>Feature sequence01 1305 574 gene locus_tag LOCUS_00010 gene rgaR 1305 574 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_00010 2515 1397 gene locus_tag LOCUS_00020 2515 1397 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722780.1 protein_id gnl|my_center|LOCUS_00020 3583 2591 gene locus_tag LOCUS_00030 3583 2591 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457984.1 protein_id gnl|my_center|LOCUS_00030 4441 3755 gene locus_tag LOCUS_00040 4441 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4690 4493 gene locus_tag LOCUS_00050 4690 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5126 4680 gene locus_tag LOCUS_00060 gene rpiB 5126 4680 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_00060 5773 5273 gene locus_tag LOCUS_00070 5773 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6048 5833 gene locus_tag LOCUS_00080 gene rpmE 6048 5833 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_00080 6873 6142 gene locus_tag LOCUS_00090 6873 6142 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989829.1 protein_id gnl|my_center|LOCUS_00090 8160 6907 gene locus_tag LOCUS_00100 8160 6907 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732525.1 protein_id gnl|my_center|LOCUS_00100 8474 8322 gene locus_tag LOCUS_00110 8474 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9063 8521 gene locus_tag LOCUS_00120 9063 8521 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142475.1 protein_id gnl|my_center|LOCUS_00120 9621 9103 gene locus_tag LOCUS_00130 gene spoIIR 9621 9103 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_00130 10499 9672 gene locus_tag LOCUS_00140 gene prmC 10499 9672 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761857.1 protein_id gnl|my_center|LOCUS_00140 11560 10499 gene locus_tag LOCUS_00150 gene prfA 11560 10499 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475834.1 protein_id gnl|my_center|LOCUS_00150 12093 11647 gene locus_tag LOCUS_00160 12093 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13949 12204 gene locus_tag LOCUS_00170 gene argS 13949 12204 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_00170 14310 13951 gene locus_tag LOCUS_00180 14310 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 14416 16377 gene locus_tag LOCUS_00190 14416 16377 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227540.1 protein_id gnl|my_center|LOCUS_00190 16435 16950 gene locus_tag LOCUS_00200 16435 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17624 16953 gene locus_tag LOCUS_00210 17624 16953 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_00210 18090 17635 gene locus_tag LOCUS_00220 gene rlmH 18090 17635 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048404.1 protein_id gnl|my_center|LOCUS_00220 18842 18090 gene locus_tag LOCUS_00230 18842 18090 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289497.1 protein_id gnl|my_center|LOCUS_00230 20341 18842 gene locus_tag LOCUS_00240 20341 18842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 21689 20343 gene locus_tag LOCUS_00250 gene dnaB 21689 20343 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_00250 22148 21708 gene locus_tag LOCUS_00260 gene rplI 22148 21708 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864305.1 protein_id gnl|my_center|LOCUS_00260 23137 22148 gene locus_tag LOCUS_00270 23137 22148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 23516 23301 gene locus_tag LOCUS_00280 23516 23301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 24053 23532 gene locus_tag LOCUS_00290 gene ssb 24053 23532 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 protein_id gnl|my_center|LOCUS_00290 24355 24068 gene locus_tag LOCUS_00300 gene rpsF 24355 24068 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233778.1 protein_id gnl|my_center|LOCUS_00300 25603 24503 gene locus_tag LOCUS_00310 gene ychF 25603 24503 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722138.1 protein_id gnl|my_center|LOCUS_00310 27280 25685 gene locus_tag LOCUS_00320 27280 25685 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_00320 27467 27252 gene locus_tag LOCUS_00330 27467 27252 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966985.1 protein_id gnl|my_center|LOCUS_00330 28263 27460 gene locus_tag LOCUS_00340 28263 27460 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382909.1 protein_id gnl|my_center|LOCUS_00340 29165 28284 gene locus_tag LOCUS_00350 29165 28284 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355975.1 protein_id gnl|my_center|LOCUS_00350 29940 29155 gene locus_tag LOCUS_00360 gene soj 29940 29155 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_00360 31516 30041 gene locus_tag LOCUS_00370 31516 30041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 32236 31592 gene locus_tag LOCUS_00380 gene rsmG 32236 31592 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019621.1 protein_id gnl|my_center|LOCUS_00380 34094 32229 gene locus_tag LOCUS_00390 gene mnmG 34094 32229 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355988.1 protein_id gnl|my_center|LOCUS_00390 35464 34100 gene locus_tag LOCUS_00400 gene mnmE 35464 34100 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700790.1 protein_id gnl|my_center|LOCUS_00400 36147 35461 gene locus_tag LOCUS_00410 36147 35461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 36823 36215 gene locus_tag LOCUS_00420 36823 36215 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_00420 37751 36825 gene locus_tag LOCUS_00430 37751 36825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 38123 37791 gene locus_tag LOCUS_00440 gene rnpA 38123 37791 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_00440 38303 38175 gene locus_tag LOCUS_00450 gene rpmH 38303 38175 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081758.1 protein_id gnl|my_center|LOCUS_00450 38673 40034 gene locus_tag LOCUS_00460 gene dnaA 38673 40034 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_00460 40193 41317 gene locus_tag LOCUS_00470 gene dnaN 40193 41317 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831813.1 protein_id gnl|my_center|LOCUS_00470 41469 41924 gene locus_tag LOCUS_00480 41469 41924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 42138 43253 gene locus_tag LOCUS_00490 gene recF 42138 43253 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723768.1 protein_id gnl|my_center|LOCUS_00490 43253 45178 gene locus_tag LOCUS_00500 gene gyrB 43253 45178 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_00500 45189 47642 gene locus_tag LOCUS_00510 gene gyrA 45189 47642 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_00510 48372 48815 gene locus_tag LOCUS_00520 gene tadA 48372 48815 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703380.1 protein_id gnl|my_center|LOCUS_00520 48940 50580 gene locus_tag LOCUS_00530 gene dnaX 48940 50580 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829412.1 protein_id gnl|my_center|LOCUS_00530 50600 50899 gene locus_tag LOCUS_00540 50600 50899 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722063.1 protein_id gnl|my_center|LOCUS_00540 50908 51504 gene locus_tag LOCUS_00550 gene recR 50908 51504 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_00550 51542 51727 gene locus_tag LOCUS_00560 51542 51727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 51741 52625 gene locus_tag LOCUS_00570 51741 52625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 52606 53397 gene locus_tag LOCUS_00580 gene ricT 52606 53397 CDS product competence/sporulation regulator complex protein RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243571.1 protein_id gnl|my_center|LOCUS_00580 53390 54070 gene locus_tag LOCUS_00590 53390 54070 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903463.1 protein_id gnl|my_center|LOCUS_00590 54077 54892 gene locus_tag LOCUS_00600 gene rsmI 54077 54892 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700659.1 protein_id gnl|my_center|LOCUS_00600 54930 55496 gene locus_tag LOCUS_00610 gene pth 54930 55496 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_00610 55503 58772 gene locus_tag LOCUS_00620 gene mfd 55503 58772 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579713.1 protein_id gnl|my_center|LOCUS_00620 58835 59467 gene locus_tag LOCUS_00630 58835 59467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 59601 60146 gene locus_tag LOCUS_00640 gene spoVT 59601 60146 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_00640 60414 61934 gene locus_tag LOCUS_00650 gene metG 60414 61934 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_00650 62046 62231 gene locus_tag LOCUS_00660 62046 62231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 62258 63013 gene locus_tag LOCUS_00670 62258 63013 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_00670 63085 63723 gene locus_tag LOCUS_00680 63085 63723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 63834 64442 gene locus_tag LOCUS_00690 63834 64442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 64544 65176 gene locus_tag LOCUS_00700 64544 65176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 65245 65946 gene locus_tag LOCUS_00710 65245 65946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 65946 66464 gene locus_tag LOCUS_00720 65946 66464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 66464 67153 gene locus_tag LOCUS_00730 66464 67153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 67155 67583 gene locus_tag LOCUS_00740 67155 67583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 67647 68441 gene locus_tag LOCUS_00750 gene rsmA 67647 68441 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_00750 68480 69259 gene locus_tag LOCUS_00760 gene yabG 68480 69259 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458914.1 protein_id gnl|my_center|LOCUS_00760 69256 69474 gene locus_tag LOCUS_00770 69256 69474 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966187.1 protein_id gnl|my_center|LOCUS_00770 69574 69843 gene locus_tag LOCUS_00780 gene spoVG 69574 69843 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_00780 69922 70218 gene locus_tag LOCUS_00790 gene yabP 69922 70218 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059104.1 protein_id gnl|my_center|LOCUS_00790 70568 70864 gene locus_tag LOCUS_00800 70568 70864 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041912.1 protein_id gnl|my_center|LOCUS_00800 70889 72205 gene locus_tag LOCUS_00810 70889 72205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 72227 74191 gene locus_tag LOCUS_00820 gene ftsH 72227 74191 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079659.1 protein_id gnl|my_center|LOCUS_00820 74242 74679 gene locus_tag LOCUS_00830 gene mscL 74242 74679 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 protein_id gnl|my_center|LOCUS_00830 74710 75687 gene locus_tag LOCUS_00840 gene dusB 74710 75687 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912262.1 protein_id gnl|my_center|LOCUS_00840 75684 76334 gene locus_tag LOCUS_00850 75684 76334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 76322 78232 gene locus_tag LOCUS_00860 gene lysS 76322 78232 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905307.1 protein_id gnl|my_center|LOCUS_00860 78282 78878 gene locus_tag LOCUS_00870 78282 78878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 78937 80523 gene locus_tag LOCUS_00880 78937 80523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 80639 81181 gene locus_tag LOCUS_00890 80639 81181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 81291 83585 gene locus_tag LOCUS_00900 gene clpC 81291 83585 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_00900 83663 86149 gene locus_tag LOCUS_00910 gene secA 83663 86149 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579368.1 protein_id gnl|my_center|LOCUS_00910 86094 86240 gene locus_tag LOCUS_00920 86094 86240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 86299 87348 gene locus_tag LOCUS_00930 86299 87348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 87420 88394 gene locus_tag LOCUS_00940 gene bsh 87420 88394 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355428.1 protein_id gnl|my_center|LOCUS_00940 88410 89240 gene locus_tag LOCUS_00950 88410 89240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_00950 89333 90445 gene locus_tag LOCUS_00960 89333 90445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 90513 92369 gene locus_tag LOCUS_00970 90513 92369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 92424 92765 gene locus_tag LOCUS_00980 92424 92765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 92747 93292 gene locus_tag LOCUS_00990 92747 93292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 93494 93859 gene locus_tag LOCUS_01000 93494 93859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 93967 94497 gene locus_tag LOCUS_01010 93967 94497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 94586 95515 gene locus_tag LOCUS_01020 94586 95515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 96128 96811 gene locus_tag LOCUS_01030 96128 96811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 96789 97652 gene locus_tag LOCUS_01040 96789 97652 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 protein_id gnl|my_center|LOCUS_01040 97653 98261 gene locus_tag LOCUS_01050 97653 98261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 98372 99061 gene locus_tag LOCUS_01060 gene ftsE 98372 99061 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263537.1 protein_id gnl|my_center|LOCUS_01060 99058 99957 gene locus_tag LOCUS_01070 gene ftsX 99058 99957 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_01070 99959 101197 gene locus_tag LOCUS_01080 99959 101197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 101258 102250 gene locus_tag LOCUS_01090 101258 102250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 102342 103121 gene locus_tag LOCUS_01100 102342 103121 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104791.1 protein_id gnl|my_center|LOCUS_01100 103213 104745 gene locus_tag LOCUS_01110 103213 104745 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_01110 104746 106158 gene locus_tag LOCUS_01120 104746 106158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 106167 107600 gene locus_tag LOCUS_01130 106167 107600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089877.1 protein_id gnl|my_center|LOCUS_01130 107606 108094 gene locus_tag LOCUS_01140 107606 108094 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_01140 108122 108859 gene locus_tag LOCUS_01150 108122 108859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 108999 110960 gene locus_tag LOCUS_01160 gene uvrB 108999 110960 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829601.1 protein_id gnl|my_center|LOCUS_01160 111013 113106 gene locus_tag LOCUS_01170 gene rnr 111013 113106 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391086.1 protein_id gnl|my_center|LOCUS_01170 113116 114288 gene locus_tag LOCUS_01180 113116 114288 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_01180 114298 114735 gene locus_tag LOCUS_01190 gene smpB 114298 114735 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085183.1 protein_id gnl|my_center|LOCUS_01190 114775 115152 gene locus_tag LOCUS_tm00010 114775 115152 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 115212 115877 gene locus_tag LOCUS_01200 115212 115877 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_01200 115963 116634 gene locus_tag LOCUS_01210 115963 116634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 116631 117692 gene locus_tag LOCUS_01220 116631 117692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 117770 117991 gene locus_tag LOCUS_01230 117770 117991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 117984 118301 gene locus_tag LOCUS_01240 117984 118301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 118303 118740 gene locus_tag LOCUS_01250 118303 118740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 118811 120091 gene locus_tag LOCUS_01260 118811 120091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 120143 122443 gene locus_tag LOCUS_01270 120143 122443 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948591.1 protein_id gnl|my_center|LOCUS_01270 122496 122571 gene locus_tag LOCUS_t00010 122496 122571 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 1157 366 gene locus_tag LOCUS_01280 1157 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 2821 1241 gene locus_tag LOCUS_01290 2821 1241 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_01290 6267 3649 gene locus_tag LOCUS_01300 6267 3649 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_01300 7123 6380 gene locus_tag LOCUS_01310 7123 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 9386 7242 gene locus_tag LOCUS_01320 9386 7242 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370122.1 protein_id gnl|my_center|LOCUS_01320 10069 9473 gene locus_tag LOCUS_01330 10069 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 10973 10158 gene locus_tag LOCUS_01340 10973 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 11824 11168 gene locus_tag LOCUS_01350 11824 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 13306 11891 gene locus_tag LOCUS_01360 gene murE 13306 11891 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766313.1 protein_id gnl|my_center|LOCUS_01360 14794 13355 gene locus_tag LOCUS_01370 14794 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 17914 14828 gene locus_tag LOCUS_01380 gene ileS 17914 14828 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454939.1 protein_id gnl|my_center|LOCUS_01380 19798 18209 gene locus_tag LOCUS_01390 19798 18209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 20660 20013 gene locus_tag LOCUS_01400 20660 20013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 22665 20662 gene locus_tag LOCUS_01410 gene ligA 22665 20662 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031450.1 protein_id gnl|my_center|LOCUS_01410 23573 22677 gene locus_tag LOCUS_01420 23573 22677 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_01420 24265 23555 gene locus_tag LOCUS_01430 24265 23555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 26371 24278 gene locus_tag LOCUS_01440 gene pcrA 26371 24278 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_01440 27279 26455 gene locus_tag LOCUS_01450 27279 26455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 27957 27301 gene locus_tag LOCUS_01460 27957 27301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 29749 27920 gene locus_tag LOCUS_01470 29749 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 29969 31654 gene locus_tag LOCUS_01480 gene rnjA 29969 31654 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245660.1 protein_id gnl|my_center|LOCUS_01480 33219 31666 gene locus_tag LOCUS_01490 gene rny 33219 31666 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354863.1 protein_id gnl|my_center|LOCUS_01490 34356 33325 gene locus_tag LOCUS_01500 gene recA 34356 33325 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 protein_id gnl|my_center|LOCUS_01500 35145 34543 gene locus_tag LOCUS_01510 gene pgsA 35145 34543 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025093.1 protein_id gnl|my_center|LOCUS_01510 35623 35114 gene locus_tag LOCUS_01520 35623 35114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 36323 35988 gene locus_tag LOCUS_01530 gene gpsB 36323 35988 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622430.1 protein_id gnl|my_center|LOCUS_01530 36604 37236 gene locus_tag LOCUS_01540 36604 37236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 37309 37899 gene locus_tag LOCUS_01550 gene recU 37309 37899 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155594.1 protein_id gnl|my_center|LOCUS_01550 37871 40711 gene locus_tag LOCUS_01560 37871 40711 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398589.1 protein_id gnl|my_center|LOCUS_01560 41228 40773 gene locus_tag LOCUS_01570 41228 40773 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287450.1 protein_id gnl|my_center|LOCUS_01570 41809 41237 gene locus_tag LOCUS_01580 gene nrdG 41809 41237 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_01580 43996 41810 gene locus_tag LOCUS_01590 gene nrdD 43996 41810 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802773.1 protein_id gnl|my_center|LOCUS_01590 44306 46246 gene locus_tag LOCUS_01600 44306 46246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 46992 46252 gene locus_tag LOCUS_01610 46992 46252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 48140 47007 gene locus_tag LOCUS_01620 gene htrC 48140 47007 CDS product serine protease HtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969578.1 protein_id gnl|my_center|LOCUS_01620 49086 48130 gene locus_tag LOCUS_01630 49086 48130 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_01630 49188 50168 gene locus_tag LOCUS_01640 49188 50168 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907503.1 protein_id gnl|my_center|LOCUS_01640 50215 51231 gene locus_tag LOCUS_01650 50215 51231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 52058 51240 gene locus_tag LOCUS_01660 gene dinD 52058 51240 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460715.1 protein_id gnl|my_center|LOCUS_01660 52797 52132 gene locus_tag LOCUS_01670 gene cwlD 52797 52132 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_01670 53192 52875 gene locus_tag LOCUS_01680 53192 52875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 53382 53239 gene locus_tag LOCUS_01690 53382 53239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 54062 53505 gene locus_tag LOCUS_01700 54062 53505 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_01700 55918 54128 gene locus_tag LOCUS_01710 55918 54128 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_01710 58042 56051 gene locus_tag LOCUS_01720 58042 56051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 59194 58187 gene locus_tag LOCUS_01730 gene pta 59194 58187 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_01730 59909 59199 gene locus_tag LOCUS_01740 59909 59199 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296505.1 protein_id gnl|my_center|LOCUS_01740 60018 61082 gene locus_tag LOCUS_01750 60018 61082 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_01750 61107 61607 gene locus_tag LOCUS_01760 61107 61607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 62559 61615 gene locus_tag LOCUS_01770 62559 61615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 62900 62568 gene locus_tag LOCUS_01780 62900 62568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 63553 62900 gene locus_tag LOCUS_01790 63553 62900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 64220 63579 gene locus_tag LOCUS_01800 64220 63579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 65919 64207 gene locus_tag LOCUS_01810 gene ezrA 65919 64207 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377294.1 protein_id gnl|my_center|LOCUS_01810 66178 66780 gene locus_tag LOCUS_01820 gene rpsD 66178 66780 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703954.1 protein_id gnl|my_center|LOCUS_01820 67164 66808 gene locus_tag LOCUS_01830 67164 66808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 68426 67164 gene locus_tag LOCUS_01840 68426 67164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 69667 68435 gene locus_tag LOCUS_01850 gene tyrS 69667 68435 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019853.1 protein_id gnl|my_center|LOCUS_01850 71720 69936 gene locus_tag LOCUS_01860 71720 69936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 72396 71980 gene locus_tag LOCUS_01870 72396 71980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 72682 72386 gene locus_tag LOCUS_01880 72682 72386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 73653 72709 gene locus_tag LOCUS_01890 73653 72709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 74347 73667 gene locus_tag LOCUS_01900 74347 73667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 75011 74397 gene locus_tag LOCUS_01910 gene trmB 75011 74397 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_01910 75088 75327 gene locus_tag LOCUS_01920 75088 75327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 75378 76106 gene locus_tag LOCUS_01930 75378 76106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 76182 77489 gene locus_tag LOCUS_01940 76182 77489 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438530.1 protein_id gnl|my_center|LOCUS_01940 77464 78759 gene locus_tag LOCUS_01950 77464 78759 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830979.1 protein_id gnl|my_center|LOCUS_01950 79663 78788 gene locus_tag LOCUS_01960 79663 78788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 79956 79711 gene locus_tag LOCUS_01970 79956 79711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 80964 80020 gene locus_tag LOCUS_01980 80964 80020 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384427.1 protein_id gnl|my_center|LOCUS_01980 81732 81028 gene locus_tag LOCUS_01990 81732 81028 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_01990 83361 81766 gene locus_tag LOCUS_02000 83361 81766 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_02000 83588 85051 gene locus_tag LOCUS_02010 83588 85051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 85051 85608 gene locus_tag LOCUS_02020 85051 85608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 85976 85629 gene locus_tag LOCUS_02030 85976 85629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 86384 86034 gene locus_tag LOCUS_02040 gene rplQ 86384 86034 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701337.1 protein_id gnl|my_center|LOCUS_02040 87347 86397 gene locus_tag LOCUS_02050 gene rpoA 87347 86397 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_02050 87749 87366 gene locus_tag LOCUS_02060 gene rpsK 87749 87366 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 protein_id gnl|my_center|LOCUS_02060 88136 87768 gene locus_tag LOCUS_02070 gene rpsM 88136 87768 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 protein_id gnl|my_center|LOCUS_02070 88498 88283 gene locus_tag LOCUS_02080 gene infA 88498 88283 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 protein_id gnl|my_center|LOCUS_02080 89250 88498 gene locus_tag LOCUS_02090 gene map 89250 88498 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_02090 89909 89253 gene locus_tag LOCUS_02100 89909 89253 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048989.1 protein_id gnl|my_center|LOCUS_02100 91174 89906 gene locus_tag LOCUS_02110 gene secY 91174 89906 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_02110 91619 91176 gene locus_tag LOCUS_02120 gene rplO 91619 91176 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_02120 92128 91619 gene locus_tag LOCUS_02130 gene rpsE 92128 91619 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_02130 92503 92141 gene locus_tag LOCUS_02140 gene rplR 92503 92141 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_02140 93052 92522 gene locus_tag LOCUS_02150 gene rplF 93052 92522 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567536.1 protein_id gnl|my_center|LOCUS_02150 93475 93068 gene locus_tag LOCUS_02160 gene rpsH 93475 93068 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245511.1 protein_id gnl|my_center|LOCUS_02160 93678 93493 gene locus_tag LOCUS_02170 gene rpsN 93678 93493 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156488.1 protein_id gnl|my_center|LOCUS_02170 94231 93692 gene locus_tag LOCUS_02180 gene rplE 94231 93692 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720938.1 protein_id gnl|my_center|LOCUS_02180 94561 94253 gene locus_tag LOCUS_02190 gene rplX 94561 94253 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_02190 94940 94572 gene locus_tag LOCUS_02200 gene rplN 94940 94572 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421155.1 protein_id gnl|my_center|LOCUS_02200 95226 94966 gene locus_tag LOCUS_02210 gene rpsQ 95226 94966 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262331.1 protein_id gnl|my_center|LOCUS_02210 95437 95237 gene locus_tag LOCUS_02220 gene rpmC 95437 95237 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644737.1 protein_id gnl|my_center|LOCUS_02220 95858 95427 gene locus_tag LOCUS_02230 gene rplP 95858 95427 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_02230 96513 95860 gene locus_tag LOCUS_02240 gene rpsC 96513 95860 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_02240 96873 96529 gene locus_tag LOCUS_02250 gene rplV 96873 96529 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906302.1 protein_id gnl|my_center|LOCUS_02250 97164 96895 gene locus_tag LOCUS_02260 gene rpsS 97164 96895 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829710.1 protein_id gnl|my_center|LOCUS_02260 98006 97176 gene locus_tag LOCUS_02270 gene rplB 98006 97176 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986654.1 protein_id gnl|my_center|LOCUS_02270 98304 98023 gene locus_tag LOCUS_02280 gene rplW 98304 98023 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829755.1 protein_id gnl|my_center|LOCUS_02280 98927 98304 gene locus_tag LOCUS_02290 gene rplD 98927 98304 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_02290 99703 98969 gene locus_tag LOCUS_02300 gene rplC 99703 98969 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_02300 100027 99716 gene locus_tag LOCUS_02310 gene rpsJ 100027 99716 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_02310 101441 100242 gene locus_tag LOCUS_02320 101441 100242 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence03 1325 1606 gene locus_tag LOCUS_02330 1325 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 1669 1974 gene locus_tag LOCUS_02340 1669 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 2036 4669 gene locus_tag LOCUS_02350 gene ppdK 2036 4669 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_02350 4845 5084 gene locus_tag LOCUS_02360 4845 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02360 5078 5263 gene locus_tag LOCUS_02370 5078 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 5465 6469 gene locus_tag LOCUS_02380 gene rfbB 5465 6469 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_02380 6558 7640 gene locus_tag LOCUS_02390 6558 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 7712 8854 gene locus_tag LOCUS_02400 7712 8854 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_02400 8936 11938 gene locus_tag LOCUS_02410 8936 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 12009 12749 gene locus_tag LOCUS_02420 12009 12749 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_02420 12758 13531 gene locus_tag LOCUS_02430 12758 13531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_02430 13534 15687 gene locus_tag LOCUS_02440 13534 15687 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 protein_id gnl|my_center|LOCUS_02440 15697 17796 gene locus_tag LOCUS_02450 15697 17796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965620.1 protein_id gnl|my_center|LOCUS_02450 17802 18515 gene locus_tag LOCUS_02460 17802 18515 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027228.1 protein_id gnl|my_center|LOCUS_02460 18517 18858 gene locus_tag LOCUS_02470 18517 18858 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050394.1 protein_id gnl|my_center|LOCUS_02470 18858 19205 gene locus_tag LOCUS_02480 18858 19205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356899.1 protein_id gnl|my_center|LOCUS_02480 19221 21113 gene locus_tag LOCUS_02490 19221 21113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505756.1 protein_id gnl|my_center|LOCUS_02490 21110 22264 gene locus_tag LOCUS_02500 gene glf 21110 22264 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_02500 22269 23309 gene locus_tag LOCUS_02510 22269 23309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 23325 25394 gene locus_tag LOCUS_02520 23325 25394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965620.1 protein_id gnl|my_center|LOCUS_02520 25482 26417 gene locus_tag LOCUS_02530 25482 26417 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_02530 26419 26871 gene locus_tag LOCUS_02540 26419 26871 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114300.1 protein_id gnl|my_center|LOCUS_02540 27674 26919 gene locus_tag LOCUS_02550 27674 26919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 27799 28092 gene locus_tag LOCUS_02560 gene gatC 27799 28092 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219442.1 protein_id gnl|my_center|LOCUS_02560 28085 29506 gene locus_tag LOCUS_02570 gene gatA 28085 29506 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722232.1 protein_id gnl|my_center|LOCUS_02570 29503 30921 gene locus_tag LOCUS_02580 gene gatB 29503 30921 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047685.1 protein_id gnl|my_center|LOCUS_02580 31085 32359 gene locus_tag LOCUS_02590 31085 32359 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_02590 32912 33817 gene locus_tag LOCUS_02600 32912 33817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 33883 34347 gene locus_tag LOCUS_02610 33883 34347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 34356 36401 gene locus_tag LOCUS_02620 34356 36401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 36410 37282 gene locus_tag LOCUS_02630 36410 37282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 38084 37257 gene locus_tag LOCUS_02640 38084 37257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 38168 39325 gene locus_tag LOCUS_02650 gene dacF 38168 39325 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_02650 39406 39996 gene locus_tag LOCUS_02660 39406 39996 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705163.1 protein_id gnl|my_center|LOCUS_02660 40054 40569 gene locus_tag LOCUS_02670 40054 40569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 40574 42895 gene locus_tag LOCUS_02680 40574 42895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 43045 43395 gene locus_tag LOCUS_02690 43045 43395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 43563 43943 gene locus_tag LOCUS_02700 43563 43943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 43955 44170 gene locus_tag LOCUS_02710 43955 44170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 44202 46154 gene locus_tag LOCUS_02720 44202 46154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 46294 47046 gene locus_tag LOCUS_02730 46294 47046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 47161 49041 gene locus_tag LOCUS_02740 47161 49041 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246534.1 protein_id gnl|my_center|LOCUS_02740 49770 50861 gene locus_tag LOCUS_02750 gene trpS 49770 50861 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760790.1 protein_id gnl|my_center|LOCUS_02750 51088 52521 gene locus_tag LOCUS_02760 51088 52521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 52638 53528 gene locus_tag LOCUS_02770 52638 53528 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994756.1 protein_id gnl|my_center|LOCUS_02770 54110 54883 gene locus_tag LOCUS_02780 54110 54883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 54867 55733 gene locus_tag LOCUS_02790 54867 55733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 56168 56311 gene locus_tag LOCUS_02800 56168 56311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 56314 56484 gene locus_tag LOCUS_02810 56314 56484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 56557 56679 gene locus_tag LOCUS_02820 56557 56679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 57388 56702 gene locus_tag LOCUS_02830 57388 56702 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909647.1 protein_id gnl|my_center|LOCUS_02830 57528 57782 gene locus_tag LOCUS_02840 57528 57782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 57775 58968 gene locus_tag LOCUS_02850 gene nusA 57775 58968 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102602.1 protein_id gnl|my_center|LOCUS_02850 58972 59235 gene locus_tag LOCUS_02860 58972 59235 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_02860 59253 61373 gene locus_tag LOCUS_02870 gene infB 59253 61373 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036341.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence04 1328 1402 gene locus_tag LOCUS_t00020 1328 1402 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1514 3157 gene locus_tag LOCUS_02880 1514 3157 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_02880 3170 3976 gene locus_tag LOCUS_02890 3170 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 4047 4883 gene locus_tag LOCUS_02900 4047 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 4883 5305 gene locus_tag LOCUS_02910 4883 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 5295 6641 gene locus_tag LOCUS_02920 5295 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 6712 7125 gene locus_tag LOCUS_02930 gene nusB 6712 7125 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286662.1 protein_id gnl|my_center|LOCUS_02930 7115 8368 gene locus_tag LOCUS_02940 gene xseA 7115 8368 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 protein_id gnl|my_center|LOCUS_02940 8380 8610 gene locus_tag LOCUS_02950 8380 8610 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896137.1 protein_id gnl|my_center|LOCUS_02950 8663 9808 gene locus_tag LOCUS_02960 8663 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 9823 10080 gene locus_tag LOCUS_02970 9823 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 10295 14326 gene locus_tag LOCUS_02980 gene cas9 10295 14326 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475518.1 protein_id gnl|my_center|LOCUS_02980 14316 15188 gene locus_tag LOCUS_02990 gene cas1 14316 15188 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_02990 15193 15498 gene locus_tag LOCUS_03000 gene cas2 15193 15498 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_03000 15495 16172 gene locus_tag LOCUS_03010 15495 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 16253 17608 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttagttctatgtcatcttaaatggtattaaaac 18871 17855 gene locus_tag LOCUS_03020 gene spoIVB 18871 17855 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_03020 18999 19304 gene locus_tag LOCUS_03030 18999 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 19489 20109 gene locus_tag LOCUS_03040 19489 20109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 20162 21274 gene locus_tag LOCUS_03050 gene mnmA 20162 21274 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723698.1 protein_id gnl|my_center|LOCUS_03050 21369 22136 gene locus_tag LOCUS_03060 21369 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 22806 22982 gene locus_tag LOCUS_03070 22806 22982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 24213 23044 gene locus_tag LOCUS_03080 gene deoB 24213 23044 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197806.1 protein_id gnl|my_center|LOCUS_03080 25121 24219 gene locus_tag LOCUS_03090 gene xerD 25121 24219 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 protein_id gnl|my_center|LOCUS_03090 25203 25805 gene locus_tag LOCUS_03100 25203 25805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 25802 26965 gene locus_tag LOCUS_03110 25802 26965 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_03110 26967 27653 gene locus_tag LOCUS_03120 gene gmk 26967 27653 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965025.1 protein_id gnl|my_center|LOCUS_03120 27650 27979 gene locus_tag LOCUS_03130 27650 27979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 29413 28001 gene locus_tag LOCUS_03140 gene pyk 29413 28001 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732565.1 protein_id gnl|my_center|LOCUS_03140 30302 29484 gene locus_tag LOCUS_03150 gene mutM 30302 29484 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114478.1 protein_id gnl|my_center|LOCUS_03150 32941 30317 gene locus_tag LOCUS_03160 gene polA 32941 30317 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_03160 33149 33009 gene locus_tag LOCUS_03170 33149 33009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 33280 33897 gene locus_tag LOCUS_03180 gene lexA 33280 33897 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_03180 34607 33909 gene locus_tag LOCUS_03190 34607 33909 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_03190 35397 34609 gene locus_tag LOCUS_03200 35397 34609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 35596 35520 gene locus_tag LOCUS_t00030 35596 35520 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 36901 35630 gene locus_tag LOCUS_03210 36901 35630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 38019 36976 gene locus_tag LOCUS_03220 38019 36976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 38975 38031 gene locus_tag LOCUS_03230 gene holA 38975 38031 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_03230 41658 38962 gene locus_tag LOCUS_03240 gene alaS 41658 38962 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261891.1 protein_id gnl|my_center|LOCUS_03240 42211 41642 gene locus_tag LOCUS_03250 42211 41642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 42738 42208 gene locus_tag LOCUS_03260 42738 42208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 43898 42753 gene locus_tag LOCUS_03270 43898 42753 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 protein_id gnl|my_center|LOCUS_03270 43984 44568 gene locus_tag LOCUS_03280 43984 44568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 44871 44569 gene locus_tag LOCUS_03290 gene trxA 44871 44569 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183075.1 protein_id gnl|my_center|LOCUS_03290 45592 44879 gene locus_tag LOCUS_03300 45592 44879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 45671 46576 gene locus_tag LOCUS_03310 gene rnhC 45671 46576 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071591.1 protein_id gnl|my_center|LOCUS_03310 47420 46587 gene locus_tag LOCUS_03320 47420 46587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 51036 47521 gene locus_tag LOCUS_03330 51036 47521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 52867 51122 gene locus_tag LOCUS_03340 gene aspS 52867 51122 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599762.1 protein_id gnl|my_center|LOCUS_03340 54296 52860 gene locus_tag LOCUS_03350 gene gatB 54296 52860 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_03350 55744 54296 gene locus_tag LOCUS_03360 55744 54296 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183059.1 protein_id gnl|my_center|LOCUS_03360 56042 55734 gene locus_tag LOCUS_03370 56042 55734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 <57437 56418 gene locus_tag LOCUS_03380 <57437 56418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109529.1:BspA family leucine-rich repeat surface protein >Feature sequence05 21 260 gene locus_tag LOCUS_03390 21 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 587 2509 gene locus_tag LOCUS_03400 587 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 2592 3458 gene locus_tag LOCUS_03410 2592 3458 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868217.1 protein_id gnl|my_center|LOCUS_03410 3520 4893 gene locus_tag LOCUS_03420 3520 4893 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771434.1 protein_id gnl|my_center|LOCUS_03420 4904 5980 gene locus_tag LOCUS_03430 gene murG 4904 5980 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_03430 5980 6885 gene locus_tag LOCUS_03440 gene murB 5980 6885 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_03440 6889 7575 gene locus_tag LOCUS_03450 6889 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 7769 8050 gene locus_tag LOCUS_03460 gene rpsP 7769 8050 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940682.1 protein_id gnl|my_center|LOCUS_03460 8050 8292 gene locus_tag LOCUS_03470 8050 8292 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728421.1 protein_id gnl|my_center|LOCUS_03470 8363 9175 gene locus_tag LOCUS_03480 8363 9175 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359680.1 protein_id gnl|my_center|LOCUS_03480 9185 10219 gene locus_tag LOCUS_03490 gene rseP 9185 10219 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583162.1 protein_id gnl|my_center|LOCUS_03490 10235 11071 gene locus_tag LOCUS_03500 10235 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 11191 13455 gene locus_tag LOCUS_03510 11191 13455 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990110.1 protein_id gnl|my_center|LOCUS_03510 13521 14018 gene locus_tag LOCUS_03520 13521 14018 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760496.1 protein_id gnl|my_center|LOCUS_03520 14022 14489 gene locus_tag LOCUS_03530 14022 14489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 14495 14710 gene locus_tag LOCUS_03540 gene rpmF 14495 14710 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_03540 14820 15989 gene locus_tag LOCUS_03550 14820 15989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 16923 16024 gene locus_tag LOCUS_03560 16923 16024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 17097 18998 gene locus_tag LOCUS_03570 gene parE 17097 18998 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062207.1 protein_id gnl|my_center|LOCUS_03570 19009 20433 gene locus_tag LOCUS_03580 19009 20433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 20443 22962 gene locus_tag LOCUS_03590 gene parC 20443 22962 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 protein_id gnl|my_center|LOCUS_03590 23035 23382 gene locus_tag LOCUS_03600 23035 23382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 23382 23603 gene locus_tag LOCUS_03610 23382 23603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 23714 23580 gene locus_tag LOCUS_03620 23714 23580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 24102 25865 gene locus_tag LOCUS_03630 gene uvrC 24102 25865 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 protein_id gnl|my_center|LOCUS_03630 25862 26272 gene locus_tag LOCUS_03640 25862 26272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 26275 28038 gene locus_tag LOCUS_03650 gene mutL 26275 28038 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_03650 28055 28921 gene locus_tag LOCUS_03660 gene miaA 28055 28921 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226482.1 protein_id gnl|my_center|LOCUS_03660 29021 29827 gene locus_tag LOCUS_03670 29021 29827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 29824 30999 gene locus_tag LOCUS_03680 29824 30999 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830748.1 protein_id gnl|my_center|LOCUS_03680 31001 32101 gene locus_tag LOCUS_03690 31001 32101 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_03690 32197 32670 gene locus_tag LOCUS_03700 gene greA 32197 32670 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102591.1 protein_id gnl|my_center|LOCUS_03700 33309 32947 gene locus_tag LOCUS_03710 33309 32947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 33418 33663 gene locus_tag LOCUS_03720 33418 33663 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939360.1 protein_id gnl|my_center|LOCUS_03720 33666 34094 gene locus_tag LOCUS_03730 gene ruvX 33666 34094 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035765.1 protein_id gnl|my_center|LOCUS_03730 34084 34374 gene locus_tag LOCUS_03740 34084 34374 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674279.1 protein_id gnl|my_center|LOCUS_03740 34412 35461 gene locus_tag LOCUS_03750 gene mltG 34412 35461 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572132.1 protein_id gnl|my_center|LOCUS_03750 35455 36057 gene locus_tag LOCUS_03760 35455 36057 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389090.1 protein_id gnl|my_center|LOCUS_03760 36062 37138 gene locus_tag LOCUS_03770 36062 37138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 37147 37854 gene locus_tag LOCUS_03780 37147 37854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 37863 38588 gene locus_tag LOCUS_03790 gene fabG 37863 38588 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_03790 38585 39487 gene locus_tag LOCUS_03800 38585 39487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 39506 40231 gene locus_tag LOCUS_03810 39506 40231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 40233 41459 gene locus_tag LOCUS_03820 40233 41459 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_03820 41477 41713 gene locus_tag LOCUS_03830 41477 41713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 41710 42576 gene locus_tag LOCUS_03840 41710 42576 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_03840 42645 43145 gene locus_tag LOCUS_03850 42645 43145 CDS product SpoIIIAH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914708.1 protein_id gnl|my_center|LOCUS_03850 43233 43439 gene locus_tag LOCUS_03860 gene gerE 43233 43439 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_03860 43487 44434 gene locus_tag LOCUS_03870 gene gerM 43487 44434 CDS product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229578.1 protein_id gnl|my_center|LOCUS_03870 44495 45043 gene locus_tag LOCUS_03880 44495 45043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 45115 45399 gene locus_tag LOCUS_03890 45115 45399 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890717.1 protein_id gnl|my_center|LOCUS_03890 45445 46512 gene locus_tag LOCUS_03900 45445 46512 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_03900 46596 46802 gene locus_tag LOCUS_03910 46596 46802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 46799 47440 gene locus_tag LOCUS_03920 46799 47440 CDS product YjbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966134.1 protein_id gnl|my_center|LOCUS_03920 47482 48012 gene locus_tag LOCUS_03930 47482 48012 CDS product DUF4878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897181.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence06 526 1056 gene locus_tag LOCUS_03940 526 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 1053 1613 gene locus_tag LOCUS_03950 1053 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 1628 2185 gene locus_tag LOCUS_03960 1628 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2175 2735 gene locus_tag LOCUS_03970 2175 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 2804 3814 gene locus_tag LOCUS_03980 2804 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 3868 4557 gene locus_tag LOCUS_03990 3868 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4704 5183 gene locus_tag LOCUS_04000 4704 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 5176 6099 gene locus_tag LOCUS_04010 5176 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 6112 7089 gene locus_tag LOCUS_04020 6112 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 7101 8624 gene locus_tag LOCUS_04030 7101 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 8636 9736 gene locus_tag LOCUS_04040 8636 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 9733 10299 gene locus_tag LOCUS_04050 9733 10299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 10283 10879 gene locus_tag LOCUS_04060 10283 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 11393 10848 gene locus_tag LOCUS_04070 11393 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 13047 11395 gene locus_tag LOCUS_04080 13047 11395 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965259.1 protein_id gnl|my_center|LOCUS_04080 13192 13383 gene locus_tag LOCUS_04090 13192 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 13386 14543 gene locus_tag LOCUS_04100 13386 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 14530 15618 gene locus_tag LOCUS_04110 14530 15618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 15665 16336 gene locus_tag LOCUS_04120 15665 16336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 16507 16340 gene locus_tag LOCUS_04130 16507 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 16751 16993 gene locus_tag LOCUS_04140 16751 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 17292 17591 gene locus_tag LOCUS_04150 17292 17591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 17646 18650 gene locus_tag LOCUS_04160 gene ftsY 17646 18650 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_04160 18647 18931 gene locus_tag LOCUS_04170 18647 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 18933 19232 gene locus_tag LOCUS_04180 18933 19232 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041362228.1 protein_id gnl|my_center|LOCUS_04180 19286 19360 gene locus_tag LOCUS_t00040 19286 19360 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21835 19502 gene locus_tag LOCUS_04190 21835 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 22395 21847 gene locus_tag LOCUS_04200 22395 21847 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963812.1 protein_id gnl|my_center|LOCUS_04200 22550 22624 gene locus_tag LOCUS_t00050 22550 22624 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22735 23010 gene locus_tag LOCUS_04210 22735 23010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 23262 23921 gene locus_tag LOCUS_04220 23262 23921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 23990 24442 gene locus_tag LOCUS_04230 23990 24442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 27287 25350 gene locus_tag LOCUS_04240 27287 25350 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306202.1 protein_id gnl|my_center|LOCUS_04240 28074 27379 gene locus_tag LOCUS_04250 28074 27379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 28492 28076 gene locus_tag LOCUS_04260 28492 28076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 28597 29487 gene locus_tag LOCUS_04270 28597 29487 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 protein_id gnl|my_center|LOCUS_04270 29796 29662 gene locus_tag LOCUS_04280 29796 29662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 29932 29777 gene locus_tag LOCUS_04290 29932 29777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 30169 32181 gene locus_tag LOCUS_04300 gene helD 30169 32181 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948433.1 protein_id gnl|my_center|LOCUS_04300 32190 32678 gene locus_tag LOCUS_04310 32190 32678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 32730 33449 gene locus_tag LOCUS_04320 32730 33449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 33453 33719 gene locus_tag LOCUS_04330 33453 33719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 33783 34037 gene locus_tag LOCUS_04340 33783 34037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 34132 34335 gene locus_tag LOCUS_04350 gene rpoZ 34132 34335 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 protein_id gnl|my_center|LOCUS_04350 34377 35129 gene locus_tag LOCUS_04360 34377 35129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 36537 35524 gene locus_tag LOCUS_04370 gene prsA 36537 35524 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 protein_id gnl|my_center|LOCUS_04370 36687 37166 gene locus_tag LOCUS_04380 36687 37166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 37349 37477 gene locus_tag LOCUS_04390 37349 37477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 37567 38067 gene locus_tag LOCUS_04400 37567 38067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 38269 38454 gene locus_tag LOCUS_04410 38269 38454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04410 38473 38661 gene locus_tag LOCUS_04420 38473 38661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04420 38822 39130 gene locus_tag LOCUS_04430 38822 39130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04430 39808 39422 gene locus_tag LOCUS_04440 39808 39422 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870381.1 protein_id gnl|my_center|LOCUS_04440 39920 40684 gene locus_tag LOCUS_04450 gene sufC 39920 40684 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 protein_id gnl|my_center|LOCUS_04450 40671 41321 gene locus_tag LOCUS_04460 40671 41321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 41335 42531 gene locus_tag LOCUS_04470 41335 42531 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_04470 42541 42966 gene locus_tag LOCUS_04480 42541 42966 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_04480 42983 44293 gene locus_tag LOCUS_04490 gene sufB 42983 44293 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 protein_id gnl|my_center|LOCUS_04490 44473 44820 gene locus_tag LOCUS_04500 gene ssb 44473 44820 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272405.1 protein_id gnl|my_center|LOCUS_04500 44919 45263 gene locus_tag LOCUS_04510 44919 45263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 45314 46537 gene locus_tag LOCUS_04520 45314 46537 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289207.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence07 100 450 gene locus_tag LOCUS_04530 100 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 513 1433 gene locus_tag LOCUS_04540 gene ylqF 513 1433 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 protein_id gnl|my_center|LOCUS_04540 1695 1444 gene locus_tag LOCUS_04550 1695 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 1773 3863 gene locus_tag LOCUS_04560 gene pbpA 1773 3863 CDS product penicillin-binding protein 2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398702.1 protein_id gnl|my_center|LOCUS_04560 3924 4535 gene locus_tag LOCUS_04570 3924 4535 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868811.1 protein_id gnl|my_center|LOCUS_04570 4613 4990 gene locus_tag LOCUS_04580 4613 4990 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903515.1 protein_id gnl|my_center|LOCUS_04580 4977 7004 gene locus_tag LOCUS_04590 4977 7004 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965539.1 protein_id gnl|my_center|LOCUS_04590 7231 7148 gene locus_tag LOCUS_t00060 7231 7148 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7317 7241 gene locus_tag LOCUS_t00070 7317 7241 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7427 7696 gene locus_tag LOCUS_04600 7427 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 7763 8026 gene locus_tag LOCUS_04610 7763 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04610 8829 8365 gene locus_tag LOCUS_04620 8829 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 8941 10290 gene locus_tag LOCUS_04630 8941 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 10734 11036 gene locus_tag LOCUS_04640 gene rplU 10734 11036 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183340.1 protein_id gnl|my_center|LOCUS_04640 11039 11341 gene locus_tag LOCUS_04650 11039 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 11355 11645 gene locus_tag LOCUS_04660 gene rpmA 11355 11645 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564659.1 protein_id gnl|my_center|LOCUS_04660 11686 12954 gene locus_tag LOCUS_04670 gene obgE 11686 12954 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836728.1 protein_id gnl|my_center|LOCUS_04670 12970 14001 gene locus_tag LOCUS_04680 12970 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 14851 17799 gene locus_tag LOCUS_04690 14851 17799 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183129.1 protein_id gnl|my_center|LOCUS_04690 17800 19239 gene locus_tag LOCUS_04700 17800 19239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 19268 20179 gene locus_tag LOCUS_04710 19268 20179 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095334.1 protein_id gnl|my_center|LOCUS_04710 20233 21060 gene locus_tag LOCUS_04720 20233 21060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 22194 21139 gene locus_tag LOCUS_04730 gene dacB 22194 21139 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_04730 22330 23688 gene locus_tag LOCUS_04740 22330 23688 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_04740 23887 23717 gene locus_tag LOCUS_04750 23887 23717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 24056 24562 gene locus_tag LOCUS_04760 24056 24562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 24565 25071 gene locus_tag LOCUS_04770 gene trmL 24565 25071 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722757.1 protein_id gnl|my_center|LOCUS_04770 25294 25103 gene locus_tag LOCUS_04780 gene rpmB 25294 25103 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183124.1 protein_id gnl|my_center|LOCUS_04780 25440 27455 gene locus_tag LOCUS_04790 25440 27455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 27499 30393 gene locus_tag LOCUS_04800 gene dnaE 27499 30393 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476006.1 protein_id gnl|my_center|LOCUS_04800 30393 30863 gene locus_tag LOCUS_04810 gene lspA 30393 30863 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640508.1 protein_id gnl|my_center|LOCUS_04810 30841 31725 gene locus_tag LOCUS_04820 30841 31725 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_04820 31770 32924 gene locus_tag LOCUS_04830 31770 32924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 32938 34362 gene locus_tag LOCUS_04840 gene proS 32938 34362 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_04840 34441 34638 gene locus_tag LOCUS_04850 34441 34638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 34631 35599 gene locus_tag LOCUS_04860 34631 35599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 35680 37509 gene locus_tag LOCUS_04870 35680 37509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 37506 38282 gene locus_tag LOCUS_04880 37506 38282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 38729 41035 gene locus_tag LOCUS_04890 38729 41035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 41048 42805 gene locus_tag LOCUS_04900 gene thrS 41048 42805 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830850.1 protein_id gnl|my_center|LOCUS_04900 43736 42846 gene locus_tag LOCUS_04910 43736 42846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 43962 43723 gene locus_tag LOCUS_04920 gene yidD 43962 43723 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence08 602 105 gene locus_tag LOCUS_04930 602 105 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964974.1 protein_id gnl|my_center|LOCUS_04930 1413 691 gene locus_tag LOCUS_04940 1413 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2467 1415 gene locus_tag LOCUS_04950 2467 1415 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837286.1 protein_id gnl|my_center|LOCUS_04950 3435 2803 gene locus_tag LOCUS_04960 3435 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 4003 3446 gene locus_tag LOCUS_04970 4003 3446 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_04970 5015 4152 gene locus_tag LOCUS_04980 5015 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 5883 5032 gene locus_tag LOCUS_04990 5883 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 7402 6212 gene locus_tag LOCUS_05000 gene rlmD 7402 6212 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_05000 9208 7586 gene locus_tag LOCUS_05010 9208 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 11437 9296 gene locus_tag LOCUS_05020 gene pnp 11437 9296 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 protein_id gnl|my_center|LOCUS_05020 11754 11485 gene locus_tag LOCUS_05030 gene rpsO 11754 11485 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 protein_id gnl|my_center|LOCUS_05030 12858 11932 gene locus_tag LOCUS_05040 12858 11932 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814967.1 protein_id gnl|my_center|LOCUS_05040 14172 13093 gene locus_tag LOCUS_05050 14172 13093 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_05050 14748 14182 gene locus_tag LOCUS_05060 14748 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 16051 14729 gene locus_tag LOCUS_05070 16051 14729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 17867 16062 gene locus_tag LOCUS_05080 17867 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 18038 20062 gene locus_tag LOCUS_05090 18038 20062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 20131 20952 gene locus_tag LOCUS_05100 20131 20952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 21512 20970 gene locus_tag LOCUS_05110 21512 20970 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_05110 21908 21528 gene locus_tag LOCUS_05120 21908 21528 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_05120 23082 22000 gene locus_tag LOCUS_05130 23082 22000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 24006 23347 gene locus_tag LOCUS_05140 24006 23347 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874707.1 protein_id gnl|my_center|LOCUS_05140 25100 24006 gene locus_tag LOCUS_05150 gene rpoD 25100 24006 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 protein_id gnl|my_center|LOCUS_05150 26829 25090 gene locus_tag LOCUS_05160 gene dnaG 26829 25090 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528211.1 protein_id gnl|my_center|LOCUS_05160 27853 26846 gene locus_tag LOCUS_05170 gene yqeH 27853 26846 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140799.1 protein_id gnl|my_center|LOCUS_05170 28370 27846 gene locus_tag LOCUS_05180 28370 27846 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640287.1 protein_id gnl|my_center|LOCUS_05180 29778 28381 gene locus_tag LOCUS_05190 29778 28381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 30674 29967 gene locus_tag LOCUS_05200 gene sigK 30674 29967 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_05200 32876 30717 gene locus_tag LOCUS_05210 32876 30717 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131470.1 protein_id gnl|my_center|LOCUS_05210 34109 32970 gene locus_tag LOCUS_05220 gene ftsZ 34109 32970 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888987.1 protein_id gnl|my_center|LOCUS_05220 35358 34129 gene locus_tag LOCUS_05230 35358 34129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 37551 35416 gene locus_tag LOCUS_05240 gene pbpB 37551 35416 CDS product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 protein_id gnl|my_center|LOCUS_05240 37867 37562 gene locus_tag LOCUS_05250 37867 37562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 38816 37884 gene locus_tag LOCUS_05260 gene rsmH 38816 37884 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731975.1 protein_id gnl|my_center|LOCUS_05260 39335 39487 gene locus_tag LOCUS_05270 39335 39487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 39762 39448 gene locus_tag LOCUS_05280 39762 39448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 40692 39775 gene locus_tag LOCUS_05290 40692 39775 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197060.1 protein_id gnl|my_center|LOCUS_05290 41980 40700 gene locus_tag LOCUS_05300 41980 40700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_05300 42869 41973 gene locus_tag LOCUS_05310 42869 41973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence09 1553 684 gene locus_tag LOCUS_05320 1553 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 2818 1550 gene locus_tag LOCUS_05330 2818 1550 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947791.1 protein_id gnl|my_center|LOCUS_05330 3716 2838 gene locus_tag LOCUS_05340 3716 2838 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456488.1 protein_id gnl|my_center|LOCUS_05340 4327 3782 gene locus_tag LOCUS_05350 4327 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 4953 4414 gene locus_tag LOCUS_05360 4953 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 6079 4994 gene locus_tag LOCUS_05370 6079 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6861 6217 gene locus_tag LOCUS_05380 6861 6217 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455123.1 protein_id gnl|my_center|LOCUS_05380 7553 6888 gene locus_tag LOCUS_05390 7553 6888 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017068.1 protein_id gnl|my_center|LOCUS_05390 8146 7565 gene locus_tag LOCUS_05400 8146 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 8696 8379 gene locus_tag LOCUS_05410 8696 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 9063 8758 gene locus_tag LOCUS_05420 9063 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 11432 9063 gene locus_tag LOCUS_05430 gene pheT 11432 9063 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498186.1 protein_id gnl|my_center|LOCUS_05430 12471 11425 gene locus_tag LOCUS_05440 gene pheS 12471 11425 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830082.1 protein_id gnl|my_center|LOCUS_05440 13095 12472 gene locus_tag LOCUS_05450 13095 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 13889 13347 gene locus_tag LOCUS_05460 gene frr 13889 13347 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262766.1 protein_id gnl|my_center|LOCUS_05460 14701 14015 gene locus_tag LOCUS_05470 14701 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 14816 15058 gene locus_tag LOCUS_05480 14816 15058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 17102 15075 gene locus_tag LOCUS_05490 gene topA 17102 15075 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_05490 17777 17169 gene locus_tag LOCUS_05500 gene rnhB 17777 17169 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174721.1 protein_id gnl|my_center|LOCUS_05500 18258 17821 gene locus_tag LOCUS_05510 18258 17821 CDS product lpg2359 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_05510 18892 18263 gene locus_tag LOCUS_05520 18892 18263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 19208 18894 gene locus_tag LOCUS_05530 19208 18894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 19779 19252 gene locus_tag LOCUS_05540 19779 19252 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731912.1 protein_id gnl|my_center|LOCUS_05540 21487 19913 gene locus_tag LOCUS_05550 21487 19913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 22574 21708 gene locus_tag LOCUS_05560 22574 21708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 23252 22617 gene locus_tag LOCUS_05570 gene rpe 23252 22617 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_05570 24085 23252 gene locus_tag LOCUS_05580 gene rsgA 24085 23252 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902190.1 protein_id gnl|my_center|LOCUS_05580 25915 24101 gene locus_tag LOCUS_05590 gene pknB 25915 24101 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_05590 26658 25912 gene locus_tag LOCUS_05600 26658 25912 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701707.1 protein_id gnl|my_center|LOCUS_05600 27674 26655 gene locus_tag LOCUS_05610 gene rlmN 27674 26655 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293986.1 protein_id gnl|my_center|LOCUS_05610 28683 27940 gene locus_tag LOCUS_05620 28683 27940 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_05620 29855 28674 gene locus_tag LOCUS_05630 29855 28674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 31179 29956 gene locus_tag LOCUS_05640 31179 29956 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861225.1 protein_id gnl|my_center|LOCUS_05640 31825 31169 gene locus_tag LOCUS_05650 31825 31169 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963772.1 protein_id gnl|my_center|LOCUS_05650 32971 31883 gene locus_tag LOCUS_05660 32971 31883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 33021 33215 gene locus_tag LOCUS_05670 33021 33215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 34451 33318 gene locus_tag LOCUS_05680 34451 33318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05680 35125 34454 gene locus_tag LOCUS_05690 35125 34454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438655.1 protein_id gnl|my_center|LOCUS_05690 36161 35214 gene locus_tag LOCUS_05700 36161 35214 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_05700 36394 36164 gene locus_tag LOCUS_05710 36394 36164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 38046 36433 gene locus_tag LOCUS_05720 38046 36433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 38748 38107 gene locus_tag LOCUS_05730 38748 38107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 39795 38827 gene locus_tag LOCUS_05740 39795 38827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 40189 39839 gene locus_tag LOCUS_05750 gene spoVAE 40189 39839 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345915.1 protein_id gnl|my_center|LOCUS_05750 41185 40190 gene locus_tag LOCUS_05760 gene spoVAD 41185 40190 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 protein_id gnl|my_center|LOCUS_05760 41625 41182 gene locus_tag LOCUS_05770 gene spoVAC 41625 41182 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_05770 <42881 41710 gene locus_tag LOCUS_05780 <42881 41710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109529.1:BspA family leucine-rich repeat surface protein >Feature sequence10 343 128 gene locus_tag LOCUS_05790 343 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 454 1011 gene locus_tag LOCUS_05800 454 1011 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_05800 1051 2943 gene locus_tag LOCUS_05810 1051 2943 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016920.1 protein_id gnl|my_center|LOCUS_05810 3841 2993 gene locus_tag LOCUS_05820 3841 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4757 3828 gene locus_tag LOCUS_05830 4757 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 6164 4758 gene locus_tag LOCUS_05840 6164 4758 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947970.1 protein_id gnl|my_center|LOCUS_05840 6407 7069 gene locus_tag LOCUS_05850 6407 7069 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948085.1 protein_id gnl|my_center|LOCUS_05850 7066 8340 gene locus_tag LOCUS_05860 7066 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 8379 9149 gene locus_tag LOCUS_05870 8379 9149 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975377.1 protein_id gnl|my_center|LOCUS_05870 9187 9861 gene locus_tag LOCUS_05880 9187 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 9926 10002 gene locus_tag LOCUS_t00080 9926 10002 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10114 10395 gene locus_tag LOCUS_05890 10114 10395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 11043 10798 gene locus_tag LOCUS_05900 11043 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 11788 11450 gene locus_tag LOCUS_05910 11788 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05910 12089 12601 gene locus_tag LOCUS_05920 gene cbrC 12089 12601 CDS product PF03691 family colicin E2 tolerance protein CbrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193070.1 protein_id gnl|my_center|LOCUS_05920 12625 12936 gene locus_tag LOCUS_05930 12625 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 12975 13250 gene locus_tag LOCUS_05940 12975 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 13267 13662 gene locus_tag LOCUS_05950 13267 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 13897 14520 gene locus_tag LOCUS_05960 13897 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 14586 15287 gene locus_tag LOCUS_05970 14586 15287 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812988.1 protein_id gnl|my_center|LOCUS_05970 15274 15786 gene locus_tag LOCUS_05980 15274 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 16530 15982 gene locus_tag LOCUS_05990 16530 15982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 16781 17056 gene locus_tag LOCUS_06000 16781 17056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 19620 17113 gene locus_tag LOCUS_06010 gene rnr 19620 17113 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829677.1 protein_id gnl|my_center|LOCUS_06010 21561 19777 gene locus_tag LOCUS_06020 gene glmS 21561 19777 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048324.1 protein_id gnl|my_center|LOCUS_06020 21666 21742 gene locus_tag LOCUS_t00090 21666 21742 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21769 22248 gene locus_tag LOCUS_06030 21769 22248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 22241 22948 gene locus_tag LOCUS_06040 22241 22948 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_06040 23574 22960 gene locus_tag LOCUS_06050 23574 22960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 24051 23638 gene locus_tag LOCUS_06060 24051 23638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 24139 24212 gene locus_tag LOCUS_t00100 24139 24212 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24312 24557 gene locus_tag LOCUS_06070 24312 24557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 24793 25074 gene locus_tag LOCUS_06080 24793 25074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06080 25162 25530 gene locus_tag LOCUS_06090 25162 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 25626 25820 gene locus_tag LOCUS_06100 25626 25820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 25990 26796 gene locus_tag LOCUS_06110 25990 26796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 26808 27260 gene locus_tag LOCUS_06120 26808 27260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 27346 27642 gene locus_tag LOCUS_06130 27346 27642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 27662 28750 gene locus_tag LOCUS_06140 27662 28750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 29053 29274 gene locus_tag LOCUS_06150 29053 29274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 29301 29549 gene locus_tag LOCUS_06160 29301 29549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 29530 29712 gene locus_tag LOCUS_06170 29530 29712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 29927 30421 gene locus_tag LOCUS_06180 29927 30421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 31037 31282 gene locus_tag LOCUS_06190 31037 31282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 31309 31821 gene locus_tag LOCUS_06200 31309 31821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 31891 32865 gene locus_tag LOCUS_06210 31891 32865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 32975 33172 gene locus_tag LOCUS_06220 32975 33172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 33416 35395 gene locus_tag LOCUS_06230 33416 35395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 35457 36041 gene locus_tag LOCUS_06240 35457 36041 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_06240 36038 37807 gene locus_tag LOCUS_06250 36038 37807 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_06250 37788 38399 gene locus_tag LOCUS_06260 37788 38399 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_06260 38404 39123 gene locus_tag LOCUS_06270 38404 39123 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262342.1 protein_id gnl|my_center|LOCUS_06270 39174 39314 gene locus_tag LOCUS_06280 39174 39314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence11 834 986 gene locus_tag LOCUS_06290 834 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 990 1289 gene locus_tag LOCUS_06300 990 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 1664 3319 gene locus_tag LOCUS_06310 1664 3319 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775553.1 protein_id gnl|my_center|LOCUS_06310 3367 3912 gene locus_tag LOCUS_06320 3367 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4469 3996 gene locus_tag LOCUS_06330 4469 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4934 4737 gene locus_tag LOCUS_06340 4934 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5180 5007 gene locus_tag LOCUS_06350 5180 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 6109 5234 gene locus_tag LOCUS_06360 6109 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 7240 6122 gene locus_tag LOCUS_06370 7240 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 8081 9226 gene locus_tag LOCUS_06380 8081 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 9385 9816 gene locus_tag LOCUS_06390 9385 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06390 9943 10236 gene locus_tag LOCUS_06400 9943 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06400 10355 11467 gene locus_tag LOCUS_06410 10355 11467 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475877.1 protein_id gnl|my_center|LOCUS_06410 11454 12119 gene locus_tag LOCUS_06420 gene dnaD 11454 12119 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728549.1 protein_id gnl|my_center|LOCUS_06420 12088 12738 gene locus_tag LOCUS_06430 gene nth 12088 12738 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933025.1 protein_id gnl|my_center|LOCUS_06430 12835 13953 gene locus_tag LOCUS_06440 12835 13953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437132.1 protein_id gnl|my_center|LOCUS_06440 13953 15518 gene locus_tag LOCUS_06450 13953 15518 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437129.1 protein_id gnl|my_center|LOCUS_06450 15581 16684 gene locus_tag LOCUS_06460 15581 16684 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638965.1 protein_id gnl|my_center|LOCUS_06460 16684 17871 gene locus_tag LOCUS_06470 gene thiI 16684 17871 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989282.1 protein_id gnl|my_center|LOCUS_06470 17945 18160 gene locus_tag LOCUS_06480 gene sspB 17945 18160 CDS product beta type acid-soluble spore protein SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233287.1 protein_id gnl|my_center|LOCUS_06480 18237 18584 gene locus_tag LOCUS_06490 18237 18584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 18643 19836 gene locus_tag LOCUS_06500 gene ackA 18643 19836 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034578.1 protein_id gnl|my_center|LOCUS_06500 19901 21085 gene locus_tag LOCUS_06510 gene ackA 19901 21085 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034575.1 protein_id gnl|my_center|LOCUS_06510 21091 22053 gene locus_tag LOCUS_06520 gene nrnA 21091 22053 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398971.1 protein_id gnl|my_center|LOCUS_06520 22037 22633 gene locus_tag LOCUS_06530 gene yihA 22037 22633 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357155.1 protein_id gnl|my_center|LOCUS_06530 22668 23120 gene locus_tag LOCUS_06540 22668 23120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 24648 23173 gene locus_tag LOCUS_06550 gene spoIVA 24648 23173 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416519.1 protein_id gnl|my_center|LOCUS_06550 24867 25058 gene locus_tag LOCUS_06560 24867 25058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 25132 25467 gene locus_tag LOCUS_06570 25132 25467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06570 26741 25986 gene locus_tag LOCUS_06580 26741 25986 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964207.1 protein_id gnl|my_center|LOCUS_06580 27799 26738 gene locus_tag LOCUS_06590 27799 26738 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964208.1 protein_id gnl|my_center|LOCUS_06590 27907 28959 gene locus_tag LOCUS_06600 27907 28959 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_06600 29691 28951 gene locus_tag LOCUS_06610 29691 28951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 29995 29756 gene locus_tag LOCUS_06620 29995 29756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 30293 30042 gene locus_tag LOCUS_06630 30293 30042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 31600 30290 gene locus_tag LOCUS_06640 gene der 31600 30290 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_06640 31915 31670 gene locus_tag LOCUS_06650 31915 31670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 32066 32716 gene locus_tag LOCUS_06660 32066 32716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 32716 33321 gene locus_tag LOCUS_06670 32716 33321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 33378 34292 gene locus_tag LOCUS_06680 33378 34292 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831154.1 protein_id gnl|my_center|LOCUS_06680 34298 35437 gene locus_tag LOCUS_06690 34298 35437 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379407.1 protein_id gnl|my_center|LOCUS_06690 35457 36110 gene locus_tag LOCUS_06700 35457 36110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 36107 36265 gene locus_tag LOCUS_06710 36107 36265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence12 1960 1373 gene locus_tag LOCUS_06720 1960 1373 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130463.1 protein_id gnl|my_center|LOCUS_06720 2685 2107 gene locus_tag LOCUS_06730 2685 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3150 2782 gene locus_tag LOCUS_06740 gene rplL 3150 2782 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_06740 3663 3163 gene locus_tag LOCUS_06750 gene rplJ 3663 3163 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732833.1 protein_id gnl|my_center|LOCUS_06750 4509 3811 gene locus_tag LOCUS_06760 gene rplA 4509 3811 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294587.1 protein_id gnl|my_center|LOCUS_06760 5023 4589 gene locus_tag LOCUS_06770 gene rplK 5023 4589 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112010.1 protein_id gnl|my_center|LOCUS_06770 5721 5155 gene locus_tag LOCUS_06780 5721 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 6257 5724 gene locus_tag LOCUS_06790 gene nusG 6257 5724 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_06790 6524 6270 gene locus_tag LOCUS_06800 6524 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6827 6612 gene locus_tag LOCUS_06810 gene secG 6827 6612 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_06810 8152 6923 gene locus_tag LOCUS_06820 gene eno 8152 6923 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_06820 9586 8234 gene locus_tag LOCUS_06830 gene murD 9586 8234 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130748.1 protein_id gnl|my_center|LOCUS_06830 9697 10947 gene locus_tag LOCUS_06840 9697 10947 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830979.1 protein_id gnl|my_center|LOCUS_06840 11616 10996 gene locus_tag LOCUS_06850 11616 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 12904 11714 gene locus_tag LOCUS_06860 gene tuf 12904 11714 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290442.1 protein_id gnl|my_center|LOCUS_06860 15067 12998 gene locus_tag LOCUS_06870 gene fusA 15067 12998 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183519.1 protein_id gnl|my_center|LOCUS_06870 15547 15080 gene locus_tag LOCUS_06880 gene rpsG 15547 15080 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_06880 15991 15581 gene locus_tag LOCUS_06890 gene rpsL 15991 15581 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142341.1 protein_id gnl|my_center|LOCUS_06890 16203 18563 gene locus_tag LOCUS_06900 16203 18563 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_06900 20275 18620 gene locus_tag LOCUS_06910 20275 18620 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_06910 20415 20996 gene locus_tag LOCUS_06920 gene clpP 20415 20996 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289402.1 protein_id gnl|my_center|LOCUS_06920 21894 20983 gene locus_tag LOCUS_06930 gene whiA 21894 20983 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006558.1 protein_id gnl|my_center|LOCUS_06930 22849 21899 gene locus_tag LOCUS_06940 gene yvcK 22849 21899 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829626.1 protein_id gnl|my_center|LOCUS_06940 23732 22842 gene locus_tag LOCUS_06950 gene trxB 23732 22842 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272302.1 protein_id gnl|my_center|LOCUS_06950 24534 23722 gene locus_tag LOCUS_06960 gene lgt 24534 23722 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 protein_id gnl|my_center|LOCUS_06960 24952 24527 gene locus_tag LOCUS_06970 24952 24527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 27770 24963 gene locus_tag LOCUS_06980 gene uvrA 27770 24963 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_06980 28040 28315 gene locus_tag LOCUS_06990 28040 28315 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357604.1 protein_id gnl|my_center|LOCUS_06990 29044 28403 gene locus_tag LOCUS_07000 29044 28403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 29680 29075 gene locus_tag LOCUS_07010 29680 29075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 30387 29686 gene locus_tag LOCUS_07020 gene rlmB 30387 29686 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494715.1 protein_id gnl|my_center|LOCUS_07020 30764 30390 gene locus_tag LOCUS_07030 30764 30390 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930887.1 protein_id gnl|my_center|LOCUS_07030 31449 30769 gene locus_tag LOCUS_07040 31449 30769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 32848 31457 gene locus_tag LOCUS_07050 32848 31457 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002662611.1 protein_id gnl|my_center|LOCUS_07050 33471 32938 gene locus_tag LOCUS_07060 gene raiA 33471 32938 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_07060 33798 33580 gene locus_tag LOCUS_07070 33798 33580 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966272.1 protein_id gnl|my_center|LOCUS_07070 34063 34647 gene locus_tag LOCUS_07080 34063 34647 CDS product accessory gene regulator ArgB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963405.1 protein_id gnl|my_center|LOCUS_07080 34689 34808 gene locus_tag LOCUS_07090 34689 34808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 <35522 34811 gene locus_tag LOCUS_07100 <35522 34811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262113.1:GHKL domain-containing protein >Feature sequence13 503 69 gene locus_tag LOCUS_07110 gene sepF 503 69 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_07110 629 1189 gene locus_tag LOCUS_07120 629 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2952 1168 gene locus_tag LOCUS_07130 2952 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 3586 3026 gene locus_tag LOCUS_07140 gene yqeK 3586 3026 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360010.1 protein_id gnl|my_center|LOCUS_07140 4859 3603 gene locus_tag LOCUS_07150 gene kinB 4859 3603 CDS product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420370.1 protein_id gnl|my_center|LOCUS_07150 6823 4943 gene locus_tag LOCUS_07160 gene htpG 6823 4943 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_07160 7203 6976 gene locus_tag LOCUS_07170 7203 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 8017 7178 gene locus_tag LOCUS_07180 8017 7178 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_07180 9134 8004 gene locus_tag LOCUS_07190 9134 8004 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398687.1 protein_id gnl|my_center|LOCUS_07190 10457 9177 gene locus_tag LOCUS_07200 10457 9177 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_07200 10615 10472 gene locus_tag LOCUS_07210 10615 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 10890 10654 gene locus_tag LOCUS_07220 gene copZ 10890 10654 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289040.1 protein_id gnl|my_center|LOCUS_07220 13084 10895 gene locus_tag LOCUS_07230 13084 10895 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948919.1 protein_id gnl|my_center|LOCUS_07230 14149 13289 gene locus_tag LOCUS_07240 14149 13289 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837306.1 protein_id gnl|my_center|LOCUS_07240 15082 14423 gene locus_tag LOCUS_07250 15082 14423 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07250 15775 15158 gene locus_tag LOCUS_07260 15775 15158 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037239.1 protein_id gnl|my_center|LOCUS_07260 16384 17685 gene locus_tag LOCUS_07270 16384 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 17678 18706 gene locus_tag LOCUS_07280 17678 18706 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108247.1 protein_id gnl|my_center|LOCUS_07280 20044 18737 gene locus_tag LOCUS_07290 20044 18737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 20183 20410 gene locus_tag LOCUS_07300 20183 20410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 20951 21316 gene locus_tag LOCUS_07310 20951 21316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 21513 21331 gene locus_tag LOCUS_07320 21513 21331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 22758 21565 gene locus_tag LOCUS_07330 22758 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 25078 23087 gene locus_tag LOCUS_07340 gene recG 25078 23087 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244692.1 protein_id gnl|my_center|LOCUS_07340 25168 25764 gene locus_tag LOCUS_07350 25168 25764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 26470 25730 gene locus_tag LOCUS_07360 gene fabG 26470 25730 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_07360 26681 26606 gene locus_tag LOCUS_t00110 26681 26606 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 26764 26688 gene locus_tag LOCUS_t00120 26764 26688 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 26844 26769 gene locus_tag LOCUS_t00130 26844 26769 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26958 26866 gene locus_tag LOCUS_t00140 26958 26866 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27054 26966 gene locus_tag LOCUS_t00150 27054 26966 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27136 27061 gene locus_tag LOCUS_t00160 27136 27061 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 27224 27150 gene locus_tag LOCUS_t00170 27224 27150 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27318 27235 gene locus_tag LOCUS_t00180 27318 27235 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 27411 27336 gene locus_tag LOCUS_t00190 27411 27336 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27495 27419 gene locus_tag LOCUS_t00200 27495 27419 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27906 27565 gene locus_tag LOCUS_07370 gene yugI 27906 27565 CDS product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722395.1 protein_id gnl|my_center|LOCUS_07370 27991 28236 gene locus_tag LOCUS_07380 27991 28236 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124572.1 protein_id gnl|my_center|LOCUS_07380 29146 28220 gene locus_tag LOCUS_07390 29146 28220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 30879 29200 gene locus_tag LOCUS_07400 30879 29200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 31161 30898 gene locus_tag LOCUS_07410 31161 30898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 31525 31247 gene locus_tag LOCUS_07420 31525 31247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 32285 31551 gene locus_tag LOCUS_07430 gene yunB 32285 31551 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968113.1 protein_id gnl|my_center|LOCUS_07430 32512 32282 gene locus_tag LOCUS_07440 32512 32282 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236745.1 protein_id gnl|my_center|LOCUS_07440 33330 32557 gene locus_tag LOCUS_07450 gene sigG 33330 32557 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197755.1 protein_id gnl|my_center|LOCUS_07450 34215 33373 gene locus_tag LOCUS_07460 34215 33373 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_07460 34410 34486 gene locus_tag LOCUS_t00210 34410 34486 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence14 <1 949 gene locus_tag LOCUS_07470 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109529.1:BspA family leucine-rich repeat surface protein 1074 2612 gene locus_tag LOCUS_07480 1074 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2671 3264 gene locus_tag LOCUS_07490 2671 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3278 3871 gene locus_tag LOCUS_07500 3278 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3879 5948 gene locus_tag LOCUS_07510 3879 5948 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986153.1 protein_id gnl|my_center|LOCUS_07510 5945 6565 gene locus_tag LOCUS_07520 5945 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 6642 8474 gene locus_tag LOCUS_07530 6642 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 8590 9315 gene locus_tag LOCUS_07540 gene rluB 8590 9315 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_07540 9592 10860 gene locus_tag LOCUS_07550 9592 10860 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_07550 10842 11441 gene locus_tag LOCUS_07560 10842 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 11825 11634 gene locus_tag LOCUS_07570 11825 11634 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_07570 11941 12738 gene locus_tag LOCUS_07580 11941 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 12836 14050 gene locus_tag LOCUS_07590 12836 14050 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_07590 14078 14917 gene locus_tag LOCUS_07600 14078 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 14934 19535 gene locus_tag LOCUS_07610 14934 19535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 19544 20443 gene locus_tag LOCUS_07620 19544 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 20716 21537 gene locus_tag LOCUS_07630 20716 21537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 21601 22332 gene locus_tag LOCUS_07640 gene estV 21601 22332 CDS product lipase EstV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129409.1 protein_id gnl|my_center|LOCUS_07640 22337 23968 gene locus_tag LOCUS_07650 22337 23968 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_07650 23974 25191 gene locus_tag LOCUS_07660 23974 25191 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_07660 26307 25246 gene locus_tag LOCUS_07670 26307 25246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 27052 26324 gene locus_tag LOCUS_07680 27052 26324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 27163 27327 gene locus_tag LOCUS_07690 27163 27327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 27320 28267 gene locus_tag LOCUS_07700 27320 28267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 28264 29502 gene locus_tag LOCUS_07710 28264 29502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 29489 30247 gene locus_tag LOCUS_07720 29489 30247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 30219 30920 gene locus_tag LOCUS_07730 30219 30920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 31030 33267 gene locus_tag LOCUS_07740 gene pflB 31030 33267 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048196.1 protein_id gnl|my_center|LOCUS_07740 33268 33984 gene locus_tag LOCUS_07750 gene pflA 33268 33984 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048195.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence15 1719 184 gene locus_tag LOCUS_07760 1719 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8928 1831 gene locus_tag LOCUS_07770 8928 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 9917 8943 gene locus_tag LOCUS_07780 9917 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 10614 9907 gene locus_tag LOCUS_07790 10614 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 11006 10704 gene locus_tag LOCUS_07800 11006 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 11183 11767 gene locus_tag LOCUS_07810 11183 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 13338 11755 gene locus_tag LOCUS_07820 13338 11755 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_07820 13474 13340 gene locus_tag LOCUS_07830 13474 13340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 13678 14064 gene locus_tag LOCUS_07840 13678 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 14051 14806 gene locus_tag LOCUS_07850 14051 14806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_07850 14793 15584 gene locus_tag LOCUS_07860 14793 15584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861383.1 protein_id gnl|my_center|LOCUS_07860 17162 15624 gene locus_tag LOCUS_07870 17162 15624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 17368 17925 gene locus_tag LOCUS_07880 17368 17925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07880 17922 18062 gene locus_tag LOCUS_07890 17922 18062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07890 19217 18186 gene locus_tag LOCUS_07900 19217 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 19518 19228 gene locus_tag LOCUS_07910 19518 19228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 19879 19571 gene locus_tag LOCUS_07920 19879 19571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 20178 19894 gene locus_tag LOCUS_07930 20178 19894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 20505 20251 gene locus_tag LOCUS_07940 20505 20251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 25064 20505 gene locus_tag LOCUS_07950 gene essC 25064 20505 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963368.1 protein_id gnl|my_center|LOCUS_07950 25764 25288 gene locus_tag LOCUS_07960 25764 25288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 25907 25785 gene locus_tag LOCUS_07970 25907 25785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 27482 26046 gene locus_tag LOCUS_07980 27482 26046 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948881.1 protein_id gnl|my_center|LOCUS_07980 28678 27491 gene locus_tag LOCUS_07990 28678 27491 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711470.1 protein_id gnl|my_center|LOCUS_07990 29844 28843 gene locus_tag LOCUS_08000 gene tsaD 29844 28843 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 protein_id gnl|my_center|LOCUS_08000 30261 29848 gene locus_tag LOCUS_08010 30261 29848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 30884 30258 gene locus_tag LOCUS_08020 gene tsaB 30884 30258 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262633.1 protein_id gnl|my_center|LOCUS_08020 31339 30881 gene locus_tag LOCUS_08030 gene tsaE 31339 30881 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence16 994 491 gene locus_tag LOCUS_08040 994 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2202 1060 gene locus_tag LOCUS_08050 gene dnaJ 2202 1060 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043938.1 protein_id gnl|my_center|LOCUS_08050 4021 2222 gene locus_tag LOCUS_08060 gene pepF 4021 2222 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_08060 5906 4086 gene locus_tag LOCUS_08070 gene dnaK 5906 4086 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721980.1 protein_id gnl|my_center|LOCUS_08070 6551 5925 gene locus_tag LOCUS_08080 gene grpE 6551 5925 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_08080 7549 6557 gene locus_tag LOCUS_08090 gene hrcA 7549 6557 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_08090 7828 7649 gene locus_tag LOCUS_08100 7828 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 8379 7825 gene locus_tag LOCUS_08110 8379 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 8964 8458 gene locus_tag LOCUS_08120 8964 8458 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_08120 9378 10205 gene locus_tag LOCUS_08130 9378 10205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 10396 10623 gene locus_tag LOCUS_08140 10396 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 10878 11834 gene locus_tag LOCUS_08150 10878 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 11822 12718 gene locus_tag LOCUS_08160 11822 12718 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693963.1 protein_id gnl|my_center|LOCUS_08160 13293 12805 gene locus_tag LOCUS_08170 13293 12805 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_08170 13573 13295 gene locus_tag LOCUS_08180 13573 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 13826 13590 gene locus_tag LOCUS_08190 13826 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 13990 14802 gene locus_tag LOCUS_08200 13990 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 14804 15889 gene locus_tag LOCUS_08210 14804 15889 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_08210 16621 15890 gene locus_tag LOCUS_08220 16621 15890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 17381 16632 gene locus_tag LOCUS_08230 gene zupT 17381 16632 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811500.1 protein_id gnl|my_center|LOCUS_08230 18208 17387 gene locus_tag LOCUS_08240 18208 17387 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546705.1 protein_id gnl|my_center|LOCUS_08240 20039 18294 gene locus_tag LOCUS_08250 gene aspS 20039 18294 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_08250 21398 20052 gene locus_tag LOCUS_08260 gene hisS 21398 20052 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003161280.1 protein_id gnl|my_center|LOCUS_08260 22793 21639 gene locus_tag LOCUS_08270 22793 21639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 22976 23956 gene locus_tag LOCUS_08280 gene mraY 22976 23956 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_08280 23975 25060 gene locus_tag LOCUS_08290 gene spoVE 23975 25060 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_08290 25744 25148 gene locus_tag LOCUS_08300 25744 25148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 26015 25939 gene locus_tag LOCUS_t00220 26015 25939 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26845 26099 gene locus_tag LOCUS_08310 26845 26099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 27148 26867 gene locus_tag LOCUS_08320 27148 26867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 28322 27162 gene locus_tag LOCUS_08330 28322 27162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence17 1360 158 gene locus_tag LOCUS_08340 1360 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 3495 1369 gene locus_tag LOCUS_08350 3495 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4375 3590 gene locus_tag LOCUS_08360 4375 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 6754 4391 gene locus_tag LOCUS_08370 6754 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 8570 6780 gene locus_tag LOCUS_08380 8570 6780 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222039.1 protein_id gnl|my_center|LOCUS_08380 9115 8567 gene locus_tag LOCUS_08390 9115 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 9407 9096 gene locus_tag LOCUS_08400 9407 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 11486 9432 gene locus_tag LOCUS_08410 11486 9432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 12633 11503 gene locus_tag LOCUS_08420 12633 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 13102 12737 gene locus_tag LOCUS_08430 13102 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 14136 13159 gene locus_tag LOCUS_08440 14136 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 14648 14148 gene locus_tag LOCUS_08450 14648 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 14828 14667 gene locus_tag LOCUS_08460 14828 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 15686 14907 gene locus_tag LOCUS_08470 15686 14907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 16582 15689 gene locus_tag LOCUS_08480 16582 15689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 17802 16597 gene locus_tag LOCUS_08490 17802 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 18644 17823 gene locus_tag LOCUS_08500 18644 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 19157 18666 gene locus_tag LOCUS_08510 19157 18666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 22010 19161 gene locus_tag LOCUS_08520 22010 19161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 22779 21997 gene locus_tag LOCUS_08530 gene srtB 22779 21997 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086126.1 protein_id gnl|my_center|LOCUS_08530 24590 22794 gene locus_tag LOCUS_08540 24590 22794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 26136 24601 gene locus_tag LOCUS_08550 26136 24601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 26252 26671 gene locus_tag LOCUS_08560 26252 26671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 <28039 26778 gene locus_tag LOCUS_08570 <28039 26778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109529.1:BspA family leucine-rich repeat surface protein >Feature sequence18 914 123 gene locus_tag LOCUS_08580 914 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1390 914 gene locus_tag LOCUS_08590 1390 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1710 1399 gene locus_tag LOCUS_08600 1710 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2540 2061 gene locus_tag LOCUS_08610 2540 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2799 2620 gene locus_tag LOCUS_08620 2799 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3847 2939 gene locus_tag LOCUS_08630 3847 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 4766 3852 gene locus_tag LOCUS_08640 4766 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4871 5512 gene locus_tag LOCUS_08650 4871 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5575 6012 gene locus_tag LOCUS_08660 5575 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 6013 6570 gene locus_tag LOCUS_08670 6013 6570 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948863.1 protein_id gnl|my_center|LOCUS_08670 8228 6609 gene locus_tag LOCUS_08680 8228 6609 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434813.1 protein_id gnl|my_center|LOCUS_08680 9287 8295 gene locus_tag LOCUS_08690 gene galE 9287 8295 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996163.1 protein_id gnl|my_center|LOCUS_08690 9899 9342 gene locus_tag LOCUS_08700 gene efp 9899 9342 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 protein_id gnl|my_center|LOCUS_08700 10086 9922 gene locus_tag LOCUS_08710 gene rpmG 10086 9922 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357626.1 protein_id gnl|my_center|LOCUS_08710 11412 10147 gene locus_tag LOCUS_08720 gene tig 11412 10147 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_08720 12508 11471 gene locus_tag LOCUS_08730 gene queA 12508 11471 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354028.1 protein_id gnl|my_center|LOCUS_08730 13528 12509 gene locus_tag LOCUS_08740 gene ruvB 13528 12509 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 protein_id gnl|my_center|LOCUS_08740 14107 13547 gene locus_tag LOCUS_08750 gene ruvA 14107 13547 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273417.1 protein_id gnl|my_center|LOCUS_08750 14838 14116 gene locus_tag LOCUS_08760 14838 14116 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 protein_id gnl|my_center|LOCUS_08760 15317 14916 gene locus_tag LOCUS_08770 15317 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 17674 15326 gene locus_tag LOCUS_08780 17674 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 17773 18102 gene locus_tag LOCUS_08790 17773 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 19004 18099 gene locus_tag LOCUS_08800 gene dnaI 19004 18099 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400104.1 protein_id gnl|my_center|LOCUS_08800 19893 19129 gene locus_tag LOCUS_08810 19893 19129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 20296 20072 gene locus_tag LOCUS_08820 20296 20072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 21649 20624 gene locus_tag LOCUS_08830 21649 20624 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_08830 23657 21663 gene locus_tag LOCUS_08840 23657 21663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 24285 23611 gene locus_tag LOCUS_08850 24285 23611 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700061.1 protein_id gnl|my_center|LOCUS_08850 25613 24462 gene locus_tag LOCUS_08860 gene ftsW 25613 24462 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967159.1 protein_id gnl|my_center|LOCUS_08860 25746 25907 gene locus_tag LOCUS_08870 25746 25907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 25973 26521 gene locus_tag LOCUS_08880 gene def 25973 26521 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957048.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence19 458 382 gene locus_tag LOCUS_t00230 458 382 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1107 505 gene locus_tag LOCUS_08890 1107 505 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775779.1 protein_id gnl|my_center|LOCUS_08890 2433 1123 gene locus_tag LOCUS_08900 2433 1123 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415039.1 protein_id gnl|my_center|LOCUS_08900 3662 2493 gene locus_tag LOCUS_08910 3662 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 3773 5089 gene locus_tag LOCUS_08920 gene spoVB 3773 5089 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198301.1 protein_id gnl|my_center|LOCUS_08920 5116 5781 gene locus_tag LOCUS_08930 5116 5781 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460434.1 protein_id gnl|my_center|LOCUS_08930 5768 7150 gene locus_tag LOCUS_08940 5768 7150 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_08940 9352 7376 gene locus_tag LOCUS_08950 9352 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 11951 9465 gene locus_tag LOCUS_08960 11951 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12911 11964 gene locus_tag LOCUS_08970 12911 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 13218 12958 gene locus_tag LOCUS_08980 13218 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 13313 13933 gene locus_tag LOCUS_08990 13313 13933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 13994 14890 gene locus_tag LOCUS_09000 13994 14890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 15416 14928 gene locus_tag LOCUS_09010 gene sipZ 15416 14928 CDS product type I signal peptidase SipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723889.1 protein_id gnl|my_center|LOCUS_09010 15814 15449 gene locus_tag LOCUS_09020 gene rplS 15814 15449 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728425.1 protein_id gnl|my_center|LOCUS_09020 16762 16001 gene locus_tag LOCUS_09030 16762 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 18434 16884 gene locus_tag LOCUS_09040 18434 16884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 18779 18495 gene locus_tag LOCUS_09050 18779 18495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 19788 18985 gene locus_tag LOCUS_09060 19788 18985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 19946 19791 gene locus_tag LOCUS_09070 19946 19791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 21405 20113 gene locus_tag LOCUS_09080 21405 20113 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411954.1 protein_id gnl|my_center|LOCUS_09080 22660 21398 gene locus_tag LOCUS_09090 22660 21398 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990111.1 protein_id gnl|my_center|LOCUS_09090 23413 22700 gene locus_tag LOCUS_09100 gene deoD 23413 22700 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183561.1 protein_id gnl|my_center|LOCUS_09100 25334 23505 gene locus_tag LOCUS_09110 25334 23505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence20 3 386 gene locus_tag LOCUS_09120 3 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1016 423 gene locus_tag LOCUS_09130 1016 423 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_09130 1120 2355 gene locus_tag LOCUS_09140 1120 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2503 3771 gene locus_tag LOCUS_09150 2503 3771 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_09150 4302 3844 gene locus_tag LOCUS_09160 4302 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 4406 4855 gene locus_tag LOCUS_09170 4406 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4903 5583 gene locus_tag LOCUS_09180 gene radC 4903 5583 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_09180 5635 6429 gene locus_tag LOCUS_09190 gene mreC 5635 6429 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725674.1 protein_id gnl|my_center|LOCUS_09190 6432 6932 gene locus_tag LOCUS_09200 6432 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 6981 7565 gene locus_tag LOCUS_09210 gene spoIVFA 6981 7565 CDS product stage IV sporulation protein SpoIVFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797471.1 protein_id gnl|my_center|LOCUS_09210 7552 8316 gene locus_tag LOCUS_09220 gene spoIVFB 7552 8316 CDS product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599058.1 protein_id gnl|my_center|LOCUS_09220 9664 11991 gene locus_tag LOCUS_09230 9664 11991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 12168 13856 gene locus_tag LOCUS_09240 12168 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 13907 14683 gene locus_tag LOCUS_09250 gene srtB 13907 14683 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989918.1 protein_id gnl|my_center|LOCUS_09250 15011 14709 gene locus_tag LOCUS_09260 15011 14709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 15091 15792 gene locus_tag LOCUS_09270 gene scpA 15091 15792 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 protein_id gnl|my_center|LOCUS_09270 15794 16360 gene locus_tag LOCUS_09280 gene scpB 15794 16360 CDS product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376225.1 protein_id gnl|my_center|LOCUS_09280 17948 16458 gene locus_tag LOCUS_09290 17948 16458 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207649719.1 protein_id gnl|my_center|LOCUS_09290 18269 18181 gene locus_tag LOCUS_t00240 18269 18181 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18403 18954 gene locus_tag LOCUS_09300 18403 18954 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080830.1 protein_id gnl|my_center|LOCUS_09300 18956 20971 gene locus_tag LOCUS_09310 18956 20971 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676339.1 protein_id gnl|my_center|LOCUS_09310 21050 22462 gene locus_tag LOCUS_09320 21050 22462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 22475 24472 gene locus_tag LOCUS_09330 22475 24472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence21 397 1314 gene locus_tag LOCUS_09340 397 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1429 1683 gene locus_tag LOCUS_09350 1429 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2760 1882 gene locus_tag LOCUS_09360 gene xerC 2760 1882 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 protein_id gnl|my_center|LOCUS_09360 3527 2748 gene locus_tag LOCUS_09370 3527 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4654 3533 gene locus_tag LOCUS_09380 gene tgt 4654 3533 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723534.1 protein_id gnl|my_center|LOCUS_09380 5067 4654 gene locus_tag LOCUS_09390 5067 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5740 5054 gene locus_tag LOCUS_09400 gene trmD 5740 5054 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687330.1 protein_id gnl|my_center|LOCUS_09400 6222 5752 gene locus_tag LOCUS_09410 gene rimM 6222 5752 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 protein_id gnl|my_center|LOCUS_09410 6955 6215 gene locus_tag LOCUS_09420 6955 6215 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_09420 7603 6965 gene locus_tag LOCUS_09430 7603 6965 CDS product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858500.1 protein_id gnl|my_center|LOCUS_09430 8315 8674 gene locus_tag LOCUS_09440 8315 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 8667 9008 gene locus_tag LOCUS_09450 8667 9008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 8992 10071 gene locus_tag LOCUS_09460 8992 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 10061 10366 gene locus_tag LOCUS_09470 10061 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 12622 11054 gene locus_tag LOCUS_09480 12622 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 13397 12690 gene locus_tag LOCUS_09490 13397 12690 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762140.1 protein_id gnl|my_center|LOCUS_09490 13795 13394 gene locus_tag LOCUS_09500 13795 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 14717 13788 gene locus_tag LOCUS_09510 14717 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 14832 16094 gene locus_tag LOCUS_09520 14832 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 16786 16412 gene locus_tag LOCUS_09530 16786 16412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 18997 16862 gene locus_tag LOCUS_09540 18997 16862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 20750 18990 gene locus_tag LOCUS_09550 20750 18990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence22 20 1906 gene locus_tag LOCUS_09560 20 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1970 4081 gene locus_tag LOCUS_09570 gene clpB 1970 4081 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_09570 4159 4341 gene locus_tag LOCUS_09580 4159 4341 CDS product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621751.1 protein_id gnl|my_center|LOCUS_09580 5575 4316 gene locus_tag LOCUS_09590 5575 4316 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438530.1 protein_id gnl|my_center|LOCUS_09590 5663 7315 gene locus_tag LOCUS_09600 gene murJ 5663 7315 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229224.1 protein_id gnl|my_center|LOCUS_09600 7315 8523 gene locus_tag LOCUS_09610 gene fmhC 7315 8523 CDS product FemA/FemB family glycyltransferase FmhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672869.1 protein_id gnl|my_center|LOCUS_09610 9279 8530 gene locus_tag LOCUS_09620 9279 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 10299 9364 gene locus_tag LOCUS_09630 10299 9364 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861205.1 protein_id gnl|my_center|LOCUS_09630 11446 10289 gene locus_tag LOCUS_09640 11446 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 11578 12708 gene locus_tag LOCUS_09650 11578 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 12750 15176 gene locus_tag LOCUS_09660 12750 15176 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688713.1 protein_id gnl|my_center|LOCUS_09660 15366 16118 gene locus_tag LOCUS_09670 15366 16118 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_09670 16119 16904 gene locus_tag LOCUS_09680 16119 16904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 16895 17692 gene locus_tag LOCUS_09690 16895 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 17694 18440 gene locus_tag LOCUS_09700 gene truA 17694 18440 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199167.1 protein_id gnl|my_center|LOCUS_09700 18537 18965 gene locus_tag LOCUS_09710 gene rplM 18537 18965 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_09710 18979 19398 gene locus_tag LOCUS_09720 gene rpsI 18979 19398 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_09720 19455 20120 gene locus_tag LOCUS_09730 19455 20120 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence23 1712 216 gene locus_tag LOCUS_09740 gene gpmI 1712 216 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_09740 3001 1727 gene locus_tag LOCUS_09750 3001 1727 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_09750 3880 3104 gene locus_tag LOCUS_09760 gene spo0A 3880 3104 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 protein_id gnl|my_center|LOCUS_09760 4660 3995 gene locus_tag LOCUS_09770 4660 3995 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855528.1 protein_id gnl|my_center|LOCUS_09770 5910 4657 gene locus_tag LOCUS_09780 5910 4657 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675474.1 protein_id gnl|my_center|LOCUS_09780 6914 5901 gene locus_tag LOCUS_09790 6914 5901 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564081.1 protein_id gnl|my_center|LOCUS_09790 7363 6911 gene locus_tag LOCUS_09800 7363 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 8553 7366 gene locus_tag LOCUS_09810 8553 7366 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902043.1 protein_id gnl|my_center|LOCUS_09810 9631 8630 gene locus_tag LOCUS_09820 gene gap 9631 8630 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016560.1 protein_id gnl|my_center|LOCUS_09820 9816 9649 gene locus_tag LOCUS_09830 9816 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 10430 9828 gene locus_tag LOCUS_09840 10430 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459317.1 protein_id gnl|my_center|LOCUS_09840 11262 10516 gene locus_tag LOCUS_09850 11262 10516 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947933.1 protein_id gnl|my_center|LOCUS_09850 14954 11322 gene locus_tag LOCUS_09860 gene rpoC 14954 11322 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567936.1 protein_id gnl|my_center|LOCUS_09860 <17353 14938 gene locus_tag LOCUS_09870 <17353 14938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009966326.1:DNA-directed RNA polymerase subunit beta >Feature sequence24 2506 545 gene locus_tag LOCUS_09880 2506 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 3035 2601 gene locus_tag LOCUS_09890 3035 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4067 3135 gene locus_tag LOCUS_09900 gene rhuM 4067 3135 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_09900 4641 4513 gene locus_tag LOCUS_09910 4641 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4921 4787 gene locus_tag LOCUS_09920 4921 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 6067 5015 gene locus_tag LOCUS_09930 6067 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 7027 6089 gene locus_tag LOCUS_09940 7027 6089 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_09940 8937 7030 gene locus_tag LOCUS_09950 8937 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 11404 9122 gene locus_tag LOCUS_09960 gene lon 11404 9122 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183303.1 protein_id gnl|my_center|LOCUS_09960 13095 11536 gene locus_tag LOCUS_09970 13095 11536 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966358.1 protein_id gnl|my_center|LOCUS_09970 14257 13088 gene locus_tag LOCUS_09980 14257 13088 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_09980 14889 14320 gene locus_tag LOCUS_09990 14889 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 15059 16966 gene locus_tag LOCUS_10000 15059 16966 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence25 270 545 gene locus_tag LOCUS_10010 270 545 CDS product post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723532.1 protein_id gnl|my_center|LOCUS_10010 556 2778 gene locus_tag LOCUS_10020 gene secDF 556 2778 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723531.1 protein_id gnl|my_center|LOCUS_10020 2805 4952 gene locus_tag LOCUS_10030 gene relA 2805 4952 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262810.1 protein_id gnl|my_center|LOCUS_10030 4953 5387 gene locus_tag LOCUS_10040 gene dtd 4953 5387 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691400.1 protein_id gnl|my_center|LOCUS_10040 5392 6453 gene locus_tag LOCUS_10050 5392 6453 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440854.1 protein_id gnl|my_center|LOCUS_10050 6450 7373 gene locus_tag LOCUS_10060 6450 7373 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973334.1 protein_id gnl|my_center|LOCUS_10060 7370 7855 gene locus_tag LOCUS_10070 7370 7855 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 protein_id gnl|my_center|LOCUS_10070 7880 8290 gene locus_tag LOCUS_10080 7880 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 8283 8792 gene locus_tag LOCUS_10090 8283 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 8803 9894 gene locus_tag LOCUS_10100 gene hemW 8803 9894 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352330.1 protein_id gnl|my_center|LOCUS_10100 10066 10932 gene locus_tag LOCUS_10110 10066 10932 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_10110 10932 11582 gene locus_tag LOCUS_10120 10932 11582 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_10120 11660 12571 gene locus_tag LOCUS_10130 11660 12571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 13054 13314 gene locus_tag LOCUS_10140 13054 13314 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_10140 13413 16226 gene locus_tag LOCUS_10150 13413 16226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence26 2053 239 gene locus_tag LOCUS_10160 gene typA 2053 239 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722695.1 protein_id gnl|my_center|LOCUS_10160 3055 2177 gene locus_tag LOCUS_10170 gene tsf 3055 2177 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018581.1 protein_id gnl|my_center|LOCUS_10170 4006 3089 gene locus_tag LOCUS_10180 4006 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4625 4098 gene locus_tag LOCUS_10190 4625 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4834 4649 gene locus_tag LOCUS_10200 4834 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 5393 4848 gene locus_tag LOCUS_10210 gene infC 5393 4848 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 protein_id gnl|my_center|LOCUS_10210 6109 5570 gene locus_tag LOCUS_10220 6109 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 6833 6102 gene locus_tag LOCUS_10230 6833 6102 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965071.1 protein_id gnl|my_center|LOCUS_10230 8206 6833 gene locus_tag LOCUS_10240 8206 6833 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_10240 8751 8233 gene locus_tag LOCUS_10250 8751 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 9717 8761 gene locus_tag LOCUS_10260 9717 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 10449 9721 gene locus_tag LOCUS_10270 gene recO 10449 9721 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730435.1 protein_id gnl|my_center|LOCUS_10270 10552 10427 gene locus_tag LOCUS_10280 10552 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 11479 10592 gene locus_tag LOCUS_10290 gene era 11479 10592 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721968.1 protein_id gnl|my_center|LOCUS_10290 11869 11480 gene locus_tag LOCUS_10300 11869 11480 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398824.1 protein_id gnl|my_center|LOCUS_10300 12299 11847 gene locus_tag LOCUS_10310 gene ybeY 12299 11847 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054692.1 protein_id gnl|my_center|LOCUS_10310 12998 12396 gene locus_tag LOCUS_10320 12998 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 14175 13009 gene locus_tag LOCUS_10330 gene yqfD 14175 13009 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230033.1 protein_id gnl|my_center|LOCUS_10330 14414 14175 gene locus_tag LOCUS_10340 14414 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 14682 14464 gene locus_tag LOCUS_10350 14682 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 15048 14875 gene locus_tag LOCUS_10360 15048 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 15194 15048 gene locus_tag LOCUS_10370 15194 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 15559 15194 gene locus_tag LOCUS_10380 15559 15194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence27 177 1040 gene locus_tag LOCUS_10390 gene srtB 177 1040 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086126.1 protein_id gnl|my_center|LOCUS_10390 1147 2511 gene locus_tag LOCUS_10400 1147 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2583 2951 gene locus_tag LOCUS_10410 gene rbfA 2583 2951 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719600.1 protein_id gnl|my_center|LOCUS_10410 2926 4302 gene locus_tag LOCUS_10420 2926 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4359 5150 gene locus_tag LOCUS_10430 gene spoIIGA 4359 5150 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986857.1 protein_id gnl|my_center|LOCUS_10430 5143 5835 gene locus_tag LOCUS_10440 gene sigE 5143 5835 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_10440 6044 6634 gene locus_tag LOCUS_10450 6044 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 6600 6992 gene locus_tag LOCUS_10460 6600 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7248 6994 gene locus_tag LOCUS_10470 7248 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7346 8770 gene locus_tag LOCUS_10480 7346 8770 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_10480 8780 9550 gene locus_tag LOCUS_10490 8780 9550 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583389.1 protein_id gnl|my_center|LOCUS_10490 9603 10256 gene locus_tag LOCUS_10500 9603 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 10261 11541 gene locus_tag LOCUS_10510 gene mtaB 10261 11541 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 protein_id gnl|my_center|LOCUS_10510 11529 13700 gene locus_tag LOCUS_10520 11529 13700 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398511.1 protein_id gnl|my_center|LOCUS_10520 13740 13892 gene locus_tag LOCUS_10530 13740 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence28 554 1411 gene locus_tag LOCUS_10540 554 1411 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831939.1 protein_id gnl|my_center|LOCUS_10540 2704 1412 gene locus_tag LOCUS_10550 2704 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2845 4656 gene locus_tag LOCUS_10560 2845 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4714 5223 gene locus_tag LOCUS_10570 4714 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5275 6108 gene locus_tag LOCUS_10580 gene cdaA 5275 6108 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_10580 6092 7450 gene locus_tag LOCUS_10590 6092 7450 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287822.1 protein_id gnl|my_center|LOCUS_10590 7665 7471 gene locus_tag LOCUS_10600 7665 7471 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_10600 7777 8775 gene locus_tag LOCUS_10610 7777 8775 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 protein_id gnl|my_center|LOCUS_10610 9364 8837 gene locus_tag LOCUS_10620 9364 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 9506 10882 gene locus_tag LOCUS_10630 gene asnS 9506 10882 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110460183.1 protein_id gnl|my_center|LOCUS_10630 10892 11383 gene locus_tag LOCUS_10640 10892 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 11469 12713 gene locus_tag LOCUS_10650 gene ctpB 11469 12713 CDS product carboxy-terminal processing protease CtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228041.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence29 <1 1100 gene locus_tag LOCUS_10660 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109529.1:BspA family leucine-rich repeat surface protein 1839 1093 gene locus_tag LOCUS_10670 gene zupT 1839 1093 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811500.1 protein_id gnl|my_center|LOCUS_10670 1938 2702 gene locus_tag LOCUS_10680 1938 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2855 3505 gene locus_tag LOCUS_10690 2855 3505 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_10690 4370 3474 gene locus_tag LOCUS_10700 4370 3474 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_10700 4476 5774 gene locus_tag LOCUS_10710 gene murC 4476 5774 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565897.1 protein_id gnl|my_center|LOCUS_10710 5892 8168 gene locus_tag LOCUS_10720 5892 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 8161 11259 gene locus_tag LOCUS_10730 gene addA 8161 11259 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989936.1 protein_id gnl|my_center|LOCUS_10730 11404 11823 gene locus_tag LOCUS_10740 11404 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence30 1250 237 gene locus_tag LOCUS_10750 gene ddcP 1250 237 CDS product protease DdcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245451.1 protein_id gnl|my_center|LOCUS_10750 1563 2210 gene locus_tag LOCUS_10760 1563 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 4352 2214 gene locus_tag LOCUS_10770 4352 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4891 4349 gene locus_tag LOCUS_10780 4891 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4977 6314 gene locus_tag LOCUS_10790 4977 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8581 7070 gene locus_tag LOCUS_10800 8581 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 10310 8658 gene locus_tag LOCUS_10810 10310 8658 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823075.1 protein_id gnl|my_center|LOCUS_10810 10764 10303 gene locus_tag LOCUS_10820 10764 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 11429 10761 gene locus_tag LOCUS_10830 gene rnc 11429 10761 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990670.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence31 101 274 gene locus_tag LOCUS_10840 101 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 466 2031 gene locus_tag LOCUS_10850 466 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2057 3343 gene locus_tag LOCUS_10860 gene serS 2057 3343 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_10860 3516 4211 gene locus_tag LOCUS_10870 3516 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4335 4511 gene locus_tag LOCUS_10880 4335 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4578 5999 gene locus_tag LOCUS_10890 gene miaB 4578 5999 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439565.1 protein_id gnl|my_center|LOCUS_10890 5977 6327 gene locus_tag LOCUS_10900 5977 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 7110 6328 gene locus_tag LOCUS_10910 7110 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 8038 7484 gene locus_tag LOCUS_10920 gene cotE 8038 7484 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288800.1 protein_id gnl|my_center|LOCUS_10920 8160 9974 gene locus_tag LOCUS_10930 8160 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence32 192 515 gene locus_tag LOCUS_10940 192 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 525 1412 gene locus_tag LOCUS_10950 525 1412 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_10950 1461 4049 gene locus_tag LOCUS_10960 gene mgtA 1461 4049 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388982.1 protein_id gnl|my_center|LOCUS_10960 4060 4791 gene locus_tag LOCUS_10970 4060 4791 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_10970 5074 5625 gene locus_tag LOCUS_10980 5074 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 6442 5642 gene locus_tag LOCUS_10990 6442 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 6528 8867 gene locus_tag LOCUS_11000 6528 8867 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_11000 9043 8953 gene locus_tag LOCUS_t00250 9043 8953 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence33 1844 603 gene locus_tag LOCUS_11010 1844 603 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_11010 2524 1850 gene locus_tag LOCUS_11020 2524 1850 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651982.1 protein_id gnl|my_center|LOCUS_11020 2651 3394 gene locus_tag LOCUS_11030 2651 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 5025 3406 gene locus_tag LOCUS_11040 5025 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5255 5659 gene locus_tag LOCUS_11050 gene exsY 5255 5659 CDS product exosporium assembly protein ExsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277735.1 protein_id gnl|my_center|LOCUS_11050 5677 6090 gene locus_tag LOCUS_11060 5677 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 6428 6102 gene locus_tag LOCUS_11070 6428 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6517 7668 gene locus_tag LOCUS_11080 6517 7668 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 protein_id gnl|my_center|LOCUS_11080 8684 7674 gene locus_tag LOCUS_11090 8684 7674 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 protein_id gnl|my_center|LOCUS_11090 8794 8869 gene locus_tag LOCUS_t00260 8794 8869 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence34 567 373 gene locus_tag LOCUS_11100 567 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 969 847 gene locus_tag LOCUS_11110 969 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1156 1620 gene locus_tag LOCUS_11120 1156 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 2180 1698 gene locus_tag LOCUS_11130 2180 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5380 2240 gene locus_tag LOCUS_11140 5380 2240 CDS product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 protein_id gnl|my_center|LOCUS_11140 6035 5406 gene locus_tag LOCUS_11150 6035 5406 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 protein_id gnl|my_center|LOCUS_11150 7013 6372 gene locus_tag LOCUS_11160 7013 6372 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373626.1 protein_id gnl|my_center|LOCUS_11160 7603 7067 gene locus_tag LOCUS_11170 gene rsmD 7603 7067 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_11170 7856 7590 gene locus_tag LOCUS_11180 7856 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence35 338 1099 gene locus_tag LOCUS_11190 gene estV 338 1099 CDS product lipase EstV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129409.1 protein_id gnl|my_center|LOCUS_11190 2904 1105 gene locus_tag LOCUS_11200 gene lepA 2904 1105 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706535.1 protein_id gnl|my_center|LOCUS_11200 3336 3013 gene locus_tag LOCUS_11210 3336 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4297 3329 gene locus_tag LOCUS_11220 4297 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5375 4353 gene locus_tag LOCUS_11230 gene gpr 5375 4353 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229991.1 protein_id gnl|my_center|LOCUS_11230 <6371 5630 gene locus_tag LOCUS_11240 <6371 5630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109529.1:BspA family leucine-rich repeat surface protein >Feature sequence36 304 675 gene locus_tag LOCUS_11250 304 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 723 1523 gene locus_tag LOCUS_11260 723 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5001 1585 gene locus_tag LOCUS_11270 gene nifJ 5001 1585 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016958.1 protein_id gnl|my_center|LOCUS_11270 <5899 5265 gene locus_tag LOCUS_11280 <5899 5265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109529.1:BspA family leucine-rich repeat surface protein >Feature sequence37 592 134 gene locus_tag LOCUS_11290 592 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1157 603 gene locus_tag LOCUS_11300 1157 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1271 2176 gene locus_tag LOCUS_11310 1271 2176 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198966.1 protein_id gnl|my_center|LOCUS_11310 2173 3237 gene locus_tag LOCUS_11320 2173 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809841.1 protein_id gnl|my_center|LOCUS_11320 3240 4187 gene locus_tag LOCUS_11330 3240 4187 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809839.1 protein_id gnl|my_center|LOCUS_11330 4609 4319 gene locus_tag LOCUS_11340 4609 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 <5564 4730 gene locus_tag LOCUS_11350 <5564 4730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109529.1:BspA family leucine-rich repeat surface protein >Feature sequence38 445 1074 gene locus_tag LOCUS_11360 gene ywaC 445 1074 CDS product GTP pyrophosphokinase YwaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244564.1 protein_id gnl|my_center|LOCUS_11360 1498 1112 gene locus_tag LOCUS_11370 1498 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1651 1726 gene locus_tag LOCUS_t00270 1651 1726 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1785 2261 gene locus_tag LOCUS_11380 gene ybaK 1785 2261 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_11380 2321 2827 gene locus_tag LOCUS_11390 2321 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11390 2863 3237 gene locus_tag LOCUS_11400 2863 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11400 3331 3627 gene locus_tag LOCUS_11410 3331 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11410 >Feature sequence39 204 764 gene locus_tag LOCUS_11420 gene rfbC 204 764 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_11420 764 1627 gene locus_tag LOCUS_11430 gene rfbD 764 1627 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721501.1 protein_id gnl|my_center|LOCUS_11430 1905 1630 gene locus_tag LOCUS_11440 gene rpsT 1905 1630 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence40 140 559 gene locus_tag LOCUS_11450 140 559 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060880.1 protein_id gnl|my_center|LOCUS_11450 564 1454 gene locus_tag LOCUS_11460 564 1454 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence41