 3259 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869949.1 protein_id gnl|my_center|LOCUS_01130 3335 3745 gene locus_tag LOCUS_01140 3335 3745 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438060.1 protein_id gnl|my_center|LOCUS_01140 3823 5190 gene locus_tag LOCUS_01150 gene hisS 3823 5190 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_01150 5346 5567 gene locus_tag LOCUS_01160 5346 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 5689 5871 gene locus_tag LOCUS_01170 5689 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 5914 7725 gene locus_tag LOCUS_01180 gene aspS 5914 7725 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_01180 8175 8297 gene locus_tag LOCUS_01190 8175 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence011 1917 265 gene locus_tag LOCUS_01200 1917 265 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210215.1 protein_id gnl|my_center|LOCUS_01200 2358 1945 gene locus_tag LOCUS_01210 2358 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 2660 2358 gene locus_tag LOCUS_01220 2660 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 3974 2772 gene locus_tag LOCUS_01230 3974 2772 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_01230 5201 4023 gene locus_tag LOCUS_01240 5201 4023 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895828.1 protein_id gnl|my_center|LOCUS_01240 6427 5249 gene locus_tag LOCUS_01250 6427 5249 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895548.1 protein_id gnl|my_center|LOCUS_01250 6947 7390 gene locus_tag LOCUS_01260 6947 7390 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence012 637 1389 gene locus_tag LOCUS_01270 637 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 1395 1946 gene locus_tag LOCUS_01280 1395 1946 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_01280 2026 2883 gene locus_tag LOCUS_01290 2026 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 2888 3127 gene locus_tag LOCUS_01300 2888 3127 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_01300 3221 4150 gene locus_tag LOCUS_01310 3221 4150 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_01310 4394 5050 gene locus_tag LOCUS_01320 gene rpsB 4394 5050 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01320 5168 6100 gene locus_tag LOCUS_01330 gene tsf 5168 6100 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_01330 7407 6730 gene locus_tag LOCUS_01340 7407 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 7823 7404 gene locus_tag LOCUS_01350 7823 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111796.1 protein_id gnl|my_center|LOCUS_01350 <8456 7922 gene locus_tag LOCUS_01360 <8456 7922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861191.1:TetR/AcrR family transcriptional regulator >Feature sequence013 <1 800 gene locus_tag LOCUS_01370 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972373.1:dipeptidase 816 2312 gene locus_tag LOCUS_01380 gene thrC 816 2312 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 protein_id gnl|my_center|LOCUS_01380 2315 3016 gene locus_tag LOCUS_01390 2315 3016 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_01390 3098 4426 gene locus_tag LOCUS_01400 gene tig 3098 4426 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_01400 4570 5151 gene locus_tag LOCUS_01410 gene clpP 4570 5151 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_01410 5183 6499 gene locus_tag LOCUS_01420 gene clpX 5183 6499 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence014 488 931 gene locus_tag LOCUS_01430 488 931 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_01430 958 1869 gene locus_tag LOCUS_01440 958 1869 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_01440 2063 2353 gene locus_tag LOCUS_01450 2063 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 2357 3883 gene locus_tag LOCUS_01460 2357 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01460 3840 4826 gene locus_tag LOCUS_01470 3840 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01470 4916 6739 gene locus_tag LOCUS_01480 4916 6739 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_01480 6732 7400 gene locus_tag LOCUS_01490 6732 7400 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_01490 >Feature sequence015 985 281 gene locus_tag LOCUS_01500 gene cwlD 985 281 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_01500 1119 1679 gene locus_tag LOCUS_01510 1119 1679 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_01510 2679 1786 gene locus_tag LOCUS_01520 2679 1786 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_01520 3275 2823 gene locus_tag LOCUS_01530 3275 2823 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_01530 3597 5108 gene locus_tag LOCUS_01540 3597 5108 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_01540 5105 5560 gene locus_tag LOCUS_01550 5105 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 6706 5645 gene locus_tag LOCUS_01560 6706 5645 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970573.1 protein_id gnl|my_center|LOCUS_01560 >Feature sequence016 3104 2238 gene locus_tag LOCUS_01570 3104 2238 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811435.1 protein_id gnl|my_center|LOCUS_01570 3260 4630 gene locus_tag LOCUS_01580 3260 4630 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_01580 4978 7629 gene locus_tag LOCUS_01590 gene alaS 4978 7629 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence017 1467 934 gene locus_tag LOCUS_01600 1467 934 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_01600 1611 2636 gene locus_tag LOCUS_01610 1611 2636 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_01610 4670 3015 gene locus_tag LOCUS_01620 4670 3015 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087145.1 protein_id gnl|my_center|LOCUS_01620 5762 4824 gene locus_tag LOCUS_01630 5762 4824 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399741.1 protein_id gnl|my_center|LOCUS_01630 7023 5845 gene locus_tag LOCUS_01640 7023 5845 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886447.1 protein_id gnl|my_center|LOCUS_01640 >Feature sequence018 305 2548 gene locus_tag LOCUS_01650 305 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 2552 3598 gene locus_tag LOCUS_01660 gene holA 2552 3598 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957659.1 protein_id gnl|my_center|LOCUS_01660 3601 4206 gene locus_tag LOCUS_01670 3601 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 4476 5087 gene locus_tag LOCUS_01680 4476 5087 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_01680 5301 6002 gene locus_tag LOCUS_01690 5301 6002 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_01690 6259 6636 gene locus_tag LOCUS_01700 6259 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 >Feature sequence019 534 259 gene locus_tag LOCUS_01710 534 259 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_01710 1132 611 gene locus_tag LOCUS_01720 1132 611 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_01720 3192 1348 gene locus_tag LOCUS_01730 gene glmS 3192 1348 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_01730 4869 3508 gene locus_tag LOCUS_01740 gene glmM 4869 3508 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048332.1 protein_id gnl|my_center|LOCUS_01740 5937 4897 gene locus_tag LOCUS_01750 gene ruvB 5937 4897 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_01750 6558 5950 gene locus_tag LOCUS_01760 gene ruvA 6558 5950 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_01760 7053 6559 gene locus_tag LOCUS_01770 gene ruvC 7053 6559 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence020 376 1401 gene locus_tag LOCUS_01780 376 1401 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227659.1 protein_id gnl|my_center|LOCUS_01780 1456 2052 gene locus_tag LOCUS_01790 gene coaE 1456 2052 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_01790 2049 3443 gene locus_tag LOCUS_01800 2049 3443 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_01800 4637 3810 gene locus_tag LOCUS_01810 gene nagB 4637 3810 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_01810 4928 4671 gene locus_tag LOCUS_01820 4928 4671 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_01820 5464 4970 gene locus_tag LOCUS_01830 5464 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 7213 6062 gene locus_tag LOCUS_01840 7213 6062 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_01840 >Feature sequence021 5 1003 gene locus_tag LOCUS_01850 5 1003 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003019.1 protein_id gnl|my_center|LOCUS_01850 984 1598 gene locus_tag LOCUS_01860 984 1598 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 protein_id gnl|my_center|LOCUS_01860 1953 1642 gene locus_tag LOCUS_01870 1953 1642 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582838.1 protein_id gnl|my_center|LOCUS_01870 2951 1971 gene locus_tag LOCUS_01880 2951 1971 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_01880 3125 3466 gene locus_tag LOCUS_01890 3125 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 3827 4279 gene locus_tag LOCUS_01900 3827 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 4289 5863 gene locus_tag LOCUS_01910 gene ftsH 4289 5863 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_01910 5869 6114 gene locus_tag LOCUS_01920 5869 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01920 6141 6674 gene locus_tag LOCUS_01930 6141 6674 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356034.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence022 <1 1239 gene locus_tag LOCUS_01940 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965974.1:alpha-amylase family glycosyl hydrolase 3389 1332 gene locus_tag LOCUS_01950 3389 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 4265 3486 gene locus_tag LOCUS_01960 4265 3486 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 protein_id gnl|my_center|LOCUS_01960 4481 5455 gene locus_tag LOCUS_01970 4481 5455 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680895.1 protein_id gnl|my_center|LOCUS_01970 5487 6023 gene locus_tag LOCUS_01980 5487 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 <6927 6351 gene locus_tag LOCUS_01990 <6927 6351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048223.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence023 162 842 gene locus_tag LOCUS_02000 162 842 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 protein_id gnl|my_center|LOCUS_02000 839 1822 gene locus_tag LOCUS_02010 839 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02010 1856 2095 gene locus_tag LOCUS_02020 1856 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 2140 2394 gene locus_tag LOCUS_02030 2140 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02030 2482 2557 gene locus_tag LOCUS_t00050 2482 2557 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4059 2650 gene locus_tag LOCUS_02040 4059 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 4418 4666 gene locus_tag LOCUS_02050 4418 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4841 5272 gene locus_tag LOCUS_02060 4841 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5321 5608 gene locus_tag LOCUS_02070 5321 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6097 5822 gene locus_tag LOCUS_02080 6097 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6351 6094 gene locus_tag LOCUS_02090 6351 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 6743 6468 gene locus_tag LOCUS_02100 6743 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence024 <1 1029 gene locus_tag LOCUS_02110 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986707.1:oligopeptide transporter, OPT family 1106 1468 gene locus_tag LOCUS_02120 1106 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 1465 1809 gene locus_tag LOCUS_02130 1465 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 1857 3299 gene locus_tag LOCUS_02140 1857 3299 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987157.1 protein_id gnl|my_center|LOCUS_02140 3650 3384 gene locus_tag LOCUS_02150 3650 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 3949 3722 gene locus_tag LOCUS_02160 3949 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 4812 4042 gene locus_tag LOCUS_02170 4812 4042 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963877.1 protein_id gnl|my_center|LOCUS_02170 5814 4864 gene locus_tag LOCUS_02180 5814 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811522.1 protein_id gnl|my_center|LOCUS_02180 6000 5824 gene locus_tag LOCUS_02190 6000 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 6518 5997 gene locus_tag LOCUS_02200 6518 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 >Feature sequence025 1021 626 gene locus_tag LOCUS_02210 1021 626 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005427021.1 protein_id gnl|my_center|LOCUS_02210 1691 1191 gene locus_tag LOCUS_02220 1691 1191 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861919.1 protein_id gnl|my_center|LOCUS_02220 1961 1761 gene locus_tag LOCUS_02230 1961 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 2202 1981 gene locus_tag LOCUS_02240 2202 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989674.1 protein_id gnl|my_center|LOCUS_02240 3437 2247 gene locus_tag LOCUS_02250 gene mobT 3437 2247 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159749263.1 protein_id gnl|my_center|LOCUS_02250 3964 3659 gene locus_tag LOCUS_02260 3964 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 4263 3961 gene locus_tag LOCUS_02270 4263 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 4824 4267 gene locus_tag LOCUS_02280 4824 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02280 5681 4794 gene locus_tag LOCUS_02290 5681 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02290 6091 5687 gene locus_tag LOCUS_02300 6091 5687 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861923.1 protein_id gnl|my_center|LOCUS_02300 6434 6111 gene locus_tag LOCUS_02310 6434 6111 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002578441.1 protein_id gnl|my_center|LOCUS_02310 >Feature sequence026 797 288 gene locus_tag LOCUS_02320 797 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 1597 812 gene locus_tag LOCUS_02330 gene thiD 1597 812 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948480.1 protein_id gnl|my_center|LOCUS_02330 2355 1915 gene locus_tag LOCUS_02340 2355 1915 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_02340 3334 2468 gene locus_tag LOCUS_02350 3334 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 4819 3380 gene locus_tag LOCUS_02360 gene proS 4819 3380 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_02360 4940 5233 gene locus_tag LOCUS_02370 4940 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 <6500 5255 gene locus_tag LOCUS_02380 <6500 5255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965659.1:threonine--tRNA ligase >Feature sequence027 <1 734 gene locus_tag LOCUS_02390 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454735.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB note possible pseudo, frameshifted 707 979 gene locus_tag LOCUS_02400 707 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1367 1927 gene locus_tag LOCUS_02410 gene efp 1367 1927 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_02410 1962 2037 gene locus_tag LOCUS_t00060 1962 2037 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2861 2127 gene locus_tag LOCUS_02420 2861 2127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460545.1 protein_id gnl|my_center|LOCUS_02420 3677 2865 gene locus_tag LOCUS_02430 3677 2865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272457.1 protein_id gnl|my_center|LOCUS_02430 4591 3674 gene locus_tag LOCUS_02440 4591 3674 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460543.1 protein_id gnl|my_center|LOCUS_02440 4999 5970 gene locus_tag LOCUS_02450 4999 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 >Feature sequence028 1678 488 gene locus_tag LOCUS_02460 1678 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3212 1770 gene locus_tag LOCUS_02470 3212 1770 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_02470 3465 4718 gene locus_tag LOCUS_02480 3465 4718 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_02480 4786 6177 gene locus_tag LOCUS_02490 gene argH 4786 6177 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence029 2 226 gene locus_tag LOCUS_02500 2 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 319 405 gene locus_tag LOCUS_t00070 319 405 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 444 716 gene locus_tag LOCUS_02510 444 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 864 2186 gene locus_tag LOCUS_02520 gene brnQ 864 2186 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964918.1 protein_id gnl|my_center|LOCUS_02520 2392 2691 gene locus_tag LOCUS_02530 2392 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 2763 3386 gene locus_tag LOCUS_02540 2763 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3614 4177 gene locus_tag LOCUS_02550 3614 4177 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973054.1 protein_id gnl|my_center|LOCUS_02550 4159 4623 gene locus_tag LOCUS_02560 gene bcp 4159 4623 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_02560 4658 5419 gene locus_tag LOCUS_02570 gene yaaA 4658 5419 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_02570 <6280 5571 gene locus_tag LOCUS_02580 <6280 5571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858758.1:threonine ammonia-lyase >Feature sequence030 101 2494 gene locus_tag LOCUS_02590 101 2494 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_02590 2674 2937 gene locus_tag LOCUS_02600 2674 2937 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362134.1 protein_id gnl|my_center|LOCUS_02600 3026 4849 gene locus_tag LOCUS_02610 gene uvrC 3026 4849 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_02610 4852 5406 gene locus_tag LOCUS_02620 gene rsmD 4852 5406 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460510.1 protein_id gnl|my_center|LOCUS_02620 5408 5893 gene locus_tag LOCUS_02630 gene coaD 5408 5893 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence031 1850 543 gene locus_tag LOCUS_02640 1850 543 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 protein_id gnl|my_center|LOCUS_02640 2522 3568 gene locus_tag LOCUS_02650 2522 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 4020 3775 gene locus_tag LOCUS_02660 4020 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4460 4014 gene locus_tag LOCUS_02670 4460 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5077 4475 gene locus_tag LOCUS_02680 5077 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 6135 5110 gene locus_tag LOCUS_02690 6135 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 >Feature sequence032 2042 900 gene locus_tag LOCUS_02700 gene tgt 2042 900 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_02700 2269 3258 gene locus_tag LOCUS_02710 gene pgl 2269 3258 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_02710 3262 4677 gene locus_tag LOCUS_02720 gene gndA 3262 4677 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190614.1 protein_id gnl|my_center|LOCUS_02720 4674 6071 gene locus_tag LOCUS_02730 gene zwf 4674 6071 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393785.1 protein_id gnl|my_center|LOCUS_02730 >Feature sequence033 1540 428 gene locus_tag LOCUS_02740 1540 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 2401 1751 gene locus_tag LOCUS_02750 2401 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2669 2385 gene locus_tag LOCUS_02760 2669 2385 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_02760 2906 2670 gene locus_tag LOCUS_02770 2906 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 3319 3059 gene locus_tag LOCUS_02780 gene rpsT 3319 3059 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_02780 3907 3581 gene locus_tag LOCUS_02790 3907 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 4161 4331 gene locus_tag LOCUS_02800 4161 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 4407 5468 gene locus_tag LOCUS_02810 4407 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 >Feature sequence034 3 245 gene locus_tag LOCUS_02820 3 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 389 2332 gene locus_tag LOCUS_02830 gene mutL 389 2332 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775469.1 protein_id gnl|my_center|LOCUS_02830 2342 3283 gene locus_tag LOCUS_02840 gene miaA 2342 3283 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965140.1 protein_id gnl|my_center|LOCUS_02840 3316 3558 gene locus_tag LOCUS_02850 gene hfq 3316 3558 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813896.1 protein_id gnl|my_center|LOCUS_02850 3578 4855 gene locus_tag LOCUS_02860 3578 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 4852 5577 gene locus_tag LOCUS_02870 4852 5577 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965420.1 protein_id gnl|my_center|LOCUS_02870 5598 6101 gene locus_tag LOCUS_02880 gene sepF 5598 6101 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416162.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence035 76 276 gene locus_tag LOCUS_02890 76 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02890 351 1547 gene locus_tag LOCUS_02900 gene spoIVA 351 1547 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02900 2147 1722 gene locus_tag LOCUS_02910 2147 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 protein_id gnl|my_center|LOCUS_02910 3261 2164 gene locus_tag LOCUS_02920 3261 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 3799 4302 gene locus_tag LOCUS_02930 3799 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 4481 5566 gene locus_tag LOCUS_02940 4481 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence036 704 531 gene locus_tag LOCUS_02950 704 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 836 1732 gene locus_tag LOCUS_02960 836 1732 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439841.1 protein_id gnl|my_center|LOCUS_02960 1745 2167 gene locus_tag LOCUS_02970 gene pth2 1745 2167 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146590.1 protein_id gnl|my_center|LOCUS_02970 2276 3175 gene locus_tag LOCUS_02980 2276 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 3579 4154 gene locus_tag LOCUS_02990 3579 4154 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_02990 4154 4459 gene locus_tag LOCUS_03000 4154 4459 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_03000 4459 5658 gene locus_tag LOCUS_03010 4459 5658 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_03010 >Feature sequence037 949 770 gene locus_tag LOCUS_03020 949 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 1580 1041 gene locus_tag LOCUS_03030 1580 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 1852 1577 gene locus_tag LOCUS_03040 1852 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 2036 1839 gene locus_tag LOCUS_03050 2036 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 2241 2056 gene locus_tag LOCUS_03060 2241 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 2292 2630 gene locus_tag LOCUS_03070 2292 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 2755 2564 gene locus_tag LOCUS_03080 2755 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2859 3239 gene locus_tag LOCUS_03090 2859 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3378 3154 gene locus_tag LOCUS_03100 3378 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3638 3432 gene locus_tag LOCUS_03110 3638 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 3772 4410 gene locus_tag LOCUS_03120 3772 4410 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110319.1 protein_id gnl|my_center|LOCUS_03120 4521 5015 gene locus_tag LOCUS_03130 4521 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 5020 5775 gene locus_tag LOCUS_03140 5020 5775 CDS product DUF1828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546132.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence038 3184 2174 gene locus_tag LOCUS_03150 3184 2174 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939915.1 protein_id gnl|my_center|LOCUS_03150 3972 3310 gene locus_tag LOCUS_03160 3972 3310 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_03160 4971 4489 gene locus_tag LOCUS_03170 gene moaC 4971 4489 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_03170 5664 5589 gene locus_tag LOCUS_t00080 5664 5589 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5810 5736 gene locus_tag LOCUS_t00090 5810 5736 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 <1 1220 gene locus_tag LOCUS_03180 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454645.1:acetyl-CoA hydrolase/transferase C-terminal domain-containing protein 1248 1367 gene locus_tag LOCUS_03190 1248 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 1706 1377 gene locus_tag LOCUS_03200 1706 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 1993 5109 gene locus_tag LOCUS_03210 1993 5109 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965948.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03210 4992 5405 gene locus_tag LOCUS_03220 4992 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03220 >Feature sequence040 551 222 gene locus_tag LOCUS_03230 551 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 865 548 gene locus_tag LOCUS_03240 865 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 1426 1019 gene locus_tag LOCUS_03250 1426 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 3559 1625 gene locus_tag LOCUS_03260 gene metG 3559 1625 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_03260 4087 3563 gene locus_tag LOCUS_03270 4087 3563 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_03270 5550 4471 gene locus_tag LOCUS_03280 5550 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence041 1433 2347 gene locus_tag LOCUS_03290 1433 2347 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_03290 2411 3238 gene locus_tag LOCUS_03300 gene pstC 2411 3238 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_03300 3275 4162 gene locus_tag LOCUS_03310 gene pstA 3275 4162 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049767.1 protein_id gnl|my_center|LOCUS_03310 4178 4930 gene locus_tag LOCUS_03320 gene pstB 4178 4930 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_03320 4930 5568 gene locus_tag LOCUS_03330 gene phoU 4930 5568 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence042 1374 634 gene locus_tag LOCUS_03340 1374 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03340 1771 1322 gene locus_tag LOCUS_03350 1771 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2655 1768 gene locus_tag LOCUS_03360 2655 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 3681 2719 gene locus_tag LOCUS_03370 3681 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 5087 4203 gene locus_tag LOCUS_03380 gene pflA 5087 4203 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048195.1 protein_id gnl|my_center|LOCUS_03380 >Feature sequence043 <1 1500 gene locus_tag LOCUS_03390 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003431686.1:SH3 domain-containing protein 1753 3675 gene locus_tag LOCUS_03400 1753 3675 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_03400 3759 4424 gene locus_tag LOCUS_03410 3759 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 <5799 5134 gene locus_tag LOCUS_03420 <5799 5134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003428643.1:prephenate dehydrogenase >Feature sequence044 3046 98 gene locus_tag LOCUS_03430 3046 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 3244 3432 gene locus_tag LOCUS_03440 3244 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 4541 3912 gene locus_tag LOCUS_03450 4541 3912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426165.1 protein_id gnl|my_center|LOCUS_03450 <5678 4607 gene locus_tag LOCUS_03460 <5678 4607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001068276.1:ABC transporter permease >Feature sequence045 349 876 gene locus_tag LOCUS_03470 349 876 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989428.1 protein_id gnl|my_center|LOCUS_03470 2369 1200 gene locus_tag LOCUS_03480 2369 1200 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_03480 2605 4098 gene locus_tag LOCUS_03490 2605 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 4722 4213 gene locus_tag LOCUS_03500 4722 4213 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_03500 5550 4912 gene locus_tag LOCUS_03510 5550 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 >Feature sequence046 4008 331 gene locus_tag LOCUS_03520 4008 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 4373 4672 gene locus_tag LOCUS_03530 4373 4672 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810336.1 protein_id gnl|my_center|LOCUS_03530 4659 5051 gene locus_tag LOCUS_03540 4659 5051 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence047 772 697 gene locus_tag LOCUS_t00100 772 697 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1028 1660 gene locus_tag LOCUS_03550 1028 1660 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023352.1 protein_id gnl|my_center|LOCUS_03550 1815 2585 gene locus_tag LOCUS_03560 1815 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 2609 2872 gene locus_tag LOCUS_03570 2609 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 2890 4353 gene locus_tag LOCUS_03580 2890 4353 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 protein_id gnl|my_center|LOCUS_03580 <5553 4408 gene locus_tag LOCUS_03590 <5553 4408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233074.1:MATE family efflux transporter >Feature sequence048 1697 270 gene locus_tag LOCUS_03600 1697 270 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357550.1 protein_id gnl|my_center|LOCUS_03600 2813 1758 gene locus_tag LOCUS_03610 2813 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 3887 2916 gene locus_tag LOCUS_03620 3887 2916 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_03620 4778 3891 gene locus_tag LOCUS_03630 4778 3891 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_03630 <5506 4800 gene locus_tag LOCUS_03640 <5506 4800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003409686.1:SDR family oxidoreductase >Feature sequence049 2653 230 gene locus_tag LOCUS_03650 2653 230 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_03650 2993 3328 gene locus_tag LOCUS_03660 2993 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 3889 3449 gene locus_tag LOCUS_03670 3889 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 4704 3886 gene locus_tag LOCUS_03680 4704 3886 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_03680 >Feature sequence050 1284 568 gene locus_tag LOCUS_03690 1284 568 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_03690 1903 1382 gene locus_tag LOCUS_03700 1903 1382 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787224.1 protein_id gnl|my_center|LOCUS_03700 2079 3683 gene locus_tag LOCUS_03710 2079 3683 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_03710 3683 4054 gene locus_tag LOCUS_03720 3683 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 4454 4107 gene locus_tag LOCUS_03730 4454 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 4652 5263 gene locus_tag LOCUS_03740 4652 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence051 1006 467 gene locus_tag LOCUS_03750 1006 467 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870146.1 protein_id gnl|my_center|LOCUS_03750 1480 1229 gene locus_tag LOCUS_03760 1480 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 1793 1963 gene locus_tag LOCUS_03770 1793 1963 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_03770 2304 3572 gene locus_tag LOCUS_03780 2304 3572 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_03780 3604 4068 gene locus_tag LOCUS_03790 3604 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4046 4297 gene locus_tag LOCUS_03800 4046 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence052 745 1938 gene locus_tag LOCUS_03810 745 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 5204 2019 gene locus_tag LOCUS_03820 gene carB 5204 2019 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence053 <1 652 gene locus_tag LOCUS_03830 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392356.1:stage V sporulation protein D 662 2104 gene locus_tag LOCUS_03840 662 2104 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_03840 2157 3539 gene locus_tag LOCUS_03850 2157 3539 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_03850 3536 4519 gene locus_tag LOCUS_03860 gene mraY 3536 4519 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731978.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence054 <1 1660 gene locus_tag LOCUS_03870 <1 1660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021371417.1:N-acetylmuramoyl-L-alanine amidase 1657 2085 gene locus_tag LOCUS_03880 1657 2085 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_03880 2279 2485 gene locus_tag LOCUS_03890 2279 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3100 2534 gene locus_tag LOCUS_03900 3100 2534 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_03900 3639 3097 gene locus_tag LOCUS_03910 3639 3097 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_03910 4096 3734 gene locus_tag LOCUS_03920 4096 3734 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence055 15 1910 gene locus_tag LOCUS_03930 15 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2170 2541 gene locus_tag LOCUS_03940 gene rbfA 2170 2541 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965109.1 protein_id gnl|my_center|LOCUS_03940 2538 3497 gene locus_tag LOCUS_03950 2538 3497 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_03950 3484 4401 gene locus_tag LOCUS_03960 gene truB 3484 4401 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399346.1 protein_id gnl|my_center|LOCUS_03960 >Feature sequence056 200 1387 gene locus_tag LOCUS_03970 200 1387 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_03970 1674 2132 gene locus_tag LOCUS_03980 gene purE 1674 2132 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_03980 2281 2991 gene locus_tag LOCUS_03990 2281 2991 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_03990 3073 4494 gene locus_tag LOCUS_04000 3073 4494 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_04000 >Feature sequence057 <1 674 gene locus_tag LOCUS_04010 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140038.1:replicative DNA helicase 691 1047 gene locus_tag LOCUS_04020 691 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 1034 1213 gene locus_tag LOCUS_04030 1034 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 1210 2010 gene locus_tag LOCUS_04040 1210 2010 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101106.1 protein_id gnl|my_center|LOCUS_04040 1994 3406 gene locus_tag LOCUS_04050 1994 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3410 3733 gene locus_tag LOCUS_04060 3410 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 3796 4110 gene locus_tag LOCUS_04070 3796 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 4107 4439 gene locus_tag LOCUS_04080 4107 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence058 259 134 gene locus_tag LOCUS_04090 259 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 365 946 gene locus_tag LOCUS_04100 365 946 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941742.1 protein_id gnl|my_center|LOCUS_04100 961 1037 gene locus_tag LOCUS_t00110 961 1037 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2534 1179 gene locus_tag LOCUS_04110 2534 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 3122 2547 gene locus_tag LOCUS_04120 3122 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 3283 3501 gene locus_tag LOCUS_04130 3283 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 3504 3746 gene locus_tag LOCUS_04140 3504 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 3709 4050 gene locus_tag LOCUS_04150 3709 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4065 4769 gene locus_tag LOCUS_04160 4065 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence059 1461 1027 gene locus_tag LOCUS_04170 1461 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 2053 2760 gene locus_tag LOCUS_04180 2053 2760 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_04180 3474 4064 gene locus_tag LOCUS_04190 3474 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 4224 4541 gene locus_tag LOCUS_04200 4224 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04200 4825 4956 gene locus_tag LOCUS_04210 4825 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence060 1751 981 gene locus_tag LOCUS_04220 1751 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 2358 1732 gene locus_tag LOCUS_04230 2358 1732 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_04230 3079 2372 gene locus_tag LOCUS_04240 3079 2372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_04240 3856 3098 gene locus_tag LOCUS_04250 3856 3098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_04250 4943 3858 gene locus_tag LOCUS_04260 4943 3858 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence061 1937 789 gene locus_tag LOCUS_04270 gene ftsZ 1937 789 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_04270 3202 2231 gene locus_tag LOCUS_04280 3202 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4357 3215 gene locus_tag LOCUS_04290 gene murG 4357 3215 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_04290 <5013 4431 gene locus_tag LOCUS_04300 <5013 4431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753510.1:stage V sporulation protein E >Feature sequence062 507 1286 gene locus_tag LOCUS_04310 507 1286 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_04310 1326 2099 gene locus_tag LOCUS_04320 1326 2099 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_04320 2102 2599 gene locus_tag LOCUS_04330 2102 2599 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_04330 3202 2687 gene locus_tag LOCUS_04340 3202 2687 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_04340 4755 3400 gene locus_tag LOCUS_04350 4755 3400 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021843.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence063 905 2422 gene locus_tag LOCUS_04360 905 2422 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_04360 2424 2675 gene locus_tag LOCUS_04370 2424 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2676 3827 gene locus_tag LOCUS_04380 2676 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3841 4725 gene locus_tag LOCUS_04390 3841 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 4710 4856 gene locus_tag LOCUS_04400 4710 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence064 2205 1102 gene locus_tag LOCUS_04410 2205 1102 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969741.1 protein_id gnl|my_center|LOCUS_04410 2529 3218 gene locus_tag LOCUS_04420 2529 3218 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618822.1 protein_id gnl|my_center|LOCUS_04420 4049 3552 gene locus_tag LOCUS_04430 4049 3552 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_04430 4896 4015 gene locus_tag LOCUS_04440 4896 4015 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393454.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence065 1331 1912 gene locus_tag LOCUS_04450 1331 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 1926 2549 gene locus_tag LOCUS_04460 1926 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3014 3262 gene locus_tag LOCUS_04470 3014 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3492 3869 gene locus_tag LOCUS_04480 3492 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3871 4080 gene locus_tag LOCUS_04490 3871 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4517 4783 gene locus_tag LOCUS_04500 4517 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence066 <1 1186 gene locus_tag LOCUS_04510 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246072.1:leucine--tRNA ligase 1308 1490 gene locus_tag LOCUS_04520 1308 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 1890 2231 gene locus_tag LOCUS_04530 1890 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2207 2560 gene locus_tag LOCUS_04540 2207 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 2658 3140 gene locus_tag LOCUS_04550 2658 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04550 3204 4652 gene locus_tag LOCUS_04560 3204 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04560 >Feature sequence067 405 665 gene locus_tag LOCUS_04570 405 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 1014 1472 gene locus_tag LOCUS_04580 1014 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 1459 2520 gene locus_tag LOCUS_04590 1459 2520 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967060.1 protein_id gnl|my_center|LOCUS_04590 2749 3312 gene locus_tag LOCUS_04600 2749 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence068 1796 618 gene locus_tag LOCUS_04610 1796 618 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_04610 3054 1834 gene locus_tag LOCUS_04620 3054 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4321 2936 gene locus_tag LOCUS_04630 4321 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence069 1750 869 gene locus_tag LOCUS_04640 1750 869 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127403.1 protein_id gnl|my_center|LOCUS_04640 2599 1991 gene locus_tag LOCUS_04650 2599 1991 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_04650 3811 2627 gene locus_tag LOCUS_04660 gene metK 3811 2627 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence070 512 1654 gene locus_tag LOCUS_04670 512 1654 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965998.1 protein_id gnl|my_center|LOCUS_04670 1676 2476 gene locus_tag LOCUS_04680 gene etfB 1676 2476 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427760.1 protein_id gnl|my_center|LOCUS_04680 2495 3610 gene locus_tag LOCUS_04690 2495 3610 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986692.1 protein_id gnl|my_center|LOCUS_04690 <4571 3745 gene locus_tag LOCUS_04700 <4571 3745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048366.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence071 74 502 gene locus_tag LOCUS_04710 gene rplP 74 502 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_04710 499 702 gene locus_tag LOCUS_04720 gene rpmC 499 702 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_04720 717 974 gene locus_tag LOCUS_04730 gene rpsQ 717 974 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_04730 987 1355 gene locus_tag LOCUS_04740 gene rplN 987 1355 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_04740 1371 1688 gene locus_tag LOCUS_04750 gene rplX 1371 1688 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_04750 1709 2254 gene locus_tag LOCUS_04760 gene rplE 1709 2254 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_04760 2270 2455 gene locus_tag LOCUS_04770 2270 2455 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_04770 3066 3464 gene locus_tag LOCUS_04780 gene rpsH 3066 3464 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_04780 3480 4025 gene locus_tag LOCUS_04790 gene rplF 3480 4025 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810135.1 protein_id gnl|my_center|LOCUS_04790 4047 4406 gene locus_tag LOCUS_04800 gene rplR 4047 4406 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence072 2683 1205 gene locus_tag LOCUS_04810 2683 1205 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_04810 3395 3039 gene locus_tag LOCUS_04820 3395 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3962 3447 gene locus_tag LOCUS_04830 gene eetB 3962 3447 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_04830 4349 3978 gene locus_tag LOCUS_04840 4349 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence073 122 1420 gene locus_tag LOCUS_04850 gene celB 122 1420 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_04850 1421 2206 gene locus_tag LOCUS_04860 1421 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2203 2745 gene locus_tag LOCUS_04870 2203 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence074 1327 809 gene locus_tag LOCUS_04880 1327 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 2414 1368 gene locus_tag LOCUS_04890 gene hrcA 2414 1368 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_04890 2718 3737 gene locus_tag LOCUS_04900 2718 3737 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102247.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence075 1378 92 gene locus_tag LOCUS_04910 gene galK 1378 92 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_04910 2674 1928 gene locus_tag LOCUS_04920 2674 1928 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355616.1 protein_id gnl|my_center|LOCUS_04920 3338 2661 gene locus_tag LOCUS_04930 3338 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4221 3427 gene locus_tag LOCUS_04940 4221 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence076 1384 95 gene locus_tag LOCUS_04950 gene guaA 1384 95 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764094.1 protein_id gnl|my_center|LOCUS_04950 1949 1500 gene locus_tag LOCUS_04960 1949 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2349 1915 gene locus_tag LOCUS_04970 2349 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 2475 3368 gene locus_tag LOCUS_04980 gene trxB 2475 3368 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948886.1 protein_id gnl|my_center|LOCUS_04980 3389 4423 gene locus_tag LOCUS_04990 3389 4423 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922574.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence077 95 952 gene locus_tag LOCUS_05000 gene rapZ 95 952 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_05000 974 1867 gene locus_tag LOCUS_05010 gene whiA 974 1867 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence078 2568 1915 gene locus_tag LOCUS_05020 2568 1915 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_05020 3760 2603 gene locus_tag LOCUS_05030 3760 2603 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_05030 <4429 3837 gene locus_tag LOCUS_05040 <4429 3837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454235.1:aconitate hydratase >Feature sequence079 448 1074 gene locus_tag LOCUS_05050 448 1074 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545224.1 protein_id gnl|my_center|LOCUS_05050 1216 1413 gene locus_tag LOCUS_05060 1216 1413 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001843884.1 protein_id gnl|my_center|LOCUS_05060 1415 1936 gene locus_tag LOCUS_05070 1415 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2065 3435 gene locus_tag LOCUS_05080 2065 3435 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence080 1065 493 gene locus_tag LOCUS_05090 1065 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 1207 1593 gene locus_tag LOCUS_05100 1207 1593 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_05100 1577 2284 gene locus_tag LOCUS_05110 1577 2284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_05110 2278 3087 gene locus_tag LOCUS_05120 2278 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_05120 3450 4313 gene locus_tag LOCUS_05130 3450 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence081 184 2256 gene locus_tag LOCUS_05140 184 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence082 1352 462 gene locus_tag LOCUS_05150 1352 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1604 2416 gene locus_tag LOCUS_05160 gene proC 1604 2416 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095814.1 protein_id gnl|my_center|LOCUS_05160 2499 2819 gene locus_tag LOCUS_05170 2499 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 2913 3785 gene locus_tag LOCUS_05180 2913 3785 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433836.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence083 2439 1768 gene locus_tag LOCUS_05190 gene rnc 2439 1768 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_05190 3125 2511 gene locus_tag LOCUS_05200 3125 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05200 3525 3022 gene locus_tag LOCUS_05210 3525 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05210 <4345 3527 gene locus_tag LOCUS_05220 <4345 3527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003645028.1:FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO >Feature sequence084 112 318 gene locus_tag LOCUS_05230 112 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 364 645 gene locus_tag LOCUS_05240 364 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 657 1136 gene locus_tag LOCUS_05250 657 1136 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391640.1 protein_id gnl|my_center|LOCUS_05250 1363 2514 gene locus_tag LOCUS_05260 1363 2514 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_05260 2511 3353 gene locus_tag LOCUS_05270 2511 3353 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_05270 3529 4056 gene locus_tag LOCUS_05280 gene raiA 3529 4056 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence085 932 336 gene locus_tag LOCUS_05290 932 336 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_05290 1109 1321 gene locus_tag LOCUS_05300 1109 1321 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418105.1 protein_id gnl|my_center|LOCUS_05300 1318 1899 gene locus_tag LOCUS_05310 1318 1899 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 protein_id gnl|my_center|LOCUS_05310 1896 2279 gene locus_tag LOCUS_05320 1896 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 2355 2663 gene locus_tag LOCUS_05330 gene trxA 2355 2663 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460330.1 protein_id gnl|my_center|LOCUS_05330 3158 3337 gene locus_tag LOCUS_05340 3158 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 3489 4247 gene locus_tag LOCUS_05350 3489 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence086 309 175 gene locus_tag LOCUS_05360 309 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 623 1903 gene locus_tag LOCUS_05370 gene dnaA 623 1903 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391551.1 protein_id gnl|my_center|LOCUS_05370 2182 3291 gene locus_tag LOCUS_05380 gene dnaN 2182 3291 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_05380 3284 3490 gene locus_tag LOCUS_05390 gene yaaA 3284 3490 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence087 1916 1521 gene locus_tag LOCUS_05400 1916 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 2389 1925 gene locus_tag LOCUS_05410 2389 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 3467 2409 gene locus_tag LOCUS_05420 3467 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence088 712 389 gene locus_tag LOCUS_05430 gene trxA 712 389 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966364.1 protein_id gnl|my_center|LOCUS_05430 1481 870 gene locus_tag LOCUS_05440 1481 870 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460050.1 protein_id gnl|my_center|LOCUS_05440 2031 1639 gene locus_tag LOCUS_05450 2031 1639 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090189.1 protein_id gnl|my_center|LOCUS_05450 3428 2133 gene locus_tag LOCUS_05460 gene serS 3428 2133 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_05460 4019 3459 gene locus_tag LOCUS_05470 4019 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence089 477 1157 gene locus_tag LOCUS_05480 gene murI 477 1157 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_05480 1183 1545 gene locus_tag LOCUS_05490 1183 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 1776 3362 gene locus_tag LOCUS_05500 gene argS 1776 3362 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence090 291 1226 gene locus_tag LOCUS_05510 291 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1473 1333 gene locus_tag LOCUS_05520 1473 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2313 1675 gene locus_tag LOCUS_05530 2313 1675 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_05530 2780 2334 gene locus_tag LOCUS_05540 2780 2334 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053228394.1 protein_id gnl|my_center|LOCUS_05540 3010 3588 gene locus_tag LOCUS_05550 3010 3588 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence091 <1 1304 gene locus_tag LOCUS_05560 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110443.1:glycogen synthase GlgA 1346 3793 gene locus_tag LOCUS_05570 1346 3793 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence092 701 1282 gene locus_tag LOCUS_05580 701 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 1383 2828 gene locus_tag LOCUS_05590 gene abfD 1383 2828 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_05590 2910 3191 gene locus_tag LOCUS_05600 2910 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence093 535 2013 gene locus_tag LOCUS_05610 535 2013 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061775.1 protein_id gnl|my_center|LOCUS_05610 4042 2120 gene locus_tag LOCUS_05620 4042 2120 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence094 2346 133 gene locus_tag LOCUS_05630 2346 133 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_05630 3112 2411 gene locus_tag LOCUS_05640 gene ftsE 3112 2411 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_05640 3216 4100 gene locus_tag LOCUS_05650 3216 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence095 2500 920 gene locus_tag LOCUS_05660 2500 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 2886 3833 gene locus_tag LOCUS_05670 2886 3833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975870.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence096 <1 1726 gene locus_tag LOCUS_05680 <1 1726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890689.1:Ig-like domain-containing protein 2680 2964 gene locus_tag LOCUS_05690 2680 2964 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420907.1 protein_id gnl|my_center|LOCUS_05690 2984 3163 gene locus_tag LOCUS_05700 2984 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05700 >Feature sequence097 <1 612 gene locus_tag LOCUS_05710 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817367.1:Gfo/Idh/MocA family oxidoreductase 641 1660 gene locus_tag LOCUS_05720 641 1660 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536378.1 protein_id gnl|my_center|LOCUS_05720 2473 3396 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttctatccacgccctctgcgaaagagggcgac 3909 3619 gene locus_tag LOCUS_05730 gene cas2 3909 3619 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence098 535 314 gene locus_tag LOCUS_05740 535 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2893 1685 gene locus_tag LOCUS_05750 2893 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3113 3397 gene locus_tag LOCUS_05760 3113 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05760 3325 3534 gene locus_tag LOCUS_05770 3325 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05770 >Feature sequence099 <1 1008 gene locus_tag LOCUS_05780 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000863460.1:signal recognition particle protein 1076 1318 gene locus_tag LOCUS_05790 gene rpsP 1076 1318 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_05790 1315 1563 gene locus_tag LOCUS_05800 1315 1563 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_05800 1876 2382 gene locus_tag LOCUS_05810 gene rimM 1876 2382 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870156.1 protein_id gnl|my_center|LOCUS_05810 2379 2837 gene locus_tag LOCUS_05820 2379 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05820 2815 3096 gene locus_tag LOCUS_05830 2815 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05830 3253 3930 gene locus_tag LOCUS_05840 gene rpiA 3253 3930 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917153.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence100 626 2119 gene locus_tag LOCUS_05850 gene rbsA 626 2119 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546779.1 protein_id gnl|my_center|LOCUS_05850 2134 3081 gene locus_tag LOCUS_05860 2134 3081 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074641.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence101 334 155 gene locus_tag LOCUS_05870 334 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 437 312 gene locus_tag LOCUS_05880 437 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1526 462 gene locus_tag LOCUS_05890 1526 462 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_05890 3916 1655 gene locus_tag LOCUS_05900 3916 1655 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966138.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence102 2638 1289 gene locus_tag LOCUS_05910 2638 1289 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_05910 2987 2718 gene locus_tag LOCUS_05920 2987 2718 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_05920 4022 3051 gene locus_tag LOCUS_05930 4022 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence103 1092 331 gene locus_tag LOCUS_05940 1092 331 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303625.1 protein_id gnl|my_center|LOCUS_05940 2135 1302 gene locus_tag LOCUS_05950 2135 1302 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 protein_id gnl|my_center|LOCUS_05950 2379 3719 gene locus_tag LOCUS_05960 2379 3719 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence104 <1 522 gene locus_tag LOCUS_05970 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000189676.1:cobyric acid synthase 519 1049 gene locus_tag LOCUS_05980 gene cobO 519 1049 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392864.1 protein_id gnl|my_center|LOCUS_05980 1046 1681 gene locus_tag LOCUS_05990 1046 1681 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_05990 1828 1995 gene locus_tag LOCUS_06000 1828 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2257 2496 gene locus_tag LOCUS_06010 2257 2496 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_06010 2517 3533 gene locus_tag LOCUS_06020 2517 3533 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence105 1218 1676 gene locus_tag LOCUS_06030 gene mscL 1218 1676 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_06030 2036 3265 gene locus_tag LOCUS_06040 2036 3265 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_06040 <3966 3335 gene locus_tag LOCUS_06050 <3966 3335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000891874.1:PLP-dependent aminotransferase family protein >Feature sequence106 419 937 gene locus_tag LOCUS_06060 419 937 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_06060 959 1696 gene locus_tag LOCUS_06070 959 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2672 2472 gene locus_tag LOCUS_06080 2672 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 2750 2899 gene locus_tag LOCUS_06090 2750 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3735 2884 gene locus_tag LOCUS_06100 gene folD 3735 2884 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence107 755 531 gene locus_tag LOCUS_06110 755 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 837 2471 gene locus_tag LOCUS_06120 gene rlmD 837 2471 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914581.1 protein_id gnl|my_center|LOCUS_06120 3529 2483 gene locus_tag LOCUS_06130 3529 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 >Feature sequence108 2557 1046 gene locus_tag LOCUS_06140 2557 1046 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942551.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence109 1605 727 gene locus_tag LOCUS_06150 1605 727 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_06150 1868 2386 gene locus_tag LOCUS_06160 1868 2386 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_06160 2431 2616 gene locus_tag LOCUS_06170 gene rpmF 2431 2616 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence110 40 113 gene locus_tag LOCUS_t00120 40 113 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 313 1008 gene locus_tag LOCUS_06180 313 1008 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_06180 1011 1853 gene locus_tag LOCUS_06190 1011 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1850 3151 gene locus_tag LOCUS_06200 1850 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence111 978 814 gene locus_tag LOCUS_06210 978 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2816 996 gene locus_tag LOCUS_06220 2816 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3184 2816 gene locus_tag LOCUS_06230 3184 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 3334 3627 gene locus_tag LOCUS_06240 3334 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence112 401 1093 gene locus_tag LOCUS_06250 gene yunB 401 1093 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075141567.1 protein_id gnl|my_center|LOCUS_06250 1159 3147 gene locus_tag LOCUS_06260 gene ligA 1159 3147 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812372.1 protein_id gnl|my_center|LOCUS_06260 3149 3436 gene locus_tag LOCUS_06270 gene gatC 3149 3436 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034582121.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence113 1211 417 gene locus_tag LOCUS_06280 1211 417 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_06280 1745 1404 gene locus_tag LOCUS_06290 1745 1404 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_06290 1873 2439 gene locus_tag LOCUS_06300 1873 2439 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_06300 2684 3646 gene locus_tag LOCUS_06310 2684 3646 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804298.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence114 613 425 gene locus_tag LOCUS_06320 613 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 2429 810 gene locus_tag LOCUS_06330 2429 810 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_06330 3223 2627 gene locus_tag LOCUS_06340 3223 2627 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613301.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence115 326 111 gene locus_tag LOCUS_06350 326 111 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_06350 652 3174 gene locus_tag LOCUS_06360 652 3174 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_06360 3245 3673 gene locus_tag LOCUS_06370 3245 3673 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence116 238 447 gene locus_tag LOCUS_06380 238 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 457 732 gene locus_tag LOCUS_06390 457 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1009 755 gene locus_tag LOCUS_06400 1009 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2099 1632 gene locus_tag LOCUS_06410 gene smpB 2099 1632 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_06410 2728 2240 gene locus_tag LOCUS_06420 2728 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 3044 2871 gene locus_tag LOCUS_06430 3044 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 <3844 3076 gene locus_tag LOCUS_06440 <3844 3076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012099505.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence117 <1 1309 gene locus_tag LOCUS_06450 <1 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948698.1:aspartate--tRNA(Asn) ligase 1492 2028 gene locus_tag LOCUS_06460 1492 2028 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_06460 2006 2242 gene locus_tag LOCUS_06470 2006 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2249 3373 gene locus_tag LOCUS_06480 2249 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence118 509 715 gene locus_tag LOCUS_06490 509 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1092 1385 gene locus_tag LOCUS_06500 1092 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 1446 1697 gene locus_tag LOCUS_06510 1446 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 1690 3471 gene locus_tag LOCUS_06520 1690 3471 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225426974.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence119 611 360 gene locus_tag LOCUS_06530 611 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 940 563 gene locus_tag LOCUS_06540 940 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 1562 1134 gene locus_tag LOCUS_06550 1562 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2674 1577 gene locus_tag LOCUS_06560 2674 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 3278 2862 gene locus_tag LOCUS_06570 3278 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3691 3269 gene locus_tag LOCUS_06580 3691 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence120 <1 1257 gene locus_tag LOCUS_06590 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870596.1:shikimate dehydrogenase 1459 3606 gene locus_tag LOCUS_06600 1459 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence121 2318 3502 gene locus_tag LOCUS_06610 2318 3502 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861572.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence122 1576 272 gene locus_tag LOCUS_06620 1576 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 2194 1931 gene locus_tag LOCUS_06630 2194 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 2576 2211 gene locus_tag LOCUS_06640 2576 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2836 2588 gene locus_tag LOCUS_06650 2836 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 3189 3010 gene locus_tag LOCUS_06660 3189 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3604 3248 gene locus_tag LOCUS_06670 3604 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence123 915 229 gene locus_tag LOCUS_06680 915 229 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_06680 1983 1021 gene locus_tag LOCUS_06690 gene prmA 1983 1021 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_06690 2837 2022 gene locus_tag LOCUS_06700 2837 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence124 2 2140 gene locus_tag LOCUS_06710 gene secDF 2 2140 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749795.1 protein_id gnl|my_center|LOCUS_06710 2230 3021 gene locus_tag LOCUS_06720 2230 3021 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048205.1 protein_id gnl|my_center|LOCUS_06720 3169 3624 gene locus_tag LOCUS_06730 gene nrdR 3169 3624 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence125 297 893 gene locus_tag LOCUS_06740 297 893 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_06740 908 1207 gene locus_tag LOCUS_06750 gene yhbY 908 1207 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 protein_id gnl|my_center|LOCUS_06750 1204 1797 gene locus_tag LOCUS_06760 1204 1797 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 protein_id gnl|my_center|LOCUS_06760 1840 2202 gene locus_tag LOCUS_06770 1840 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06770 2192 2419 gene locus_tag LOCUS_06780 2192 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06780 >Feature sequence126 118 1614 gene locus_tag LOCUS_06790 118 1614 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_06790 2882 1752 gene locus_tag LOCUS_06800 gene rodA 2882 1752 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546334.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence127 <1 995 gene locus_tag LOCUS_06810 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020582.1:PepSY domain-containing protein 1940 1110 gene locus_tag LOCUS_06820 1940 1110 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_06820 2466 1954 gene locus_tag LOCUS_06830 2466 1954 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049484.1 protein_id gnl|my_center|LOCUS_06830 2587 2856 gene locus_tag LOCUS_06840 2587 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2869 3258 gene locus_tag LOCUS_06850 2869 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 3282 3563 gene locus_tag LOCUS_06860 3282 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence128 <1 524 gene locus_tag LOCUS_06870 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393603.1:response regulator 535 912 gene locus_tag LOCUS_06880 535 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06880 955 1353 gene locus_tag LOCUS_06890 955 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06890 1360 2784 gene locus_tag LOCUS_06900 1360 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3336 2854 gene locus_tag LOCUS_06910 3336 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence129 1784 516 gene locus_tag LOCUS_06920 1784 516 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_06920 2565 1921 gene locus_tag LOCUS_06930 2565 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06930 3083 2562 gene locus_tag LOCUS_06940 3083 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06940 3364 3080 gene locus_tag LOCUS_06950 3364 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence130 402 1472 gene locus_tag LOCUS_06960 402 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1540 1962 gene locus_tag LOCUS_06970 1540 1962 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_06970 2299 3381 gene locus_tag LOCUS_06980 2299 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence131 440 1252 gene locus_tag LOCUS_06990 440 1252 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277403.1 protein_id gnl|my_center|LOCUS_06990 1404 1775 gene locus_tag LOCUS_07000 1404 1775 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583004.1 protein_id gnl|my_center|LOCUS_07000 2312 2500 gene locus_tag LOCUS_07010 2312 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2487 2966 gene locus_tag LOCUS_07020 2487 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence132 594 289 gene locus_tag LOCUS_07030 594 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1250 591 gene locus_tag LOCUS_07040 1250 591 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640258.1 protein_id gnl|my_center|LOCUS_07040 1942 1247 gene locus_tag LOCUS_07050 1942 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 2186 2677 gene locus_tag LOCUS_07060 2186 2677 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence133 3123 1291 gene locus_tag LOCUS_07070 3123 1291 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence134 <1 1072 gene locus_tag LOCUS_07080 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963452.1:DNA polymerase III subunit gamma/tau 1085 1441 gene locus_tag LOCUS_07090 1085 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1441 2007 gene locus_tag LOCUS_07100 1441 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence135 1003 1977 gene locus_tag LOCUS_07110 1003 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07110 1982 3196 gene locus_tag LOCUS_07120 1982 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence136 310 1245 gene locus_tag LOCUS_07130 gene rsmH 310 1245 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731975.1 protein_id gnl|my_center|LOCUS_07130 1273 1758 gene locus_tag LOCUS_07140 1273 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence137 >Feature sequence138 1560 205 gene locus_tag LOCUS_07150 1560 205 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_07150 3219 1723 gene locus_tag LOCUS_07160 3219 1723 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996423.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence139 111 977 gene locus_tag LOCUS_07170 111 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1048 1560 gene locus_tag LOCUS_07180 1048 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 1580 2701 gene locus_tag LOCUS_07190 gene alr 1580 2701 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_07190 2865 3227 gene locus_tag LOCUS_07200 2865 3227 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence140 121 1920 gene locus_tag LOCUS_07210 121 1920 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence141 <1 939 gene locus_tag LOCUS_07220 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582707.1:tripartite tricarboxylate transporter permease 1091 1813 gene locus_tag LOCUS_07230 1091 1813 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_07230 1825 2517 gene locus_tag LOCUS_07240 1825 2517 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_07240 2534 3424 gene locus_tag LOCUS_07250 2534 3424 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083266.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence142 2819 735 gene locus_tag LOCUS_07260 gene fusA 2819 735 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence143 <1 1359 gene locus_tag LOCUS_07270 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861612.1:NFACT RNA binding domain-containing protein 2508 1570 gene locus_tag LOCUS_07280 2508 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence144 1380 2285 gene locus_tag LOCUS_07290 1380 2285 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391904.1 protein_id gnl|my_center|LOCUS_07290 2278 2481 gene locus_tag LOCUS_07300 2278 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 2760 2518 gene locus_tag LOCUS_07310 2760 2518 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence145 2 811 gene locus_tag LOCUS_07320 2 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 830 958 gene locus_tag LOCUS_07330 830 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1083 1159 gene locus_tag LOCUS_t00130 1083 1159 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1611 2276 gene locus_tag LOCUS_07340 1611 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 2273 2737 gene locus_tag LOCUS_07350 2273 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence146 <1 760 gene locus_tag LOCUS_07360 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545682.1:aspartate kinase 854 1042 gene locus_tag LOCUS_07370 854 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1206 2339 gene locus_tag LOCUS_07380 1206 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3021 2371 gene locus_tag LOCUS_07390 3021 2371 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence147 324 575 gene locus_tag LOCUS_07400 324 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 628 1677 gene locus_tag LOCUS_07410 628 1677 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence148 <1 689 gene locus_tag LOCUS_07420 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987067.1:glycerol kinase GlpK 3269 894 gene locus_tag LOCUS_07430 3269 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence149 259 1473 gene locus_tag LOCUS_07440 259 1473 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903248.1 protein_id gnl|my_center|LOCUS_07440 1995 1660 gene locus_tag LOCUS_07450 1995 1660 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_07450 2114 2947 gene locus_tag LOCUS_07460 2114 2947 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861298.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence150 2119 3195 gene locus_tag LOCUS_07470 2119 3195 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence151 355 1734 gene locus_tag LOCUS_07480 355 1734 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_07480 1731 2189 gene locus_tag LOCUS_07490 1731 2189 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_07490 2278 2481 gene locus_tag LOCUS_07500 gene rpmE 2278 2481 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_07500 2553 3212 gene locus_tag LOCUS_07510 2553 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07510 >Feature sequence152 443 709 gene locus_tag LOCUS_07520 443 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1462 809 gene locus_tag LOCUS_07530 gene pth 1462 809 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_07530 <3294 2087 gene locus_tag LOCUS_07540 <3294 2087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004440884.1:DAK2 domain-containing protein >Feature sequence153 822 157 gene locus_tag LOCUS_07550 822 157 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_07550 1993 854 gene locus_tag LOCUS_07560 gene prfB 1993 854 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191976281.1 protein_id gnl|my_center|LOCUS_07560 2278 3228 gene locus_tag LOCUS_07570 2278 3228 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence154 782 528 gene locus_tag LOCUS_07580 782 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07580 1196 798 gene locus_tag LOCUS_07590 1196 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07590 1340 2542 gene locus_tag LOCUS_07600 gene vpsB 1340 2542 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase VpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence155 3 305 gene locus_tag LOCUS_07610 3 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07610 307 447 gene locus_tag LOCUS_07620 307 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 464 904 gene locus_tag LOCUS_07630 464 904 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_07630 927 2615 gene locus_tag LOCUS_07640 gene recN 927 2615 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence156 937 1692 gene locus_tag LOCUS_07650 gene iolR 937 1692 CDS product myo-inositol utilization transcriptional regulator IolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227050.1 protein_id gnl|my_center|LOCUS_07650 2720 1836 gene locus_tag LOCUS_07660 2720 1836 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074572.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence157 1705 1322 gene locus_tag LOCUS_07670 1705 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 1902 1729 gene locus_tag LOCUS_07680 1902 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2581 1907 gene locus_tag LOCUS_07690 gene cmk 2581 1907 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_07690 <3229 2581 gene locus_tag LOCUS_07700 <3229 2581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965154.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence158 779 1399 gene locus_tag LOCUS_07710 779 1399 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385658.1 protein_id gnl|my_center|LOCUS_07710 1392 2609 gene locus_tag LOCUS_07720 1392 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 2606 2926 gene locus_tag LOCUS_07730 2606 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence159 518 237 gene locus_tag LOCUS_07740 518 237 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392562.1 protein_id gnl|my_center|LOCUS_07740 1605 541 gene locus_tag LOCUS_07750 gene nusA 1605 541 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428238.1 protein_id gnl|my_center|LOCUS_07750 2091 1627 gene locus_tag LOCUS_07760 2091 1627 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_07760 2926 2258 gene locus_tag LOCUS_07770 2926 2258 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906063.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence160 <1 965 gene locus_tag LOCUS_07780 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001087145.1:solute:sodium symporter family transporter 1186 2199 gene locus_tag LOCUS_07790 gene iolG 1186 2199 CDS product bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244482.1 protein_id gnl|my_center|LOCUS_07790 2233 3099 gene locus_tag LOCUS_07800 gene iolI 2233 3099 CDS product 2-keto-myo-inositol isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244546.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence161 414 1157 gene locus_tag LOCUS_07810 414 1157 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_07810 3057 1285 gene locus_tag LOCUS_07820 3057 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence162 144 2510 gene locus_tag LOCUS_07830 144 2510 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence163 822 595 gene locus_tag LOCUS_07840 822 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1018 1821 gene locus_tag LOCUS_07850 1018 1821 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_07850 1911 2645 gene locus_tag LOCUS_07860 1911 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence164 425 835 gene locus_tag LOCUS_07870 425 835 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056959.1 protein_id gnl|my_center|LOCUS_07870 898 1383 gene locus_tag LOCUS_07880 898 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 1398 2102 gene locus_tag LOCUS_07890 1398 2102 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_07890 2129 2800 gene locus_tag LOCUS_07900 2129 2800 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459533.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence165 198 2615 gene locus_tag LOCUS_07910 gene pcrA 198 2615 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_07910 2726 2854 gene locus_tag LOCUS_07920 2726 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence166 401 1348 gene locus_tag LOCUS_07930 gene fabK 401 1348 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 protein_id gnl|my_center|LOCUS_07930 1361 2089 gene locus_tag LOCUS_07940 gene fabG 1361 2089 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence167 703 332 gene locus_tag LOCUS_07950 703 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 <3147 725 gene locus_tag LOCUS_07960 <3147 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987024.1:flagellar filament capping protein FliD >Feature sequence168 >Feature sequence169 104 889 gene locus_tag LOCUS_07970 104 889 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_07970 896 2911 gene locus_tag LOCUS_07980 gene pknB 896 2911 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence170 883 1593 gene locus_tag LOCUS_07990 883 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1672 2250 gene locus_tag LOCUS_08000 1672 2250 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 protein_id gnl|my_center|LOCUS_08000 2274 2804 gene locus_tag LOCUS_08010 2274 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 2818 3045 gene locus_tag LOCUS_08020 2818 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence171 <3126 414 gene locus_tag LOCUS_08030 <3126 414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707240.1:retention module-containing protein >Feature sequence172 1020 370 gene locus_tag LOCUS_08040 1020 370 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021652.1 protein_id gnl|my_center|LOCUS_08040 2604 1102 gene locus_tag LOCUS_08050 2604 1102 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence173 1611 1180 gene locus_tag LOCUS_08060 gene ytfJ 1611 1180 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350003.1 protein_id gnl|my_center|LOCUS_08060 2248 1604 gene locus_tag LOCUS_08070 2248 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2825 2256 gene locus_tag LOCUS_08080 gene scpB 2825 2256 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence174 225 782 gene locus_tag LOCUS_08090 225 782 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_08090 1010 2116 gene locus_tag LOCUS_08100 1010 2116 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963477.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence175 1046 216 gene locus_tag LOCUS_08110 1046 216 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_08110 1978 1157 gene locus_tag LOCUS_08120 1978 1157 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964017.1 protein_id gnl|my_center|LOCUS_08120 2128 2337 gene locus_tag LOCUS_08130 2128 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence176 764 1291 gene locus_tag LOCUS_08140 764 1291 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337019.1 protein_id gnl|my_center|LOCUS_08140 1334 2695 gene locus_tag LOCUS_08150 1334 2695 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence177 29 2383 gene locus_tag LOCUS_08160 29 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2410 2631 gene locus_tag LOCUS_08170 2410 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence178 1347 643 gene locus_tag LOCUS_08180 gene rsmG 1347 643 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_08180 3056 1458 gene locus_tag LOCUS_08190 gene mnmG 3056 1458 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence179 335 628 gene locus_tag LOCUS_08200 gene rplW 335 628 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_08200 904 1737 gene locus_tag LOCUS_08210 gene rplB 904 1737 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_08210 1756 2037 gene locus_tag LOCUS_08220 gene rpsS 1756 2037 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_08220 2055 2390 gene locus_tag LOCUS_08230 gene rplV 2055 2390 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence180 <1 1767 gene locus_tag LOCUS_08240 <1 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000441046.1:excinuclease ABC subunit B 1764 2585 gene locus_tag LOCUS_08250 1764 2585 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986756.1 protein_id gnl|my_center|LOCUS_08250 2633 2941 gene locus_tag LOCUS_08260 2633 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08260 >Feature sequence181 277 1959 gene locus_tag LOCUS_08270 277 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence182 164 1171 gene locus_tag LOCUS_08280 gene iolG 164 1171 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_08280 1270 2058 gene locus_tag LOCUS_08290 1270 2058 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256274.1 protein_id gnl|my_center|LOCUS_08290 2689 2871 gene locus_tag LOCUS_08300 2689 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence183 <1 508 gene locus_tag LOCUS_08310 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003388628.1:YicC family protein 524 787 gene locus_tag LOCUS_08320 524 787 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_08320 774 1340 gene locus_tag LOCUS_08330 gene gmk 774 1340 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_08330 1402 1788 gene locus_tag LOCUS_08340 1402 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1792 2994 gene locus_tag LOCUS_08350 gene coaBC 1792 2994 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence184 3 743 gene locus_tag LOCUS_08360 3 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1046 2275 gene locus_tag LOCUS_08370 1046 2275 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence185 98 334 gene locus_tag LOCUS_08380 98 334 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379121.1 protein_id gnl|my_center|LOCUS_08380 331 1215 gene locus_tag LOCUS_08390 331 1215 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_08390 1259 1378 gene locus_tag LOCUS_08400 1259 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1413 1976 gene locus_tag LOCUS_08410 1413 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08410 >Feature sequence186 1982 1083 gene locus_tag LOCUS_08420 1982 1083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_08420 2350 1979 gene locus_tag LOCUS_08430 gene ytrA 2350 1979 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence187 528 1025 gene locus_tag LOCUS_08440 528 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2165 1098 gene locus_tag LOCUS_08450 2165 1098 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence188 272 1051 gene locus_tag LOCUS_08460 272 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1142 1969 gene locus_tag LOCUS_08470 1142 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 <2969 2030 gene locus_tag LOCUS_08480 <2969 2030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016932.1:2-hydroxyacyl-CoA dehydratase >Feature sequence189 535 1536 gene locus_tag LOCUS_08490 535 1536 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_08490 1657 2616 gene locus_tag LOCUS_08500 1657 2616 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence190 1751 2608 gene locus_tag LOCUS_08510 gene rfbA 1751 2608 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence191 <1 933 gene locus_tag LOCUS_08520 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801609.1:DUF2156 domain-containing protein 930 1727 gene locus_tag LOCUS_08530 930 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1742 2293 gene locus_tag LOCUS_08540 1742 2293 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_08540 2280 2849 gene locus_tag LOCUS_08550 2280 2849 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence192 991 665 gene locus_tag LOCUS_08560 991 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1481 1089 gene locus_tag LOCUS_08570 1481 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_08570 2107 1481 gene locus_tag LOCUS_08580 gene ysxC 2107 1481 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869113.1 protein_id gnl|my_center|LOCUS_08580 <2905 2104 gene locus_tag LOCUS_08590 <2905 2104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000097310.1:endopeptidase La >Feature sequence193 865 440 gene locus_tag LOCUS_08600 gene rplK 865 440 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_08600 1674 1138 gene locus_tag LOCUS_08610 gene nusG 1674 1138 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_08610 1919 1689 gene locus_tag LOCUS_08620 1919 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2087 1938 gene locus_tag LOCUS_08630 gene rpmG 2087 1938 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_08630 2351 2767 gene locus_tag LOCUS_08640 gene ruvX 2351 2767 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence194 314 1609 gene locus_tag LOCUS_08650 gene hemL 314 1609 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933753.1 protein_id gnl|my_center|LOCUS_08650 1646 2728 gene locus_tag LOCUS_08660 1646 2728 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214081.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08660 2643 2837 gene locus_tag LOCUS_08670 2643 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence195 <1 647 gene locus_tag LOCUS_08680 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392430.1:ribosome small subunit-dependent GTPase A 617 1279 gene locus_tag LOCUS_08690 617 1279 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_08690 1415 2614 gene locus_tag LOCUS_08700 1415 2614 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence196 85 1065 gene locus_tag LOCUS_08710 85 1065 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence197 <1 1148 gene locus_tag LOCUS_08720 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357478.1:FtsW/RodA/SpoVE family cell cycle protein 1149 2522 gene locus_tag LOCUS_08730 1149 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence198 598 1806 gene locus_tag LOCUS_08740 gene nifS 598 1806 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_08740 1862 2311 gene locus_tag LOCUS_08750 gene nifU 1862 2311 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence199 <1 575 gene locus_tag LOCUS_08760 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793488.1:DNA recombination protein RmuC 966 1448 gene locus_tag LOCUS_08770 gene ybaK 966 1448 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_08770 2205 1432 gene locus_tag LOCUS_08780 2205 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence200 675 112 gene locus_tag LOCUS_08790 675 112 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_08790 <2819 892 gene locus_tag LOCUS_08800 <2819 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000423561.1:polyphosphate kinase >Feature sequence201 621 2519 gene locus_tag LOCUS_08810 621 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence202 1096 845 gene locus_tag LOCUS_08820 1096 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1329 1114 gene locus_tag LOCUS_08830 1329 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08830 2131 1247 gene locus_tag LOCUS_08840 2131 1247 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08840 2389 2739 gene locus_tag LOCUS_08850 2389 2739 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence203 <1 788 gene locus_tag LOCUS_08860 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003562821.1:replication-associated recombination protein A 793 1215 gene locus_tag LOCUS_08870 793 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 <2777 1573 gene locus_tag LOCUS_08880 <2777 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812354.1:glutamine synthetase III >Feature sequence204 376 1071 gene locus_tag LOCUS_08890 gene yycF 376 1071 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722907.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence205 2167 1049 gene locus_tag LOCUS_08900 2167 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2283 2164 gene locus_tag LOCUS_08910 2283 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence206 841 491 gene locus_tag LOCUS_08920 841 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1065 1733 gene locus_tag LOCUS_08930 gene lexA 1065 1733 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_08930 <2745 2089 gene locus_tag LOCUS_08940 <2745 2089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425090.1:methyl-accepting chemotaxis protein >Feature sequence207 825 403 gene locus_tag LOCUS_08950 825 403 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861039.1 protein_id gnl|my_center|LOCUS_08950 1088 825 gene locus_tag LOCUS_08960 1088 825 CDS product DUF2577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901352.1 protein_id gnl|my_center|LOCUS_08960 <2739 1081 gene locus_tag LOCUS_08970 <2739 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861038.1:NlpC/P60 family protein >Feature sequence208 1170 445 gene locus_tag LOCUS_08980 1170 445 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048308.1 protein_id gnl|my_center|LOCUS_08980 2233 1301 gene locus_tag LOCUS_08990 gene hprK 2233 1301 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_08990 2436 2624 gene locus_tag LOCUS_09000 gene rpmB 2436 2624 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence209 1336 1908 gene locus_tag LOCUS_09010 1336 1908 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965733.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence210 387 1259 gene locus_tag LOCUS_09020 gene argB 387 1259 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_09020 1286 2467 gene locus_tag LOCUS_09030 1286 2467 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence211 2686 1901 gene locus_tag LOCUS_09040 2686 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence212 405 1667 gene locus_tag LOCUS_09050 405 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1657 2271 gene locus_tag LOCUS_09060 1657 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence213 2173 497 gene locus_tag LOCUS_09070 2173 497 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_09070 2448 2188 gene locus_tag LOCUS_09080 2448 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence214 126 338 gene locus_tag LOCUS_09090 126 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 263 865 gene locus_tag LOCUS_09100 263 865 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357431.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09100 >Feature sequence215 134 595 gene locus_tag LOCUS_09110 134 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 <2687 1481 gene locus_tag LOCUS_09120 <2687 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861915.1:conjugal transfer protein >Feature sequence216 105 392 gene locus_tag LOCUS_09130 105 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 382 951 gene locus_tag LOCUS_09140 382 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 955 1362 gene locus_tag LOCUS_09150 955 1362 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 protein_id gnl|my_center|LOCUS_09150 1462 2004 gene locus_tag LOCUS_09160 1462 2004 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence217 1479 334 gene locus_tag LOCUS_09170 1479 334 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095789.1 protein_id gnl|my_center|LOCUS_09170 <2670 1582 gene locus_tag LOCUS_09180 <2670 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288004.1:response regulator >Feature sequence218 348 965 gene locus_tag LOCUS_09190 348 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence219 170 568 gene locus_tag LOCUS_09200 170 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 573 1355 gene locus_tag LOCUS_09210 gene ymdB 573 1355 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence220 824 687 gene locus_tag LOCUS_09220 824 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1040 1690 gene locus_tag LOCUS_09230 1040 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 <2636 1757 gene locus_tag LOCUS_09240 <2636 1757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000076750.1:polyribonucleotide nucleotidyltransferase >Feature sequence221 145 1515 gene locus_tag LOCUS_09250 145 1515 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964280.1 protein_id gnl|my_center|LOCUS_09250 1531 2268 gene locus_tag LOCUS_09260 1531 2268 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948177.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence222 862 455 gene locus_tag LOCUS_09270 gene gtcA 862 455 CDS product cell wall teichoic acid glycosylation protein GtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724105.1 protein_id gnl|my_center|LOCUS_09270 1787 852 gene locus_tag LOCUS_09280 1787 852 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_09280 <2608 2072 gene locus_tag LOCUS_09290 <2608 2072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795587.1:alcohol dehydrogenase >Feature sequence223 469 849 gene locus_tag LOCUS_09300 gene flgB 469 849 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361361.1 protein_id gnl|my_center|LOCUS_09300 866 1333 gene locus_tag LOCUS_09310 gene flgC 866 1333 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965463.1 protein_id gnl|my_center|LOCUS_09310 1352 1663 gene locus_tag LOCUS_09320 1352 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence224 1682 267 gene locus_tag LOCUS_09330 gene cysS 1682 267 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_09330 2577 1975 gene locus_tag LOCUS_09340 2577 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence225 >Feature sequence226 <1 530 gene locus_tag LOCUS_09350 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986381.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB 544 1137 gene locus_tag LOCUS_09360 544 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1168 1470 gene locus_tag LOCUS_09370 1168 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09370 >Feature sequence227 1054 677 gene locus_tag LOCUS_09380 1054 677 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948112.1 protein_id gnl|my_center|LOCUS_09380 1605 1051 gene locus_tag LOCUS_09390 1605 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1852 2454 gene locus_tag LOCUS_09400 1852 2454 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence228 >Feature sequence229 1286 1071 gene locus_tag LOCUS_09410 1286 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2344 1355 gene locus_tag LOCUS_09420 2344 1355 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence230 198 737 gene locus_tag LOCUS_09430 198 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 734 1984 gene locus_tag LOCUS_09440 gene purD 734 1984 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence231 <1 2235 gene locus_tag LOCUS_09450 <1 2235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965118.1:DNA translocase FtsK >Feature sequence232 1259 264 gene locus_tag LOCUS_09460 1259 264 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_09460 2012 1470 gene locus_tag LOCUS_09470 2012 1470 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence233 392 1882 gene locus_tag LOCUS_09480 gene malQ 392 1882 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence234 270 683 gene locus_tag LOCUS_09490 270 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1670 726 gene locus_tag LOCUS_09500 1670 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2007 1708 gene locus_tag LOCUS_09510 2007 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence235 44 1018 gene locus_tag LOCUS_09520 44 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09520 928 1422 gene locus_tag LOCUS_09530 928 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence236 1789 1235 gene locus_tag LOCUS_09540 1789 1235 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 protein_id gnl|my_center|LOCUS_09540 1973 2320 gene locus_tag LOCUS_09550 1973 2320 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence237 609 845 gene locus_tag LOCUS_09560 609 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 823 1140 gene locus_tag LOCUS_09570 823 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence238 3 1064 gene locus_tag LOCUS_09580 3 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1476 1853 gene locus_tag LOCUS_09590 1476 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence239 <1 624 gene locus_tag LOCUS_09600 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902660.1:sodium ion-translocating decarboxylase subunit beta 780 1370 gene locus_tag LOCUS_09610 780 1370 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902402.1 protein_id gnl|my_center|LOCUS_09610 1553 1834 gene locus_tag LOCUS_09620 gene spoIIID 1553 1834 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_09620 2127 1885 gene locus_tag LOCUS_09630 2127 1885 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence240 103 633 gene locus_tag LOCUS_09640 gene cobU 103 633 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869446.1 protein_id gnl|my_center|LOCUS_09640 630 1418 gene locus_tag LOCUS_09650 gene cobS 630 1418 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680312.1 protein_id gnl|my_center|LOCUS_09650 1415 1750 gene locus_tag LOCUS_09660 1415 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence241 1763 591 gene locus_tag LOCUS_09670 1763 591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence242 1293 217 gene locus_tag LOCUS_09680 1293 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09680 1718 1254 gene locus_tag LOCUS_09690 1718 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09690 2351 1809 gene locus_tag LOCUS_09700 2351 1809 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947988.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence243 <1 1007 gene locus_tag LOCUS_09710 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000057611.1:glucose-1-phosphate adenylyltransferase 1018 2148 gene locus_tag LOCUS_09720 gene glgD 1018 2148 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence244 <1 728 gene locus_tag LOCUS_09730 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047964.1:tRNA 2-thiouridine(34) synthase MnmA 742 1647 gene locus_tag LOCUS_09740 742 1647 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_09740 1937 1853 gene locus_tag LOCUS_t00140 1937 1853 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence245 134 637 gene locus_tag LOCUS_09750 gene greA 134 637 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564597.1 protein_id gnl|my_center|LOCUS_09750 1810 782 gene locus_tag LOCUS_09760 gene gap 1810 782 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence246 302 1669 gene locus_tag LOCUS_09770 302 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09770 >Feature sequence247 1049 1714 gene locus_tag LOCUS_09780 1049 1714 CDS product DUF6320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804300.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence248 >Feature sequence249 >Feature sequence250 >Feature sequence251 540 962 gene locus_tag LOCUS_09790 540 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 959 2008 gene locus_tag LOCUS_09800 gene mutY 959 2008 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971157.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence252 1822 944 gene locus_tag LOCUS_09810 1822 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2142 1819 gene locus_tag LOCUS_09820 2142 1819 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence253 1422 646 gene locus_tag LOCUS_09830 1422 646 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_09830 2075 1419 gene locus_tag LOCUS_09840 2075 1419 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence254 <1 1660 gene locus_tag LOCUS_09850 <1 1660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861866.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence255 839 1864 gene locus_tag LOCUS_09860 gene iolG 839 1864 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence256 <2320 758 gene locus_tag LOCUS_09870 <2320 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000435993.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence257 392 465 gene locus_tag LOCUS_t00150 392 465 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1732 593 gene locus_tag LOCUS_09880 1732 593 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358446.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence258 1410 313 gene locus_tag LOCUS_09890 1410 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1813 1424 gene locus_tag LOCUS_09900 gene spoIIIAD 1813 1424 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393042.1 protein_id gnl|my_center|LOCUS_09900 2004 1810 gene locus_tag LOCUS_09910 2004 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence259 1684 683 gene locus_tag LOCUS_09920 1684 683 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_09920 <2300 1668 gene locus_tag LOCUS_09930 <2300 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811665.1:M42 family metallopeptidase >Feature sequence260 1555 1406 gene locus_tag LOCUS_09940 1555 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 2154 1642 gene locus_tag LOCUS_09950 2154 1642 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939955.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence261 1613 693 gene locus_tag LOCUS_09960 1613 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1999 1655 gene locus_tag LOCUS_09970 1999 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 >Feature sequence262 1581 340 gene locus_tag LOCUS_09980 gene glyA 1581 340 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence263 161 1135 gene locus_tag LOCUS_09990 gene dusB 161 1135 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_09990 1172 1777 gene locus_tag LOCUS_10000 gene sigM 1172 1777 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence264 195 2123 gene locus_tag LOCUS_10010 gene abc-f 195 2123 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195117.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence265 1869 499 gene locus_tag LOCUS_10020 gene murC 1869 499 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence266 538 1260 gene locus_tag LOCUS_10030 538 1260 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence267 173 703 gene locus_tag LOCUS_10040 173 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10040 770 1042 gene locus_tag LOCUS_10050 770 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10050 1042 1845 gene locus_tag LOCUS_10060 1042 1845 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_10060 1873 2220 gene locus_tag LOCUS_10070 1873 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence268 >Feature sequence269 154 441 gene locus_tag LOCUS_10080 154 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1015 1428 gene locus_tag LOCUS_10090 1015 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1593 2093 gene locus_tag LOCUS_10100 1593 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence270 480 1205 gene locus_tag LOCUS_10110 480 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence271 264 560 gene locus_tag LOCUS_10120 264 560 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_10120 553 1293 gene locus_tag LOCUS_10130 553 1293 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_10130 1297 2178 gene locus_tag LOCUS_10140 gene hslO 1297 2178 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence272 1609 428 gene locus_tag LOCUS_10150 1609 428 CDS product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964882.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence273 627 508 gene locus_tag LOCUS_10160 627 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1060 842 gene locus_tag LOCUS_10170 gene infA 1060 842 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_10170 1361 1083 gene locus_tag LOCUS_10180 1361 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2089 1361 gene locus_tag LOCUS_10190 gene map 2089 1361 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence274 758 1282 gene locus_tag LOCUS_10200 758 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence275 624 549 gene locus_tag LOCUS_t00160 624 549 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 775 2187 gene locus_tag LOCUS_10210 775 2187 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence276 <2221 252 gene locus_tag LOCUS_10220 <2221 252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113304420.1:S-layer homology domain-containing protein >Feature sequence277 1492 200 gene locus_tag LOCUS_10230 1492 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2188 2102 gene locus_tag LOCUS_t00170 2188 2102 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence278 <1 1148 gene locus_tag LOCUS_10240 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245717.1:pitrilysin family protein >Feature sequence279 >Feature sequence280 >Feature sequence281 92 1465 gene locus_tag LOCUS_10250 92 1465 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence282 514 224 gene locus_tag LOCUS_10260 514 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 984 511 gene locus_tag LOCUS_10270 984 511 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_10270 1517 987 gene locus_tag LOCUS_10280 1517 987 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861247.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence283 1449 682 gene locus_tag LOCUS_10290 1449 682 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence284 1419 2096 gene locus_tag LOCUS_10300 1419 2096 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence285 >Feature sequence286 538 849 gene locus_tag LOCUS_10310 gene rpsJ 538 849 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_10310 1227 1925 gene locus_tag LOCUS_10320 gene rplC 1227 1925 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence287 <1 869 gene locus_tag LOCUS_10330 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966117.1:pyridoxal phosphate-dependent aminotransferase 1743 1570 gene locus_tag LOCUS_10340 1743 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence288 1 216 gene locus_tag LOCUS_10350 1 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 232 1020 gene locus_tag LOCUS_10360 232 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1036 1314 gene locus_tag LOCUS_10370 gene hbs 1036 1314 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_10370 1315 1554 gene locus_tag LOCUS_10380 1315 1554 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 protein_id gnl|my_center|LOCUS_10380 1694 1978 gene locus_tag LOCUS_10390 1694 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence289 961 71 gene locus_tag LOCUS_10400 961 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1359 958 gene locus_tag LOCUS_10410 1359 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence290 861 1541 gene locus_tag LOCUS_10420 861 1541 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence291 <2118 1029 gene locus_tag LOCUS_10430 <2118 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038038884.1:prephenate dehydratase >Feature sequence292 746 195 gene locus_tag LOCUS_10440 gene greA 746 195 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_10440 1961 801 gene locus_tag LOCUS_10450 1961 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence293 938 558 gene locus_tag LOCUS_10460 938 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1012 1215 gene locus_tag LOCUS_10470 1012 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1258 1710 gene locus_tag LOCUS_10480 1258 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1754 1990 gene locus_tag LOCUS_10490 1754 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence294 486 1052 gene locus_tag LOCUS_10500 486 1052 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_10500 1771 1133 gene locus_tag LOCUS_10510 1771 1133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10510 1912 1775 gene locus_tag LOCUS_10520 1912 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10520 >Feature sequence295 >Feature sequence296 1218 184 gene locus_tag LOCUS_10530 1218 184 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_10530 1383 2051 gene locus_tag LOCUS_10540 1383 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence297 656 204 gene locus_tag LOCUS_10550 656 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1570 692 gene locus_tag LOCUS_10560 1570 692 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence298 2020 629 gene locus_tag LOCUS_10570 2020 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence299 178 552 gene locus_tag LOCUS_10580 178 552 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_10580 637 1326 gene locus_tag LOCUS_10590 637 1326 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674542.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence300 914 201 gene locus_tag LOCUS_10600 gene hisA 914 201 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_10600 1528 911 gene locus_tag LOCUS_10610 gene hisH 1528 911 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964257.1 protein_id gnl|my_center|LOCUS_10610 1934 1557 gene locus_tag LOCUS_10620 gene crcB 1934 1557 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975197.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence301 234 632 gene locus_tag LOCUS_10630 234 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 685 915 gene locus_tag LOCUS_10640 685 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence302 1541 522 gene locus_tag LOCUS_10650 gene mglB 1541 522 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881084.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence303 686 411 gene locus_tag LOCUS_10660 686 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1074 1583 gene locus_tag LOCUS_10670 gene infC 1074 1583 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808206.1 protein_id gnl|my_center|LOCUS_10670 1629 1832 gene locus_tag LOCUS_10680 gene rpmI 1629 1832 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence304 1349 402 gene locus_tag LOCUS_10690 1349 402 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_10690 2028 1435 gene locus_tag LOCUS_10700 gene rpsD 2028 1435 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence305 335 850 gene locus_tag LOCUS_10710 335 850 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_10710 1889 1020 gene locus_tag LOCUS_10720 1889 1020 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence306 1805 1173 gene locus_tag LOCUS_10730 1805 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence307 3 689 gene locus_tag LOCUS_10740 3 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1354 764 gene locus_tag LOCUS_10750 1354 764 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_10750 <2060 1351 gene locus_tag LOCUS_10760 <2060 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392578.1:dipicolinate synthase subunit DpsA >Feature sequence308 435 1400 gene locus_tag LOCUS_10770 435 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence309 <1 844 gene locus_tag LOCUS_10780 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393644.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD >Feature sequence310 263 490 gene locus_tag LOCUS_10790 263 490 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723866.1 protein_id gnl|my_center|LOCUS_10790 1619 555 gene locus_tag LOCUS_10800 1619 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816022.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence311 <1 1106 gene locus_tag LOCUS_10810 <1 1106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943758.1:isoleucine--tRNA ligase 1163 1672 gene locus_tag LOCUS_10820 gene lspA 1163 1672 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence312 <1 769 gene locus_tag LOCUS_10830 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726680.1:tripartite tricarboxylate transporter substrate binding protein 766 924 gene locus_tag LOCUS_10840 766 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 988 1452 gene locus_tag LOCUS_10850 988 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence313 3 728 gene locus_tag LOCUS_10860 3 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 725 1453 gene locus_tag LOCUS_10870 gene cobJ 725 1453 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896461.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence314 <1 692 gene locus_tag LOCUS_10880 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001282864.1:DNA gyrase subunit A 949 1332 gene locus_tag LOCUS_10890 949 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1329 1538 gene locus_tag LOCUS_10900 1329 1538 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861845.1 protein_id gnl|my_center|LOCUS_10900 1897 1625 gene locus_tag LOCUS_10910 gene rpsR 1897 1625 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence315 448 960 gene locus_tag LOCUS_10920 448 960 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864729.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence316 <1 1704 gene locus_tag LOCUS_10930 <1 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000796568.1:heavy metal translocating P-type ATPase >Feature sequence317 1129 38 gene locus_tag LOCUS_10940 gene aroC 1129 38 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_10940 <2008 1142 gene locus_tag LOCUS_10950 <2008 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009893310.1:3-dehydroquinate synthase >Feature sequence318 >Feature sequence319 180 1553 gene locus_tag LOCUS_10960 gene trkA 180 1553 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence320 >Feature sequence321 1122 58 gene locus_tag LOCUS_10970 1122 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1597 1106 gene locus_tag LOCUS_10980 1597 1106 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence322 1023 577 gene locus_tag LOCUS_10990 gene rplI 1023 577 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_10990 <1983 1074 gene locus_tag LOCUS_11000 <1983 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966978.1:DHH family phosphoesterase >Feature sequence323 1051 32 gene locus_tag LOCUS_11010 gene pheS 1051 32 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence324 265 62 gene locus_tag LOCUS_11020 265 62 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879289.1 protein_id gnl|my_center|LOCUS_11020 684 268 gene locus_tag LOCUS_11030 684 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence325 <1 1101 gene locus_tag LOCUS_11040 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003356585.1:MraY family glycosyltransferase >Feature sequence326 <1 1184 gene locus_tag LOCUS_11050 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964611.1:DNA primase >Feature sequence327 <1 583 gene locus_tag LOCUS_11060 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462325.1:DUF554 domain-containing protein 673 1155 gene locus_tag LOCUS_11070 673 1155 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_11070 1226 1606 gene locus_tag LOCUS_11080 1226 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence328 <1 689 gene locus_tag LOCUS_11090 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014635474.1:oxaloacetate decarboxylase subunit alpha 692 1024 gene locus_tag LOCUS_11100 692 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1039 1410 gene locus_tag LOCUS_11110 1039 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence329 1784 1107 gene locus_tag LOCUS_11120 1784 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence330 <1 895 gene locus_tag LOCUS_11130 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963838.1:DNA polymerase III subunit alpha 938 1912 gene locus_tag LOCUS_11140 gene pfkA 938 1912 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence331 704 381 gene locus_tag LOCUS_11150 704 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1230 775 gene locus_tag LOCUS_11160 1230 775 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927248.1 protein_id gnl|my_center|LOCUS_11160 <1944 1321 gene locus_tag LOCUS_11170 <1944 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243401.1:glucose-6-phosphate isomerase >Feature sequence332 1065 691 gene locus_tag LOCUS_11180 1065 691 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227791.1 protein_id gnl|my_center|LOCUS_11180 1213 1767 gene locus_tag LOCUS_11190 1213 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289506.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence333 <1939 109 gene locus_tag LOCUS_11200 <1939 109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357703.1:phenylalanine--tRNA ligase subunit beta >Feature sequence334 76 152 gene locus_tag LOCUS_t00180 76 152 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 174 250 gene locus_tag LOCUS_t00190 174 250 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 290 365 gene locus_tag LOCUS_t00200 290 365 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1435 524 gene locus_tag LOCUS_11210 1435 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence335 <1 708 gene locus_tag LOCUS_11220 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012099524.1:4Fe-4S dicluster domain-containing protein >Feature sequence336 512 1384 gene locus_tag LOCUS_11230 gene accD 512 1384 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905556.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence337 179 949 gene locus_tag LOCUS_11240 179 949 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101106.1 protein_id gnl|my_center|LOCUS_11240 970 1800 gene locus_tag LOCUS_11250 970 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence338 600 166 gene locus_tag LOCUS_11260 600 166 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583173.1 protein_id gnl|my_center|LOCUS_11260 <1913 665 gene locus_tag LOCUS_11270 <1913 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000412819.1:DNA polymerase I >Feature sequence339 <1 510 gene locus_tag LOCUS_11280 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460301.1:AzlC family ABC transporter permease 507 836 gene locus_tag LOCUS_11290 gene azlD 507 836 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence340 >Feature sequence341 <1905 775 gene locus_tag LOCUS_11300 <1905 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707761.1:galactose/methyl galactoside ABC transporter ATP-binding protein MglA >Feature sequence342 399 1685 gene locus_tag LOCUS_11310 399 1685 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence343 241 98 gene locus_tag LOCUS_11320 241 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1411 314 gene locus_tag LOCUS_11330 1411 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence344 <1 549 gene locus_tag LOCUS_11340 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048369.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 940 1290 gene locus_tag LOCUS_11350 940 1290 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence345 176 400 gene locus_tag LOCUS_11360 176 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence346 1652 366 gene locus_tag LOCUS_11370 1652 366 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence347 382 609 gene locus_tag LOCUS_11380 382 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 606 1310 gene locus_tag LOCUS_11390 606 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1301 1735 gene locus_tag LOCUS_11400 1301 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence348 <1 631 gene locus_tag LOCUS_11410 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582733.1:iron-containing alcohol dehydrogenase <1880 925 gene locus_tag LOCUS_11420 <1880 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004536378.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence349 1601 552 gene locus_tag LOCUS_11430 gene aguA 1601 552 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989327.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence350 <1 636 gene locus_tag LOCUS_11440 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989914.1:acyl CoA:acetate/3-ketoacid CoA transferase >Feature sequence351 1562 270 gene locus_tag LOCUS_11450 1562 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1717 1562 gene locus_tag LOCUS_11460 1717 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence352 357 1655 gene locus_tag LOCUS_11470 357 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence353 1744 182 gene locus_tag LOCUS_11480 1744 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence354 1309 5 gene locus_tag LOCUS_11490 1309 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence355 312 1265 gene locus_tag LOCUS_11500 312 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence356 736 194 gene locus_tag LOCUS_11510 736 194 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_11510 1174 764 gene locus_tag LOCUS_11520 1174 764 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence357 1167 1691 gene locus_tag LOCUS_11530 1167 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence358 2 805 gene locus_tag LOCUS_11540 2 805 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_11540 819 1718 gene locus_tag LOCUS_11550 gene ispE 819 1718 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence359 116 1564 gene locus_tag LOCUS_11560 116 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence360 <1 574 gene locus_tag LOCUS_11570 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888921.1:GTPase ObgE 670 1554 gene locus_tag LOCUS_11580 670 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1701 1582 gene locus_tag LOCUS_11590 1701 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence361 1056 421 gene locus_tag LOCUS_11600 1056 421 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817429.1 protein_id gnl|my_center|LOCUS_11600 1660 1151 gene locus_tag LOCUS_11610 gene nrdG 1660 1151 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_11610 1830 1660 gene locus_tag LOCUS_11620 1830 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence362 1538 597 gene locus_tag LOCUS_11630 1538 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence363 <1827 828 gene locus_tag LOCUS_11640 <1827 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009926914.1:threonine-phosphate decarboxylase CobD >Feature sequence364 >Feature sequence365 >Feature sequence366 1301 90 gene locus_tag LOCUS_11650 1301 90 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence367 1094 243 gene locus_tag LOCUS_11660 1094 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence368 871 647 gene locus_tag LOCUS_11670 871 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1109 792 gene locus_tag LOCUS_11680 1109 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 <1806 1164 gene locus_tag LOCUS_11690 <1806 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965345.1:3D domain-containing protein >Feature sequence369 <1804 793 gene locus_tag LOCUS_11700 <1804 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141968.1:serpin family protein >Feature sequence370 459 70 gene locus_tag LOCUS_11710 459 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1753 710 gene locus_tag LOCUS_11720 1753 710 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387217.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence371 <1 814 gene locus_tag LOCUS_11730 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460075.1:ATP-binding protein <1791 956 gene locus_tag LOCUS_11740 <1791 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542382.1:trypsin-like peptidase domain-containing protein >Feature sequence372 >Feature sequence373 313 1359 gene locus_tag LOCUS_11750 gene recA 313 1359 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence374 688 999 gene locus_tag LOCUS_11760 gene rplU 688 999 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_11760 1049 1342 gene locus_tag LOCUS_11770 1049 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1329 1607 gene locus_tag LOCUS_11780 gene rpmA 1329 1607 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence375 >Feature sequence376 1187 972 gene locus_tag LOCUS_11790 1187 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence377 <1 559 gene locus_tag LOCUS_11800 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964029.1:phosphoglycerate kinase 804 1574 gene locus_tag LOCUS_11810 gene tpiA 804 1574 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence378 833 1522 gene locus_tag LOCUS_11820 833 1522 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356531.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence379 >Feature sequence380 >Feature sequence381 <1 853 gene locus_tag LOCUS_11830 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003398827.1:protein jag >Feature sequence382 700 1707 gene locus_tag LOCUS_11840 700 1707 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113485.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence383 <1738 259 gene locus_tag LOCUS_11850 <1738 259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243561.1:molecular chaperone HtpG >Feature sequence384 <1 601 gene locus_tag LOCUS_11860 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496404.1:deoxyribonuclease IV 667 1101 gene locus_tag LOCUS_11870 gene aroQ 667 1101 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence385 543 1559 gene locus_tag LOCUS_11880 gene aroF 543 1559 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence386 <1 1223 gene locus_tag LOCUS_11890 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003732282.1:pitrilysin family protein >Feature sequence387 385 792 gene locus_tag LOCUS_11900 385 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence388 >Feature sequence389 >Feature sequence390 125 1021 gene locus_tag LOCUS_11910 125 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1075 1275 gene locus_tag LOCUS_11920 1075 1275 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583030.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence391 368 586 gene locus_tag LOCUS_11930 gene infA 368 586 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_11930 891 1259 gene locus_tag LOCUS_11940 gene rpsM 891 1259 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004571523.1 protein_id gnl|my_center|LOCUS_11940 1271 1669 gene locus_tag LOCUS_11950 gene rpsK 1271 1669 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence392 <1 1049 gene locus_tag LOCUS_11960 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965975.1:DNA helicase RecQ 1164 1505 gene locus_tag LOCUS_11970 1164 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence393 1269 361 gene locus_tag LOCUS_11980 1269 361 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence394 494 1534 gene locus_tag LOCUS_11990 494 1534 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence395 <1 1490 gene locus_tag LOCUS_12000 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461050.1:efflux RND transporter permease subunit >Feature sequence396 1010 330 gene locus_tag LOCUS_12010 1010 330 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence397 1087 311 gene locus_tag LOCUS_12020 gene soj 1087 311 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence398 269 1594 gene locus_tag LOCUS_12030 gene der 269 1594 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence399 >Feature sequence400 338 27 gene locus_tag LOCUS_12040 338 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1075 335 gene locus_tag LOCUS_12050 1075 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1675 1100 gene locus_tag LOCUS_12060 1675 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence401 >Feature sequence402 >Feature sequence403 1657 782 gene locus_tag LOCUS_12070 1657 782 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence404 459 532 gene locus_tag LOCUS_t00210 459 532 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence405 <1 1029 gene locus_tag LOCUS_12080 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768329.1:homoserine dehydrogenase >Feature sequence406 1062 526 gene locus_tag LOCUS_12090 1062 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence407 398 204 gene locus_tag LOCUS_12100 398 204 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_12100 561 1502 gene locus_tag LOCUS_12110 561 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence408 >Feature sequence409 >Feature sequence410 >Feature sequence411 <1 779 gene locus_tag LOCUS_12120 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437109.1:MATE family efflux transporter 797 1000 gene locus_tag LOCUS_12130 797 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12130 997 1209 gene locus_tag LOCUS_12140 997 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12140 >Feature sequence412 1092 337 gene locus_tag LOCUS_12150 gene cobM 1092 337 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_12150 <1628 1089 gene locus_tag LOCUS_12160 <1628 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937949.1:precorrin-2 C(20)-methyltransferase >Feature sequence413 723 142 gene locus_tag LOCUS_12170 723 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 <1627 757 gene locus_tag LOCUS_12180 <1627 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011166371.1:transglutaminase domain-containing protein >Feature sequence414 401 1270 gene locus_tag LOCUS_12190 401 1270 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence415 <1 1179 gene locus_tag LOCUS_12200 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425850.1:F0F1 ATP synthase subunit beta 1181 1582 gene locus_tag LOCUS_12210 1181 1582 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence416 <1 670 gene locus_tag LOCUS_12220 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861882.1:glycine betaine ABC transporter substrate-binding protein 675 1430 gene locus_tag LOCUS_12230 675 1430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889397.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence417 310 651 gene locus_tag LOCUS_12240 gene rplS 310 651 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_12240 783 1358 gene locus_tag LOCUS_12250 gene lepB 783 1358 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861178.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence418 426 962 gene locus_tag LOCUS_12260 426 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence419 >Feature sequence420 1020 1460 gene locus_tag LOCUS_12270 1020 1460 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence421 127 411 gene locus_tag LOCUS_12280 127 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 415 633 gene locus_tag LOCUS_12290 gene infA 415 633 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_12290 814 1179 gene locus_tag LOCUS_12300 gene rpsM 814 1179 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055958.1 protein_id gnl|my_center|LOCUS_12300 1196 1600 gene locus_tag LOCUS_12310 gene rpsK 1196 1600 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence422 <1603 85 gene locus_tag LOCUS_12320 <1603 85 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002396652.1:SulP family inorganic anion transporter >Feature sequence423 20 412 gene locus_tag LOCUS_12330 20 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence424 >Feature sequence425 <1593 617 gene locus_tag LOCUS_12340 <1593 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861036.1:tape measure protein >Feature sequence426 456 1184 gene locus_tag LOCUS_12350 456 1184 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence427 1567 860 gene locus_tag LOCUS_12360 1567 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence428 <1585 204 gene locus_tag LOCUS_12370 <1585 204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965527.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence429 >Feature sequence430 239 745 gene locus_tag LOCUS_12380 239 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12380 995 1432 gene locus_tag LOCUS_12390 gene rnhA 995 1432 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence431 1487 555 gene locus_tag LOCUS_12400 1487 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence432 150 299 gene locus_tag LOCUS_12410 150 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 442 855 gene locus_tag LOCUS_12420 442 855 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence433 <1 931 gene locus_tag LOCUS_12430 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393505.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence434 794 414 gene locus_tag LOCUS_12440 794 414 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_12440 1400 912 gene locus_tag LOCUS_12450 1400 912 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence435 <1556 637 gene locus_tag LOCUS_12460 <1556 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009902958.1:MATE family efflux transporter >Feature sequence436 1522 797 gene locus_tag LOCUS_12470 1522 797 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence437 1057 581 gene locus_tag LOCUS_12480 gene ilvN 1057 581 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence438 >Feature sequence439 <1 1203 gene locus_tag LOCUS_12490 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002610375.1:site-specific integrase >Feature sequence440 680 994 gene locus_tag LOCUS_12500 680 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12500 998 1261 gene locus_tag LOCUS_12510 998 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence441 >Feature sequence442 1237 683 gene locus_tag LOCUS_12520 gene frr 1237 683 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence443 181 1332 gene locus_tag LOCUS_12530 181 1332 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680415.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence444 1281 145 gene locus_tag LOCUS_12540 gene cbiD 1281 145 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence445 1072 1293 gene locus_tag LOCUS_12550 1072 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence446 <1504 902 gene locus_tag LOCUS_12560 <1504 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035887521.1:MBOAT family O-acyltransferase >Feature sequence447 <1 1145 gene locus_tag LOCUS_12570 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897245.1:molybdopterin-dependent oxidoreductase >Feature sequence448 >Feature sequence449 >Feature sequence450 <1 768 gene locus_tag LOCUS_12580 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817222.1:methionine ABC transporter ATP-binding protein 755 1408 gene locus_tag LOCUS_12590 755 1408 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817223.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence451 163 1173 gene locus_tag LOCUS_12600 163 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence452 402 1034 gene locus_tag LOCUS_12610 402 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence453 >Feature sequence454 >Feature sequence455 >Feature sequence456 811 1317 gene locus_tag LOCUS_12620 811 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence457 >Feature sequence458 304 804 gene locus_tag LOCUS_12630 gene tadA 304 804 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674836.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence459 513 208 gene locus_tag LOCUS_12640 gene trxA 513 208 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_12640 1341 532 gene locus_tag LOCUS_12650 1341 532 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence460 987 391 gene locus_tag LOCUS_12660 987 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence461 <1460 582 gene locus_tag LOCUS_12670 <1460 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000471986.1:myo-inosose-2 dehydratase >Feature sequence462 1457 678 gene locus_tag LOCUS_12680 1457 678 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence463 16 924 gene locus_tag LOCUS_12690 16 924 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence464 492 755 gene locus_tag LOCUS_12700 492 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 876 1385 gene locus_tag LOCUS_12710 876 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence465 179 637 gene locus_tag LOCUS_12720 179 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence466 >Feature sequence467 292 1260 gene locus_tag LOCUS_12730 292 1260 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence468 1142 471 gene locus_tag LOCUS_12740 gene tenA 1142 471 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence469 >Feature sequence470 987 1060 gene locus_tag LOCUS_t00220 987 1060 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1241 1316 gene locus_tag LOCUS_t00230 1241 1316 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence471 <1430 3 gene locus_tag LOCUS_12750 <1430 3 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000104804.1:phage tail protein >Feature sequence472 >Feature sequence473 156 605 gene locus_tag LOCUS_12760 gene dtd 156 605 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_12760 622 1254 gene locus_tag LOCUS_12770 622 1254 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence474 >Feature sequence475 233 442 gene locus_tag LOCUS_12780 233 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 460 681 gene locus_tag LOCUS_12790 460 681 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427474.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence476 >Feature sequence477 <1 721 gene locus_tag LOCUS_12800 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481692.1:ABC transporter ATP-binding protein >Feature sequence478 1394 24 gene locus_tag LOCUS_12810 gene mobT 1394 24 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159749263.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence479 3 698 gene locus_tag LOCUS_12820 3 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence480 >Feature sequence481 >Feature sequence482 377 195 gene locus_tag LOCUS_12830 377 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence483 809 195 gene locus_tag LOCUS_12840 gene rsxA 809 195 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_12840 <1383 810 gene locus_tag LOCUS_12850 <1383 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869098.1:electron transport complex subunit E >Feature sequence484 >Feature sequence485 683 360 gene locus_tag LOCUS_12860 683 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1187 801 gene locus_tag LOCUS_12870 gene hisI 1187 801 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397763.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence486 841 326 gene locus_tag LOCUS_12880 841 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence487 170 1186 gene locus_tag LOCUS_12890 170 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence488 1 318 gene locus_tag LOCUS_12900 1 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 474 734 gene locus_tag LOCUS_12910 474 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence489 1048 635 gene locus_tag LOCUS_12920 1048 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence490 <1 510 gene locus_tag LOCUS_12930 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895824.1:GTPase HflX 596 1231 gene locus_tag LOCUS_12940 596 1231 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357796.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence491 >Feature sequence492 <1 825 gene locus_tag LOCUS_12950 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943877.1:HAMP domain-containing sensor histidine kinase >Feature sequence493 309 1 gene locus_tag LOCUS_12960 309 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence494 938 501 gene locus_tag LOCUS_12970 gene spoIIAB 938 501 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_12970 1257 940 gene locus_tag LOCUS_12980 gene spoIIAA 1257 940 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence495 76 342 gene locus_tag LOCUS_12990 76 342 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence496 166 1008 gene locus_tag LOCUS_13000 166 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence497 632 144 gene locus_tag LOCUS_13010 632 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 <1343 770 gene locus_tag LOCUS_13020 <1343 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392833.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence498 205 1032 gene locus_tag LOCUS_13030 gene mreC 205 1032 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence499 699 286 gene locus_tag LOCUS_13040 699 286 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_13040 <1339 805 gene locus_tag LOCUS_13050 <1339 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436685.1:hemolysin III family protein >Feature sequence500 1266 529 gene locus_tag LOCUS_13060 1266 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence501 562 254 gene locus_tag LOCUS_13070 562 254 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475524.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence502 128 1087 gene locus_tag LOCUS_13080 128 1087 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence503 837 262 gene locus_tag LOCUS_13090 gene hisB 837 262 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921561.1 protein_id gnl|my_center|LOCUS_13090 <1324 824 gene locus_tag LOCUS_13100 <1324 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243286.1:histidinol dehydrogenase >Feature sequence504 <1 820 gene locus_tag LOCUS_13110 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398480.1:LacI family DNA-binding transcriptional regulator >Feature sequence505 >Feature sequence506 270 82 gene locus_tag LOCUS_13120 270 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence507 599 1075 gene locus_tag LOCUS_13130 gene agaV 599 1075 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence508 196 789 gene locus_tag LOCUS_13140 196 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence509 <1 571 gene locus_tag LOCUS_13150 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811355.1:RNA polymerase sporulation sigma factor SigE 683 1174 gene locus_tag LOCUS_13160 683 1174 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence510 899 180 gene locus_tag LOCUS_13170 899 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence511 187 654 gene locus_tag LOCUS_13180 187 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence512 >Feature sequence513 1113 928 gene locus_tag LOCUS_13190 1113 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence514 <1280 147 gene locus_tag LOCUS_13200 <1280 147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434259.1:adenylosuccinate synthase >Feature sequence515 566 642 gene locus_tag LOCUS_t00240 566 642 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence516 >Feature sequence517 1270 998 gene locus_tag LOCUS_13210 1270 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence518 236 84 gene locus_tag LOCUS_13220 236 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 541 230 gene locus_tag LOCUS_13230 541 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1011 556 gene locus_tag LOCUS_13240 1011 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence519 >Feature sequence520 >Feature sequence521 247 1143 gene locus_tag LOCUS_13250 247 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13250 >Feature sequence522 1 198 gene locus_tag LOCUS_13260 1 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 324 920 gene locus_tag LOCUS_13270 324 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 917 1063 gene locus_tag LOCUS_13280 917 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence523 >Feature sequence524 >Feature sequence525 127 969 gene locus_tag LOCUS_13290 127 969 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789270.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence526 1023 139 gene locus_tag LOCUS_13300 1023 139 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence527 <1 897 gene locus_tag LOCUS_13310 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546068.1:tRNA lysidine(34) synthetase TilS >Feature sequence528 <1244 318 gene locus_tag LOCUS_13320 <1244 318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966243.1:UDP-glucose 4-epimerase GalE >Feature sequence529 1176 31 gene locus_tag LOCUS_13330 gene dnaJ 1176 31 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence530 >Feature sequence531 <1229 193 gene locus_tag LOCUS_13340 <1229 193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861078.1:helicase-exonuclease AddAB subunit AddB >Feature sequence532 1228 884 gene locus_tag LOCUS_13350 1228 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence533 >Feature sequence534 >Feature sequence535 <1 679 gene locus_tag LOCUS_13360 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391743.1:cysteine desulfurase family protein >Feature sequence536 <1 531 gene locus_tag LOCUS_13370 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680420.1:YedE family putative selenium transporter 528 740 gene locus_tag LOCUS_13380 528 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 737 979 gene locus_tag LOCUS_13390 737 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence537 925 743 gene locus_tag LOCUS_13400 925 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence538 626 39 gene locus_tag LOCUS_13410 626 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence539 1110 712 gene locus_tag LOCUS_13420 1110 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence540 337 705 gene locus_tag LOCUS_13430 gene rsfS 337 705 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence541 578 1015 gene locus_tag LOCUS_13440 578 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence542 >Feature sequence543 >Feature sequence544 >Feature sequence545 260 970 gene locus_tag LOCUS_13450 260 970 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence546 >Feature sequence547 <1186 561 gene locus_tag LOCUS_13460 <1186 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000517539.1:uracil phosphoribosyltransferase >Feature sequence548 32 595 gene locus_tag LOCUS_13470 32 595 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811907.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence549 >Feature sequence550 <1 570 gene locus_tag LOCUS_13480 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965437.1:putative manganese-dependent inorganic diphosphatase >Feature sequence551 1085 582 gene locus_tag LOCUS_13490 1085 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence552 <1170 495 gene locus_tag LOCUS_13500 <1170 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964931.1:lactate utilization protein >Feature sequence553 <1 830 gene locus_tag LOCUS_13510 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583124.1:DUF4914 family protein >Feature sequence554 >Feature sequence555 94 990 gene locus_tag LOCUS_13520 94 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13520 >Feature sequence556 406 993 gene locus_tag LOCUS_13530 406 993 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence557 <1159 318 gene locus_tag LOCUS_13540 <1159 318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391561.1:1-phosphofructokinase >Feature sequence558 >Feature sequence559 <1153 530 gene locus_tag LOCUS_13550 <1153 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393917.1:preprotein translocase subunit SecY >Feature sequence560 949 485 gene locus_tag LOCUS_13560 949 485 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence561 >Feature sequence562 296 880 gene locus_tag LOCUS_13570 296 880 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_13570 906 1094 gene locus_tag LOCUS_13580 906 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence563 268 193 gene locus_tag LOCUS_t00250 268 193 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 564 860 gene locus_tag LOCUS_13590 gene rpsF 564 860 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence564 >Feature sequence565 >Feature sequence566 <1 685 gene locus_tag LOCUS_13600 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000391701.1:glucokinase >Feature sequence567 32 601 gene locus_tag LOCUS_13610 32 601 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence568 961 86 gene locus_tag LOCUS_13620 gene pstA 961 86 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence569 <1 846 gene locus_tag LOCUS_13630 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810412.1:ferrous iron transport protein B >Feature sequence570 <1121 222 gene locus_tag LOCUS_13640 <1121 222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476434.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence571 <1117 482 gene locus_tag LOCUS_13650 <1117 482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000188193.1:macrolide ABC transporter ATP-binding protein/permease MacB >Feature sequence572 <1 1021 gene locus_tag LOCUS_13660 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016931.1:acyl-CoA dehydratase activase >Feature sequence573 2 340 gene locus_tag LOCUS_13670 2 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence574 227 883 gene locus_tag LOCUS_13680 227 883 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence575 >Feature sequence576 >Feature sequence577 <1090 514 gene locus_tag LOCUS_13690 <1090 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966994.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence578 271 696 gene locus_tag LOCUS_13700 gene fabZ 271 696 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966834.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence579 <1086 339 gene locus_tag LOCUS_13710 <1086 339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068784.1:glycosyltransferase family 2 protein >Feature sequence580 <1 657 gene locus_tag LOCUS_13720 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897780.1:SDR family oxidoreductase >Feature sequence581 185 688 gene locus_tag LOCUS_13730 185 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence582 684 85 gene locus_tag LOCUS_13740 684 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence583 >Feature sequence584 <1062 349 gene locus_tag LOCUS_13750 <1062 349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459800.1:M42 family metallopeptidase >Feature sequence585 >Feature sequence586 <1 501 gene locus_tag LOCUS_13760 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674047.1:thiamine phosphate synthase >Feature sequence587 <1 549 gene locus_tag LOCUS_13770 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379414.1:ATP-binding cassette domain-containing protein >Feature sequence588 423 809 gene locus_tag LOCUS_13780 423 809 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence589 >Feature sequence590 39 542 gene locus_tag LOCUS_13790 gene rpsE 39 542 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_13790 560 742 gene locus_tag LOCUS_13800 gene rpmD 560 742 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966394.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence591 <1044 304 gene locus_tag LOCUS_13810 <1044 304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022296.1:DUF1015 domain-containing protein >Feature sequence592 <1039 82 gene locus_tag LOCUS_13820 <1039 82 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_077417416.1:solute:sodium symporter family transporter >Feature sequence593 >Feature sequence594 <1039 191 gene locus_tag LOCUS_13830 <1039 191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814229.1:ABC transporter permease >Feature sequence595 >Feature sequence596 963 178 gene locus_tag LOCUS_13840 963 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence597 <1 727 gene locus_tag LOCUS_13850 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523123.1:N-acetyl-gamma-glutamyl-phosphate reductase >Feature sequence598 1 660 gene locus_tag LOCUS_13860 1 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence599 <1024 330 gene locus_tag LOCUS_13870 <1024 330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921866.1:DNA repair protein RadA >Feature sequence600 <1 823 gene locus_tag LOCUS_13880 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584102.1:dihydroxy-acid dehydratase >Feature sequence601 >Feature sequence602 <1016 467 gene locus_tag LOCUS_13890 <1016 467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003428488.1:electron transport complex subunit RsxC >Feature sequence603 >Feature sequence604 >Feature sequence605 >Feature sequence606 <1 567 gene locus_tag LOCUS_13900 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461245.1:MBOAT family protein >Feature sequence607 >Feature sequence608 <1 812 gene locus_tag LOCUS_13910 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403048.1:ATP-dependent DNA helicase RecG >Feature sequence609 >Feature sequence610 >Feature sequence611 >Feature sequence612 <1 672 gene locus_tag LOCUS_13920 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004112601.1:MetQ/NlpA family ABC transporter substrate-binding protein