>Feature sequence001 1191 64 gene locus_tag LOCUS_00010 1191 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2406 1210 gene locus_tag LOCUS_00020 2406 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2751 2824 gene locus_tag LOCUS_t00010 2751 2824 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2828 2904 gene locus_tag LOCUS_t00020 2828 2904 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2938 3014 gene locus_tag LOCUS_t00030 2938 3014 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4547 3129 gene locus_tag LOCUS_00030 4547 3129 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_00030 5955 4594 gene locus_tag LOCUS_00040 5955 4594 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_00040 6080 7435 gene locus_tag LOCUS_00050 6080 7435 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714165.1 protein_id gnl|my_center|LOCUS_00050 7501 8964 gene locus_tag LOCUS_00060 7501 8964 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993859.1 protein_id gnl|my_center|LOCUS_00060 9091 9696 gene locus_tag LOCUS_00070 9091 9696 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_00070 10338 9703 gene locus_tag LOCUS_00080 10338 9703 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249474.1 protein_id gnl|my_center|LOCUS_00080 11869 10427 gene locus_tag LOCUS_00090 11869 10427 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_00090 13331 12594 gene locus_tag LOCUS_00100 13331 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13651 13391 gene locus_tag LOCUS_00110 13651 13391 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644609.1 protein_id gnl|my_center|LOCUS_00110 14401 13667 gene locus_tag LOCUS_00120 14401 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15162 14437 gene locus_tag LOCUS_00130 15162 14437 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583598.1 protein_id gnl|my_center|LOCUS_00130 15994 15191 gene locus_tag LOCUS_00140 gene pgeF 15994 15191 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227882.1 protein_id gnl|my_center|LOCUS_00140 17152 16004 gene locus_tag LOCUS_00150 gene ftsZ 17152 16004 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_00150 19024 17636 gene locus_tag LOCUS_00160 19024 17636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20495 19074 gene locus_tag LOCUS_00170 gene murC 20495 19074 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939773.1 protein_id gnl|my_center|LOCUS_00170 21660 20536 gene locus_tag LOCUS_00180 gene murG 21660 20536 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403336.1 protein_id gnl|my_center|LOCUS_00180 23209 21701 gene locus_tag LOCUS_00190 23209 21701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24612 23209 gene locus_tag LOCUS_00200 gene murD 24612 23209 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_00200 25650 24625 gene locus_tag LOCUS_00210 gene mraY 25650 24625 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_00210 27095 25650 gene locus_tag LOCUS_00220 27095 25650 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_00220 28960 27113 gene locus_tag LOCUS_00230 28960 27113 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_00230 29496 28993 gene locus_tag LOCUS_00240 29496 28993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30595 29618 gene locus_tag LOCUS_00250 gene rsmH 30595 29618 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_00250 31044 30616 gene locus_tag LOCUS_00260 gene mraZ 31044 30616 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814584.1 protein_id gnl|my_center|LOCUS_00260 32207 31281 gene locus_tag LOCUS_00270 gene xerD 32207 31281 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_00270 33861 32215 gene locus_tag LOCUS_00280 33861 32215 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_00280 35604 33967 gene locus_tag LOCUS_00290 gene recN 35604 33967 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_00290 36459 35605 gene locus_tag LOCUS_00300 36459 35605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 37339 36542 gene locus_tag LOCUS_00310 37339 36542 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_00310 37554 37345 gene locus_tag LOCUS_00320 37554 37345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 38201 37554 gene locus_tag LOCUS_00330 38201 37554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38566 38207 gene locus_tag LOCUS_00340 38566 38207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 39345 38776 gene locus_tag LOCUS_00350 gene efp 39345 38776 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_00350 40592 39456 gene locus_tag LOCUS_00360 40592 39456 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042854.1 protein_id gnl|my_center|LOCUS_00360 41835 40630 gene locus_tag LOCUS_00370 41835 40630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 42383 41832 gene locus_tag LOCUS_00380 gene aroK 42383 41832 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 protein_id gnl|my_center|LOCUS_00380 42949 42476 gene locus_tag LOCUS_00390 42949 42476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43449 42949 gene locus_tag LOCUS_00400 43449 42949 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460298.1 protein_id gnl|my_center|LOCUS_00400 44706 43456 gene locus_tag LOCUS_00410 gene mltG 44706 43456 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_00410 45318 44899 gene locus_tag LOCUS_00420 45318 44899 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286668.1 protein_id gnl|my_center|LOCUS_00420 46335 45391 gene locus_tag LOCUS_00430 46335 45391 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700025.1 protein_id gnl|my_center|LOCUS_00430 47169 46354 gene locus_tag LOCUS_00440 47169 46354 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254158.1 protein_id gnl|my_center|LOCUS_00440 48171 47185 gene locus_tag LOCUS_00450 48171 47185 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702191.1 protein_id gnl|my_center|LOCUS_00450 49088 48660 gene locus_tag LOCUS_00460 gene ruvX 49088 48660 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_00460 51736 49085 gene locus_tag LOCUS_00470 gene alaS 51736 49085 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703239.1 protein_id gnl|my_center|LOCUS_00470 53097 51751 gene locus_tag LOCUS_00480 53097 51751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 53946 53122 gene locus_tag LOCUS_00490 53946 53122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 54310 53933 gene locus_tag LOCUS_00500 54310 53933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 54868 54323 gene locus_tag LOCUS_00510 54868 54323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 56304 54940 gene locus_tag LOCUS_00520 56304 54940 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_00520 57571 56309 gene locus_tag LOCUS_00530 57571 56309 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_00530 59484 57631 gene locus_tag LOCUS_00540 59484 57631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60049 59537 gene locus_tag LOCUS_00550 60049 59537 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_00550 60830 60039 gene locus_tag LOCUS_00560 60830 60039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 61371 60979 gene locus_tag LOCUS_00570 61371 60979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 62433 61381 gene locus_tag LOCUS_00580 gene ruvB 62433 61381 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_00580 63073 62435 gene locus_tag LOCUS_00590 gene ruvA 63073 62435 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223336.1 protein_id gnl|my_center|LOCUS_00590 63705 63070 gene locus_tag LOCUS_00600 63705 63070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 65626 63794 gene locus_tag LOCUS_00610 65626 63794 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390069.1 protein_id gnl|my_center|LOCUS_00610 66093 65713 gene locus_tag LOCUS_00620 66093 65713 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392799.1 protein_id gnl|my_center|LOCUS_00620 66349 67818 gene locus_tag LOCUS_00630 66349 67818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 71772 67873 gene locus_tag LOCUS_00640 gene dnaE 71772 67873 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_00640 75374 71850 gene locus_tag LOCUS_00650 75374 71850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 78634 75371 gene locus_tag LOCUS_00660 78634 75371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 79001 78699 gene locus_tag LOCUS_00670 79001 78699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 79161 79517 gene locus_tag LOCUS_00680 79161 79517 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053231.1 protein_id gnl|my_center|LOCUS_00680 80687 79407 gene locus_tag LOCUS_00690 80687 79407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 81956 80796 gene locus_tag LOCUS_00700 gene fucO 81956 80796 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783906.1 protein_id gnl|my_center|LOCUS_00700 82081 83667 gene locus_tag LOCUS_00710 82081 83667 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114145401.1 protein_id gnl|my_center|LOCUS_00710 84579 83860 gene locus_tag LOCUS_00720 gene dapB 84579 83860 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698231.1 protein_id gnl|my_center|LOCUS_00720 85462 84572 gene locus_tag LOCUS_00730 gene dapA 85462 84572 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286879.1 protein_id gnl|my_center|LOCUS_00730 85935 86489 gene locus_tag LOCUS_00740 85935 86489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 86470 87756 gene locus_tag LOCUS_00750 86470 87756 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_00750 89607 88078 gene locus_tag LOCUS_00760 gene gatB 89607 88078 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_00760 91100 89604 gene locus_tag LOCUS_00770 gene gatA 91100 89604 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141527.1 protein_id gnl|my_center|LOCUS_00770 91417 91100 gene locus_tag LOCUS_00780 gene gatC 91417 91100 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170162.1 protein_id gnl|my_center|LOCUS_00780 91828 92604 gene locus_tag LOCUS_00790 gene sufC 91828 92604 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_00790 92609 94024 gene locus_tag LOCUS_00800 gene sufB 92609 94024 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_00800 94024 95124 gene locus_tag LOCUS_00810 94024 95124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 95121 96377 gene locus_tag LOCUS_00820 95121 96377 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_00820 96364 96828 gene locus_tag LOCUS_00830 96364 96828 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_00830 96831 97334 gene locus_tag LOCUS_00840 96831 97334 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_00840 98893 97583 gene locus_tag LOCUS_00850 98893 97583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 99990 99118 gene locus_tag LOCUS_00860 gene fba 99990 99118 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_00860 >Feature sequence002 366 290 gene locus_tag LOCUS_t00040 366 290 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1684 449 gene locus_tag LOCUS_00870 1684 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 2032 1859 gene locus_tag LOCUS_00880 2032 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 2069 2389 gene locus_tag LOCUS_00890 2069 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00890 2400 3827 gene locus_tag LOCUS_00900 2400 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 3836 4531 gene locus_tag LOCUS_00910 3836 4531 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461432.1 protein_id gnl|my_center|LOCUS_00910 4629 5285 gene locus_tag LOCUS_00920 4629 5285 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254296.1 protein_id gnl|my_center|LOCUS_00920 5698 5339 gene locus_tag LOCUS_00930 5698 5339 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925454.1 protein_id gnl|my_center|LOCUS_00930 6963 5701 gene locus_tag LOCUS_00940 6963 5701 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_00940 8438 6963 gene locus_tag LOCUS_00950 8438 6963 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_00950 10380 8506 gene locus_tag LOCUS_00960 10380 8506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_00960 12103 10373 gene locus_tag LOCUS_00970 12103 10373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 protein_id gnl|my_center|LOCUS_00970 13941 12121 gene locus_tag LOCUS_00980 13941 12121 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_00980 15192 13999 gene locus_tag LOCUS_00990 gene coaBC 15192 13999 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_00990 15912 15193 gene locus_tag LOCUS_01000 15912 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 17100 15937 gene locus_tag LOCUS_01010 gene nifS 17100 15937 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_01010 17792 17115 gene locus_tag LOCUS_01020 gene rpe 17792 17115 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480039.1 protein_id gnl|my_center|LOCUS_01020 18814 17813 gene locus_tag LOCUS_01030 18814 17813 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104352.1 protein_id gnl|my_center|LOCUS_01030 19488 18811 gene locus_tag LOCUS_01040 gene plsY 19488 18811 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_01040 20816 19485 gene locus_tag LOCUS_01050 gene der 20816 19485 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_01050 21708 20854 gene locus_tag LOCUS_01060 gene ispH 21708 20854 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_01060 23223 21712 gene locus_tag LOCUS_01070 23223 21712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 23891 23220 gene locus_tag LOCUS_01080 23891 23220 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919228.1 protein_id gnl|my_center|LOCUS_01080 24694 23897 gene locus_tag LOCUS_01090 24694 23897 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_01090 25383 24691 gene locus_tag LOCUS_01100 25383 24691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 26192 25383 gene locus_tag LOCUS_01110 26192 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 26865 26197 gene locus_tag LOCUS_01120 26865 26197 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_01120 27173 26895 gene locus_tag LOCUS_01130 27173 26895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 29164 27170 gene locus_tag LOCUS_01140 29164 27170 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_01140 29556 29176 gene locus_tag LOCUS_01150 29556 29176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 30461 29676 gene locus_tag LOCUS_01160 30461 29676 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203150.1 protein_id gnl|my_center|LOCUS_01160 30597 30522 gene locus_tag LOCUS_t00050 30597 30522 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 30718 30644 gene locus_tag LOCUS_t00060 30718 30644 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30909 30834 gene locus_tag LOCUS_t00070 30909 30834 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31135 31515 gene locus_tag LOCUS_01170 31135 31515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 33340 31625 gene locus_tag LOCUS_01180 33340 31625 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880188.1 protein_id gnl|my_center|LOCUS_01180 34572 33484 gene locus_tag LOCUS_01190 gene ispG 34572 33484 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_01190 35954 34581 gene locus_tag LOCUS_01200 gene rseP 35954 34581 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906325.1 protein_id gnl|my_center|LOCUS_01200 37152 35956 gene locus_tag LOCUS_01210 37152 35956 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_01210 38105 37155 gene locus_tag LOCUS_01220 38105 37155 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259407.1 protein_id gnl|my_center|LOCUS_01220 38887 38102 gene locus_tag LOCUS_01230 38887 38102 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_01230 39433 38888 gene locus_tag LOCUS_01240 gene frr 39433 38888 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_01240 40157 39435 gene locus_tag LOCUS_01250 gene pyrH 40157 39435 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_01250 41188 40316 gene locus_tag LOCUS_01260 gene tsf 41188 40316 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_01260 41983 41231 gene locus_tag LOCUS_01270 gene rpsB 41983 41231 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_01270 43157 42228 gene locus_tag LOCUS_01280 gene xerC 43157 42228 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_01280 44482 43154 gene locus_tag LOCUS_01290 gene trmFO 44482 43154 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_01290 45381 44479 gene locus_tag LOCUS_01300 gene dprA 45381 44479 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114641.1 protein_id gnl|my_center|LOCUS_01300 45896 45378 gene locus_tag LOCUS_01310 45896 45378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 46826 46047 gene locus_tag LOCUS_01320 gene rnhB 46826 46047 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174721.1 protein_id gnl|my_center|LOCUS_01320 47232 46888 gene locus_tag LOCUS_01330 gene rplS 47232 46888 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_01330 50184 47425 gene locus_tag LOCUS_01340 gene ppdK 50184 47425 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_01340 50761 50381 gene locus_tag LOCUS_01350 50761 50381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 52949 50853 gene locus_tag LOCUS_01360 gene glyS 52949 50853 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260903.1 protein_id gnl|my_center|LOCUS_01360 53855 52950 gene locus_tag LOCUS_01370 gene glyQ 53855 52950 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_01370 54462 53887 gene locus_tag LOCUS_01380 gene lepB 54462 53887 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811571.1 protein_id gnl|my_center|LOCUS_01380 55198 54443 gene locus_tag LOCUS_01390 gene trmD 55198 54443 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_01390 55719 55198 gene locus_tag LOCUS_01400 gene rimM 55719 55198 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293716.1 protein_id gnl|my_center|LOCUS_01400 56019 55723 gene locus_tag LOCUS_01410 56019 55723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 56332 56024 gene locus_tag LOCUS_01420 56332 56024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 56598 57278 gene locus_tag LOCUS_01430 56598 57278 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238594.1 protein_id gnl|my_center|LOCUS_01430 57284 58525 gene locus_tag LOCUS_01440 57284 58525 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_01440 58527 59816 gene locus_tag LOCUS_01450 gene dinB 58527 59816 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_01450 60199 59813 gene locus_tag LOCUS_01460 gene rsfS 60199 59813 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818118.1 protein_id gnl|my_center|LOCUS_01460 60837 60196 gene locus_tag LOCUS_01470 gene yqeK 60837 60196 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356300.1 protein_id gnl|my_center|LOCUS_01470 61501 60827 gene locus_tag LOCUS_01480 gene nadD 61501 60827 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390005.1 protein_id gnl|my_center|LOCUS_01480 62637 61522 gene locus_tag LOCUS_01490 gene proB 62637 61522 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_01490 64036 62639 gene locus_tag LOCUS_01500 gene obgE 64036 62639 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_01500 64424 64167 gene locus_tag LOCUS_01510 gene rpmA 64424 64167 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060213.1 protein_id gnl|my_center|LOCUS_01510 64805 64464 gene locus_tag LOCUS_01520 gene rplU 64805 64464 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067132.1 protein_id gnl|my_center|LOCUS_01520 66022 65024 gene locus_tag LOCUS_01530 66022 65024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 67282 66050 gene locus_tag LOCUS_01540 gene rodA 67282 66050 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460900.1 protein_id gnl|my_center|LOCUS_01540 69331 67301 gene locus_tag LOCUS_01550 gene mrdA 69331 67301 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_01550 69930 69334 gene locus_tag LOCUS_01560 69930 69334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 71051 69948 gene locus_tag LOCUS_01570 71051 69948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 72111 71068 gene locus_tag LOCUS_01580 72111 71068 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_01580 73462 72161 gene locus_tag LOCUS_01590 73462 72161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 74041 73496 gene locus_tag LOCUS_01600 74041 73496 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_01600 75114 74152 gene locus_tag LOCUS_01610 75114 74152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 77859 75184 gene locus_tag LOCUS_01620 gene acnA 77859 75184 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391258.1 protein_id gnl|my_center|LOCUS_01620 80236 77816 gene locus_tag LOCUS_01630 80236 77816 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence003 1844 63 gene locus_tag LOCUS_01640 1844 63 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_01640 3801 2020 gene locus_tag LOCUS_01650 3801 2020 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_01650 6192 4174 gene locus_tag LOCUS_01660 6192 4174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_01660 7236 6208 gene locus_tag LOCUS_01670 7236 6208 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812440.1 protein_id gnl|my_center|LOCUS_01670 8239 7247 gene locus_tag LOCUS_01680 8239 7247 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812438.1 protein_id gnl|my_center|LOCUS_01680 8753 8505 gene locus_tag LOCUS_01690 gene secG 8753 8505 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_01690 9644 8880 gene locus_tag LOCUS_01700 gene tpiA 9644 8880 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990539.1 protein_id gnl|my_center|LOCUS_01700 10836 9637 gene locus_tag LOCUS_01710 10836 9637 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_01710 11959 10934 gene locus_tag LOCUS_01720 gene gap 11959 10934 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_01720 13215 12247 gene locus_tag LOCUS_01730 gene whiA 13215 12247 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_01730 14153 13218 gene locus_tag LOCUS_01740 gene rapZ 14153 13218 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462179.1 protein_id gnl|my_center|LOCUS_01740 15256 14174 gene locus_tag LOCUS_01750 15256 14174 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 protein_id gnl|my_center|LOCUS_01750 16069 15380 gene locus_tag LOCUS_01760 16069 15380 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113937.1 protein_id gnl|my_center|LOCUS_01760 17046 16081 gene locus_tag LOCUS_01770 17046 16081 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804460.1 protein_id gnl|my_center|LOCUS_01770 17995 17072 gene locus_tag LOCUS_01780 17995 17072 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993834.1 protein_id gnl|my_center|LOCUS_01780 18909 18034 gene locus_tag LOCUS_01790 18909 18034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 19865 18909 gene locus_tag LOCUS_01800 19865 18909 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573446.1 protein_id gnl|my_center|LOCUS_01800 20710 19871 gene locus_tag LOCUS_01810 20710 19871 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116524.1 protein_id gnl|my_center|LOCUS_01810 22764 20713 gene locus_tag LOCUS_01820 22764 20713 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993832.1 protein_id gnl|my_center|LOCUS_01820 23722 22766 gene locus_tag LOCUS_01830 23722 22766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137618.1 protein_id gnl|my_center|LOCUS_01830 25461 23842 gene locus_tag LOCUS_01840 25461 23842 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116517.1 protein_id gnl|my_center|LOCUS_01840 27760 25769 gene locus_tag LOCUS_01850 gene uvrC 27760 25769 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_01850 28935 27763 gene locus_tag LOCUS_01860 28935 27763 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389677.1 protein_id gnl|my_center|LOCUS_01860 29384 28998 gene locus_tag LOCUS_01870 29384 28998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 30161 29394 gene locus_tag LOCUS_01880 gene hisF 30161 29394 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501998.1 protein_id gnl|my_center|LOCUS_01880 30907 30164 gene locus_tag LOCUS_01890 gene hisA 30907 30164 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461460.1 protein_id gnl|my_center|LOCUS_01890 31572 30904 gene locus_tag LOCUS_01900 gene hisH 31572 30904 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_01900 32172 31585 gene locus_tag LOCUS_01910 gene hisB 32172 31585 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067468.1 protein_id gnl|my_center|LOCUS_01910 33267 32173 gene locus_tag LOCUS_01920 gene hisC 33267 32173 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927011.1 protein_id gnl|my_center|LOCUS_01920 34661 33270 gene locus_tag LOCUS_01930 gene hisD 34661 33270 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880475.1 protein_id gnl|my_center|LOCUS_01930 36325 34661 gene locus_tag LOCUS_01940 36325 34661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 38401 36758 gene locus_tag LOCUS_01950 gene murJ 38401 36758 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806275.1 protein_id gnl|my_center|LOCUS_01950 38901 38398 gene locus_tag LOCUS_01960 gene ybaK 38901 38398 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107235.1 protein_id gnl|my_center|LOCUS_01960 41797 38888 gene locus_tag LOCUS_01970 gene uvrA 41797 38888 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_01970 42622 41843 gene locus_tag LOCUS_01980 42622 41843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 44016 42619 gene locus_tag LOCUS_01990 44016 42619 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964280.1 protein_id gnl|my_center|LOCUS_01990 44654 44196 gene locus_tag LOCUS_02000 44654 44196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 44792 45655 gene locus_tag LOCUS_02010 44792 45655 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393156.1 protein_id gnl|my_center|LOCUS_02010 45666 46889 gene locus_tag LOCUS_02020 45666 46889 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_02020 46905 48566 gene locus_tag LOCUS_02030 46905 48566 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620446.1 protein_id gnl|my_center|LOCUS_02030 50890 48635 gene locus_tag LOCUS_02040 gene uvrB 50890 48635 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_02040 51543 50941 gene locus_tag LOCUS_02050 51543 50941 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393337.1 protein_id gnl|my_center|LOCUS_02050 52151 51540 gene locus_tag LOCUS_02060 gene coaE 52151 51540 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888527.1 protein_id gnl|my_center|LOCUS_02060 52565 52161 gene locus_tag LOCUS_02070 52565 52161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643513.1 protein_id gnl|my_center|LOCUS_02070 53744 52680 gene locus_tag LOCUS_02080 53744 52680 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836873.1 protein_id gnl|my_center|LOCUS_02080 55011 53746 gene locus_tag LOCUS_02090 gene pepT 55011 53746 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_02090 55263 56888 gene locus_tag LOCUS_02100 55263 56888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 57106 58728 gene locus_tag LOCUS_02110 57106 58728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 59026 60444 gene locus_tag LOCUS_02120 59026 60444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 60441 61172 gene locus_tag LOCUS_02130 60441 61172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_02130 61169 62392 gene locus_tag LOCUS_02140 61169 62392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_02140 63537 62470 gene locus_tag LOCUS_02150 63537 62470 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459112.1 protein_id gnl|my_center|LOCUS_02150 64615 63539 gene locus_tag LOCUS_02160 64615 63539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_02160 65599 64628 gene locus_tag LOCUS_02170 65599 64628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583498.1 protein_id gnl|my_center|LOCUS_02170 66534 65599 gene locus_tag LOCUS_02180 66534 65599 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583497.1 protein_id gnl|my_center|LOCUS_02180 68382 66736 gene locus_tag LOCUS_02190 68382 66736 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537708.1 protein_id gnl|my_center|LOCUS_02190 69920 68733 gene locus_tag LOCUS_02200 69920 68733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 70147 69917 gene locus_tag LOCUS_02210 70147 69917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 70372 71154 gene locus_tag LOCUS_02220 70372 71154 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812980.1 protein_id gnl|my_center|LOCUS_02220 71522 71151 gene locus_tag LOCUS_02230 71522 71151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 72214 71672 gene locus_tag LOCUS_02240 gene rnhA 72214 71672 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095689.1 protein_id gnl|my_center|LOCUS_02240 74917 72218 gene locus_tag LOCUS_02250 gene polA 74917 72218 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_02250 >Feature sequence004 401 78 gene locus_tag LOCUS_02260 401 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 1924 398 gene locus_tag LOCUS_02270 1924 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 3541 1931 gene locus_tag LOCUS_02280 3541 1931 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_02280 4744 3548 gene locus_tag LOCUS_02290 4744 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 4883 5344 gene locus_tag LOCUS_02300 4883 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 5354 5839 gene locus_tag LOCUS_02310 5354 5839 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_02310 6719 5856 gene locus_tag LOCUS_02320 6719 5856 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858506.1 protein_id gnl|my_center|LOCUS_02320 6894 8147 gene locus_tag LOCUS_02330 gene larA 6894 8147 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_02330 8374 8781 gene locus_tag LOCUS_02340 8374 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 8868 11456 gene locus_tag LOCUS_02350 8868 11456 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067921.1 protein_id gnl|my_center|LOCUS_02350 12975 11557 gene locus_tag LOCUS_02360 12975 11557 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166879.1 protein_id gnl|my_center|LOCUS_02360 14207 13191 gene locus_tag LOCUS_02370 14207 13191 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157570.1 protein_id gnl|my_center|LOCUS_02370 14340 15770 gene locus_tag LOCUS_02380 gene sacA 14340 15770 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 protein_id gnl|my_center|LOCUS_02380 17527 15848 gene locus_tag LOCUS_02390 gene ettA 17527 15848 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993639.1 protein_id gnl|my_center|LOCUS_02390 17705 18715 gene locus_tag LOCUS_02400 gene ansA 17705 18715 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 protein_id gnl|my_center|LOCUS_02400 18939 20615 gene locus_tag LOCUS_02410 18939 20615 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_02410 20758 21609 gene locus_tag LOCUS_02420 20758 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 21809 23293 gene locus_tag LOCUS_02430 gene nagE 21809 23293 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815380.1 protein_id gnl|my_center|LOCUS_02430 23290 24207 gene locus_tag LOCUS_02440 23290 24207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868990.1 protein_id gnl|my_center|LOCUS_02440 26300 24318 gene locus_tag LOCUS_02450 26300 24318 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_02450 26852 27184 gene locus_tag LOCUS_02460 26852 27184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 29138 27234 gene locus_tag LOCUS_02470 29138 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 29645 29169 gene locus_tag LOCUS_02480 29645 29169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 29808 31022 gene locus_tag LOCUS_02490 29808 31022 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_02490 31951 31148 gene locus_tag LOCUS_02500 31951 31148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 32328 31948 gene locus_tag LOCUS_02510 32328 31948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 32555 33067 gene locus_tag LOCUS_02520 32555 33067 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_02520 33114 33548 gene locus_tag LOCUS_02530 33114 33548 CDS product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721468.1 protein_id gnl|my_center|LOCUS_02530 34180 35547 gene locus_tag LOCUS_02540 34180 35547 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389943.1 protein_id gnl|my_center|LOCUS_02540 35807 37636 gene locus_tag LOCUS_02550 35807 37636 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250525.1 protein_id gnl|my_center|LOCUS_02550 39175 37874 gene locus_tag LOCUS_02560 39175 37874 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_02560 40552 39383 gene locus_tag LOCUS_02570 gene nagA 40552 39383 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289803.1 protein_id gnl|my_center|LOCUS_02570 41768 40593 gene locus_tag LOCUS_02580 41768 40593 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357242.1 protein_id gnl|my_center|LOCUS_02580 42522 41794 gene locus_tag LOCUS_02590 42522 41794 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301131.1 protein_id gnl|my_center|LOCUS_02590 43781 42681 gene locus_tag LOCUS_02600 43781 42681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 44574 43771 gene locus_tag LOCUS_02610 gene agaW 44574 43771 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406209.1 protein_id gnl|my_center|LOCUS_02610 45178 44696 gene locus_tag LOCUS_02620 gene agaV 45178 44696 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_02620 45672 45235 gene locus_tag LOCUS_02630 45672 45235 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361048.1 protein_id gnl|my_center|LOCUS_02630 46067 47002 gene locus_tag LOCUS_02640 gene pfkB 46067 47002 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_02640 47086 47937 gene locus_tag LOCUS_02650 47086 47937 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_02650 48145 49890 gene locus_tag LOCUS_02660 48145 49890 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073558.1 protein_id gnl|my_center|LOCUS_02660 50436 49966 gene locus_tag LOCUS_02670 50436 49966 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_02670 50794 52083 gene locus_tag LOCUS_02680 gene eno 50794 52083 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727923.1 protein_id gnl|my_center|LOCUS_02680 53099 52188 gene locus_tag LOCUS_02690 53099 52188 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_02690 53203 53718 gene locus_tag LOCUS_02700 53203 53718 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_02700 54683 53802 gene locus_tag LOCUS_02710 54683 53802 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_02710 55247 54873 gene locus_tag LOCUS_02720 55247 54873 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459318.1 protein_id gnl|my_center|LOCUS_02720 55645 55244 gene locus_tag LOCUS_02730 55645 55244 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682353.1 protein_id gnl|my_center|LOCUS_02730 57354 55693 gene locus_tag LOCUS_02740 gene cydC 57354 55693 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_02740 59074 57341 gene locus_tag LOCUS_02750 59074 57341 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_02750 59354 59488 gene locus_tag LOCUS_02760 59354 59488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 60528 59581 gene locus_tag LOCUS_02770 60528 59581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 61517 60729 gene locus_tag LOCUS_02780 gene proC 61517 60729 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363628.1 protein_id gnl|my_center|LOCUS_02780 62745 61543 gene locus_tag LOCUS_02790 62745 61543 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 protein_id gnl|my_center|LOCUS_02790 63010 64830 gene locus_tag LOCUS_02800 gene glgB 63010 64830 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020147.1 protein_id gnl|my_center|LOCUS_02800 64938 65558 gene locus_tag LOCUS_02810 64938 65558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 67079 65724 gene locus_tag LOCUS_02820 67079 65724 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_02820 67246 68067 gene locus_tag LOCUS_02830 gene arsB 67246 68067 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482643.1 protein_id gnl|my_center|LOCUS_02830 >Feature sequence005 147 1775 gene locus_tag LOCUS_02840 147 1775 CDS product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837259.1 protein_id gnl|my_center|LOCUS_02840 1905 2813 gene locus_tag LOCUS_02850 1905 2813 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774996.1 protein_id gnl|my_center|LOCUS_02850 4215 2896 gene locus_tag LOCUS_02860 4215 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 5785 4295 gene locus_tag LOCUS_02870 gene glpK 5785 4295 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080610.1 protein_id gnl|my_center|LOCUS_02870 6735 5788 gene locus_tag LOCUS_02880 6735 5788 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 protein_id gnl|my_center|LOCUS_02880 7561 6728 gene locus_tag LOCUS_02890 7561 6728 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989643.1 protein_id gnl|my_center|LOCUS_02890 8979 7564 gene locus_tag LOCUS_02900 8979 7564 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989642.1 protein_id gnl|my_center|LOCUS_02900 9153 10196 gene locus_tag LOCUS_02910 gene degA 9153 10196 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_02910 10411 11859 gene locus_tag LOCUS_02920 10411 11859 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644020.1 protein_id gnl|my_center|LOCUS_02920 11955 13649 gene locus_tag LOCUS_02930 11955 13649 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922209.1 protein_id gnl|my_center|LOCUS_02930 13651 14931 gene locus_tag LOCUS_02940 13651 14931 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989646.1 protein_id gnl|my_center|LOCUS_02940 15120 16130 gene locus_tag LOCUS_02950 15120 16130 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 protein_id gnl|my_center|LOCUS_02950 16259 18763 gene locus_tag LOCUS_02960 16259 18763 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817358.1 protein_id gnl|my_center|LOCUS_02960 19863 18868 gene locus_tag LOCUS_02970 19863 18868 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296705.1 protein_id gnl|my_center|LOCUS_02970 19996 21372 gene locus_tag LOCUS_02980 19996 21372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 21456 23678 gene locus_tag LOCUS_02990 21456 23678 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 protein_id gnl|my_center|LOCUS_02990 23692 25146 gene locus_tag LOCUS_03000 23692 25146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 25159 26766 gene locus_tag LOCUS_03010 25159 26766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 26888 29566 gene locus_tag LOCUS_03020 26888 29566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 29699 31537 gene locus_tag LOCUS_03030 29699 31537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 31798 32361 gene locus_tag LOCUS_03040 gene ahpC 31798 32361 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_03040 32442 34085 gene locus_tag LOCUS_03050 32442 34085 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810050.1 protein_id gnl|my_center|LOCUS_03050 34412 34945 gene locus_tag LOCUS_03060 34412 34945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03060 34942 35313 gene locus_tag LOCUS_03070 34942 35313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 35310 35456 gene locus_tag LOCUS_03080 35310 35456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 35681 37075 gene locus_tag LOCUS_03090 35681 37075 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_03090 38180 37317 gene locus_tag LOCUS_03100 38180 37317 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_03100 38659 38336 gene locus_tag LOCUS_03110 38659 38336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 38844 39239 gene locus_tag LOCUS_03120 38844 39239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 39251 39757 gene locus_tag LOCUS_03130 39251 39757 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_03130 40720 40028 gene locus_tag LOCUS_03140 40720 40028 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_03140 42517 40823 gene locus_tag LOCUS_03150 gene treC 42517 40823 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_03150 44588 42576 gene locus_tag LOCUS_03160 gene treP 44588 42576 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262352.1 protein_id gnl|my_center|LOCUS_03160 44851 45573 gene locus_tag LOCUS_03170 44851 45573 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_03170 45706 46161 gene locus_tag LOCUS_03180 45706 46161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 47086 46232 gene locus_tag LOCUS_03190 47086 46232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03190 47504 47316 gene locus_tag LOCUS_03200 47504 47316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 48545 47580 gene locus_tag LOCUS_03210 48545 47580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 48974 48651 gene locus_tag LOCUS_03220 48974 48651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 49184 50317 gene locus_tag LOCUS_03230 49184 50317 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_03230 50770 50321 gene locus_tag LOCUS_03240 50770 50321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 51678 50932 gene locus_tag LOCUS_03250 51678 50932 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399515.1 protein_id gnl|my_center|LOCUS_03250 53470 51671 gene locus_tag LOCUS_03260 53470 51671 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574971.1 protein_id gnl|my_center|LOCUS_03260 54137 53586 gene locus_tag LOCUS_03270 54137 53586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115564.1 protein_id gnl|my_center|LOCUS_03270 54775 54209 gene locus_tag LOCUS_03280 54775 54209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115564.1 protein_id gnl|my_center|LOCUS_03280 55245 55607 gene locus_tag LOCUS_03290 55245 55607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 56983 55601 gene locus_tag LOCUS_03300 56983 55601 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_03300 58819 56996 gene locus_tag LOCUS_03310 58819 56996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 59680 59237 gene locus_tag LOCUS_03320 59680 59237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 59681 61141 gene locus_tag LOCUS_03330 59681 61141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 61134 62189 gene locus_tag LOCUS_03340 gene ypdE 61134 62189 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891992.1 protein_id gnl|my_center|LOCUS_03340 62230 62571 gene locus_tag LOCUS_03350 62230 62571 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421329.1 protein_id gnl|my_center|LOCUS_03350 62614 62955 gene locus_tag LOCUS_03360 62614 62955 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421322.1 protein_id gnl|my_center|LOCUS_03360 62959 64311 gene locus_tag LOCUS_03370 62959 64311 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861972.1 protein_id gnl|my_center|LOCUS_03370 64421 65506 gene locus_tag LOCUS_03380 64421 65506 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861971.1 protein_id gnl|my_center|LOCUS_03380 65509 66711 gene locus_tag LOCUS_03390 65509 66711 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861787.1 protein_id gnl|my_center|LOCUS_03390 66698 67303 gene locus_tag LOCUS_03400 66698 67303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence006 1438 86 gene locus_tag LOCUS_03410 1438 86 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966696.1 protein_id gnl|my_center|LOCUS_03410 1634 3202 gene locus_tag LOCUS_03420 1634 3202 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099686814.1 protein_id gnl|my_center|LOCUS_03420 4907 3333 gene locus_tag LOCUS_03430 4907 3333 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966695.1 protein_id gnl|my_center|LOCUS_03430 5085 5852 gene locus_tag LOCUS_03440 5085 5852 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966694.1 protein_id gnl|my_center|LOCUS_03440 5849 6337 gene locus_tag LOCUS_03450 5849 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 6398 6571 gene locus_tag LOCUS_03460 6398 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 6604 6768 gene locus_tag LOCUS_03470 6604 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7965 7036 gene locus_tag LOCUS_03480 7965 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8801 9526 gene locus_tag LOCUS_03490 8801 9526 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357197.1 protein_id gnl|my_center|LOCUS_03490 9681 10109 gene locus_tag LOCUS_03500 9681 10109 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_03500 12624 10189 gene locus_tag LOCUS_03510 12624 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 12824 13426 gene locus_tag LOCUS_03520 12824 13426 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879642.1 protein_id gnl|my_center|LOCUS_03520 13594 14778 gene locus_tag LOCUS_03530 13594 14778 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_03530 14802 15254 gene locus_tag LOCUS_03540 gene pth2 14802 15254 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978149.1 protein_id gnl|my_center|LOCUS_03540 16744 15335 gene locus_tag LOCUS_03550 gene asnS 16744 15335 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966534.1 protein_id gnl|my_center|LOCUS_03550 17636 16926 gene locus_tag LOCUS_03560 17636 16926 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_03560 17989 17684 gene locus_tag LOCUS_03570 17989 17684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 18172 19542 gene locus_tag LOCUS_03580 gene fumC 18172 19542 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857888.1 protein_id gnl|my_center|LOCUS_03580 19547 20695 gene locus_tag LOCUS_03590 19547 20695 CDS product NAD-dependent malic enzyme 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199012.1 protein_id gnl|my_center|LOCUS_03590 21749 20709 gene locus_tag LOCUS_03600 21749 20709 CDS product IS1595-like element ISSsu9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775606.1 protein_id gnl|my_center|LOCUS_03600 22707 21931 gene locus_tag LOCUS_03610 22707 21931 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_03610 23862 22753 gene locus_tag LOCUS_03620 23862 22753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462288.1 protein_id gnl|my_center|LOCUS_03620 24794 25771 gene locus_tag LOCUS_03630 24794 25771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 25771 26283 gene locus_tag LOCUS_03640 25771 26283 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_03640 27053 26280 gene locus_tag LOCUS_03650 27053 26280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542058.1 protein_id gnl|my_center|LOCUS_03650 27222 27929 gene locus_tag LOCUS_03660 27222 27929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 27926 28249 gene locus_tag LOCUS_03670 27926 28249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 29358 28225 gene locus_tag LOCUS_03680 29358 28225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 30001 29489 gene locus_tag LOCUS_03690 30001 29489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 30102 30899 gene locus_tag LOCUS_03700 30102 30899 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_03700 32377 30989 gene locus_tag LOCUS_03710 32377 30989 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_03710 33828 32941 gene locus_tag LOCUS_03720 33828 32941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 35060 33825 gene locus_tag LOCUS_03730 35060 33825 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_03730 35762 35103 gene locus_tag LOCUS_03740 35762 35103 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102108.1 protein_id gnl|my_center|LOCUS_03740 37903 35762 gene locus_tag LOCUS_03750 37903 35762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 39550 37997 gene locus_tag LOCUS_03760 39550 37997 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077963.1 protein_id gnl|my_center|LOCUS_03760 42109 40460 gene locus_tag LOCUS_03770 42109 40460 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963677.1 protein_id gnl|my_center|LOCUS_03770 43607 42123 gene locus_tag LOCUS_03780 43607 42123 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286002.1 protein_id gnl|my_center|LOCUS_03780 45140 43617 gene locus_tag LOCUS_03790 45140 43617 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705328.1 protein_id gnl|my_center|LOCUS_03790 46585 45167 gene locus_tag LOCUS_03800 gene uxaC 46585 45167 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_03800 48059 47079 gene locus_tag LOCUS_03810 48059 47079 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_03810 49589 48168 gene locus_tag LOCUS_03820 49589 48168 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 protein_id gnl|my_center|LOCUS_03820 49991 52159 gene locus_tag LOCUS_03830 49991 52159 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296832.1 protein_id gnl|my_center|LOCUS_03830 52163 52744 gene locus_tag LOCUS_03840 gene ysxC 52163 52744 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869116.1 protein_id gnl|my_center|LOCUS_03840 53232 52897 gene locus_tag LOCUS_03850 53232 52897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 54508 53213 gene locus_tag LOCUS_03860 54508 53213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 54471 54650 gene locus_tag LOCUS_03870 54471 54650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 54952 55224 gene locus_tag LOCUS_03880 54952 55224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 56211 55243 gene locus_tag LOCUS_03890 56211 55243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 57466 56216 gene locus_tag LOCUS_03900 57466 56216 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068614.1 protein_id gnl|my_center|LOCUS_03900 58905 57580 gene locus_tag LOCUS_03910 58905 57580 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390379.1 protein_id gnl|my_center|LOCUS_03910 61140 59011 gene locus_tag LOCUS_03920 61140 59011 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068724.1 protein_id gnl|my_center|LOCUS_03920 61437 61309 gene locus_tag LOCUS_03930 61437 61309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 61867 62718 gene locus_tag LOCUS_03940 61867 62718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 64196 62805 gene locus_tag LOCUS_03950 64196 62805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 65271 64201 gene locus_tag LOCUS_03960 65271 64201 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_03960 65394 65657 gene locus_tag LOCUS_03970 65394 65657 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_03970 65660 65845 gene locus_tag LOCUS_03980 65660 65845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 66206 66559 gene locus_tag LOCUS_03990 66206 66559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 >Feature sequence007 386 120 gene locus_tag LOCUS_04000 gene rpsT 386 120 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_04000 618 2426 gene locus_tag LOCUS_04010 gene lepA 618 2426 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288355.1 protein_id gnl|my_center|LOCUS_04010 2423 3478 gene locus_tag LOCUS_04020 gene dusB 2423 3478 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_04020 3471 4721 gene locus_tag LOCUS_04030 gene hemW 3471 4721 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087641.1 protein_id gnl|my_center|LOCUS_04030 4846 5979 gene locus_tag LOCUS_04040 4846 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 6104 7276 gene locus_tag LOCUS_04050 gene dnaJ 6104 7276 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_04050 7277 8542 gene locus_tag LOCUS_04060 gene mtaB 7277 8542 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123590.1 protein_id gnl|my_center|LOCUS_04060 8610 9575 gene locus_tag LOCUS_04070 8610 9575 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_04070 9565 10068 gene locus_tag LOCUS_04080 gene ybeY 9565 10068 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816440.1 protein_id gnl|my_center|LOCUS_04080 10065 10439 gene locus_tag LOCUS_04090 10065 10439 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398824.1 protein_id gnl|my_center|LOCUS_04090 10452 11450 gene locus_tag LOCUS_04100 gene era 10452 11450 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_04100 11453 12196 gene locus_tag LOCUS_04110 gene recO 11453 12196 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_04110 12377 12655 gene locus_tag LOCUS_04120 gene rpsO 12377 12655 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084034.1 protein_id gnl|my_center|LOCUS_04120 12790 15036 gene locus_tag LOCUS_04130 gene pnp 12790 15036 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_04130 15299 16960 gene locus_tag LOCUS_04140 15299 16960 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460381.1 protein_id gnl|my_center|LOCUS_04140 16962 19553 gene locus_tag LOCUS_04150 16962 19553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 19556 20971 gene locus_tag LOCUS_04160 19556 20971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 20981 21478 gene locus_tag LOCUS_04170 20981 21478 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_04170 21444 22817 gene locus_tag LOCUS_04180 gene rimO 21444 22817 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_04180 22819 23412 gene locus_tag LOCUS_04190 gene pgsA 22819 23412 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_04190 23416 23943 gene locus_tag LOCUS_04200 23416 23943 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870383.1 protein_id gnl|my_center|LOCUS_04200 24133 25230 gene locus_tag LOCUS_04210 gene recA 24133 25230 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_04210 25236 25913 gene locus_tag LOCUS_04220 25236 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 26162 27745 gene locus_tag LOCUS_04230 gene rny 26162 27745 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_04230 27749 28837 gene locus_tag LOCUS_04240 27749 28837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 28939 29256 gene locus_tag LOCUS_04250 28939 29256 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362540.1 protein_id gnl|my_center|LOCUS_04250 29258 30625 gene locus_tag LOCUS_04260 gene miaB 29258 30625 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_04260 30622 31545 gene locus_tag LOCUS_04270 gene miaA 30622 31545 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_04270 31545 32837 gene locus_tag LOCUS_04280 gene hflX 31545 32837 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090287.1 protein_id gnl|my_center|LOCUS_04280 33612 32863 gene locus_tag LOCUS_04290 33612 32863 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878031.1 protein_id gnl|my_center|LOCUS_04290 34267 33617 gene locus_tag LOCUS_04300 gene lexA 34267 33617 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_04300 34455 34868 gene locus_tag LOCUS_04310 34455 34868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 34988 35437 gene locus_tag LOCUS_04320 gene nrdR 34988 35437 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699785.1 protein_id gnl|my_center|LOCUS_04320 35434 35880 gene locus_tag LOCUS_04330 gene dut 35434 35880 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_04330 35977 37290 gene locus_tag LOCUS_04340 35977 37290 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047961.1 protein_id gnl|my_center|LOCUS_04340 37489 38436 gene locus_tag LOCUS_04350 gene trxB 37489 38436 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_04350 40405 38780 gene locus_tag LOCUS_04360 40405 38780 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_04360 41026 40493 gene locus_tag LOCUS_04370 gene apt 41026 40493 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350746.1 protein_id gnl|my_center|LOCUS_04370 41839 41054 gene locus_tag LOCUS_04380 41839 41054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 42275 41844 gene locus_tag LOCUS_04390 42275 41844 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856253.1 protein_id gnl|my_center|LOCUS_04390 42700 42320 gene locus_tag LOCUS_04400 42700 42320 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_04400 43587 42724 gene locus_tag LOCUS_04410 43587 42724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 44855 43572 gene locus_tag LOCUS_04420 44855 43572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 45636 44905 gene locus_tag LOCUS_04430 45636 44905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 45799 46740 gene locus_tag LOCUS_04440 45799 46740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 48315 46828 gene locus_tag LOCUS_04450 48315 46828 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_04450 48542 49525 gene locus_tag LOCUS_04460 48542 49525 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964851.1 protein_id gnl|my_center|LOCUS_04460 50430 49609 gene locus_tag LOCUS_04470 50430 49609 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786401.1 protein_id gnl|my_center|LOCUS_04470 51398 50448 gene locus_tag LOCUS_04480 51398 50448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 51877 51533 gene locus_tag LOCUS_04490 51877 51533 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 protein_id gnl|my_center|LOCUS_04490 54841 51941 gene locus_tag LOCUS_04500 54841 51941 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680008.1 protein_id gnl|my_center|LOCUS_04500 55516 54845 gene locus_tag LOCUS_04510 gene hypB 55516 54845 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_04510 56186 55533 gene locus_tag LOCUS_04520 56186 55533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 56857 56183 gene locus_tag LOCUS_04530 56857 56183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 57659 57105 gene locus_tag LOCUS_04540 57659 57105 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_04540 58120 57656 gene locus_tag LOCUS_04550 58120 57656 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_04550 58962 58216 gene locus_tag LOCUS_04560 58962 58216 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_04560 59188 58964 gene locus_tag LOCUS_04570 59188 58964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 60260 59244 gene locus_tag LOCUS_04580 60260 59244 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814924.1 protein_id gnl|my_center|LOCUS_04580 60382 61467 gene locus_tag LOCUS_04590 60382 61467 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_04590 61508 62716 gene locus_tag LOCUS_04600 gene galK 61508 62716 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_04600 62707 64287 gene locus_tag LOCUS_04610 gene galT 62707 64287 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836862.1 protein_id gnl|my_center|LOCUS_04610 64931 64452 gene locus_tag LOCUS_04620 64931 64452 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047822.1 protein_id gnl|my_center|LOCUS_04620 65733 65449 gene locus_tag LOCUS_04630 65733 65449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence008 150 422 gene locus_tag LOCUS_04640 150 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 566 907 gene locus_tag LOCUS_04650 566 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 1678 1238 gene locus_tag LOCUS_04660 1678 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 1820 1954 gene locus_tag LOCUS_04670 1820 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 2648 2782 gene locus_tag LOCUS_04680 2648 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 4358 2868 gene locus_tag LOCUS_04690 4358 2868 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775649.1 protein_id gnl|my_center|LOCUS_04690 6701 4383 gene locus_tag LOCUS_04700 6701 4383 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 protein_id gnl|my_center|LOCUS_04700 7921 6899 gene locus_tag LOCUS_04710 7921 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 8304 8501 gene locus_tag LOCUS_04720 8304 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 10064 8823 gene locus_tag LOCUS_04730 10064 8823 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813597.1 protein_id gnl|my_center|LOCUS_04730 10533 11846 gene locus_tag LOCUS_04740 10533 11846 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_04740 12314 11940 gene locus_tag LOCUS_04750 12314 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 12612 12418 gene locus_tag LOCUS_04760 12612 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 13090 12656 gene locus_tag LOCUS_04770 13090 12656 CDS product DUF5684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028234.1 protein_id gnl|my_center|LOCUS_04770 13654 15159 gene locus_tag LOCUS_04780 13654 15159 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_04780 15159 15752 gene locus_tag LOCUS_04790 15159 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04790 15823 16845 gene locus_tag LOCUS_04800 gene trpD 15823 16845 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_04800 16890 17699 gene locus_tag LOCUS_04810 gene trpC 16890 17699 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_04810 17696 18304 gene locus_tag LOCUS_04820 17696 18304 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262055.1 protein_id gnl|my_center|LOCUS_04820 18336 19535 gene locus_tag LOCUS_04830 gene trpB 18336 19535 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_04830 19528 20322 gene locus_tag LOCUS_04840 gene trpA 19528 20322 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_04840 20659 20378 gene locus_tag LOCUS_04850 20659 20378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 21740 20745 gene locus_tag LOCUS_04860 21740 20745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 22198 22866 gene locus_tag LOCUS_04870 22198 22866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 22875 23438 gene locus_tag LOCUS_04880 22875 23438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 23569 23856 gene locus_tag LOCUS_04890 23569 23856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 24310 27447 gene locus_tag LOCUS_04900 24310 27447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 28609 27557 gene locus_tag LOCUS_04910 28609 27557 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202979.1 protein_id gnl|my_center|LOCUS_04910 31191 28642 gene locus_tag LOCUS_04920 31191 28642 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788368.1 protein_id gnl|my_center|LOCUS_04920 31831 31517 gene locus_tag LOCUS_04930 31831 31517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04930 31897 32049 gene locus_tag LOCUS_04940 31897 32049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 32104 32382 gene locus_tag LOCUS_04950 32104 32382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 32470 33033 gene locus_tag LOCUS_04960 32470 33033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 33803 33282 gene locus_tag LOCUS_04970 33803 33282 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_04970 34051 34425 gene locus_tag LOCUS_04980 34051 34425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 34335 34553 gene locus_tag LOCUS_04990 34335 34553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 35268 34906 gene locus_tag LOCUS_05000 35268 34906 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964792.1 protein_id gnl|my_center|LOCUS_05000 35399 35713 gene locus_tag LOCUS_05010 35399 35713 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_05010 35793 37199 gene locus_tag LOCUS_05020 35793 37199 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094396572.1 protein_id gnl|my_center|LOCUS_05020 37237 38556 gene locus_tag LOCUS_05030 37237 38556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 38765 40894 gene locus_tag LOCUS_05040 gene brxL 38765 40894 CDS product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 protein_id gnl|my_center|LOCUS_05040 40950 41948 gene locus_tag LOCUS_05050 40950 41948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 42361 42137 gene locus_tag LOCUS_05060 42361 42137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 42476 43420 gene locus_tag LOCUS_05070 42476 43420 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430615.1 protein_id gnl|my_center|LOCUS_05070 44380 45471 gene locus_tag LOCUS_05080 44380 45471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 45662 45468 gene locus_tag LOCUS_05090 45662 45468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 45900 45724 gene locus_tag LOCUS_05100 45900 45724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 46070 46657 gene locus_tag LOCUS_05110 46070 46657 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140078.1 protein_id gnl|my_center|LOCUS_05110 46841 47749 gene locus_tag LOCUS_05120 46841 47749 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_05120 47900 48475 gene locus_tag LOCUS_05130 47900 48475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 49786 48479 gene locus_tag LOCUS_05140 49786 48479 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_05140 51188 49902 gene locus_tag LOCUS_05150 51188 49902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 52027 51143 gene locus_tag LOCUS_05160 52027 51143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 52317 52042 gene locus_tag LOCUS_05170 52317 52042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 52809 52327 gene locus_tag LOCUS_05180 52809 52327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 53280 52831 gene locus_tag LOCUS_05190 53280 52831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 53511 54260 gene locus_tag LOCUS_05200 53511 54260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 54253 54975 gene locus_tag LOCUS_05210 54253 54975 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230777.1 protein_id gnl|my_center|LOCUS_05210 55168 55575 gene locus_tag LOCUS_05220 55168 55575 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144028.1 protein_id gnl|my_center|LOCUS_05220 55582 56118 gene locus_tag LOCUS_05230 55582 56118 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_05230 56208 56807 gene locus_tag LOCUS_05240 56208 56807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 57016 56804 gene locus_tag LOCUS_05250 57016 56804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 57315 58754 gene locus_tag LOCUS_05260 57315 58754 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002375743.1 protein_id gnl|my_center|LOCUS_05260 58771 59610 gene locus_tag LOCUS_05270 58771 59610 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603534.1 protein_id gnl|my_center|LOCUS_05270 60223 59681 gene locus_tag LOCUS_05280 60223 59681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 60479 61276 gene locus_tag LOCUS_05290 60479 61276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 61680 61387 gene locus_tag LOCUS_05300 61680 61387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 62135 62665 gene locus_tag LOCUS_05310 62135 62665 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764887.1 protein_id gnl|my_center|LOCUS_05310 63311 62736 gene locus_tag LOCUS_05320 63311 62736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 64206 63433 gene locus_tag LOCUS_05330 64206 63433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence009 <1 1382 gene locus_tag LOCUS_05340 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051223.1:amidohydrolase family protein 1372 1665 gene locus_tag LOCUS_05350 1372 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05350 2620 1835 gene locus_tag LOCUS_05360 2620 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 2877 4544 gene locus_tag LOCUS_05370 2877 4544 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_05370 4656 5291 gene locus_tag LOCUS_05380 4656 5291 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583068.1 protein_id gnl|my_center|LOCUS_05380 5276 6133 gene locus_tag LOCUS_05390 5276 6133 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_05390 6130 6795 gene locus_tag LOCUS_05400 gene folE 6130 6795 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429416.1 protein_id gnl|my_center|LOCUS_05400 6792 8807 gene locus_tag LOCUS_05410 6792 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 8804 9658 gene locus_tag LOCUS_05420 8804 9658 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021379.1 protein_id gnl|my_center|LOCUS_05420 9655 10959 gene locus_tag LOCUS_05430 9655 10959 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_05430 10997 12418 gene locus_tag LOCUS_05440 10997 12418 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804613.1 protein_id gnl|my_center|LOCUS_05440 12633 13064 gene locus_tag LOCUS_05450 12633 13064 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 protein_id gnl|my_center|LOCUS_05450 14320 13484 gene locus_tag LOCUS_05460 14320 13484 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_05460 15097 14426 gene locus_tag LOCUS_05470 15097 14426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_05470 15836 15090 gene locus_tag LOCUS_05480 15836 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 16435 18201 gene locus_tag LOCUS_05490 gene thrS 16435 18201 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_05490 20433 18298 gene locus_tag LOCUS_05500 20433 18298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 20668 21465 gene locus_tag LOCUS_05510 20668 21465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 21992 21492 gene locus_tag LOCUS_05520 21992 21492 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797943.1 protein_id gnl|my_center|LOCUS_05520 22849 22001 gene locus_tag LOCUS_05530 22849 22001 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_05530 23250 22879 gene locus_tag LOCUS_05540 23250 22879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 23679 23260 gene locus_tag LOCUS_05550 gene mutT 23679 23260 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_05550 24395 23679 gene locus_tag LOCUS_05560 24395 23679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 25068 24487 gene locus_tag LOCUS_05570 25068 24487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 25538 25059 gene locus_tag LOCUS_05580 25538 25059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 25645 26232 gene locus_tag LOCUS_05590 25645 26232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 27265 26291 gene locus_tag LOCUS_05600 27265 26291 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_05600 27378 28508 gene locus_tag LOCUS_05610 gene rnd 27378 28508 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086908.1 protein_id gnl|my_center|LOCUS_05610 28590 29282 gene locus_tag LOCUS_05620 28590 29282 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499537.1 protein_id gnl|my_center|LOCUS_05620 29269 30630 gene locus_tag LOCUS_05630 gene xseA 29269 30630 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_05630 30640 30906 gene locus_tag LOCUS_05640 gene xseB 30640 30906 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393512.1 protein_id gnl|my_center|LOCUS_05640 31014 31364 gene locus_tag LOCUS_05650 31014 31364 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430911.1 protein_id gnl|my_center|LOCUS_05650 31587 32765 gene locus_tag LOCUS_05660 31587 32765 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_05660 33024 33239 gene locus_tag LOCUS_05670 33024 33239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 34291 33410 gene locus_tag LOCUS_05680 34291 33410 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 protein_id gnl|my_center|LOCUS_05680 34648 36243 gene locus_tag LOCUS_05690 gene pckA 34648 36243 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626187.1 protein_id gnl|my_center|LOCUS_05690 37347 36370 gene locus_tag LOCUS_05700 gene pta 37347 36370 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_05700 37549 38748 gene locus_tag LOCUS_05710 gene glf 37549 38748 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_05710 38756 39790 gene locus_tag LOCUS_05720 38756 39790 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_05720 40849 39869 gene locus_tag LOCUS_05730 40849 39869 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_05730 41456 40842 gene locus_tag LOCUS_05740 41456 40842 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_05740 41711 41526 gene locus_tag LOCUS_05750 41711 41526 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811990.1 protein_id gnl|my_center|LOCUS_05750 43277 41928 gene locus_tag LOCUS_05760 gene rlmD 43277 41928 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143127.1 protein_id gnl|my_center|LOCUS_05760 45884 43281 gene locus_tag LOCUS_05770 45884 43281 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 protein_id gnl|my_center|LOCUS_05770 46075 47079 gene locus_tag LOCUS_05780 gene argF 46075 47079 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_05780 48229 47174 gene locus_tag LOCUS_05790 gene trpS 48229 47174 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827911.1 protein_id gnl|my_center|LOCUS_05790 48400 48999 gene locus_tag LOCUS_05800 48400 48999 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_05800 49652 48990 gene locus_tag LOCUS_05810 49652 48990 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261995.1 protein_id gnl|my_center|LOCUS_05810 50779 49790 gene locus_tag LOCUS_05820 50779 49790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 52192 50915 gene locus_tag LOCUS_05830 52192 50915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 53345 52200 gene locus_tag LOCUS_05840 gene pheA 53345 52200 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_05840 54490 53354 gene locus_tag LOCUS_05850 gene aroC 54490 53354 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_05850 55813 54491 gene locus_tag LOCUS_05860 gene aroA 55813 54491 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_05860 56908 55817 gene locus_tag LOCUS_05870 gene aroB 56908 55817 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257969.1 protein_id gnl|my_center|LOCUS_05870 57770 56901 gene locus_tag LOCUS_05880 57770 56901 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_05880 58797 57775 gene locus_tag LOCUS_05890 gene aroF 58797 57775 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_05890 58943 59019 gene locus_tag LOCUS_t00080 58943 59019 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 59690 59316 gene locus_tag LOCUS_05900 59690 59316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 60025 59792 gene locus_tag LOCUS_05910 60025 59792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 61173 60013 gene locus_tag LOCUS_05920 61173 60013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 61349 61131 gene locus_tag LOCUS_05930 61349 61131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence010 896 162 gene locus_tag LOCUS_05940 896 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 1883 936 gene locus_tag LOCUS_05950 1883 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2719 1889 gene locus_tag LOCUS_05960 gene truA 2719 1889 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_05960 3445 2960 gene locus_tag LOCUS_05970 gene rplQ 3445 2960 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536492.1 protein_id gnl|my_center|LOCUS_05970 4420 3479 gene locus_tag LOCUS_05980 4420 3479 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641267.1 protein_id gnl|my_center|LOCUS_05980 5035 4442 gene locus_tag LOCUS_05990 gene rpsD 5035 4442 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_05990 5452 5051 gene locus_tag LOCUS_06000 gene rpsK 5452 5051 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_06000 5834 5463 gene locus_tag LOCUS_06010 gene rpsM 5834 5463 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_06010 6245 6027 gene locus_tag LOCUS_06020 gene infA 6245 6027 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_06020 7287 6421 gene locus_tag LOCUS_06030 gene map 7287 6421 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_06030 7910 7281 gene locus_tag LOCUS_06040 7910 7281 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_06040 9229 7943 gene locus_tag LOCUS_06050 gene secY 9229 7943 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_06050 9672 9223 gene locus_tag LOCUS_06060 gene rplO 9672 9223 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356221.1 protein_id gnl|my_center|LOCUS_06060 9874 9683 gene locus_tag LOCUS_06070 9874 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 10398 9877 gene locus_tag LOCUS_06080 gene rpsE 10398 9877 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_06080 10777 10409 gene locus_tag LOCUS_06090 gene rplR 10777 10409 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966396.1 protein_id gnl|my_center|LOCUS_06090 11367 10831 gene locus_tag LOCUS_06100 gene rplF 11367 10831 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 protein_id gnl|my_center|LOCUS_06100 11796 11398 gene locus_tag LOCUS_06110 gene rpsH 11796 11398 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_06110 12069 11884 gene locus_tag LOCUS_06120 12069 11884 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_06120 12712 12155 gene locus_tag LOCUS_06130 gene rplE 12712 12155 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403660.1 protein_id gnl|my_center|LOCUS_06130 13915 12917 gene locus_tag LOCUS_06140 13915 12917 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582853.1 protein_id gnl|my_center|LOCUS_06140 14347 14030 gene locus_tag LOCUS_06150 gene rplX 14347 14030 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_06150 14730 14362 gene locus_tag LOCUS_06160 gene rplN 14730 14362 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_06160 15080 14814 gene locus_tag LOCUS_06170 gene rpsQ 15080 14814 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_06170 15312 15097 gene locus_tag LOCUS_06180 gene rpmC 15312 15097 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421158.1 protein_id gnl|my_center|LOCUS_06180 15729 15316 gene locus_tag LOCUS_06190 gene rplP 15729 15316 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_06190 16439 15729 gene locus_tag LOCUS_06200 gene rpsC 16439 15729 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088146.1 protein_id gnl|my_center|LOCUS_06200 16805 16443 gene locus_tag LOCUS_06210 gene rplV 16805 16443 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_06210 17081 16821 gene locus_tag LOCUS_06220 gene rpsS 17081 16821 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_06220 17940 17104 gene locus_tag LOCUS_06230 gene rplB 17940 17104 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_06230 18392 18090 gene locus_tag LOCUS_06240 gene rplW 18392 18090 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_06240 19019 18393 gene locus_tag LOCUS_06250 gene rplD 19019 18393 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701303.1 protein_id gnl|my_center|LOCUS_06250 19678 19058 gene locus_tag LOCUS_06260 gene rplC 19678 19058 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_06260 20332 20024 gene locus_tag LOCUS_06270 gene rpsJ 20332 20024 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_06270 22473 20374 gene locus_tag LOCUS_06280 gene fusA 22473 20374 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_06280 22965 22495 gene locus_tag LOCUS_06290 gene rpsG 22965 22495 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 protein_id gnl|my_center|LOCUS_06290 23384 23010 gene locus_tag LOCUS_06300 gene rpsL 23384 23010 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_06300 28071 23629 gene locus_tag LOCUS_06310 28071 23629 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399740.1 protein_id gnl|my_center|LOCUS_06310 31589 28074 gene locus_tag LOCUS_06320 31589 28074 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900992.1 protein_id gnl|my_center|LOCUS_06320 32243 31866 gene locus_tag LOCUS_06330 gene rplL 32243 31866 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_06330 32841 32326 gene locus_tag LOCUS_06340 gene rplJ 32841 32326 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870241.1 protein_id gnl|my_center|LOCUS_06340 33887 33183 gene locus_tag LOCUS_06350 gene rplA 33887 33183 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_06350 34438 34007 gene locus_tag LOCUS_06360 gene rplK 34438 34007 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776394.1 protein_id gnl|my_center|LOCUS_06360 35081 34530 gene locus_tag LOCUS_06370 gene nusG 35081 34530 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726896.1 protein_id gnl|my_center|LOCUS_06370 35443 35084 gene locus_tag LOCUS_06380 35443 35084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 35595 35520 gene locus_tag LOCUS_t00090 35595 35520 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 35760 35611 gene locus_tag LOCUS_06390 gene rpmG 35760 35611 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583730.1 protein_id gnl|my_center|LOCUS_06390 37159 35969 gene locus_tag LOCUS_06400 gene tuf 37159 35969 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903497.1 protein_id gnl|my_center|LOCUS_06400 37332 37256 gene locus_tag LOCUS_t00100 37332 37256 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 37421 37346 gene locus_tag LOCUS_t00110 37421 37346 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 37506 37423 gene locus_tag LOCUS_t00120 37506 37423 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 38135 38061 gene locus_tag LOCUS_t00130 38135 38061 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 38711 38154 gene locus_tag LOCUS_06410 38711 38154 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_06410 39658 38708 gene locus_tag LOCUS_06420 39658 38708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 41137 39662 gene locus_tag LOCUS_06430 gene cysS 41137 39662 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459084.1 protein_id gnl|my_center|LOCUS_06430 41721 41218 gene locus_tag LOCUS_06440 gene ispF 41721 41218 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_06440 42539 41721 gene locus_tag LOCUS_06450 gene ispD 42539 41721 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_06450 43639 42536 gene locus_tag LOCUS_06460 gene disA 43639 42536 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015293.1 protein_id gnl|my_center|LOCUS_06460 46379 43791 gene locus_tag LOCUS_06470 46379 43791 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_06470 47075 46551 gene locus_tag LOCUS_06480 47075 46551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 49508 47154 gene locus_tag LOCUS_06490 49508 47154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 50063 49596 gene locus_tag LOCUS_06500 gene greA 50063 49596 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475971.1 protein_id gnl|my_center|LOCUS_06500 50445 50125 gene locus_tag LOCUS_06510 50445 50125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 50678 51412 gene locus_tag LOCUS_06520 50678 51412 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027345.1 protein_id gnl|my_center|LOCUS_06520 51771 51478 gene locus_tag LOCUS_06530 51771 51478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 52491 51886 gene locus_tag LOCUS_06540 52491 51886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 53285 52521 gene locus_tag LOCUS_06550 53285 52521 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_06550 53931 53278 gene locus_tag LOCUS_06560 53931 53278 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722217.1 protein_id gnl|my_center|LOCUS_06560 54869 54006 gene locus_tag LOCUS_06570 54869 54006 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_06570 55100 55318 gene locus_tag LOCUS_06580 55100 55318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 56083 55388 gene locus_tag LOCUS_06590 56083 55388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567269.1 protein_id gnl|my_center|LOCUS_06590 56458 56090 gene locus_tag LOCUS_06600 56458 56090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 57153 56410 gene locus_tag LOCUS_06610 57153 56410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 58230 57391 gene locus_tag LOCUS_06620 58230 57391 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390060.1 protein_id gnl|my_center|LOCUS_06620 58365 58820 gene locus_tag LOCUS_06630 58365 58820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence011 503 428 gene locus_tag LOCUS_t00140 503 428 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1237 557 gene locus_tag LOCUS_06640 1237 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2121 1237 gene locus_tag LOCUS_06650 2121 1237 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_06650 3693 2218 gene locus_tag LOCUS_06660 3693 2218 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461512.1 protein_id gnl|my_center|LOCUS_06660 4486 3764 gene locus_tag LOCUS_06670 4486 3764 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 protein_id gnl|my_center|LOCUS_06670 5780 4569 gene locus_tag LOCUS_06680 5780 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 6055 5783 gene locus_tag LOCUS_06690 6055 5783 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_06690 7410 6064 gene locus_tag LOCUS_06700 gene purB 7410 6064 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817240.1 protein_id gnl|my_center|LOCUS_06700 8937 7534 gene locus_tag LOCUS_06710 gene argH 8937 7534 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041296.1 protein_id gnl|my_center|LOCUS_06710 10395 9166 gene locus_tag LOCUS_06720 10395 9166 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869501.1 protein_id gnl|my_center|LOCUS_06720 11692 10802 gene locus_tag LOCUS_06730 11692 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 11834 11759 gene locus_tag LOCUS_t00150 11834 11759 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13190 11952 gene locus_tag LOCUS_06740 13190 11952 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_06740 13763 13275 gene locus_tag LOCUS_06750 13763 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 13905 13831 gene locus_tag LOCUS_t00160 13905 13831 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14310 17192 gene locus_tag LOCUS_06760 14310 17192 CDS product SrtB-anchored collagen-binding adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861958.1 protein_id gnl|my_center|LOCUS_06760 22151 17271 gene locus_tag LOCUS_06770 22151 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 22372 23358 gene locus_tag LOCUS_06780 22372 23358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 23351 24277 gene locus_tag LOCUS_06790 23351 24277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 27269 24318 gene locus_tag LOCUS_06800 27269 24318 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_06800 28225 27269 gene locus_tag LOCUS_06810 28225 27269 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_06810 28342 29421 gene locus_tag LOCUS_06820 gene rlmN 28342 29421 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_06820 30686 29499 gene locus_tag LOCUS_06830 gene tnpB 30686 29499 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861290.1 protein_id gnl|my_center|LOCUS_06830 31080 30688 gene locus_tag LOCUS_06840 gene tnpA 31080 30688 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435056.1 protein_id gnl|my_center|LOCUS_06840 31501 31256 gene locus_tag LOCUS_06850 31501 31256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 32373 31501 gene locus_tag LOCUS_06860 32373 31501 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_06860 33166 32366 gene locus_tag LOCUS_06870 33166 32366 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_06870 34246 34040 gene locus_tag LOCUS_06880 34246 34040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 35450 34707 gene locus_tag LOCUS_06890 gene rsmG 35450 34707 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886662.1 protein_id gnl|my_center|LOCUS_06890 36115 35540 gene locus_tag LOCUS_06900 36115 35540 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462331.1 protein_id gnl|my_center|LOCUS_06900 36933 36172 gene locus_tag LOCUS_06910 36933 36172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 37196 36954 gene locus_tag LOCUS_06920 37196 36954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 37516 37193 gene locus_tag LOCUS_06930 gene rnpA 37516 37193 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_06930 37659 37525 gene locus_tag LOCUS_06940 37659 37525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 38106 39320 gene locus_tag LOCUS_06950 38106 39320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 39414 40937 gene locus_tag LOCUS_06960 39414 40937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 41189 42289 gene locus_tag LOCUS_06970 gene dnaN 41189 42289 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_06970 42293 43384 gene locus_tag LOCUS_06980 gene recF 42293 43384 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058276.1 protein_id gnl|my_center|LOCUS_06980 43371 44003 gene locus_tag LOCUS_06990 43371 44003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 44197 44484 gene locus_tag LOCUS_07000 44197 44484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 45073 47016 gene locus_tag LOCUS_07010 gene gyrB 45073 47016 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_07010 47030 49882 gene locus_tag LOCUS_07020 gene gyrA 47030 49882 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_07020 50080 52494 gene locus_tag LOCUS_07030 50080 52494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 52525 54960 gene locus_tag LOCUS_07040 52525 54960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 56194 55037 gene locus_tag LOCUS_07050 56194 55037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 56177 56362 gene locus_tag LOCUS_07060 56177 56362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 58653 56389 gene locus_tag LOCUS_07070 58653 56389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence012 396 581 gene locus_tag LOCUS_07080 396 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1224 694 gene locus_tag LOCUS_07090 1224 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1328 3361 gene locus_tag LOCUS_07100 1328 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3419 4291 gene locus_tag LOCUS_07110 3419 4291 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 protein_id gnl|my_center|LOCUS_07110 5523 4288 gene locus_tag LOCUS_07120 5523 4288 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_07120 6409 5528 gene locus_tag LOCUS_07130 gene argB 6409 5528 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_07130 7705 6431 gene locus_tag LOCUS_07140 gene argJ 7705 6431 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_07140 8877 7792 gene locus_tag LOCUS_07150 gene argC 8877 7792 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_07150 10471 9053 gene locus_tag LOCUS_07160 10471 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 11150 10473 gene locus_tag LOCUS_07170 11150 10473 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_07170 11818 11153 gene locus_tag LOCUS_07180 gene phoU 11818 11153 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020935.1 protein_id gnl|my_center|LOCUS_07180 12572 11820 gene locus_tag LOCUS_07190 gene pstB 12572 11820 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_07190 13396 12572 gene locus_tag LOCUS_07200 gene pstB 13396 12572 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289486.1 protein_id gnl|my_center|LOCUS_07200 14328 13393 gene locus_tag LOCUS_07210 gene pstA 14328 13393 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722630.1 protein_id gnl|my_center|LOCUS_07210 15262 14321 gene locus_tag LOCUS_07220 gene pstC 15262 14321 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316421.1 protein_id gnl|my_center|LOCUS_07220 16295 15363 gene locus_tag LOCUS_07230 16295 15363 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357425.1 protein_id gnl|my_center|LOCUS_07230 16687 17178 gene locus_tag LOCUS_07240 16687 17178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 17175 19043 gene locus_tag LOCUS_07250 17175 19043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_07250 19040 20974 gene locus_tag LOCUS_07260 19040 20974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_07260 21084 22202 gene locus_tag LOCUS_07270 21084 22202 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_07270 22533 23546 gene locus_tag LOCUS_07280 22533 23546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 25389 23647 gene locus_tag LOCUS_07290 25389 23647 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143601.1 protein_id gnl|my_center|LOCUS_07290 25752 25393 gene locus_tag LOCUS_07300 25752 25393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 26059 27144 gene locus_tag LOCUS_07310 gene serC 26059 27144 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_07310 27182 28372 gene locus_tag LOCUS_07320 27182 28372 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_07320 28391 29674 gene locus_tag LOCUS_07330 28391 29674 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_07330 29782 31026 gene locus_tag LOCUS_07340 29782 31026 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_07340 31376 31023 gene locus_tag LOCUS_07350 gene czrA 31376 31023 CDS product Zn(II)-responsive metalloregulatory transcriptional repressor CzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003759.1 protein_id gnl|my_center|LOCUS_07350 31528 33960 gene locus_tag LOCUS_07360 31528 33960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 35451 34039 gene locus_tag LOCUS_07370 gene pepV 35451 34039 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_07370 35532 36260 gene locus_tag LOCUS_07380 35532 36260 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_07380 36562 36359 gene locus_tag LOCUS_07390 36562 36359 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719639.1 protein_id gnl|my_center|LOCUS_07390 37767 36823 gene locus_tag LOCUS_07400 37767 36823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 37987 39213 gene locus_tag LOCUS_07410 37987 39213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068433.1 protein_id gnl|my_center|LOCUS_07410 39853 39299 gene locus_tag LOCUS_07420 39853 39299 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_07420 42093 39865 gene locus_tag LOCUS_07430 42093 39865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 43034 42099 gene locus_tag LOCUS_07440 gene nadA 43034 42099 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 protein_id gnl|my_center|LOCUS_07440 46538 43230 gene locus_tag LOCUS_07450 46538 43230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 46953 47918 gene locus_tag LOCUS_07460 46953 47918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 47933 48457 gene locus_tag LOCUS_07470 47933 48457 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262000.1 protein_id gnl|my_center|LOCUS_07470 48664 48485 gene locus_tag LOCUS_07480 48664 48485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 49988 48636 gene locus_tag LOCUS_07490 49988 48636 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_07490 50066 50614 gene locus_tag LOCUS_07500 50066 50614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 51432 50611 gene locus_tag LOCUS_07510 51432 50611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 52104 51628 gene locus_tag LOCUS_07520 52104 51628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 53120 52218 gene locus_tag LOCUS_07530 53120 52218 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059810.1 protein_id gnl|my_center|LOCUS_07530 53305 54027 gene locus_tag LOCUS_07540 53305 54027 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071889.1 protein_id gnl|my_center|LOCUS_07540 54024 54326 gene locus_tag LOCUS_07550 54024 54326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 54464 55672 gene locus_tag LOCUS_07560 54464 55672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 55833 57056 gene locus_tag LOCUS_07570 55833 57056 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_07570 57226 58182 gene locus_tag LOCUS_07580 57226 58182 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence013 2157 217 gene locus_tag LOCUS_07590 gene pknB 2157 217 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965035.1 protein_id gnl|my_center|LOCUS_07590 5171 2304 gene locus_tag LOCUS_07600 5171 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 6502 5174 gene locus_tag LOCUS_07610 6502 5174 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_07610 6912 6499 gene locus_tag LOCUS_07620 6912 6499 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003079002.1 protein_id gnl|my_center|LOCUS_07620 8088 6913 gene locus_tag LOCUS_07630 8088 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 9870 8095 gene locus_tag LOCUS_07640 9870 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 10030 10116 gene locus_tag LOCUS_t00170 10030 10116 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10465 10277 gene locus_tag LOCUS_07650 10465 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 10377 10601 gene locus_tag LOCUS_07660 10377 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 10594 11880 gene locus_tag LOCUS_07670 gene serS 10594 11880 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_07670 12025 12417 gene locus_tag LOCUS_07680 12025 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 12534 12458 gene locus_tag LOCUS_t00180 12534 12458 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12917 13354 gene locus_tag LOCUS_07690 12917 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07690 13351 13677 gene locus_tag LOCUS_07700 13351 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07700 13948 13858 gene locus_tag LOCUS_t00190 13948 13858 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14954 13965 gene locus_tag LOCUS_07710 14954 13965 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993597.1 protein_id gnl|my_center|LOCUS_07710 15077 15772 gene locus_tag LOCUS_07720 15077 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 15772 16536 gene locus_tag LOCUS_07730 15772 16536 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089169.1 protein_id gnl|my_center|LOCUS_07730 16529 17248 gene locus_tag LOCUS_07740 16529 17248 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126809660.1 protein_id gnl|my_center|LOCUS_07740 17325 17768 gene locus_tag LOCUS_07750 17325 17768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 17929 19767 gene locus_tag LOCUS_07760 gene typA 17929 19767 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_07760 20579 19851 gene locus_tag LOCUS_07770 20579 19851 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013417.1 protein_id gnl|my_center|LOCUS_07770 20711 20801 gene locus_tag LOCUS_t00200 20711 20801 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20846 20935 gene locus_tag LOCUS_t00210 20846 20935 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21119 22156 gene locus_tag LOCUS_07780 21119 22156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 22424 22717 gene locus_tag LOCUS_07790 gene rpsF 22424 22717 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_07790 22757 23239 gene locus_tag LOCUS_07800 22757 23239 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_07800 23357 23566 gene locus_tag LOCUS_07810 23357 23566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 23599 24651 gene locus_tag LOCUS_07820 23599 24651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 24689 25210 gene locus_tag LOCUS_07830 gene rplI 24689 25210 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_07830 25662 27059 gene locus_tag LOCUS_07840 gene dnaB 25662 27059 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_07840 27191 28471 gene locus_tag LOCUS_07850 27191 28471 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_07850 28545 29846 gene locus_tag LOCUS_07860 gene purD 28545 29846 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968869.1 protein_id gnl|my_center|LOCUS_07860 29848 30636 gene locus_tag LOCUS_07870 29848 30636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 30706 32478 gene locus_tag LOCUS_07880 30706 32478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_07880 32590 33528 gene locus_tag LOCUS_07890 32590 33528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 33579 34040 gene locus_tag LOCUS_07900 gene purE 33579 34040 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_07900 34072 34521 gene locus_tag LOCUS_07910 34072 34521 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115302.1 protein_id gnl|my_center|LOCUS_07910 34693 35733 gene locus_tag LOCUS_07920 34693 35733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 35760 37286 gene locus_tag LOCUS_07930 gene purF 35760 37286 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804524.1 protein_id gnl|my_center|LOCUS_07930 37289 38353 gene locus_tag LOCUS_07940 gene purM 37289 38353 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_07940 38350 38973 gene locus_tag LOCUS_07950 gene purN 38350 38973 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 protein_id gnl|my_center|LOCUS_07950 40015 39053 gene locus_tag LOCUS_07960 40015 39053 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139264482.1 protein_id gnl|my_center|LOCUS_07960 40589 40143 gene locus_tag LOCUS_07970 40589 40143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07970 41664 40804 gene locus_tag LOCUS_07980 41664 40804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 42875 41676 gene locus_tag LOCUS_07990 gene rlmD 42875 41676 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_07990 43048 44013 gene locus_tag LOCUS_08000 43048 44013 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861477.1 protein_id gnl|my_center|LOCUS_08000 44195 45673 gene locus_tag LOCUS_08010 44195 45673 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_08010 46189 48459 gene locus_tag LOCUS_08020 46189 48459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 48492 48815 gene locus_tag LOCUS_08030 48492 48815 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_08030 48817 49419 gene locus_tag LOCUS_08040 gene recR 48817 49419 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_08040 49555 50424 gene locus_tag LOCUS_08050 49555 50424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 50584 50660 gene locus_tag LOCUS_t00220 50584 50660 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 50815 51510 gene locus_tag LOCUS_08060 50815 51510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 51641 52147 gene locus_tag LOCUS_08070 51641 52147 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_08070 52147 53016 gene locus_tag LOCUS_08080 52147 53016 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_08080 53095 53640 gene locus_tag LOCUS_08090 53095 53640 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_08090 53800 54237 gene locus_tag LOCUS_08100 53800 54237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 54480 55799 gene locus_tag LOCUS_08110 54480 55799 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259308.1 protein_id gnl|my_center|LOCUS_08110 55956 57428 gene locus_tag LOCUS_08120 55956 57428 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068205.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence014 551 39 gene locus_tag LOCUS_08130 551 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1616 564 gene locus_tag LOCUS_08140 1616 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4297 1613 gene locus_tag LOCUS_08150 4297 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 6120 4537 gene locus_tag LOCUS_08160 6120 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 7375 6125 gene locus_tag LOCUS_08170 7375 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 8070 7867 gene locus_tag LOCUS_08180 8070 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 8657 8067 gene locus_tag LOCUS_08190 8657 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 10596 8680 gene locus_tag LOCUS_08200 10596 8680 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393552.1 protein_id gnl|my_center|LOCUS_08200 10773 11336 gene locus_tag LOCUS_08210 10773 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 12276 11533 gene locus_tag LOCUS_08220 12276 11533 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_08220 13039 12305 gene locus_tag LOCUS_08230 13039 12305 CDS product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707609.1 protein_id gnl|my_center|LOCUS_08230 14151 13042 gene locus_tag LOCUS_08240 14151 13042 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704265.1 protein_id gnl|my_center|LOCUS_08240 14837 14163 gene locus_tag LOCUS_08250 14837 14163 CDS product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361314.1 protein_id gnl|my_center|LOCUS_08250 15572 14856 gene locus_tag LOCUS_08260 15572 14856 CDS product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288309.1 protein_id gnl|my_center|LOCUS_08260 15961 15572 gene locus_tag LOCUS_08270 15961 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 16325 15951 gene locus_tag LOCUS_08280 16325 15951 CDS product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006179053.1 protein_id gnl|my_center|LOCUS_08280 16684 16322 gene locus_tag LOCUS_08290 16684 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 17786 16665 gene locus_tag LOCUS_08300 17786 16665 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139971.1 protein_id gnl|my_center|LOCUS_08300 17980 18732 gene locus_tag LOCUS_08310 17980 18732 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922320.1 protein_id gnl|my_center|LOCUS_08310 18882 19712 gene locus_tag LOCUS_08320 18882 19712 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721781.1 protein_id gnl|my_center|LOCUS_08320 21353 19812 gene locus_tag LOCUS_08330 21353 19812 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948061.1 protein_id gnl|my_center|LOCUS_08330 22846 21488 gene locus_tag LOCUS_08340 22846 21488 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948060.1 protein_id gnl|my_center|LOCUS_08340 23072 23821 gene locus_tag LOCUS_08350 23072 23821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 23818 24612 gene locus_tag LOCUS_08360 23818 24612 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948062.1 protein_id gnl|my_center|LOCUS_08360 25574 24609 gene locus_tag LOCUS_08370 25574 24609 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969244.1 protein_id gnl|my_center|LOCUS_08370 25716 26552 gene locus_tag LOCUS_08380 25716 26552 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649894.1 protein_id gnl|my_center|LOCUS_08380 27178 26624 gene locus_tag LOCUS_08390 27178 26624 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_08390 27396 27181 gene locus_tag LOCUS_08400 27396 27181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 27741 28037 gene locus_tag LOCUS_08410 27741 28037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 28387 28118 gene locus_tag LOCUS_08420 28387 28118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 28938 28402 gene locus_tag LOCUS_08430 28938 28402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 30451 29138 gene locus_tag LOCUS_08440 30451 29138 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054178.1 protein_id gnl|my_center|LOCUS_08440 31472 30837 gene locus_tag LOCUS_08450 31472 30837 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263264.1 protein_id gnl|my_center|LOCUS_08450 31710 32303 gene locus_tag LOCUS_08460 31710 32303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 32769 32359 gene locus_tag LOCUS_08470 32769 32359 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_08470 33266 32856 gene locus_tag LOCUS_08480 33266 32856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 34172 33438 gene locus_tag LOCUS_08490 34172 33438 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071300.1 protein_id gnl|my_center|LOCUS_08490 34849 34172 gene locus_tag LOCUS_08500 34849 34172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 35762 34953 gene locus_tag LOCUS_08510 35762 34953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 36141 37067 gene locus_tag LOCUS_08520 36141 37067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 37083 37736 gene locus_tag LOCUS_08530 37083 37736 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046916.1 protein_id gnl|my_center|LOCUS_08530 39703 37733 gene locus_tag LOCUS_08540 39703 37733 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986566.1 protein_id gnl|my_center|LOCUS_08540 40364 39696 gene locus_tag LOCUS_08550 40364 39696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 42283 40364 gene locus_tag LOCUS_08560 42283 40364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986568.1 protein_id gnl|my_center|LOCUS_08560 44176 42377 gene locus_tag LOCUS_08570 44176 42377 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986569.1 protein_id gnl|my_center|LOCUS_08570 45552 44335 gene locus_tag LOCUS_08580 gene ydeA 45552 44335 CDS product L-arabinose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210801.1 protein_id gnl|my_center|LOCUS_08580 45742 46941 gene locus_tag LOCUS_08590 45742 46941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089891.1 protein_id gnl|my_center|LOCUS_08590 46957 47400 gene locus_tag LOCUS_08600 46957 47400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 48429 47404 gene locus_tag LOCUS_08610 48429 47404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 48627 49094 gene locus_tag LOCUS_08620 48627 49094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 49950 49159 gene locus_tag LOCUS_08630 49950 49159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163851494.1 protein_id gnl|my_center|LOCUS_08630 50175 51152 gene locus_tag LOCUS_08640 50175 51152 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817700.1 protein_id gnl|my_center|LOCUS_08640 52077 51625 gene locus_tag LOCUS_08650 52077 51625 CDS product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358680.1 protein_id gnl|my_center|LOCUS_08650 52403 52158 gene locus_tag LOCUS_08660 52403 52158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 52613 53989 gene locus_tag LOCUS_08670 gene amrA 52613 53989 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680398.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence015 1254 367 gene locus_tag LOCUS_08680 gene thrB 1254 367 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674786.1 protein_id gnl|my_center|LOCUS_08680 2749 1256 gene locus_tag LOCUS_08690 gene thrC 2749 1256 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068263.1 protein_id gnl|my_center|LOCUS_08690 2855 3988 gene locus_tag LOCUS_08700 2855 3988 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_08700 3990 5312 gene locus_tag LOCUS_08710 3990 5312 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286872.1 protein_id gnl|my_center|LOCUS_08710 5324 6337 gene locus_tag LOCUS_08720 gene asd 5324 6337 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_08720 6797 6426 gene locus_tag LOCUS_08730 6797 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8461 6914 gene locus_tag LOCUS_08740 8461 6914 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_08740 8581 9405 gene locus_tag LOCUS_08750 8581 9405 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_08750 11393 9492 gene locus_tag LOCUS_08760 gene ftsH 11393 9492 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_08760 13417 11516 gene locus_tag LOCUS_08770 13417 11516 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_08770 13956 16772 gene locus_tag LOCUS_08780 gene ileS 13956 16772 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_08780 16841 17326 gene locus_tag LOCUS_08790 gene lspA 16841 17326 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_08790 17319 18341 gene locus_tag LOCUS_08800 17319 18341 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 protein_id gnl|my_center|LOCUS_08800 18381 19676 gene locus_tag LOCUS_08810 18381 19676 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_08810 19815 21329 gene locus_tag LOCUS_08820 19815 21329 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_08820 24287 21456 gene locus_tag LOCUS_08830 24287 21456 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_08830 25114 24284 gene locus_tag LOCUS_08840 25114 24284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 25322 27892 gene locus_tag LOCUS_08850 gene leuS 25322 27892 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_08850 28933 27989 gene locus_tag LOCUS_08860 28933 27989 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222593.1 protein_id gnl|my_center|LOCUS_08860 29082 29591 gene locus_tag LOCUS_08870 29082 29591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 29613 30875 gene locus_tag LOCUS_08880 gene nusA 29613 30875 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_08880 30928 33681 gene locus_tag LOCUS_08890 30928 33681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 33691 34092 gene locus_tag LOCUS_08900 33691 34092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 34100 35140 gene locus_tag LOCUS_08910 34100 35140 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_08910 35137 36066 gene locus_tag LOCUS_08920 gene truB 35137 36066 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728501.1 protein_id gnl|my_center|LOCUS_08920 36084 37148 gene locus_tag LOCUS_08930 36084 37148 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_08930 37145 39079 gene locus_tag LOCUS_08940 gene dnaG 37145 39079 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068315.1 protein_id gnl|my_center|LOCUS_08940 39119 40489 gene locus_tag LOCUS_08950 39119 40489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 41286 41005 gene locus_tag LOCUS_08960 41286 41005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 41323 41973 gene locus_tag LOCUS_08970 41323 41973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 42095 42658 gene locus_tag LOCUS_08980 42095 42658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 42660 43637 gene locus_tag LOCUS_08990 42660 43637 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_08990 43703 43930 gene locus_tag LOCUS_09000 gene acpP 43703 43930 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419132.1 protein_id gnl|my_center|LOCUS_09000 43962 44906 gene locus_tag LOCUS_09010 gene fabK 43962 44906 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 protein_id gnl|my_center|LOCUS_09010 44894 45829 gene locus_tag LOCUS_09020 gene fabD 44894 45829 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060542.1 protein_id gnl|my_center|LOCUS_09020 45829 46602 gene locus_tag LOCUS_09030 gene fabG 45829 46602 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_09030 46631 47878 gene locus_tag LOCUS_09040 gene fabF 46631 47878 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_09040 47882 48355 gene locus_tag LOCUS_09050 gene accB 47882 48355 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921156.1 protein_id gnl|my_center|LOCUS_09050 48365 48793 gene locus_tag LOCUS_09060 gene fabZ 48365 48793 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_09060 48797 50137 gene locus_tag LOCUS_09070 48797 50137 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_09070 50130 51857 gene locus_tag LOCUS_09080 50130 51857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 51857 52780 gene locus_tag LOCUS_09090 51857 52780 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081771.1 protein_id gnl|my_center|LOCUS_09090 52911 52985 gene locus_tag LOCUS_t00230 52911 52985 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 53751 53026 gene locus_tag LOCUS_09100 53751 53026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence016 290 436 gene locus_tag LOCUS_09110 290 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1101 511 gene locus_tag LOCUS_09120 1101 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1445 1098 gene locus_tag LOCUS_09130 1445 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2203 1445 gene locus_tag LOCUS_09140 2203 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3661 3020 gene locus_tag LOCUS_09150 3661 3020 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_09150 5436 3664 gene locus_tag LOCUS_09160 gene iorA 5436 3664 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_09160 7093 5459 gene locus_tag LOCUS_09170 7093 5459 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282029.1 protein_id gnl|my_center|LOCUS_09170 7431 8399 gene locus_tag LOCUS_09180 gene metA 7431 8399 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054763.1 protein_id gnl|my_center|LOCUS_09180 8426 9712 gene locus_tag LOCUS_09190 8426 9712 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_09190 10205 9651 gene locus_tag LOCUS_09200 gene tadA 10205 9651 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_09200 10404 11339 gene locus_tag LOCUS_09210 gene pfkB 10404 11339 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391561.1 protein_id gnl|my_center|LOCUS_09210 11420 11510 gene locus_tag LOCUS_t00240 11420 11510 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11580 12131 gene locus_tag LOCUS_09220 11580 12131 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_09220 13023 12643 gene locus_tag LOCUS_09230 13023 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 13351 13049 gene locus_tag LOCUS_09240 13351 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09240 13505 13302 gene locus_tag LOCUS_09250 13505 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 13908 13693 gene locus_tag LOCUS_09260 13908 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 14203 14042 gene locus_tag LOCUS_09270 14203 14042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 16254 14227 gene locus_tag LOCUS_09280 16254 14227 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 protein_id gnl|my_center|LOCUS_09280 16965 16312 gene locus_tag LOCUS_09290 16965 16312 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476419.1 protein_id gnl|my_center|LOCUS_09290 17917 16973 gene locus_tag LOCUS_09300 17917 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 18580 17921 gene locus_tag LOCUS_09310 18580 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 19017 18826 gene locus_tag LOCUS_09320 19017 18826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 20551 19376 gene locus_tag LOCUS_09330 20551 19376 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09330 20444 20824 gene locus_tag LOCUS_09340 20444 20824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 23806 20906 gene locus_tag LOCUS_09350 23806 20906 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203068.1 protein_id gnl|my_center|LOCUS_09350 24368 26752 gene locus_tag LOCUS_09360 24368 26752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 27734 27027 gene locus_tag LOCUS_09370 27734 27027 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254139.1 protein_id gnl|my_center|LOCUS_09370 27997 28707 gene locus_tag LOCUS_09380 gene deoC 27997 28707 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254138.1 protein_id gnl|my_center|LOCUS_09380 29369 28932 gene locus_tag LOCUS_09390 29369 28932 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361048.1 protein_id gnl|my_center|LOCUS_09390 30511 29393 gene locus_tag LOCUS_09400 30511 29393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 32052 30523 gene locus_tag LOCUS_09410 32052 30523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 33050 32052 gene locus_tag LOCUS_09420 33050 32052 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067059.1 protein_id gnl|my_center|LOCUS_09420 34031 33198 gene locus_tag LOCUS_09430 gene agaD 34031 33198 CDS product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534354.1 protein_id gnl|my_center|LOCUS_09430 34824 34021 gene locus_tag LOCUS_09440 gene agaC 34824 34021 CDS product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101866.1 protein_id gnl|my_center|LOCUS_09440 35365 34898 gene locus_tag LOCUS_09450 gene agaB 35365 34898 CDS product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098022.1 protein_id gnl|my_center|LOCUS_09450 36291 35590 gene locus_tag LOCUS_09460 36291 35590 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966768.1 protein_id gnl|my_center|LOCUS_09460 37436 36594 gene locus_tag LOCUS_09470 gene frlR 37436 36594 CDS product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276847.1 protein_id gnl|my_center|LOCUS_09470 38404 37469 gene locus_tag LOCUS_09480 38404 37469 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166346.1 protein_id gnl|my_center|LOCUS_09480 39489 38401 gene locus_tag LOCUS_09490 39489 38401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854337.1 protein_id gnl|my_center|LOCUS_09490 40525 39494 gene locus_tag LOCUS_09500 40525 39494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974099.1 protein_id gnl|my_center|LOCUS_09500 41518 40529 gene locus_tag LOCUS_09510 gene opp1B 41518 40529 CDS product oligopeptide ABC transporter permease Opp1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381304.1 protein_id gnl|my_center|LOCUS_09510 43264 41594 gene locus_tag LOCUS_09520 43264 41594 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823441.1 protein_id gnl|my_center|LOCUS_09520 44182 43364 gene locus_tag LOCUS_09530 gene frlD 44182 43364 CDS product fructosamine kinase FrlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228626.1 protein_id gnl|my_center|LOCUS_09530 45229 44237 gene locus_tag LOCUS_09540 gene frlB 45229 44237 CDS product fructosamine deglycase FrlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243688.1 protein_id gnl|my_center|LOCUS_09540 46850 46164 gene locus_tag LOCUS_09550 46850 46164 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068365.1 protein_id gnl|my_center|LOCUS_09550 48274 46850 gene locus_tag LOCUS_09560 48274 46850 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_09560 48655 49611 gene locus_tag LOCUS_09570 48655 49611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09570 50672 50301 gene locus_tag LOCUS_09580 50672 50301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence017 196 543 gene locus_tag LOCUS_09590 196 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2098 677 gene locus_tag LOCUS_09600 gene uxaC 2098 677 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906065.1 protein_id gnl|my_center|LOCUS_09600 3198 2104 gene locus_tag LOCUS_09610 gene uxuA 3198 2104 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906067.1 protein_id gnl|my_center|LOCUS_09610 4843 3227 gene locus_tag LOCUS_09620 4843 3227 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288175.1 protein_id gnl|my_center|LOCUS_09620 5142 5861 gene locus_tag LOCUS_09630 5142 5861 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289316.1 protein_id gnl|my_center|LOCUS_09630 6008 6631 gene locus_tag LOCUS_09640 6008 6631 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_09640 6830 7924 gene locus_tag LOCUS_09650 6830 7924 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099305.1 protein_id gnl|my_center|LOCUS_09650 8042 8491 gene locus_tag LOCUS_09660 8042 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 8558 8863 gene locus_tag LOCUS_09670 8558 8863 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066065.1 protein_id gnl|my_center|LOCUS_09670 9055 9357 gene locus_tag LOCUS_09680 9055 9357 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053232.1 protein_id gnl|my_center|LOCUS_09680 10554 9607 gene locus_tag LOCUS_09690 10554 9607 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_09690 10806 11816 gene locus_tag LOCUS_09700 10806 11816 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 protein_id gnl|my_center|LOCUS_09700 12773 12000 gene locus_tag LOCUS_09710 12773 12000 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 protein_id gnl|my_center|LOCUS_09710 12930 14285 gene locus_tag LOCUS_09720 12930 14285 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101564.1 protein_id gnl|my_center|LOCUS_09720 14497 15147 gene locus_tag LOCUS_09730 14497 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 15179 16714 gene locus_tag LOCUS_09740 15179 16714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 17661 16771 gene locus_tag LOCUS_09750 17661 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_09750 18400 17606 gene locus_tag LOCUS_09760 18400 17606 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_09760 19178 18414 gene locus_tag LOCUS_09770 19178 18414 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775663.1 protein_id gnl|my_center|LOCUS_09770 19325 19933 gene locus_tag LOCUS_09780 19325 19933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 19938 21482 gene locus_tag LOCUS_09790 19938 21482 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861882.1 protein_id gnl|my_center|LOCUS_09790 21482 22315 gene locus_tag LOCUS_09800 21482 22315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438780.1 protein_id gnl|my_center|LOCUS_09800 22367 23347 gene locus_tag LOCUS_09810 22367 23347 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904591.1 protein_id gnl|my_center|LOCUS_09810 23383 23823 gene locus_tag LOCUS_09820 23383 23823 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775495.1 protein_id gnl|my_center|LOCUS_09820 24577 24819 gene locus_tag LOCUS_09830 24577 24819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 25252 24791 gene locus_tag LOCUS_09840 25252 24791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09840 25635 25237 gene locus_tag LOCUS_09850 25635 25237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 26213 25632 gene locus_tag LOCUS_09860 26213 25632 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_09860 26377 26955 gene locus_tag LOCUS_09870 26377 26955 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_09870 27919 27026 gene locus_tag LOCUS_09880 27919 27026 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948434.1 protein_id gnl|my_center|LOCUS_09880 28835 27906 gene locus_tag LOCUS_09890 28835 27906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 29083 29613 gene locus_tag LOCUS_09900 29083 29613 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948363.1 protein_id gnl|my_center|LOCUS_09900 29750 30955 gene locus_tag LOCUS_09910 29750 30955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 31638 30952 gene locus_tag LOCUS_09920 gene fsa 31638 30952 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228415.1 protein_id gnl|my_center|LOCUS_09920 31905 32702 gene locus_tag LOCUS_09930 31905 32702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 33340 32945 gene locus_tag LOCUS_09940 33340 32945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 33877 33374 gene locus_tag LOCUS_09950 33877 33374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272655.1 protein_id gnl|my_center|LOCUS_09950 34059 35357 gene locus_tag LOCUS_09960 34059 35357 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_09960 36236 35676 gene locus_tag LOCUS_09970 36236 35676 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642721.1 protein_id gnl|my_center|LOCUS_09970 36841 36308 gene locus_tag LOCUS_09980 36841 36308 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397668.1 protein_id gnl|my_center|LOCUS_09980 38053 36893 gene locus_tag LOCUS_09990 38053 36893 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_09990 38181 39146 gene locus_tag LOCUS_10000 38181 39146 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027936894.1 protein_id gnl|my_center|LOCUS_10000 39270 39593 gene locus_tag LOCUS_10010 39270 39593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 39810 39667 gene locus_tag LOCUS_10020 39810 39667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 39963 40277 gene locus_tag LOCUS_10030 39963 40277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 40501 40848 gene locus_tag LOCUS_10040 40501 40848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 40952 41707 gene locus_tag LOCUS_10050 40952 41707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 41841 41966 gene locus_tag LOCUS_10060 41841 41966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 42048 42380 gene locus_tag LOCUS_10070 42048 42380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 42377 43081 gene locus_tag LOCUS_10080 42377 43081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10080 42994 43419 gene locus_tag LOCUS_10090 42994 43419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10090 43395 43661 gene locus_tag LOCUS_10100 43395 43661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 44246 43686 gene locus_tag LOCUS_10110 44246 43686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 44530 44318 gene locus_tag LOCUS_10120 44530 44318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 45122 45898 gene locus_tag LOCUS_10130 45122 45898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 45895 46392 gene locus_tag LOCUS_10140 45895 46392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 47365 46601 gene locus_tag LOCUS_10150 47365 46601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 47897 47355 gene locus_tag LOCUS_10160 47897 47355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 50152 48779 gene locus_tag LOCUS_10170 50152 48779 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994768.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence018 189 743 gene locus_tag LOCUS_10180 189 743 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356776.1 protein_id gnl|my_center|LOCUS_10180 1681 809 gene locus_tag LOCUS_10190 1681 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1988 3148 gene locus_tag LOCUS_10200 1988 3148 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_10200 3375 4310 gene locus_tag LOCUS_10210 3375 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 4834 4400 gene locus_tag LOCUS_10220 4834 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 5222 5515 gene locus_tag LOCUS_10230 5222 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 6977 5925 gene locus_tag LOCUS_10240 gene allD 6977 5925 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703947.1 protein_id gnl|my_center|LOCUS_10240 7963 7016 gene locus_tag LOCUS_10250 gene arcC 7963 7016 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922501.1 protein_id gnl|my_center|LOCUS_10250 8854 8039 gene locus_tag LOCUS_10260 8854 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 11858 8859 gene locus_tag LOCUS_10270 11858 8859 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706747.1 protein_id gnl|my_center|LOCUS_10270 12687 11896 gene locus_tag LOCUS_10280 gene allE 12687 11896 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540997.1 protein_id gnl|my_center|LOCUS_10280 14141 12888 gene locus_tag LOCUS_10290 14141 12888 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378762.1 protein_id gnl|my_center|LOCUS_10290 15401 14172 gene locus_tag LOCUS_10300 gene allC 15401 14172 CDS product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589772.1 protein_id gnl|my_center|LOCUS_10300 15947 17176 gene locus_tag LOCUS_10310 15947 17176 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358375.1 protein_id gnl|my_center|LOCUS_10310 17219 17746 gene locus_tag LOCUS_10320 17219 17746 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895862.1 protein_id gnl|my_center|LOCUS_10320 18794 17829 gene locus_tag LOCUS_10330 18794 17829 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_10330 18964 20607 gene locus_tag LOCUS_10340 18964 20607 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461634.1 protein_id gnl|my_center|LOCUS_10340 20604 21479 gene locus_tag LOCUS_10350 20604 21479 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819165.1 protein_id gnl|my_center|LOCUS_10350 21822 21532 gene locus_tag LOCUS_10360 21822 21532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 22569 22051 gene locus_tag LOCUS_10370 22569 22051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 22980 22905 gene locus_tag LOCUS_t00250 22980 22905 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 24383 23079 gene locus_tag LOCUS_10380 24383 23079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 24568 25479 gene locus_tag LOCUS_10390 24568 25479 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_10390 25989 25534 gene locus_tag LOCUS_10400 25989 25534 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892531.1 protein_id gnl|my_center|LOCUS_10400 26706 26122 gene locus_tag LOCUS_10410 26706 26122 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_10410 27876 26719 gene locus_tag LOCUS_10420 27876 26719 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_10420 29844 28111 gene locus_tag LOCUS_10430 29844 28111 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_10430 31661 29838 gene locus_tag LOCUS_10440 31661 29838 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_10440 33112 31970 gene locus_tag LOCUS_10450 gene leuB 33112 31970 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143540.1 protein_id gnl|my_center|LOCUS_10450 33622 33116 gene locus_tag LOCUS_10460 gene leuD 33622 33116 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583553.1 protein_id gnl|my_center|LOCUS_10460 34906 33641 gene locus_tag LOCUS_10470 gene leuC 34906 33641 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_10470 36201 34927 gene locus_tag LOCUS_10480 36201 34927 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460075.1 protein_id gnl|my_center|LOCUS_10480 37863 36208 gene locus_tag LOCUS_10490 gene ilvD 37863 36208 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_10490 39114 37915 gene locus_tag LOCUS_10500 gene ilvA 39114 37915 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_10500 40828 39125 gene locus_tag LOCUS_10510 gene ilvB 40828 39125 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_10510 42016 40997 gene locus_tag LOCUS_10520 gene ilvC 42016 40997 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142651.1 protein_id gnl|my_center|LOCUS_10520 42681 42175 gene locus_tag LOCUS_10530 gene ilvN 42681 42175 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_10530 44383 42686 gene locus_tag LOCUS_10540 44383 42686 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_10540 45957 44422 gene locus_tag LOCUS_10550 45957 44422 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_10550 46845 46639 gene locus_tag LOCUS_10560 46845 46639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence019 2306 333 gene locus_tag LOCUS_10570 gene htpG 2306 333 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_10570 2614 2907 gene locus_tag LOCUS_10580 2614 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 3162 3410 gene locus_tag LOCUS_10590 3162 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4196 3492 gene locus_tag LOCUS_10600 4196 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5318 4233 gene locus_tag LOCUS_10610 5318 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5537 7792 gene locus_tag LOCUS_10620 5537 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 7785 9167 gene locus_tag LOCUS_10630 7785 9167 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_10630 9171 11555 gene locus_tag LOCUS_10640 9171 11555 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_10640 11597 12337 gene locus_tag LOCUS_10650 11597 12337 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_10650 13400 12399 gene locus_tag LOCUS_10660 13400 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 15602 13512 gene locus_tag LOCUS_10670 15602 13512 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399551.1 protein_id gnl|my_center|LOCUS_10670 15960 15622 gene locus_tag LOCUS_10680 15960 15622 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_10680 16659 16147 gene locus_tag LOCUS_10690 16659 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 17549 16776 gene locus_tag LOCUS_10700 17549 16776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10700 17977 18981 gene locus_tag LOCUS_10710 17977 18981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 19671 19045 gene locus_tag LOCUS_10720 19671 19045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 20476 19892 gene locus_tag LOCUS_10730 20476 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 20915 21646 gene locus_tag LOCUS_10740 20915 21646 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853259.1 protein_id gnl|my_center|LOCUS_10740 21771 22667 gene locus_tag LOCUS_10750 21771 22667 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461725.1 protein_id gnl|my_center|LOCUS_10750 22745 23494 gene locus_tag LOCUS_10760 22745 23494 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853332.1 protein_id gnl|my_center|LOCUS_10760 23498 24145 gene locus_tag LOCUS_10770 23498 24145 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853290.1 protein_id gnl|my_center|LOCUS_10770 24168 24863 gene locus_tag LOCUS_10780 24168 24863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 26574 25147 gene locus_tag LOCUS_10790 26574 25147 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_10790 27430 26603 gene locus_tag LOCUS_10800 gene rhaD 27430 26603 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924506.1 protein_id gnl|my_center|LOCUS_10800 28921 27491 gene locus_tag LOCUS_10810 28921 27491 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_10810 29085 29975 gene locus_tag LOCUS_10820 29085 29975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 30889 29972 gene locus_tag LOCUS_10830 30889 29972 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390165.1 protein_id gnl|my_center|LOCUS_10830 31759 30893 gene locus_tag LOCUS_10840 31759 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 33302 31896 gene locus_tag LOCUS_10850 33302 31896 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644020.1 protein_id gnl|my_center|LOCUS_10850 35837 33393 gene locus_tag LOCUS_10860 35837 33393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 35943 36926 gene locus_tag LOCUS_10870 35943 36926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 37160 37393 gene locus_tag LOCUS_10880 37160 37393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10880 37390 37578 gene locus_tag LOCUS_10890 37390 37578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10890 37665 38048 gene locus_tag LOCUS_10900 37665 38048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 38054 38290 gene locus_tag LOCUS_10910 38054 38290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10910 38343 38969 gene locus_tag LOCUS_10920 38343 38969 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 protein_id gnl|my_center|LOCUS_10920 39337 40080 gene locus_tag LOCUS_10930 gene pflA 39337 40080 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_10930 40091 42361 gene locus_tag LOCUS_10940 gene pflB 40091 42361 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_10940 43796 43521 gene locus_tag LOCUS_10950 43796 43521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 44071 45093 gene locus_tag LOCUS_10960 44071 45093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 46513 45245 gene locus_tag LOCUS_10970 gene pepT 46513 45245 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence020 1019 126 gene locus_tag LOCUS_10980 1019 126 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_10980 1263 2297 gene locus_tag LOCUS_10990 1263 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 2355 3176 gene locus_tag LOCUS_11000 2355 3176 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_11000 4265 3264 gene locus_tag LOCUS_11010 4265 3264 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089142.1 protein_id gnl|my_center|LOCUS_11010 4619 4936 gene locus_tag LOCUS_11020 4619 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5972 5019 gene locus_tag LOCUS_11030 5972 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 6892 6143 gene locus_tag LOCUS_11040 6892 6143 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_11040 7712 7077 gene locus_tag LOCUS_11050 7712 7077 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386997.1 protein_id gnl|my_center|LOCUS_11050 7997 8299 gene locus_tag LOCUS_11060 7997 8299 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991611.1 protein_id gnl|my_center|LOCUS_11060 8309 8626 gene locus_tag LOCUS_11070 8309 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 9206 8829 gene locus_tag LOCUS_11080 9206 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 9469 9819 gene locus_tag LOCUS_11090 9469 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 10701 9952 gene locus_tag LOCUS_11100 10701 9952 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724030.1 protein_id gnl|my_center|LOCUS_11100 12223 10928 gene locus_tag LOCUS_11110 gene pyrP 12223 10928 CDS product uracil permease PyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221479.1 protein_id gnl|my_center|LOCUS_11110 12526 12678 gene locus_tag LOCUS_11120 12526 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 15213 13138 gene locus_tag LOCUS_11130 15213 13138 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_11130 16015 15203 gene locus_tag LOCUS_11140 16015 15203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_11140 17170 16103 gene locus_tag LOCUS_11150 17170 16103 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_11150 17847 17167 gene locus_tag LOCUS_11160 17847 17167 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_11160 18059 18754 gene locus_tag LOCUS_11170 18059 18754 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890784.1 protein_id gnl|my_center|LOCUS_11170 19572 18751 gene locus_tag LOCUS_11180 19572 18751 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890403.1 protein_id gnl|my_center|LOCUS_11180 20357 19569 gene locus_tag LOCUS_11190 20357 19569 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547854.1 protein_id gnl|my_center|LOCUS_11190 20564 21238 gene locus_tag LOCUS_11200 gene cutC 20564 21238 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356490.1 protein_id gnl|my_center|LOCUS_11200 21653 21303 gene locus_tag LOCUS_11210 21653 21303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 21537 21812 gene locus_tag LOCUS_11220 21537 21812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 22436 21702 gene locus_tag LOCUS_11230 22436 21702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11230 22906 22436 gene locus_tag LOCUS_11240 gene ohrR 22906 22436 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_11240 23448 22906 gene locus_tag LOCUS_11250 23448 22906 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_11250 24569 23574 gene locus_tag LOCUS_11260 24569 23574 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886390.1 protein_id gnl|my_center|LOCUS_11260 25107 25520 gene locus_tag LOCUS_11270 25107 25520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 26104 25718 gene locus_tag LOCUS_11280 26104 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 26337 26089 gene locus_tag LOCUS_11290 26337 26089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 26461 26874 gene locus_tag LOCUS_11300 26461 26874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 27329 27646 gene locus_tag LOCUS_11310 27329 27646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 27643 28026 gene locus_tag LOCUS_11320 27643 28026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 28023 28301 gene locus_tag LOCUS_11330 28023 28301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 29280 29489 gene locus_tag LOCUS_11340 29280 29489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 29486 32728 gene locus_tag LOCUS_11350 29486 32728 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_11350 32722 33354 gene locus_tag LOCUS_11360 32722 33354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 33351 35057 gene locus_tag LOCUS_11370 33351 35057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 35074 36957 gene locus_tag LOCUS_11380 35074 36957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 37032 38564 gene locus_tag LOCUS_11390 37032 38564 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948261.1 protein_id gnl|my_center|LOCUS_11390 38561 41752 gene locus_tag LOCUS_11400 38561 41752 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088592653.1 protein_id gnl|my_center|LOCUS_11400 43995 42313 gene locus_tag LOCUS_11410 43995 42313 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence021 384 130 gene locus_tag LOCUS_11420 384 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1507 371 gene locus_tag LOCUS_11430 1507 371 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_11430 2095 1589 gene locus_tag LOCUS_11440 gene mog 2095 1589 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986482.1 protein_id gnl|my_center|LOCUS_11440 3147 2101 gene locus_tag LOCUS_11450 3147 2101 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435117.1 protein_id gnl|my_center|LOCUS_11450 3626 3159 gene locus_tag LOCUS_11460 3626 3159 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943767.1 protein_id gnl|my_center|LOCUS_11460 4102 3623 gene locus_tag LOCUS_11470 gene moaC 4102 3623 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101438.1 protein_id gnl|my_center|LOCUS_11470 5057 4104 gene locus_tag LOCUS_11480 gene moaA 5057 4104 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943757.1 protein_id gnl|my_center|LOCUS_11480 6132 5050 gene locus_tag LOCUS_11490 6132 5050 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_11490 6815 6132 gene locus_tag LOCUS_11500 gene modB 6815 6132 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_11500 7709 6858 gene locus_tag LOCUS_11510 gene modA 7709 6858 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949046.1 protein_id gnl|my_center|LOCUS_11510 8827 7784 gene locus_tag LOCUS_11520 8827 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 9888 8818 gene locus_tag LOCUS_11530 gene selD 9888 8818 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957237.1 protein_id gnl|my_center|LOCUS_11530 10688 9888 gene locus_tag LOCUS_11540 gene yqeB 10688 9888 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_11540 10931 10698 gene locus_tag LOCUS_11550 10931 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 12109 10928 gene locus_tag LOCUS_11560 12109 10928 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392916.1 protein_id gnl|my_center|LOCUS_11560 12747 12121 gene locus_tag LOCUS_11570 gene yedF 12747 12121 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356602.1 protein_id gnl|my_center|LOCUS_11570 12970 13632 gene locus_tag LOCUS_11580 gene yqeC 12970 13632 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_11580 14088 13708 gene locus_tag LOCUS_11590 14088 13708 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939916.1 protein_id gnl|my_center|LOCUS_11590 15503 14151 gene locus_tag LOCUS_11600 gene hydA 15503 14151 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387141.1 protein_id gnl|my_center|LOCUS_11600 16453 15500 gene locus_tag LOCUS_11610 16453 15500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 17423 16482 gene locus_tag LOCUS_11620 gene arcC 17423 16482 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367131.1 protein_id gnl|my_center|LOCUS_11620 18718 17516 gene locus_tag LOCUS_11630 gene ygeW 18718 17516 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_11630 20151 18766 gene locus_tag LOCUS_11640 20151 18766 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 protein_id gnl|my_center|LOCUS_11640 21689 20457 gene locus_tag LOCUS_11650 gene dpaL 21689 20457 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819571.1 protein_id gnl|my_center|LOCUS_11650 22821 21871 gene locus_tag LOCUS_11660 22821 21871 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_11660 25832 22974 gene locus_tag LOCUS_11670 gene xdh 25832 22974 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_11670 26381 25842 gene locus_tag LOCUS_11680 26381 25842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 29446 26456 gene locus_tag LOCUS_11690 gene ygfK 29446 26456 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_11690 30871 29528 gene locus_tag LOCUS_11700 gene ssnA 30871 29528 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_11700 31237 31890 gene locus_tag LOCUS_11710 31237 31890 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_11710 32773 31982 gene locus_tag LOCUS_11720 32773 31982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11720 33440 33222 gene locus_tag LOCUS_11730 33440 33222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11730 33589 34845 gene locus_tag LOCUS_11740 33589 34845 CDS product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 protein_id gnl|my_center|LOCUS_11740 35782 34826 gene locus_tag LOCUS_11750 35782 34826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 36016 36222 gene locus_tag LOCUS_11760 36016 36222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 37023 36316 gene locus_tag LOCUS_11770 37023 36316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 37156 37482 gene locus_tag LOCUS_11780 37156 37482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11780 37634 37437 gene locus_tag LOCUS_11790 37634 37437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 37587 38234 gene locus_tag LOCUS_11800 37587 38234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11800 38556 39221 gene locus_tag LOCUS_11810 38556 39221 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_11810 39982 39299 gene locus_tag LOCUS_11820 39982 39299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 40111 40671 gene locus_tag LOCUS_11830 40111 40671 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898156.1 protein_id gnl|my_center|LOCUS_11830 41045 40668 gene locus_tag LOCUS_11840 41045 40668 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625774.1 protein_id gnl|my_center|LOCUS_11840 41958 41104 gene locus_tag LOCUS_11850 41958 41104 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390165.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence022 1500 112 gene locus_tag LOCUS_11860 1500 112 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391765.1 protein_id gnl|my_center|LOCUS_11860 2404 1508 gene locus_tag LOCUS_11870 gene galU 2404 1508 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_11870 3510 2587 gene locus_tag LOCUS_11880 3510 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3957 3517 gene locus_tag LOCUS_11890 3957 3517 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673217.1 protein_id gnl|my_center|LOCUS_11890 5381 4098 gene locus_tag LOCUS_11900 gene murA 5381 4098 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 protein_id gnl|my_center|LOCUS_11900 5827 5393 gene locus_tag LOCUS_11910 5827 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 7328 5838 gene locus_tag LOCUS_11920 gene atpD 7328 5838 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966149.1 protein_id gnl|my_center|LOCUS_11920 8242 7328 gene locus_tag LOCUS_11930 gene atpG 8242 7328 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035800.1 protein_id gnl|my_center|LOCUS_11930 9863 8253 gene locus_tag LOCUS_11940 gene atpA 9863 8253 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027518.1 protein_id gnl|my_center|LOCUS_11940 10330 9863 gene locus_tag LOCUS_11950 10330 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 10928 10314 gene locus_tag LOCUS_11960 10928 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 11148 10960 gene locus_tag LOCUS_11970 11148 10960 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 protein_id gnl|my_center|LOCUS_11970 12048 11239 gene locus_tag LOCUS_11980 12048 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 12355 12083 gene locus_tag LOCUS_11990 12355 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 13166 12522 gene locus_tag LOCUS_12000 gene upp 13166 12522 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027487.1 protein_id gnl|my_center|LOCUS_12000 13639 13169 gene locus_tag LOCUS_12010 gene rpiB 13639 13169 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_12010 15196 13715 gene locus_tag LOCUS_12020 gene glpK 15196 13715 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_12020 15465 15914 gene locus_tag LOCUS_12030 15465 15914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12030 15959 16906 gene locus_tag LOCUS_12040 15959 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12040 16966 18444 gene locus_tag LOCUS_12050 16966 18444 CDS product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101979.1 protein_id gnl|my_center|LOCUS_12050 18492 18740 gene locus_tag LOCUS_12060 18492 18740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 18883 19500 gene locus_tag LOCUS_12070 18883 19500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 19497 20120 gene locus_tag LOCUS_12080 19497 20120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 20236 21000 gene locus_tag LOCUS_12090 20236 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 21713 21075 gene locus_tag LOCUS_12100 21713 21075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 22787 21717 gene locus_tag LOCUS_12110 22787 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 23925 22858 gene locus_tag LOCUS_12120 gene prfA 23925 22858 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_12120 26191 24068 gene locus_tag LOCUS_12130 26191 24068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 26372 27175 gene locus_tag LOCUS_12140 26372 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 28371 27937 gene locus_tag LOCUS_12150 28371 27937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 28567 29349 gene locus_tag LOCUS_12160 28567 29349 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_12160 30056 29346 gene locus_tag LOCUS_12170 30056 29346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 31502 30060 gene locus_tag LOCUS_12180 31502 30060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 32357 31617 gene locus_tag LOCUS_12190 32357 31617 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_12190 32421 33320 gene locus_tag LOCUS_12200 32421 33320 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854943.1 protein_id gnl|my_center|LOCUS_12200 33375 34154 gene locus_tag LOCUS_12210 33375 34154 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_12210 35018 34209 gene locus_tag LOCUS_12220 35018 34209 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963831.1 protein_id gnl|my_center|LOCUS_12220 35518 35126 gene locus_tag LOCUS_12230 35518 35126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 36687 35518 gene locus_tag LOCUS_12240 36687 35518 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806343.1 protein_id gnl|my_center|LOCUS_12240 38688 36724 gene locus_tag LOCUS_12250 gene ftsH 38688 36724 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243881.1 protein_id gnl|my_center|LOCUS_12250 39293 38745 gene locus_tag LOCUS_12260 gene hpt 39293 38745 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567626.1 protein_id gnl|my_center|LOCUS_12260 40821 39298 gene locus_tag LOCUS_12270 gene tilS 40821 39298 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_12270 40930 41754 gene locus_tag LOCUS_12280 40930 41754 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence023 1122 91 gene locus_tag LOCUS_12290 1122 91 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027206.1 protein_id gnl|my_center|LOCUS_12290 2018 1260 gene locus_tag LOCUS_12300 2018 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3199 2288 gene locus_tag LOCUS_12310 gene cysK 3199 2288 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_12310 3825 3385 gene locus_tag LOCUS_12320 3825 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 4620 3946 gene locus_tag LOCUS_12330 4620 3946 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355118.1 protein_id gnl|my_center|LOCUS_12330 5405 4623 gene locus_tag LOCUS_12340 gene murI 5405 4623 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475984.1 protein_id gnl|my_center|LOCUS_12340 6042 5419 gene locus_tag LOCUS_12350 6042 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 6106 6669 gene locus_tag LOCUS_12360 6106 6669 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_12360 7544 6666 gene locus_tag LOCUS_12370 7544 6666 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059810.1 protein_id gnl|my_center|LOCUS_12370 7624 8586 gene locus_tag LOCUS_12380 7624 8586 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272197.1 protein_id gnl|my_center|LOCUS_12380 9206 8652 gene locus_tag LOCUS_12390 9206 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 9714 9190 gene locus_tag LOCUS_12400 9714 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 10586 9726 gene locus_tag LOCUS_12410 10586 9726 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890755.1 protein_id gnl|my_center|LOCUS_12410 11291 10608 gene locus_tag LOCUS_12420 11291 10608 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044451.1 protein_id gnl|my_center|LOCUS_12420 11436 11927 gene locus_tag LOCUS_12430 11436 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 12412 11984 gene locus_tag LOCUS_12440 12412 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 13280 13044 gene locus_tag LOCUS_12450 13280 13044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 13575 14837 gene locus_tag LOCUS_12460 13575 14837 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_12460 14892 15719 gene locus_tag LOCUS_12470 14892 15719 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_12470 16508 15798 gene locus_tag LOCUS_12480 16508 15798 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_12480 17007 16519 gene locus_tag LOCUS_12490 17007 16519 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_12490 17859 17053 gene locus_tag LOCUS_12500 17859 17053 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389509.1 protein_id gnl|my_center|LOCUS_12500 20341 17861 gene locus_tag LOCUS_12510 20341 17861 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804532.1 protein_id gnl|my_center|LOCUS_12510 21654 20443 gene locus_tag LOCUS_12520 21654 20443 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_12520 22616 21681 gene locus_tag LOCUS_12530 22616 21681 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986031.1 protein_id gnl|my_center|LOCUS_12530 22836 23285 gene locus_tag LOCUS_12540 22836 23285 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723309.1 protein_id gnl|my_center|LOCUS_12540 24248 23340 gene locus_tag LOCUS_12550 24248 23340 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143687.1 protein_id gnl|my_center|LOCUS_12550 24871 24359 gene locus_tag LOCUS_12560 24871 24359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 25326 24868 gene locus_tag LOCUS_12570 25326 24868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 25533 28502 gene locus_tag LOCUS_12580 25533 28502 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966288.1 protein_id gnl|my_center|LOCUS_12580 28503 29828 gene locus_tag LOCUS_12590 28503 29828 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047742.1 protein_id gnl|my_center|LOCUS_12590 29821 31545 gene locus_tag LOCUS_12600 29821 31545 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047743.1 protein_id gnl|my_center|LOCUS_12600 33618 31627 gene locus_tag LOCUS_12610 33618 31627 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390346.1 protein_id gnl|my_center|LOCUS_12610 34428 34060 gene locus_tag LOCUS_12620 34428 34060 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_12620 35834 34503 gene locus_tag LOCUS_12630 35834 34503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 37372 35867 gene locus_tag LOCUS_12640 37372 35867 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_12640 38903 37506 gene locus_tag LOCUS_12650 38903 37506 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_12650 39309 39500 gene locus_tag LOCUS_12660 39309 39500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence024 169 5 gene locus_tag LOCUS_12670 169 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 534 169 gene locus_tag LOCUS_12680 534 169 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722125.1 protein_id gnl|my_center|LOCUS_12680 826 527 gene locus_tag LOCUS_12690 826 527 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478850.1 protein_id gnl|my_center|LOCUS_12690 2793 880 gene locus_tag LOCUS_12700 gene licR 2793 880 CDS product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 protein_id gnl|my_center|LOCUS_12700 2898 3278 gene locus_tag LOCUS_12710 2898 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 4895 3705 gene locus_tag LOCUS_12720 4895 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 5894 4977 gene locus_tag LOCUS_12730 5894 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 6466 5891 gene locus_tag LOCUS_12740 6466 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 7565 6528 gene locus_tag LOCUS_12750 7565 6528 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 protein_id gnl|my_center|LOCUS_12750 8660 7584 gene locus_tag LOCUS_12760 8660 7584 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641280.1 protein_id gnl|my_center|LOCUS_12760 9240 8650 gene locus_tag LOCUS_12770 gene raiA 9240 8650 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_12770 10286 9369 gene locus_tag LOCUS_12780 10286 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 11401 10736 gene locus_tag LOCUS_12790 11401 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 12205 11438 gene locus_tag LOCUS_12800 12205 11438 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 protein_id gnl|my_center|LOCUS_12800 13279 12272 gene locus_tag LOCUS_12810 13279 12272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 14198 13266 gene locus_tag LOCUS_12820 gene rsmA 14198 13266 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388190.1 protein_id gnl|my_center|LOCUS_12820 15804 14203 gene locus_tag LOCUS_12830 gene metG 15804 14203 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080396.1 protein_id gnl|my_center|LOCUS_12830 16116 15922 gene locus_tag LOCUS_12840 16116 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 17231 16209 gene locus_tag LOCUS_12850 17231 16209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 18326 17463 gene locus_tag LOCUS_12860 gene rsmI 18326 17463 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837307.1 protein_id gnl|my_center|LOCUS_12860 19378 18326 gene locus_tag LOCUS_12870 19378 18326 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740878.1 protein_id gnl|my_center|LOCUS_12870 19959 19480 gene locus_tag LOCUS_12880 gene queD 19959 19480 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966887.1 protein_id gnl|my_center|LOCUS_12880 20209 19943 gene locus_tag LOCUS_12890 20209 19943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 21553 20225 gene locus_tag LOCUS_12900 21553 20225 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_12900 23263 21683 gene locus_tag LOCUS_12910 23263 21683 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257012.1 protein_id gnl|my_center|LOCUS_12910 24384 23260 gene locus_tag LOCUS_12920 gene holB 24384 23260 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_12920 25018 24377 gene locus_tag LOCUS_12930 gene tmk 25018 24377 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_12930 27596 25020 gene locus_tag LOCUS_12940 27596 25020 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902213.1 protein_id gnl|my_center|LOCUS_12940 28397 27606 gene locus_tag LOCUS_12950 gene tatC 28397 27606 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887452.1 protein_id gnl|my_center|LOCUS_12950 29038 28400 gene locus_tag LOCUS_12960 29038 28400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 29393 29082 gene locus_tag LOCUS_12970 29393 29082 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429306.1 protein_id gnl|my_center|LOCUS_12970 30329 29424 gene locus_tag LOCUS_12980 30329 29424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 31857 30520 gene locus_tag LOCUS_12990 31857 30520 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_12990 31926 32234 gene locus_tag LOCUS_13000 31926 32234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 33784 32324 gene locus_tag LOCUS_13010 gene nhaA 33784 32324 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_13010 33997 34878 gene locus_tag LOCUS_13020 33997 34878 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357950.1 protein_id gnl|my_center|LOCUS_13020 34953 35618 gene locus_tag LOCUS_13030 gene pyrE 34953 35618 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_13030 36734 35775 gene locus_tag LOCUS_13040 36734 35775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence025 269 39 gene locus_tag LOCUS_13050 269 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1984 356 gene locus_tag LOCUS_13060 1984 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2350 1994 gene locus_tag LOCUS_13070 2350 1994 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_13070 2481 2846 gene locus_tag LOCUS_13080 2481 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3103 4914 gene locus_tag LOCUS_13090 3103 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 5852 5067 gene locus_tag LOCUS_13100 5852 5067 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_13100 7200 5845 gene locus_tag LOCUS_13110 7200 5845 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_13110 8166 7609 gene locus_tag LOCUS_13120 gene idi 8166 7609 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261194.1 protein_id gnl|my_center|LOCUS_13120 8728 8168 gene locus_tag LOCUS_13130 8728 8168 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764801.1 protein_id gnl|my_center|LOCUS_13130 10232 8751 gene locus_tag LOCUS_13140 10232 8751 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704601.1 protein_id gnl|my_center|LOCUS_13140 10560 10324 gene locus_tag LOCUS_13150 10560 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 11161 10562 gene locus_tag LOCUS_13160 11161 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 11809 11258 gene locus_tag LOCUS_13170 11809 11258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13170 12233 11778 gene locus_tag LOCUS_13180 12233 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 13963 12575 gene locus_tag LOCUS_13190 13963 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 14382 13972 gene locus_tag LOCUS_13200 14382 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 14595 14401 gene locus_tag LOCUS_13210 14595 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 15046 16071 gene locus_tag LOCUS_13220 15046 16071 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083793.1 protein_id gnl|my_center|LOCUS_13220 16172 16660 gene locus_tag LOCUS_13230 16172 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 17452 16859 gene locus_tag LOCUS_13240 17452 16859 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136889.1 protein_id gnl|my_center|LOCUS_13240 18253 17990 gene locus_tag LOCUS_13250 18253 17990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 19897 18254 gene locus_tag LOCUS_13260 19897 18254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 20809 19985 gene locus_tag LOCUS_13270 20809 19985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 21520 20822 gene locus_tag LOCUS_13280 21520 20822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 22930 21533 gene locus_tag LOCUS_13290 22930 21533 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_13290 22980 23318 gene locus_tag LOCUS_13300 22980 23318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 23330 24082 gene locus_tag LOCUS_13310 23330 24082 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_13310 24094 24666 gene locus_tag LOCUS_13320 24094 24666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 24756 25301 gene locus_tag LOCUS_13330 24756 25301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13330 26113 25466 gene locus_tag LOCUS_13340 26113 25466 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460050.1 protein_id gnl|my_center|LOCUS_13340 27165 26110 gene locus_tag LOCUS_13350 gene ada 27165 26110 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190110.1 protein_id gnl|my_center|LOCUS_13350 27569 27345 gene locus_tag LOCUS_13360 27569 27345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 28087 27497 gene locus_tag LOCUS_13370 28087 27497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13370 28510 28815 gene locus_tag LOCUS_13380 28510 28815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 30413 29337 gene locus_tag LOCUS_13390 30413 29337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 31642 30410 gene locus_tag LOCUS_13400 31642 30410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 32024 32455 gene locus_tag LOCUS_13410 32024 32455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 32719 32934 gene locus_tag LOCUS_13420 32719 32934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 32906 33241 gene locus_tag LOCUS_13430 32906 33241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 33300 33755 gene locus_tag LOCUS_13440 33300 33755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence026 1785 388 gene locus_tag LOCUS_13450 gene istA 1785 388 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_13450 1944 1801 gene locus_tag LOCUS_13460 1944 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2234 3829 gene locus_tag LOCUS_13470 gene istA 2234 3829 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_13470 3816 4586 gene locus_tag LOCUS_13480 gene istB 3816 4586 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_13480 4733 4972 gene locus_tag LOCUS_13490 4733 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5231 5040 gene locus_tag LOCUS_13500 5231 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 5404 5667 gene locus_tag LOCUS_13510 5404 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6858 5818 gene locus_tag LOCUS_13520 6858 5818 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015263273.1 protein_id gnl|my_center|LOCUS_13520 7590 6868 gene locus_tag LOCUS_13530 7590 6868 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981011.1 protein_id gnl|my_center|LOCUS_13530 8424 7597 gene locus_tag LOCUS_13540 8424 7597 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379605.1 protein_id gnl|my_center|LOCUS_13540 8782 8450 gene locus_tag LOCUS_13550 8782 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 10577 9843 gene locus_tag LOCUS_13560 10577 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 12320 11367 gene locus_tag LOCUS_13570 12320 11367 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101287.1 protein_id gnl|my_center|LOCUS_13570 13786 12323 gene locus_tag LOCUS_13580 13786 12323 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068371.1 protein_id gnl|my_center|LOCUS_13580 14817 13798 gene locus_tag LOCUS_13590 gene rfbB 14817 13798 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389344.1 protein_id gnl|my_center|LOCUS_13590 15720 14821 gene locus_tag LOCUS_13600 gene rfbA 15720 14821 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_13600 16510 15722 gene locus_tag LOCUS_13610 16510 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 17337 16705 gene locus_tag LOCUS_13620 17337 16705 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113620978.1 protein_id gnl|my_center|LOCUS_13620 21026 18051 gene locus_tag LOCUS_13630 21026 18051 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_13630 21945 21094 gene locus_tag LOCUS_13640 21945 21094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 22470 22030 gene locus_tag LOCUS_13650 22470 22030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 22987 23559 gene locus_tag LOCUS_13660 22987 23559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 23617 23772 gene locus_tag LOCUS_13670 23617 23772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 24407 23769 gene locus_tag LOCUS_13680 24407 23769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 25784 24426 gene locus_tag LOCUS_13690 25784 24426 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_13690 25762 25977 gene locus_tag LOCUS_13700 25762 25977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 25998 27494 gene locus_tag LOCUS_13710 25998 27494 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963666.1 protein_id gnl|my_center|LOCUS_13710 29124 27931 gene locus_tag LOCUS_13720 29124 27931 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496601.1 protein_id gnl|my_center|LOCUS_13720 31724 29658 gene locus_tag LOCUS_13730 gene fusA 31724 29658 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869860.1 protein_id gnl|my_center|LOCUS_13730 32482 31895 gene locus_tag LOCUS_13740 32482 31895 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136487.1 protein_id gnl|my_center|LOCUS_13740 32842 32483 gene locus_tag LOCUS_13750 gene crcB 32842 32483 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971646.1 protein_id gnl|my_center|LOCUS_13750 33083 33448 gene locus_tag LOCUS_13760 33083 33448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 33672 33460 gene locus_tag LOCUS_13770 33672 33460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence027 96 680 gene locus_tag LOCUS_13780 96 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1669 866 gene locus_tag LOCUS_13790 1669 866 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 protein_id gnl|my_center|LOCUS_13790 3126 1678 gene locus_tag LOCUS_13800 3126 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 4667 3123 gene locus_tag LOCUS_13810 4667 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4818 5147 gene locus_tag LOCUS_13820 4818 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 6902 5151 gene locus_tag LOCUS_13830 6902 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 7836 6904 gene locus_tag LOCUS_13840 gene rbsK 7836 6904 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_13840 7937 8158 gene locus_tag LOCUS_13850 7937 8158 CDS product FaeA/PapI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813931.1 protein_id gnl|my_center|LOCUS_13850 8262 8918 gene locus_tag LOCUS_13860 8262 8918 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_13860 10174 8915 gene locus_tag LOCUS_13870 10174 8915 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_13870 10851 10171 gene locus_tag LOCUS_13880 10851 10171 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_13880 11033 12655 gene locus_tag LOCUS_13890 gene dltA 11033 12655 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242511.1 protein_id gnl|my_center|LOCUS_13890 12669 13844 gene locus_tag LOCUS_13900 gene dltB 12669 13844 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426712.1 protein_id gnl|my_center|LOCUS_13900 13846 14106 gene locus_tag LOCUS_13910 gene dltC 13846 14106 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130226.1 protein_id gnl|my_center|LOCUS_13910 14120 15352 gene locus_tag LOCUS_13920 gene dltD 14120 15352 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808969.1 protein_id gnl|my_center|LOCUS_13920 15349 15549 gene locus_tag LOCUS_13930 15349 15549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 17297 15636 gene locus_tag LOCUS_13940 17297 15636 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751431.1 protein_id gnl|my_center|LOCUS_13940 18329 17412 gene locus_tag LOCUS_13950 18329 17412 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 protein_id gnl|my_center|LOCUS_13950 19064 18495 gene locus_tag LOCUS_13960 19064 18495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 19460 19098 gene locus_tag LOCUS_13970 19460 19098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 20247 19453 gene locus_tag LOCUS_13980 20247 19453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 20426 21295 gene locus_tag LOCUS_13990 gene metF 20426 21295 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_13990 21342 22010 gene locus_tag LOCUS_14000 21342 22010 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_14000 21994 24513 gene locus_tag LOCUS_14010 21994 24513 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_14010 25444 24644 gene locus_tag LOCUS_14020 25444 24644 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113651.1 protein_id gnl|my_center|LOCUS_14020 26271 25588 gene locus_tag LOCUS_14030 26271 25588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 27701 26268 gene locus_tag LOCUS_14040 27701 26268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 28612 27698 gene locus_tag LOCUS_14050 28612 27698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 29762 28599 gene locus_tag LOCUS_14060 29762 28599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 32499 29764 gene locus_tag LOCUS_14070 32499 29764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 33021 33497 gene locus_tag LOCUS_14080 33021 33497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence028 1485 73 gene locus_tag LOCUS_14090 1485 73 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783579.1 protein_id gnl|my_center|LOCUS_14090 4905 2218 gene locus_tag LOCUS_14100 4905 2218 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_14100 5968 5171 gene locus_tag LOCUS_14110 5968 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 6697 7167 gene locus_tag LOCUS_14120 6697 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 7164 7652 gene locus_tag LOCUS_14130 7164 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 7994 7812 gene locus_tag LOCUS_14140 7994 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 7926 8615 gene locus_tag LOCUS_14150 7926 8615 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_14150 8609 9421 gene locus_tag LOCUS_14160 8609 9421 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 protein_id gnl|my_center|LOCUS_14160 9610 12504 gene locus_tag LOCUS_14170 9610 12504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 13938 12652 gene locus_tag LOCUS_14180 gene clpX 13938 12652 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_14180 14562 13942 gene locus_tag LOCUS_14190 gene clpP 14562 13942 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_14190 16000 14657 gene locus_tag LOCUS_14200 gene tig 16000 14657 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127573.1 protein_id gnl|my_center|LOCUS_14200 16155 16071 gene locus_tag LOCUS_t00260 16155 16071 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19535 16302 gene locus_tag LOCUS_14210 gene carB 19535 16302 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_14210 20842 19535 gene locus_tag LOCUS_14220 gene carA 20842 19535 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081322.1 protein_id gnl|my_center|LOCUS_14220 22032 21598 gene locus_tag LOCUS_14230 22032 21598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 22013 22327 gene locus_tag LOCUS_14240 22013 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 22403 22633 gene locus_tag LOCUS_14250 22403 22633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 22713 23048 gene locus_tag LOCUS_14260 22713 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 24376 23045 gene locus_tag LOCUS_14270 gene gdhA 24376 23045 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 protein_id gnl|my_center|LOCUS_14270 24664 25470 gene locus_tag LOCUS_14280 24664 25470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 25520 25596 gene locus_tag LOCUS_t00270 25520 25596 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 25603 25678 gene locus_tag LOCUS_t00280 25603 25678 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25997 27016 gene locus_tag LOCUS_14290 25997 27016 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_14290 27020 27931 gene locus_tag LOCUS_14300 27020 27931 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_14300 29710 28007 gene locus_tag LOCUS_14310 gene ptsP 29710 28007 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475729.1 protein_id gnl|my_center|LOCUS_14310 30764 29829 gene locus_tag LOCUS_14320 gene pfkB 30764 29829 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_14320 31299 30847 gene locus_tag LOCUS_14330 31299 30847 CDS product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263697.1 protein_id gnl|my_center|LOCUS_14330 31635 31711 gene locus_tag LOCUS_t00290 31635 31711 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32338 31754 gene locus_tag LOCUS_14340 32338 31754 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_14340 32472 32396 gene locus_tag LOCUS_t00300 32472 32396 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 32575 32499 gene locus_tag LOCUS_t00310 32575 32499 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 32668 32593 gene locus_tag LOCUS_t00320 32668 32593 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence029 816 613 gene locus_tag LOCUS_14350 816 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 986 1681 gene locus_tag LOCUS_14360 986 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1776 1976 gene locus_tag LOCUS_14370 1776 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2339 2055 gene locus_tag LOCUS_14380 2339 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 4239 2314 gene locus_tag LOCUS_14390 4239 2314 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921886.1 protein_id gnl|my_center|LOCUS_14390 4969 4352 gene locus_tag LOCUS_14400 4969 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 5322 4975 gene locus_tag LOCUS_14410 5322 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 5751 5323 gene locus_tag LOCUS_14420 5751 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 7811 5781 gene locus_tag LOCUS_14430 7811 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 8277 7801 gene locus_tag LOCUS_14440 8277 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 8461 8258 gene locus_tag LOCUS_14450 8461 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 8868 8458 gene locus_tag LOCUS_14460 8868 8458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 9092 8904 gene locus_tag LOCUS_14470 9092 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 9711 9106 gene locus_tag LOCUS_14480 9711 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 10605 9712 gene locus_tag LOCUS_14490 10605 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 11903 10581 gene locus_tag LOCUS_14500 11903 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 13301 11904 gene locus_tag LOCUS_14510 13301 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 13993 13298 gene locus_tag LOCUS_14520 13993 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 15465 14287 gene locus_tag LOCUS_14530 gene rsgA 15465 14287 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943166.1 protein_id gnl|my_center|LOCUS_14530 18145 15467 gene locus_tag LOCUS_14540 18145 15467 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_14540 18824 18336 gene locus_tag LOCUS_14550 18824 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 20019 18856 gene locus_tag LOCUS_14560 20019 18856 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705317.1 protein_id gnl|my_center|LOCUS_14560 21360 20071 gene locus_tag LOCUS_14570 21360 20071 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177663.1 protein_id gnl|my_center|LOCUS_14570 22558 21491 gene locus_tag LOCUS_14580 gene pdxA 22558 21491 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_14580 23454 22558 gene locus_tag LOCUS_14590 23454 22558 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126955.1 protein_id gnl|my_center|LOCUS_14590 24635 23481 gene locus_tag LOCUS_14600 24635 23481 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705320.1 protein_id gnl|my_center|LOCUS_14600 25867 24632 gene locus_tag LOCUS_14610 25867 24632 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063966.1 protein_id gnl|my_center|LOCUS_14610 26001 27776 gene locus_tag LOCUS_14620 26001 27776 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_14620 28571 27849 gene locus_tag LOCUS_14630 28571 27849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 28908 29927 gene locus_tag LOCUS_14640 28908 29927 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707803.1 protein_id gnl|my_center|LOCUS_14640 30279 31718 gene locus_tag LOCUS_14650 gene pyk 30279 31718 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_14650 <32598 31853 gene locus_tag LOCUS_14660 <32598 31853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113826.1:N-acetylglucosamine-6-phosphate deacetylase >Feature sequence030 239 114 gene locus_tag LOCUS_14670 239 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 443 1129 gene locus_tag LOCUS_14680 443 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1472 1239 gene locus_tag LOCUS_14690 gene rpmB 1472 1239 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056915.1 protein_id gnl|my_center|LOCUS_14690 1816 2160 gene locus_tag LOCUS_14700 1816 2160 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_14700 2211 3881 gene locus_tag LOCUS_14710 2211 3881 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001868429.1 protein_id gnl|my_center|LOCUS_14710 3885 6062 gene locus_tag LOCUS_14720 gene recG 3885 6062 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_14720 6059 6637 gene locus_tag LOCUS_14730 gene rsmD 6059 6637 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_14730 6638 7159 gene locus_tag LOCUS_14740 gene coaD 6638 7159 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393371.1 protein_id gnl|my_center|LOCUS_14740 7256 7753 gene locus_tag LOCUS_14750 7256 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 7763 8341 gene locus_tag LOCUS_14760 7763 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 8479 8658 gene locus_tag LOCUS_14770 gene rpmF 8479 8658 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_14770 8752 9753 gene locus_tag LOCUS_14780 gene plsX 8752 9753 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684092.1 protein_id gnl|my_center|LOCUS_14780 9789 10028 gene locus_tag LOCUS_14790 9789 10028 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531676.1 protein_id gnl|my_center|LOCUS_14790 10029 10760 gene locus_tag LOCUS_14800 gene rncS 10029 10760 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232030.1 protein_id gnl|my_center|LOCUS_14800 10800 14348 gene locus_tag LOCUS_14810 gene smc 10800 14348 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728333.1 protein_id gnl|my_center|LOCUS_14810 14341 15258 gene locus_tag LOCUS_14820 14341 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 15259 16701 gene locus_tag LOCUS_14830 gene ffh 15259 16701 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_14830 17362 17165 gene locus_tag LOCUS_14840 17362 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 18256 18056 gene locus_tag LOCUS_14850 18256 18056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 18800 19909 gene locus_tag LOCUS_14860 18800 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 20091 21788 gene locus_tag LOCUS_14870 20091 21788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 21946 22407 gene locus_tag LOCUS_14880 21946 22407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 22420 23556 gene locus_tag LOCUS_14890 gene cas7e 22420 23556 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_14890 23556 24293 gene locus_tag LOCUS_14900 23556 24293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 24290 24994 gene locus_tag LOCUS_14910 gene cas6e 24290 24994 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_14910 25357 25124 gene locus_tag LOCUS_14920 25357 25124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 25439 26026 gene locus_tag LOCUS_14930 25439 26026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 26023 26376 gene locus_tag LOCUS_14940 26023 26376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 26937 31053 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgctccccgcgtaagcggggatgatcc >Feature sequence031 1023 526 gene locus_tag LOCUS_14950 1023 526 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762812.1 protein_id gnl|my_center|LOCUS_14950 1773 1036 gene locus_tag LOCUS_14960 1773 1036 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_14960 3203 1857 gene locus_tag LOCUS_14970 3203 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4422 3184 gene locus_tag LOCUS_14980 4422 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5029 5718 gene locus_tag LOCUS_14990 5029 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 5721 7559 gene locus_tag LOCUS_15000 5721 7559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886531.1 protein_id gnl|my_center|LOCUS_15000 7656 7581 gene locus_tag LOCUS_t00330 7656 7581 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7793 7717 gene locus_tag LOCUS_t00340 7793 7717 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 7922 8113 gene locus_tag LOCUS_15010 7922 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 8324 8809 gene locus_tag LOCUS_15020 8324 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 9019 10491 gene locus_tag LOCUS_15030 9019 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 10667 11248 gene locus_tag LOCUS_15040 10667 11248 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085359.1 protein_id gnl|my_center|LOCUS_15040 12323 11340 gene locus_tag LOCUS_15050 gene rfbB 12323 11340 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389344.1 protein_id gnl|my_center|LOCUS_15050 12665 16009 gene locus_tag LOCUS_15060 12665 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 18024 16135 gene locus_tag LOCUS_15070 18024 16135 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068688.1 protein_id gnl|my_center|LOCUS_15070 18288 19406 gene locus_tag LOCUS_15080 18288 19406 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643284.1 protein_id gnl|my_center|LOCUS_15080 19520 21559 gene locus_tag LOCUS_15090 19520 21559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 23121 21556 gene locus_tag LOCUS_15100 23121 21556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 24687 23422 gene locus_tag LOCUS_15110 24687 23422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 25225 24830 gene locus_tag LOCUS_15120 25225 24830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 25505 26482 gene locus_tag LOCUS_15130 25505 26482 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261984.1 protein_id gnl|my_center|LOCUS_15130 26981 26634 gene locus_tag LOCUS_15140 26981 26634 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379614.1 protein_id gnl|my_center|LOCUS_15140 27673 26993 gene locus_tag LOCUS_15150 27673 26993 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_15150 27995 29044 gene locus_tag LOCUS_15160 27995 29044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 29068 30306 gene locus_tag LOCUS_15170 29068 30306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 30479 30766 gene locus_tag LOCUS_15180 30479 30766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence032 1380 925 gene locus_tag LOCUS_15190 1380 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15190 1767 1393 gene locus_tag LOCUS_15200 1767 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15200 2134 3060 gene locus_tag LOCUS_15210 2134 3060 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_15210 3077 3331 gene locus_tag LOCUS_15220 3077 3331 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816171.1 protein_id gnl|my_center|LOCUS_15220 3369 3575 gene locus_tag LOCUS_15230 gene thiS 3369 3575 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_15230 3578 4405 gene locus_tag LOCUS_15240 gene moeB 3578 4405 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_15240 4416 4835 gene locus_tag LOCUS_15250 4416 4835 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_15250 4825 5607 gene locus_tag LOCUS_15260 4825 5607 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202902.1 protein_id gnl|my_center|LOCUS_15260 5663 6670 gene locus_tag LOCUS_15270 5663 6670 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480277.1 protein_id gnl|my_center|LOCUS_15270 6720 7766 gene locus_tag LOCUS_15280 6720 7766 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705153.1 protein_id gnl|my_center|LOCUS_15280 7759 8553 gene locus_tag LOCUS_15290 7759 8553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212068.1 protein_id gnl|my_center|LOCUS_15290 8718 9719 gene locus_tag LOCUS_15300 8718 9719 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_15300 9732 9920 gene locus_tag LOCUS_15310 9732 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 10154 9990 gene locus_tag LOCUS_15320 10154 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 11339 10593 gene locus_tag LOCUS_15330 11339 10593 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 protein_id gnl|my_center|LOCUS_15330 11250 11528 gene locus_tag LOCUS_15340 11250 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 11557 12849 gene locus_tag LOCUS_15350 gene thiC 11557 12849 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_15350 12928 13758 gene locus_tag LOCUS_15360 gene thiM 12928 13758 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_15360 13758 14447 gene locus_tag LOCUS_15370 gene thiE 13758 14447 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_15370 14444 15211 gene locus_tag LOCUS_15380 gene thiD 14444 15211 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_15380 15465 15208 gene locus_tag LOCUS_15390 15465 15208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 15892 16074 gene locus_tag LOCUS_15400 15892 16074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 17667 16114 gene locus_tag LOCUS_15410 17667 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 17758 18438 gene locus_tag LOCUS_15420 17758 18438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 18465 19847 gene locus_tag LOCUS_15430 18465 19847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_15430 19849 21456 gene locus_tag LOCUS_15440 19849 21456 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229183.1 protein_id gnl|my_center|LOCUS_15440 22218 21460 gene locus_tag LOCUS_15450 22218 21460 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_15450 23076 22300 gene locus_tag LOCUS_15460 23076 22300 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137994.1 protein_id gnl|my_center|LOCUS_15460 23919 23095 gene locus_tag LOCUS_15470 23919 23095 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776970.1 protein_id gnl|my_center|LOCUS_15470 24596 23937 gene locus_tag LOCUS_15480 24596 23937 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776971.1 protein_id gnl|my_center|LOCUS_15480 25729 24728 gene locus_tag LOCUS_15490 25729 24728 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776972.1 protein_id gnl|my_center|LOCUS_15490 26107 27408 gene locus_tag LOCUS_15500 26107 27408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 27481 28407 gene locus_tag LOCUS_15510 27481 28407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 28444 29085 gene locus_tag LOCUS_15520 28444 29085 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416612.1 protein_id gnl|my_center|LOCUS_15520 30131 29082 gene locus_tag LOCUS_15530 30131 29082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence033 130 1815 gene locus_tag LOCUS_15540 130 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2631 1876 gene locus_tag LOCUS_15550 gene nagR 2631 1876 CDS product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 protein_id gnl|my_center|LOCUS_15550 3304 2633 gene locus_tag LOCUS_15560 3304 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 5821 3362 gene locus_tag LOCUS_15570 gene pheT 5821 3362 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_15570 6937 5870 gene locus_tag LOCUS_15580 gene pheS 6937 5870 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736387.1 protein_id gnl|my_center|LOCUS_15580 8204 7356 gene locus_tag LOCUS_15590 8204 7356 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089502.1 protein_id gnl|my_center|LOCUS_15590 9017 8229 gene locus_tag LOCUS_15600 9017 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 10124 9135 gene locus_tag LOCUS_15610 10124 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 11005 10136 gene locus_tag LOCUS_15620 11005 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 11421 11020 gene locus_tag LOCUS_15630 11421 11020 CDS product PTS N-acetylglucosamine transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573589.1 protein_id gnl|my_center|LOCUS_15630 12461 11568 gene locus_tag LOCUS_15640 12461 11568 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568992.1 protein_id gnl|my_center|LOCUS_15640 13239 12454 gene locus_tag LOCUS_15650 13239 12454 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563386.1 protein_id gnl|my_center|LOCUS_15650 13803 13255 gene locus_tag LOCUS_15660 13803 13255 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312631.1 protein_id gnl|my_center|LOCUS_15660 16717 13973 gene locus_tag LOCUS_15670 16717 13973 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383122.1 protein_id gnl|my_center|LOCUS_15670 17057 18262 gene locus_tag LOCUS_15680 gene arcA 17057 18262 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385506.1 protein_id gnl|my_center|LOCUS_15680 19281 18337 gene locus_tag LOCUS_15690 19281 18337 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_15690 19524 21155 gene locus_tag LOCUS_15700 gene ypwA 19524 21155 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215086.1 protein_id gnl|my_center|LOCUS_15700 21157 21609 gene locus_tag LOCUS_15710 gene dtd 21157 21609 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887535.1 protein_id gnl|my_center|LOCUS_15710 22406 21672 gene locus_tag LOCUS_15720 22406 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 23436 22624 gene locus_tag LOCUS_15730 23436 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 23772 23957 gene locus_tag LOCUS_15740 23772 23957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 24229 24720 gene locus_tag LOCUS_15750 24229 24720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 25559 24852 gene locus_tag LOCUS_15760 25559 24852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_15760 26449 25556 gene locus_tag LOCUS_15770 26449 25556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_15770 27554 26439 gene locus_tag LOCUS_15780 27554 26439 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_15780 28439 27564 gene locus_tag LOCUS_15790 28439 27564 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563083.1 protein_id gnl|my_center|LOCUS_15790 29823 28639 gene locus_tag LOCUS_15800 29823 28639 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_15800 29708 29926 gene locus_tag LOCUS_15810 29708 29926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 30226 29984 gene locus_tag LOCUS_15820 30226 29984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence034 832 140 gene locus_tag LOCUS_15830 832 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1042 3336 gene locus_tag LOCUS_15840 gene glgB 1042 3336 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272358.1 protein_id gnl|my_center|LOCUS_15840 3379 5814 gene locus_tag LOCUS_15850 3379 5814 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272357.1 protein_id gnl|my_center|LOCUS_15850 5854 6996 gene locus_tag LOCUS_15860 5854 6996 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460012.1 protein_id gnl|my_center|LOCUS_15860 6999 8099 gene locus_tag LOCUS_15870 gene glgD 6999 8099 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183792.1 protein_id gnl|my_center|LOCUS_15870 8123 9613 gene locus_tag LOCUS_15880 gene glgA 8123 9613 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_15880 9712 12891 gene locus_tag LOCUS_15890 9712 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 13033 16491 gene locus_tag LOCUS_15900 gene mfd 13033 16491 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_15900 16775 16563 gene locus_tag LOCUS_15910 16775 16563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 17006 17821 gene locus_tag LOCUS_15920 17006 17821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 17824 18810 gene locus_tag LOCUS_15930 17824 18810 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_15930 18846 18930 gene locus_tag LOCUS_t00350 18846 18930 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19147 20889 gene locus_tag LOCUS_15940 19147 20889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 20882 21862 gene locus_tag LOCUS_15950 20882 21862 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_15950 21989 21915 gene locus_tag LOCUS_t00360 21989 21915 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 23069 22083 gene locus_tag LOCUS_15960 23069 22083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 24106 23066 gene locus_tag LOCUS_15970 24106 23066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 24585 26438 gene locus_tag LOCUS_15980 24585 26438 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_15980 26746 27972 gene locus_tag LOCUS_15990 26746 27972 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_15990 30278 28722 gene locus_tag LOCUS_16000 30278 28722 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371461.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence035 1420 62 gene locus_tag LOCUS_16010 1420 62 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287584.1 protein_id gnl|my_center|LOCUS_16010 1814 1497 gene locus_tag LOCUS_16020 gene licB 1814 1497 CDS product PTS lichenan transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218755.1 protein_id gnl|my_center|LOCUS_16020 2190 1864 gene locus_tag LOCUS_16030 2190 1864 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082802.1 protein_id gnl|my_center|LOCUS_16030 4101 2194 gene locus_tag LOCUS_16040 gene licR 4101 2194 CDS product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 protein_id gnl|my_center|LOCUS_16040 4837 4292 gene locus_tag LOCUS_16050 4837 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 6400 5138 gene locus_tag LOCUS_16060 gene pepT 6400 5138 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_16060 7269 6511 gene locus_tag LOCUS_16070 7269 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 7611 8711 gene locus_tag LOCUS_16080 7611 8711 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707687.1 protein_id gnl|my_center|LOCUS_16080 13680 8896 gene locus_tag LOCUS_16090 13680 8896 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861332.1 protein_id gnl|my_center|LOCUS_16090 14402 13677 gene locus_tag LOCUS_16100 14402 13677 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023665.1 protein_id gnl|my_center|LOCUS_16100 15418 14534 gene locus_tag LOCUS_16110 15418 14534 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101850.1 protein_id gnl|my_center|LOCUS_16110 15602 17044 gene locus_tag LOCUS_16120 15602 17044 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 protein_id gnl|my_center|LOCUS_16120 17505 17239 gene locus_tag LOCUS_16130 17505 17239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 17973 17515 gene locus_tag LOCUS_16140 17973 17515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 17956 18174 gene locus_tag LOCUS_16150 17956 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 19308 18238 gene locus_tag LOCUS_16160 19308 18238 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 protein_id gnl|my_center|LOCUS_16160 19474 21021 gene locus_tag LOCUS_16170 19474 21021 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_16170 21790 21101 gene locus_tag LOCUS_16180 21790 21101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16180 22114 21845 gene locus_tag LOCUS_16190 22114 21845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 23474 22689 gene locus_tag LOCUS_16200 23474 22689 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073373.1 protein_id gnl|my_center|LOCUS_16200 23593 24408 gene locus_tag LOCUS_16210 23593 24408 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251908.1 protein_id gnl|my_center|LOCUS_16210 24922 24476 gene locus_tag LOCUS_16220 24922 24476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 25908 25012 gene locus_tag LOCUS_16230 25908 25012 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964769.1 protein_id gnl|my_center|LOCUS_16230 26780 25911 gene locus_tag LOCUS_16240 26780 25911 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964768.1 protein_id gnl|my_center|LOCUS_16240 27310 26813 gene locus_tag LOCUS_16250 27310 26813 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896729.1 protein_id gnl|my_center|LOCUS_16250 27792 27361 gene locus_tag LOCUS_16260 27792 27361 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964766.1 protein_id gnl|my_center|LOCUS_16260 28688 28080 gene locus_tag LOCUS_16270 28688 28080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence036 1454 636 gene locus_tag LOCUS_16280 1454 636 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_16280 1917 1540 gene locus_tag LOCUS_16290 1917 1540 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_16290 2374 2150 gene locus_tag LOCUS_16300 2374 2150 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974619.1 protein_id gnl|my_center|LOCUS_16300 2850 2371 gene locus_tag LOCUS_16310 2850 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3346 2981 gene locus_tag LOCUS_16320 3346 2981 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_16320 3486 4133 gene locus_tag LOCUS_16330 3486 4133 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 protein_id gnl|my_center|LOCUS_16330 4912 4130 gene locus_tag LOCUS_16340 4912 4130 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_16340 5537 4917 gene locus_tag LOCUS_16350 5537 4917 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548869.1 protein_id gnl|my_center|LOCUS_16350 6242 5709 gene locus_tag LOCUS_16360 6242 5709 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130536.1 protein_id gnl|my_center|LOCUS_16360 7382 6258 gene locus_tag LOCUS_16370 gene zinU 7382 6258 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_16370 7588 8439 gene locus_tag LOCUS_16380 7588 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 8448 9005 gene locus_tag LOCUS_16390 8448 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 9645 9088 gene locus_tag LOCUS_16400 9645 9088 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_16400 9956 10396 gene locus_tag LOCUS_16410 9956 10396 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_16410 10595 11401 gene locus_tag LOCUS_16420 10595 11401 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644019.1 protein_id gnl|my_center|LOCUS_16420 11509 12957 gene locus_tag LOCUS_16430 11509 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 13043 14494 gene locus_tag LOCUS_16440 13043 14494 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 protein_id gnl|my_center|LOCUS_16440 14556 15083 gene locus_tag LOCUS_16450 14556 15083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 15559 15951 gene locus_tag LOCUS_16460 15559 15951 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_16460 17240 16062 gene locus_tag LOCUS_16470 17240 16062 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_16470 17885 17244 gene locus_tag LOCUS_16480 17885 17244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 18148 19080 gene locus_tag LOCUS_16490 18148 19080 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964930.1 protein_id gnl|my_center|LOCUS_16490 20431 19139 gene locus_tag LOCUS_16500 20431 19139 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_16500 21572 20982 gene locus_tag LOCUS_16510 gene pdxT 21572 20982 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113516.1 protein_id gnl|my_center|LOCUS_16510 22468 21572 gene locus_tag LOCUS_16520 gene pdxS 22468 21572 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815352.1 protein_id gnl|my_center|LOCUS_16520 22603 24048 gene locus_tag LOCUS_16530 22603 24048 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_16530 24393 24052 gene locus_tag LOCUS_16540 24393 24052 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_16540 24606 25367 gene locus_tag LOCUS_16550 24606 25367 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565300.1 protein_id gnl|my_center|LOCUS_16550 25364 26269 gene locus_tag LOCUS_16560 gene pfkB 25364 26269 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_16560 26372 28336 gene locus_tag LOCUS_16570 26372 28336 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475561.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence037 1458 355 gene locus_tag LOCUS_16580 1458 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1604 2602 gene locus_tag LOCUS_16590 1604 2602 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053235.1 protein_id gnl|my_center|LOCUS_16590 3436 2633 gene locus_tag LOCUS_16600 3436 2633 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_16600 3578 3832 gene locus_tag LOCUS_16610 3578 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 5305 3893 gene locus_tag LOCUS_16620 gene gltA 5305 3893 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_16620 6135 5293 gene locus_tag LOCUS_16630 6135 5293 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370486.1 protein_id gnl|my_center|LOCUS_16630 6880 6305 gene locus_tag LOCUS_16640 gene pth 6880 6305 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_16640 7233 6991 gene locus_tag LOCUS_16650 7233 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 8244 7345 gene locus_tag LOCUS_16660 gene murQ 8244 7345 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098312.1 protein_id gnl|my_center|LOCUS_16660 8716 8291 gene locus_tag LOCUS_16670 8716 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 9015 9860 gene locus_tag LOCUS_16680 9015 9860 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114712.1 protein_id gnl|my_center|LOCUS_16680 9894 10205 gene locus_tag LOCUS_16690 9894 10205 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643121.1 protein_id gnl|my_center|LOCUS_16690 10307 11614 gene locus_tag LOCUS_16700 10307 11614 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363934.1 protein_id gnl|my_center|LOCUS_16700 11760 12851 gene locus_tag LOCUS_16710 11760 12851 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861793.1 protein_id gnl|my_center|LOCUS_16710 12848 13801 gene locus_tag LOCUS_16720 12848 13801 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439905.1 protein_id gnl|my_center|LOCUS_16720 13795 14991 gene locus_tag LOCUS_16730 gene anmK 13795 14991 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_16730 15003 15401 gene locus_tag LOCUS_16740 15003 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 16178 15408 gene locus_tag LOCUS_16750 16178 15408 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723335.1 protein_id gnl|my_center|LOCUS_16750 17236 16502 gene locus_tag LOCUS_16760 17236 16502 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_16760 17565 18518 gene locus_tag LOCUS_16770 17565 18518 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_16770 18556 19476 gene locus_tag LOCUS_16780 gene murQ 18556 19476 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726731.1 protein_id gnl|my_center|LOCUS_16780 19541 21031 gene locus_tag LOCUS_16790 19541 21031 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775345.1 protein_id gnl|my_center|LOCUS_16790 21139 22206 gene locus_tag LOCUS_16800 21139 22206 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102203.1 protein_id gnl|my_center|LOCUS_16800 22583 22422 gene locus_tag LOCUS_16810 22583 22422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 23342 24742 gene locus_tag LOCUS_16820 23342 24742 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_16820 24985 24746 gene locus_tag LOCUS_16830 24985 24746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 27006 25198 gene locus_tag LOCUS_16840 27006 25198 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030802.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence038 127 1326 gene locus_tag LOCUS_16850 127 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2632 1466 gene locus_tag LOCUS_16860 2632 1466 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_16860 4498 3299 gene locus_tag LOCUS_16870 gene ugpC 4498 3299 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818931.1 protein_id gnl|my_center|LOCUS_16870 5990 4500 gene locus_tag LOCUS_16880 gene malQ 5990 4500 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_16880 6864 6001 gene locus_tag LOCUS_16890 6864 6001 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_16890 7766 6864 gene locus_tag LOCUS_16900 7766 6864 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_16900 9198 7858 gene locus_tag LOCUS_16910 9198 7858 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_16910 10254 9244 gene locus_tag LOCUS_16920 10254 9244 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_16920 10504 11802 gene locus_tag LOCUS_16930 10504 11802 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_16930 12735 11881 gene locus_tag LOCUS_16940 12735 11881 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130010930.1 protein_id gnl|my_center|LOCUS_16940 14336 13089 gene locus_tag LOCUS_16950 14336 13089 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_16950 15884 14415 gene locus_tag LOCUS_16960 15884 14415 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939555.1 protein_id gnl|my_center|LOCUS_16960 18147 16276 gene locus_tag LOCUS_16970 18147 16276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143606.1 protein_id gnl|my_center|LOCUS_16970 19900 18125 gene locus_tag LOCUS_16980 19900 18125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814218.1 protein_id gnl|my_center|LOCUS_16980 20387 19878 gene locus_tag LOCUS_16990 20387 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 20612 22195 gene locus_tag LOCUS_17000 gene amyS 20612 22195 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476408.1 protein_id gnl|my_center|LOCUS_17000 23331 22192 gene locus_tag LOCUS_17010 23331 22192 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_17010 23837 23346 gene locus_tag LOCUS_17020 23837 23346 CDS product DUF3955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775247.1 protein_id gnl|my_center|LOCUS_17020 24001 23813 gene locus_tag LOCUS_17030 24001 23813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 25349 23949 gene locus_tag LOCUS_17040 25349 23949 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389902.1 protein_id gnl|my_center|LOCUS_17040 25524 25880 gene locus_tag LOCUS_17050 25524 25880 CDS product DUF1304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836732.1 protein_id gnl|my_center|LOCUS_17050 25904 26104 gene locus_tag LOCUS_17060 25904 26104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 26833 26150 gene locus_tag LOCUS_17070 26833 26150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 27074 26805 gene locus_tag LOCUS_17080 27074 26805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence039 134 976 gene locus_tag LOCUS_17090 gene amrS 134 976 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393777.1 protein_id gnl|my_center|LOCUS_17090 1077 1322 gene locus_tag LOCUS_17100 1077 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1697 1323 gene locus_tag LOCUS_17110 1697 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1824 2141 gene locus_tag LOCUS_17120 gene trxA 1824 2141 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545412.1 protein_id gnl|my_center|LOCUS_17120 2149 2520 gene locus_tag LOCUS_17130 2149 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3573 2647 gene locus_tag LOCUS_17140 gene rihA 3573 2647 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705366.1 protein_id gnl|my_center|LOCUS_17140 5312 3570 gene locus_tag LOCUS_17150 5312 3570 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384673.1 protein_id gnl|my_center|LOCUS_17150 6111 5323 gene locus_tag LOCUS_17160 6111 5323 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357916.1 protein_id gnl|my_center|LOCUS_17160 7311 6181 gene locus_tag LOCUS_17170 7311 6181 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379352.1 protein_id gnl|my_center|LOCUS_17170 8407 7364 gene locus_tag LOCUS_17180 8407 7364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002413403.1 protein_id gnl|my_center|LOCUS_17180 9284 8454 gene locus_tag LOCUS_17190 9284 8454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 protein_id gnl|my_center|LOCUS_17190 9571 10431 gene locus_tag LOCUS_17200 9571 10431 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460667.1 protein_id gnl|my_center|LOCUS_17200 11635 11417 gene locus_tag LOCUS_17210 11635 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 11994 11815 gene locus_tag LOCUS_17220 11994 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 12422 12048 gene locus_tag LOCUS_17230 12422 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 12975 12346 gene locus_tag LOCUS_17240 12975 12346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 13281 14669 gene locus_tag LOCUS_17250 13281 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 15733 14723 gene locus_tag LOCUS_17260 15733 14723 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296705.1 protein_id gnl|my_center|LOCUS_17260 15911 17761 gene locus_tag LOCUS_17270 gene uidA 15911 17761 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003648792.1 protein_id gnl|my_center|LOCUS_17270 17928 17731 gene locus_tag LOCUS_17280 17928 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 18081 18899 gene locus_tag LOCUS_17290 gene dhuD 18081 18899 CDS product monomeric 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase DhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139169.1 protein_id gnl|my_center|LOCUS_17290 19002 19640 gene locus_tag LOCUS_17300 19002 19640 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965894.1 protein_id gnl|my_center|LOCUS_17300 19746 20765 gene locus_tag LOCUS_17310 19746 20765 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922035.1 protein_id gnl|my_center|LOCUS_17310 21482 20841 gene locus_tag LOCUS_17320 21482 20841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 22405 21635 gene locus_tag LOCUS_17330 22405 21635 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242836.1 protein_id gnl|my_center|LOCUS_17330 25151 22446 gene locus_tag LOCUS_17340 gene adhE 25151 22446 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_17340 26286 25480 gene locus_tag LOCUS_17350 26286 25480 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963843.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence040 1634 630 gene locus_tag LOCUS_17360 1634 630 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_17360 2348 1656 gene locus_tag LOCUS_17370 2348 1656 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_17370 2555 3136 gene locus_tag LOCUS_17380 2555 3136 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964937.1 protein_id gnl|my_center|LOCUS_17380 3282 4214 gene locus_tag LOCUS_17390 3282 4214 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538553.1 protein_id gnl|my_center|LOCUS_17390 4481 4792 gene locus_tag LOCUS_17400 4481 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 5344 4802 gene locus_tag LOCUS_17410 5344 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 5751 5356 gene locus_tag LOCUS_17420 5751 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 6302 5865 gene locus_tag LOCUS_17430 6302 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 6463 7371 gene locus_tag LOCUS_17440 6463 7371 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052677.1 protein_id gnl|my_center|LOCUS_17440 7740 7501 gene locus_tag LOCUS_17450 7740 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 8483 7737 gene locus_tag LOCUS_17460 8483 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 10042 8690 gene locus_tag LOCUS_17470 gene larC 10042 8690 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058129.1 protein_id gnl|my_center|LOCUS_17470 10815 10051 gene locus_tag LOCUS_17480 gene larB 10815 10051 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_17480 11673 10819 gene locus_tag LOCUS_17490 gene larE 11673 10819 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_17490 11821 13776 gene locus_tag LOCUS_17500 11821 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 13780 14499 gene locus_tag LOCUS_17510 13780 14499 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_17510 14516 16021 gene locus_tag LOCUS_17520 14516 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 16084 16881 gene locus_tag LOCUS_17530 16084 16881 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068222.1 protein_id gnl|my_center|LOCUS_17530 16878 17603 gene locus_tag LOCUS_17540 16878 17603 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_17540 17624 18508 gene locus_tag LOCUS_17550 gene nudC 17624 18508 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_17550 20290 18593 gene locus_tag LOCUS_17560 20290 18593 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_17560 20425 21264 gene locus_tag LOCUS_17570 20425 21264 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869867.1 protein_id gnl|my_center|LOCUS_17570 21885 21316 gene locus_tag LOCUS_17580 gene nrdG 21885 21316 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_17580 24248 22026 gene locus_tag LOCUS_17590 gene nrdD 24248 22026 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence041 261 2198 gene locus_tag LOCUS_17600 261 2198 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_17600 2438 2728 gene locus_tag LOCUS_17610 gene groES 2438 2728 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_17610 2790 4433 gene locus_tag LOCUS_17620 gene groL 2790 4433 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_17620 4621 5898 gene locus_tag LOCUS_17630 4621 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 5943 7019 gene locus_tag LOCUS_17640 gene ychF 5943 7019 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218707.1 protein_id gnl|my_center|LOCUS_17640 8605 7184 gene locus_tag LOCUS_17650 8605 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 8889 10478 gene locus_tag LOCUS_17660 gene guaA 8889 10478 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817253.1 protein_id gnl|my_center|LOCUS_17660 10910 11101 gene locus_tag LOCUS_17670 10910 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 11104 13230 gene locus_tag LOCUS_17680 11104 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 13234 16059 gene locus_tag LOCUS_17690 13234 16059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 17462 16425 gene locus_tag LOCUS_17700 17462 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 18552 17425 gene locus_tag LOCUS_17710 18552 17425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 18751 19038 gene locus_tag LOCUS_17720 18751 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 19166 19035 gene locus_tag LOCUS_17730 19166 19035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 19683 19408 gene locus_tag LOCUS_17740 19683 19408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 20003 19680 gene locus_tag LOCUS_17750 20003 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17750 20181 20471 gene locus_tag LOCUS_17760 20181 20471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 20703 23201 gene locus_tag LOCUS_17770 20703 23201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 23198 23524 gene locus_tag LOCUS_17780 23198 23524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence042 955 113 gene locus_tag LOCUS_17790 gene lgt 955 113 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_17790 1275 1042 gene locus_tag LOCUS_17800 1275 1042 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015102.1 protein_id gnl|my_center|LOCUS_17800 3933 1423 gene locus_tag LOCUS_17810 3933 1423 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393214.1 protein_id gnl|my_center|LOCUS_17810 5155 3938 gene locus_tag LOCUS_17820 gene tyrS 5155 3938 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583842.1 protein_id gnl|my_center|LOCUS_17820 5433 7652 gene locus_tag LOCUS_17830 5433 7652 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_17830 8167 7763 gene locus_tag LOCUS_17840 gene argR 8167 7763 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633181.1 protein_id gnl|my_center|LOCUS_17840 8661 9593 gene locus_tag LOCUS_17850 8661 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 11461 9737 gene locus_tag LOCUS_17860 11461 9737 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_17860 11712 14234 gene locus_tag LOCUS_17870 gene rlmKL 11712 14234 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819954.1 protein_id gnl|my_center|LOCUS_17870 15819 14317 gene locus_tag LOCUS_17880 15819 14317 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389978.1 protein_id gnl|my_center|LOCUS_17880 16028 18274 gene locus_tag LOCUS_17890 16028 18274 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321207.1 protein_id gnl|my_center|LOCUS_17890 19206 18373 gene locus_tag LOCUS_17900 gene yidA 19206 18373 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295119.1 protein_id gnl|my_center|LOCUS_17900 20756 19197 gene locus_tag LOCUS_17910 20756 19197 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_17910 21067 20771 gene locus_tag LOCUS_17920 21067 20771 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392891.1 protein_id gnl|my_center|LOCUS_17920 21235 21492 gene locus_tag LOCUS_17930 21235 21492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 21447 22103 gene locus_tag LOCUS_17940 21447 22103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 22512 22105 gene locus_tag LOCUS_17950 22512 22105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 22480 22716 gene locus_tag LOCUS_17960 22480 22716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 23996 22785 gene locus_tag LOCUS_17970 23996 22785 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966298.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence043 501 79 gene locus_tag LOCUS_17980 501 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 689 498 gene locus_tag LOCUS_17990 689 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1010 1579 gene locus_tag LOCUS_18000 1010 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2350 1895 gene locus_tag LOCUS_18010 2350 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3154 2354 gene locus_tag LOCUS_18020 3154 2354 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860631.1 protein_id gnl|my_center|LOCUS_18020 4413 3463 gene locus_tag LOCUS_18030 4413 3463 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 protein_id gnl|my_center|LOCUS_18030 4556 5128 gene locus_tag LOCUS_18040 4556 5128 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975272.1 protein_id gnl|my_center|LOCUS_18040 5889 5125 gene locus_tag LOCUS_18050 5889 5125 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 protein_id gnl|my_center|LOCUS_18050 6760 6113 gene locus_tag LOCUS_18060 gene pcp 6760 6113 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 protein_id gnl|my_center|LOCUS_18060 7812 6847 gene locus_tag LOCUS_18070 7812 6847 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287082.1 protein_id gnl|my_center|LOCUS_18070 8525 7812 gene locus_tag LOCUS_18080 8525 7812 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287083.1 protein_id gnl|my_center|LOCUS_18080 9584 8895 gene locus_tag LOCUS_18090 9584 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 10812 9820 gene locus_tag LOCUS_18100 10812 9820 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_18100 11417 10812 gene locus_tag LOCUS_18110 11417 10812 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261995.1 protein_id gnl|my_center|LOCUS_18110 12051 11626 gene locus_tag LOCUS_18120 12051 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 12380 12090 gene locus_tag LOCUS_18130 12380 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18130 12610 12383 gene locus_tag LOCUS_18140 12610 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254332.1 protein_id gnl|my_center|LOCUS_18140 13687 12893 gene locus_tag LOCUS_18150 13687 12893 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447223.1 protein_id gnl|my_center|LOCUS_18150 13986 15347 gene locus_tag LOCUS_18160 13986 15347 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_18160 16269 15436 gene locus_tag LOCUS_18170 16269 15436 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_18170 16844 16422 gene locus_tag LOCUS_18180 16844 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18180 17108 16905 gene locus_tag LOCUS_18190 17108 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18190 18413 17583 gene locus_tag LOCUS_18200 18413 17583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 19773 18703 gene locus_tag LOCUS_18210 19773 18703 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766598.1 protein_id gnl|my_center|LOCUS_18210 20582 19770 gene locus_tag LOCUS_18220 20582 19770 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547854.1 protein_id gnl|my_center|LOCUS_18220 21915 20584 gene locus_tag LOCUS_18230 21915 20584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence044 1609 50 gene locus_tag LOCUS_18240 1609 50 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114145401.1 protein_id gnl|my_center|LOCUS_18240 2694 1843 gene locus_tag LOCUS_18250 2694 1843 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460109.1 protein_id gnl|my_center|LOCUS_18250 2980 2684 gene locus_tag LOCUS_18260 2980 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3743 3111 gene locus_tag LOCUS_18270 3743 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 5950 3899 gene locus_tag LOCUS_18280 5950 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 6916 6245 gene locus_tag LOCUS_18290 6916 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 8971 7127 gene locus_tag LOCUS_18300 gene argS 8971 7127 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_18300 10582 9092 gene locus_tag LOCUS_18310 10582 9092 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_18310 10986 10669 gene locus_tag LOCUS_18320 10986 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 11996 11058 gene locus_tag LOCUS_18330 11996 11058 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_18330 12130 12055 gene locus_tag LOCUS_t00370 12130 12055 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12606 13796 gene locus_tag LOCUS_18340 12606 13796 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_18340 14613 14251 gene locus_tag LOCUS_18350 gene rplT 14613 14251 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028296.1 protein_id gnl|my_center|LOCUS_18350 14841 14647 gene locus_tag LOCUS_18360 gene rpmI 14841 14647 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_18360 15422 14844 gene locus_tag LOCUS_18370 gene infC 15422 14844 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014321.1 protein_id gnl|my_center|LOCUS_18370 15794 16567 gene locus_tag LOCUS_18380 15794 16567 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462052.1 protein_id gnl|my_center|LOCUS_18380 17699 16713 gene locus_tag LOCUS_18390 17699 16713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 18340 17696 gene locus_tag LOCUS_18400 18340 17696 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_18400 19100 18351 gene locus_tag LOCUS_18410 19100 18351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 19819 19097 gene locus_tag LOCUS_18420 19819 19097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 20670 19816 gene locus_tag LOCUS_18430 20670 19816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 21126 20731 gene locus_tag LOCUS_18440 21126 20731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence045 253 53 gene locus_tag LOCUS_18450 253 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18450 1255 788 gene locus_tag LOCUS_18460 1255 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1329 1583 gene locus_tag LOCUS_18470 1329 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2546 1761 gene locus_tag LOCUS_18480 2546 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3312 3623 gene locus_tag LOCUS_18490 3312 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 3904 3638 gene locus_tag LOCUS_18500 3904 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 4541 4765 gene locus_tag LOCUS_18510 4541 4765 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014649.1 protein_id gnl|my_center|LOCUS_18510 5561 4986 gene locus_tag LOCUS_18520 gene yfcE 5561 4986 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_18520 5839 7758 gene locus_tag LOCUS_18530 gene dnaK 5839 7758 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557108.1 protein_id gnl|my_center|LOCUS_18530 7833 8564 gene locus_tag LOCUS_18540 7833 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 8642 9616 gene locus_tag LOCUS_18550 8642 9616 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_18550 9603 10058 gene locus_tag LOCUS_18560 9603 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 10271 12991 gene locus_tag LOCUS_18570 gene clpB 10271 12991 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_18570 13173 15194 gene locus_tag LOCUS_18580 13173 15194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 15197 15373 gene locus_tag LOCUS_18590 15197 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 16233 15565 gene locus_tag LOCUS_18600 16233 15565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 17534 16236 gene locus_tag LOCUS_18610 17534 16236 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_18610 19252 17984 gene locus_tag LOCUS_18620 19252 17984 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_18620 20007 19435 gene locus_tag LOCUS_18630 20007 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 20326 20748 gene locus_tag LOCUS_18640 20326 20748 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966974.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence046 1748 216 gene locus_tag LOCUS_18650 1748 216 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812931.1 protein_id gnl|my_center|LOCUS_18650 2126 5881 gene locus_tag LOCUS_18660 2126 5881 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_18660 6073 6714 gene locus_tag LOCUS_18670 6073 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 6805 8169 gene locus_tag LOCUS_18680 6805 8169 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461680.1 protein_id gnl|my_center|LOCUS_18680 9595 8312 gene locus_tag LOCUS_18690 9595 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 9956 11203 gene locus_tag LOCUS_18700 9956 11203 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_18700 11219 11593 gene locus_tag LOCUS_18710 11219 11593 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461711.1 protein_id gnl|my_center|LOCUS_18710 12584 11670 gene locus_tag LOCUS_18720 gene murB 12584 11670 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_18720 12922 13893 gene locus_tag LOCUS_18730 12922 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 14184 14765 gene locus_tag LOCUS_18740 14184 14765 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053234.1 protein_id gnl|my_center|LOCUS_18740 14768 16549 gene locus_tag LOCUS_18750 14768 16549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 16551 17351 gene locus_tag LOCUS_18760 16551 17351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 17468 19084 gene locus_tag LOCUS_18770 17468 19084 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_18770 19243 20172 gene locus_tag LOCUS_18780 19243 20172 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269437.1 protein_id gnl|my_center|LOCUS_18780 20557 20237 gene locus_tag LOCUS_18790 20557 20237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence047 441 3356 gene locus_tag LOCUS_18800 441 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3487 6366 gene locus_tag LOCUS_18810 gene secA 3487 6366 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727975.1 protein_id gnl|my_center|LOCUS_18810 6366 7490 gene locus_tag LOCUS_18820 gene prfB 6366 7490 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_18820 7487 8362 gene locus_tag LOCUS_18830 7487 8362 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_18830 8509 9408 gene locus_tag LOCUS_18840 8509 9408 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_18840 9401 10330 gene locus_tag LOCUS_18850 9401 10330 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_18850 10690 11748 gene locus_tag LOCUS_18860 10690 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 11735 12658 gene locus_tag LOCUS_18870 gene ftsX 11735 12658 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 protein_id gnl|my_center|LOCUS_18870 12746 14797 gene locus_tag LOCUS_18880 gene rnr 12746 14797 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838893.1 protein_id gnl|my_center|LOCUS_18880 14849 15709 gene locus_tag LOCUS_18890 14849 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 15709 16185 gene locus_tag LOCUS_18900 gene smpB 15709 16185 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_18900 16217 16729 gene locus_tag LOCUS_18910 gene feR 16217 16729 CDS product ferric-chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878333.1 protein_id gnl|my_center|LOCUS_18910 16795 16941 gene locus_tag LOCUS_18920 16795 16941 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_18920 17087 17794 gene locus_tag LOCUS_18930 17087 17794 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_18930 18384 19766 gene locus_tag LOCUS_18940 18384 19766 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641680.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence048 106 342 gene locus_tag LOCUS_18950 106 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 773 315 gene locus_tag LOCUS_18960 773 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18960 1195 1434 gene locus_tag LOCUS_18970 1195 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2514 1546 gene locus_tag LOCUS_18980 2514 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2853 3479 gene locus_tag LOCUS_18990 2853 3479 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_18990 3472 4464 gene locus_tag LOCUS_19000 3472 4464 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732986.1 protein_id gnl|my_center|LOCUS_19000 4483 5799 gene locus_tag LOCUS_19010 4483 5799 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_19010 5835 6776 gene locus_tag LOCUS_19020 5835 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 7917 6841 gene locus_tag LOCUS_19030 7917 6841 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_19030 8164 8361 gene locus_tag LOCUS_19040 8164 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 8701 10005 gene locus_tag LOCUS_19050 8701 10005 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_19050 10008 10442 gene locus_tag LOCUS_19060 10008 10442 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_19060 10481 10771 gene locus_tag LOCUS_19070 10481 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 11117 10911 gene locus_tag LOCUS_19080 11117 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 12072 11140 gene locus_tag LOCUS_19090 12072 11140 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262899.1 protein_id gnl|my_center|LOCUS_19090 12575 14998 gene locus_tag LOCUS_19100 gene feoB 12575 14998 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_19100 15111 15485 gene locus_tag LOCUS_19110 15111 15485 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_19110 16372 15482 gene locus_tag LOCUS_19120 16372 15482 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546960.1 protein_id gnl|my_center|LOCUS_19120 17811 16483 gene locus_tag LOCUS_19130 17811 16483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 17890 19425 gene locus_tag LOCUS_19140 17890 19425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence049 419 132 gene locus_tag LOCUS_19150 419 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 633 367 gene locus_tag LOCUS_19160 633 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1717 593 gene locus_tag LOCUS_19170 1717 593 CDS product IS1595-like element ISSsu9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775606.1 protein_id gnl|my_center|LOCUS_19170 3339 1876 gene locus_tag LOCUS_19180 gene rsmB 3339 1876 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_19180 4262 3336 gene locus_tag LOCUS_19190 gene fmt 4262 3336 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805211.1 protein_id gnl|my_center|LOCUS_19190 4825 4259 gene locus_tag LOCUS_19200 gene def 4825 4259 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378195.1 protein_id gnl|my_center|LOCUS_19200 7231 4898 gene locus_tag LOCUS_19210 gene priA 7231 4898 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_19210 7546 7337 gene locus_tag LOCUS_19220 7546 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 7891 8160 gene locus_tag LOCUS_19230 7891 8160 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_19230 9768 8518 gene locus_tag LOCUS_19240 gene metK 9768 8518 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_19240 9760 10020 gene locus_tag LOCUS_19250 9760 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 10816 10061 gene locus_tag LOCUS_19260 10816 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 11001 13853 gene locus_tag LOCUS_19270 11001 13853 CDS product YhgE/Pip family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143686.1 protein_id gnl|my_center|LOCUS_19270 13837 16077 gene locus_tag LOCUS_19280 13837 16077 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 protein_id gnl|my_center|LOCUS_19280 16184 17638 gene locus_tag LOCUS_19290 gene gltX 16184 17638 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_19290 18038 17901 gene locus_tag LOCUS_19300 18038 17901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 18734 18090 gene locus_tag LOCUS_19310 18734 18090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence050 1054 308 gene locus_tag LOCUS_19320 1054 308 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963474.1 protein_id gnl|my_center|LOCUS_19320 1207 1827 gene locus_tag LOCUS_19330 1207 1827 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_19330 1894 3057 gene locus_tag LOCUS_19340 gene queA 1894 3057 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_19340 4367 3144 gene locus_tag LOCUS_19350 4367 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 4638 4913 gene locus_tag LOCUS_19360 4638 4913 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949584.1 protein_id gnl|my_center|LOCUS_19360 5053 5844 gene locus_tag LOCUS_19370 5053 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 5846 6988 gene locus_tag LOCUS_19380 gene tgt 5846 6988 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_19380 7087 8574 gene locus_tag LOCUS_19390 7087 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 8567 9514 gene locus_tag LOCUS_19400 gene secF 8567 9514 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_19400 9520 13185 gene locus_tag LOCUS_19410 9520 13185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 13189 15501 gene locus_tag LOCUS_19420 13189 15501 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 protein_id gnl|my_center|LOCUS_19420 15502 16146 gene locus_tag LOCUS_19430 15502 16146 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_19430 16239 16329 gene locus_tag LOCUS_t00380 16239 16329 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16443 16529 gene locus_tag LOCUS_t00390 16443 16529 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16732 17610 gene locus_tag LOCUS_19440 16732 17610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 18241 18852 gene locus_tag LOCUS_19450 18241 18852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence051 59 427 gene locus_tag LOCUS_19460 59 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 1448 1308 gene locus_tag LOCUS_19470 1448 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1881 2849 gene locus_tag LOCUS_19480 1881 2849 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_19480 2956 3873 gene locus_tag LOCUS_19490 2956 3873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700784.1 protein_id gnl|my_center|LOCUS_19490 3873 4667 gene locus_tag LOCUS_19500 3873 4667 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_19500 5727 4792 gene locus_tag LOCUS_19510 5727 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 5930 6952 gene locus_tag LOCUS_19520 5930 6952 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_19520 7460 7017 gene locus_tag LOCUS_19530 7460 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 7705 7367 gene locus_tag LOCUS_19540 7705 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 8354 7710 gene locus_tag LOCUS_19550 8354 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19550 8631 9092 gene locus_tag LOCUS_19560 8631 9092 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964044.1 protein_id gnl|my_center|LOCUS_19560 11438 9774 gene locus_tag LOCUS_19570 11438 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 12961 11867 gene locus_tag LOCUS_19580 12961 11867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_19580 14677 12965 gene locus_tag LOCUS_19590 14677 12965 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769364.1 protein_id gnl|my_center|LOCUS_19590 15969 14830 gene locus_tag LOCUS_19600 15969 14830 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_19600 16288 16944 gene locus_tag LOCUS_19610 16288 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 17694 17083 gene locus_tag LOCUS_19620 17694 17083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence052 230 1048 gene locus_tag LOCUS_19630 230 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1163 1963 gene locus_tag LOCUS_19640 1163 1963 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861366.1 protein_id gnl|my_center|LOCUS_19640 2046 2675 gene locus_tag LOCUS_19650 2046 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 3376 2672 gene locus_tag LOCUS_19660 3376 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4442 3384 gene locus_tag LOCUS_19670 gene iolU 4442 3384 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_19670 4589 6406 gene locus_tag LOCUS_19680 gene pepF 4589 6406 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989921.1 protein_id gnl|my_center|LOCUS_19680 6531 7160 gene locus_tag LOCUS_19690 gene udk 6531 7160 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700143.1 protein_id gnl|my_center|LOCUS_19690 8065 7157 gene locus_tag LOCUS_19700 8065 7157 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_19700 8910 8062 gene locus_tag LOCUS_19710 8910 8062 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015513.1 protein_id gnl|my_center|LOCUS_19710 10480 9077 gene locus_tag LOCUS_19720 10480 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 11495 10578 gene locus_tag LOCUS_19730 11495 10578 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_19730 13416 11554 gene locus_tag LOCUS_19740 13416 11554 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296194.1 protein_id gnl|my_center|LOCUS_19740 14624 13521 gene locus_tag LOCUS_19750 14624 13521 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_19750 15776 14649 gene locus_tag LOCUS_19760 15776 14649 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705012.1 protein_id gnl|my_center|LOCUS_19760 16245 15787 gene locus_tag LOCUS_19770 16245 15787 CDS product DUF6379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705011.1 protein_id gnl|my_center|LOCUS_19770 16961 16305 gene locus_tag LOCUS_19780 16961 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence053 114 326 gene locus_tag LOCUS_19790 114 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1375 431 gene locus_tag LOCUS_19800 1375 431 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965690.1 protein_id gnl|my_center|LOCUS_19800 1886 1392 gene locus_tag LOCUS_19810 1886 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2210 2983 gene locus_tag LOCUS_19820 2210 2983 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476619.1 protein_id gnl|my_center|LOCUS_19820 4018 3065 gene locus_tag LOCUS_19830 4018 3065 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359214.1 protein_id gnl|my_center|LOCUS_19830 7675 4076 gene locus_tag LOCUS_19840 7675 4076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_19840 8381 7680 gene locus_tag LOCUS_19850 8381 7680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_19850 8555 8860 gene locus_tag LOCUS_19860 8555 8860 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938488.1 protein_id gnl|my_center|LOCUS_19860 10445 8916 gene locus_tag LOCUS_19870 10445 8916 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832016.1 protein_id gnl|my_center|LOCUS_19870 11258 10446 gene locus_tag LOCUS_19880 gene phnE 11258 10446 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905273.1 protein_id gnl|my_center|LOCUS_19880 12149 11271 gene locus_tag LOCUS_19890 gene phnE 12149 11271 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131699.1 protein_id gnl|my_center|LOCUS_19890 12939 12139 gene locus_tag LOCUS_19900 gene phnC 12939 12139 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 protein_id gnl|my_center|LOCUS_19900 14136 13048 gene locus_tag LOCUS_19910 14136 13048 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905271.1 protein_id gnl|my_center|LOCUS_19910 14416 14973 gene locus_tag LOCUS_19920 14416 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 16045 15044 gene locus_tag LOCUS_19930 gene gmuE 16045 15044 CDS product fructokinase GmuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234095.1 protein_id gnl|my_center|LOCUS_19930 16118 16597 gene locus_tag LOCUS_19940 16118 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence054 127 201 gene locus_tag LOCUS_t00400 127 201 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 435 1265 gene locus_tag LOCUS_19950 435 1265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837184.1 protein_id gnl|my_center|LOCUS_19950 1279 2034 gene locus_tag LOCUS_19960 1279 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2061 3911 gene locus_tag LOCUS_19970 2061 3911 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068688.1 protein_id gnl|my_center|LOCUS_19970 4361 4065 gene locus_tag LOCUS_19980 4361 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 4254 4781 gene locus_tag LOCUS_19990 gene pyrR 4254 4781 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460661.1 protein_id gnl|my_center|LOCUS_19990 4781 5719 gene locus_tag LOCUS_20000 4781 5719 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_20000 5703 7001 gene locus_tag LOCUS_20010 5703 7001 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_20010 6998 7846 gene locus_tag LOCUS_20020 6998 7846 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765719.1 protein_id gnl|my_center|LOCUS_20020 7843 8766 gene locus_tag LOCUS_20030 7843 8766 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_20030 8760 9479 gene locus_tag LOCUS_20040 gene pyrF 8760 9479 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_20040 9643 9975 gene locus_tag LOCUS_20050 gene mihF 9643 9975 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_20050 9975 10553 gene locus_tag LOCUS_20060 gene gmk 9975 10553 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_20060 10553 10837 gene locus_tag LOCUS_20070 10553 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 10837 12096 gene locus_tag LOCUS_20080 gene thiI 10837 12096 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878380.1 protein_id gnl|my_center|LOCUS_20080 12215 12979 gene locus_tag LOCUS_20090 12215 12979 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836677.1 protein_id gnl|my_center|LOCUS_20090 12972 15311 gene locus_tag LOCUS_20100 12972 15311 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 protein_id gnl|my_center|LOCUS_20100 15347 16327 gene locus_tag LOCUS_20110 gene holA 15347 16327 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence055 98 715 gene locus_tag LOCUS_20120 98 715 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_20120 1365 799 gene locus_tag LOCUS_20130 1365 799 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837101.1 protein_id gnl|my_center|LOCUS_20130 2205 1417 gene locus_tag LOCUS_20140 gene ygiD 2205 1417 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212189.1 protein_id gnl|my_center|LOCUS_20140 2345 2716 gene locus_tag LOCUS_20150 2345 2716 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814177.1 protein_id gnl|my_center|LOCUS_20150 2713 3495 gene locus_tag LOCUS_20160 2713 3495 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_20160 3660 4709 gene locus_tag LOCUS_20170 3660 4709 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812796.1 protein_id gnl|my_center|LOCUS_20170 4744 5370 gene locus_tag LOCUS_20180 4744 5370 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966375.1 protein_id gnl|my_center|LOCUS_20180 5478 6128 gene locus_tag LOCUS_20190 5478 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 6306 7259 gene locus_tag LOCUS_20200 6306 7259 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861477.1 protein_id gnl|my_center|LOCUS_20200 8390 7341 gene locus_tag LOCUS_20210 8390 7341 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035713.1 protein_id gnl|my_center|LOCUS_20210 8626 9660 gene locus_tag LOCUS_20220 8626 9660 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_20220 9829 10266 gene locus_tag LOCUS_20230 gene mscL 9829 10266 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_20230 10450 11763 gene locus_tag LOCUS_20240 gene hisS 10450 11763 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_20240 12476 11907 gene locus_tag LOCUS_20250 12476 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 13282 12749 gene locus_tag LOCUS_20260 13282 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 14187 15200 gene locus_tag LOCUS_20270 gene cbiM 14187 15200 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964089.1 protein_id gnl|my_center|LOCUS_20270 15187 16011 gene locus_tag LOCUS_20280 15187 16011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence056 653 1531 gene locus_tag LOCUS_20290 653 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389995.1 protein_id gnl|my_center|LOCUS_20290 1671 1823 gene locus_tag LOCUS_20300 1671 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1852 2232 gene locus_tag LOCUS_20310 1852 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2229 2855 gene locus_tag LOCUS_20320 2229 2855 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052109.1 protein_id gnl|my_center|LOCUS_20320 2926 3987 gene locus_tag LOCUS_20330 2926 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 4097 4810 gene locus_tag LOCUS_20340 4097 4810 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_20340 4980 4807 gene locus_tag LOCUS_20350 4980 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 5182 5601 gene locus_tag LOCUS_20360 5182 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20360 5618 6181 gene locus_tag LOCUS_20370 5618 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20370 6804 6427 gene locus_tag LOCUS_20380 6804 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 7034 6849 gene locus_tag LOCUS_20390 7034 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 7014 7397 gene locus_tag LOCUS_20400 7014 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 7398 7931 gene locus_tag LOCUS_20410 7398 7931 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_20410 7934 8506 gene locus_tag LOCUS_20420 7934 8506 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202093.1 protein_id gnl|my_center|LOCUS_20420 8550 8882 gene locus_tag LOCUS_20430 8550 8882 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_20430 9126 9530 gene locus_tag LOCUS_20440 9126 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 9674 9759 gene locus_tag LOCUS_t00410 9674 9759 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9870 10799 gene locus_tag LOCUS_20450 9870 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 11635 10892 gene locus_tag LOCUS_20460 11635 10892 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254139.1 protein_id gnl|my_center|LOCUS_20460 11855 12565 gene locus_tag LOCUS_20470 gene deoC 11855 12565 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254138.1 protein_id gnl|my_center|LOCUS_20470 12574 13536 gene locus_tag LOCUS_20480 12574 13536 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966201.1 protein_id gnl|my_center|LOCUS_20480 13545 14417 gene locus_tag LOCUS_20490 gene rfbD 13545 14417 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_20490 15291 14689 gene locus_tag LOCUS_20500 15291 14689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence057 698 48 gene locus_tag LOCUS_20510 698 48 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920863.1 protein_id gnl|my_center|LOCUS_20510 1305 808 gene locus_tag LOCUS_20520 1305 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20520 1932 1324 gene locus_tag LOCUS_20530 1932 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20530 3694 2537 gene locus_tag LOCUS_20540 3694 2537 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223849864.1 protein_id gnl|my_center|LOCUS_20540 4093 5541 gene locus_tag LOCUS_20550 4093 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 6157 5450 gene locus_tag LOCUS_20560 6157 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20560 6552 6274 gene locus_tag LOCUS_20570 6552 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20570 6530 6856 gene locus_tag LOCUS_20580 6530 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 7023 8321 gene locus_tag LOCUS_20590 gene eno 7023 8321 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_20590 8443 11208 gene locus_tag LOCUS_20600 gene mgtA 8443 11208 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905854.1 protein_id gnl|my_center|LOCUS_20600 12079 11183 gene locus_tag LOCUS_20610 12079 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 12846 12139 gene locus_tag LOCUS_20620 12846 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20620 13241 12963 gene locus_tag LOCUS_20630 13241 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20630 13778 13314 gene locus_tag LOCUS_20640 13778 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 14181 13849 gene locus_tag LOCUS_20650 14181 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 14455 14171 gene locus_tag LOCUS_20660 14455 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 14644 14462 gene locus_tag LOCUS_20670 14644 14462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 14855 14631 gene locus_tag LOCUS_20680 14855 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 15302 15227 gene locus_tag LOCUS_t00420 15302 15227 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence058 175 354 gene locus_tag LOCUS_20690 175 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 3226 488 gene locus_tag LOCUS_20700 3226 488 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 protein_id gnl|my_center|LOCUS_20700 5173 3404 gene locus_tag LOCUS_20710 gene aspS 5173 3404 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_20710 5566 6249 gene locus_tag LOCUS_20720 5566 6249 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_20720 6419 6724 gene locus_tag LOCUS_20730 6419 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 8451 6847 gene locus_tag LOCUS_20740 8451 6847 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_20740 9571 8573 gene locus_tag LOCUS_20750 9571 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 10517 9576 gene locus_tag LOCUS_20760 10517 9576 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068301.1 protein_id gnl|my_center|LOCUS_20760 10746 12131 gene locus_tag LOCUS_20770 10746 12131 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016800.1 protein_id gnl|my_center|LOCUS_20770 12340 12128 gene locus_tag LOCUS_20780 12340 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 13167 12520 gene locus_tag LOCUS_20790 13167 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 14217 13189 gene locus_tag LOCUS_20800 14217 13189 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082562.1 protein_id gnl|my_center|LOCUS_20800 14520 15248 gene locus_tag LOCUS_20810 14520 15248 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288176.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence059 132 1604 gene locus_tag LOCUS_20820 132 1604 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298149.1 protein_id gnl|my_center|LOCUS_20820 1625 3064 gene locus_tag LOCUS_20830 1625 3064 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861817.1 protein_id gnl|my_center|LOCUS_20830 3137 4081 gene locus_tag LOCUS_20840 3137 4081 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262899.1 protein_id gnl|my_center|LOCUS_20840 4157 4531 gene locus_tag LOCUS_20850 4157 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 4724 5896 gene locus_tag LOCUS_20860 4724 5896 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_20860 5971 9198 gene locus_tag LOCUS_20870 5971 9198 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149495417.1 protein_id gnl|my_center|LOCUS_20870 9274 9741 gene locus_tag LOCUS_20880 9274 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 9741 10400 gene locus_tag LOCUS_20890 9741 10400 CDS product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640660.1 protein_id gnl|my_center|LOCUS_20890 10591 11664 gene locus_tag LOCUS_20900 10591 11664 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_20900 11710 12477 gene locus_tag LOCUS_20910 11710 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 12494 14926 gene locus_tag LOCUS_20920 12494 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence060 197 637 gene locus_tag LOCUS_20930 gene rplM 197 637 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933443.1 protein_id gnl|my_center|LOCUS_20930 641 1036 gene locus_tag LOCUS_20940 gene rpsI 641 1036 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_20940 1199 1903 gene locus_tag LOCUS_20950 1199 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20950 1890 2096 gene locus_tag LOCUS_20960 1890 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20960 2252 4102 gene locus_tag LOCUS_20970 gene glmS 2252 4102 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_20970 4107 4637 gene locus_tag LOCUS_20980 4107 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4703 6334 gene locus_tag LOCUS_20990 4703 6334 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_20990 6331 7491 gene locus_tag LOCUS_21000 gene alr 6331 7491 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182683.1 protein_id gnl|my_center|LOCUS_21000 7484 8194 gene locus_tag LOCUS_21010 7484 8194 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_21010 8197 8715 gene locus_tag LOCUS_21020 gene tsaE 8197 8715 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002272923.1 protein_id gnl|my_center|LOCUS_21020 8740 11214 gene locus_tag LOCUS_21030 8740 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 11500 12399 gene locus_tag LOCUS_21040 11500 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 12484 13677 gene locus_tag LOCUS_21050 12484 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 13674 14426 gene locus_tag LOCUS_21060 13674 14426 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356242.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence061 1058 114 gene locus_tag LOCUS_21070 1058 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 1941 976 gene locus_tag LOCUS_21080 1941 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1973 3145 gene locus_tag LOCUS_21090 1973 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 3848 3195 gene locus_tag LOCUS_21100 3848 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 4861 3860 gene locus_tag LOCUS_21110 4861 3860 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_21110 5184 5447 gene locus_tag LOCUS_21120 5184 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 5447 5746 gene locus_tag LOCUS_21130 gene yafQ 5447 5746 CDS product type II toxin-antitoxin system mRNA interferase toxin YafQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615974.1 protein_id gnl|my_center|LOCUS_21130 5749 6645 gene locus_tag LOCUS_21140 5749 6645 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_21140 6764 7318 gene locus_tag LOCUS_21150 6764 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 7206 7763 gene locus_tag LOCUS_21160 7206 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 8750 7767 gene locus_tag LOCUS_21170 8750 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 8894 10330 gene locus_tag LOCUS_21180 8894 10330 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644020.1 protein_id gnl|my_center|LOCUS_21180 10374 11264 gene locus_tag LOCUS_21190 10374 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 12329 11445 gene locus_tag LOCUS_21200 12329 11445 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189188.1 protein_id gnl|my_center|LOCUS_21200 12843 12376 gene locus_tag LOCUS_21210 12843 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21210 13289 12840 gene locus_tag LOCUS_21220 13289 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 <14699 14176 gene locus_tag LOCUS_21230 <14699 14176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003644021.1:ChbG/HpnK family deacetylase >Feature sequence062 482 1876 gene locus_tag LOCUS_21240 482 1876 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_21240 2675 1965 gene locus_tag LOCUS_21250 gene dapD 2675 1965 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286875.1 protein_id gnl|my_center|LOCUS_21250 4002 2701 gene locus_tag LOCUS_21260 4002 2701 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905867.1 protein_id gnl|my_center|LOCUS_21260 4196 5335 gene locus_tag LOCUS_21270 4196 5335 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286870.1 protein_id gnl|my_center|LOCUS_21270 6593 5430 gene locus_tag LOCUS_21280 6593 5430 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_21280 7461 6673 gene locus_tag LOCUS_21290 7461 6673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184185.1 protein_id gnl|my_center|LOCUS_21290 8518 7466 gene locus_tag LOCUS_21300 8518 7466 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_21300 9351 8515 gene locus_tag LOCUS_21310 9351 8515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_21310 9682 9344 gene locus_tag LOCUS_21320 9682 9344 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 protein_id gnl|my_center|LOCUS_21320 10038 10559 gene locus_tag LOCUS_21330 10038 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 11816 10650 gene locus_tag LOCUS_21340 11816 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21340 12320 12135 gene locus_tag LOCUS_21350 12320 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21350 14333 12417 gene locus_tag LOCUS_21360 gene istA 14333 12417 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100512979.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence063 1809 988 gene locus_tag LOCUS_21370 1809 988 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096700.1 protein_id gnl|my_center|LOCUS_21370 2011 1823 gene locus_tag LOCUS_21380 2011 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1938 2447 gene locus_tag LOCUS_21390 1938 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3056 2832 gene locus_tag LOCUS_21400 3056 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 3086 4615 gene locus_tag LOCUS_21410 3086 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 5089 4625 gene locus_tag LOCUS_21420 5089 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 6431 5517 gene locus_tag LOCUS_21430 6431 5517 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132772.1 protein_id gnl|my_center|LOCUS_21430 7817 6864 gene locus_tag LOCUS_21440 7817 6864 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815889.1 protein_id gnl|my_center|LOCUS_21440 7972 7829 gene locus_tag LOCUS_21450 7972 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 8040 8576 gene locus_tag LOCUS_21460 8040 8576 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964041.1 protein_id gnl|my_center|LOCUS_21460 9827 8748 gene locus_tag LOCUS_21470 9827 8748 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922483.1 protein_id gnl|my_center|LOCUS_21470 12376 9872 gene locus_tag LOCUS_21480 12376 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618669.1 protein_id gnl|my_center|LOCUS_21480 12734 12444 gene locus_tag LOCUS_21490 12734 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 13924 12740 gene locus_tag LOCUS_21500 13924 12740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence064 99 593 gene locus_tag LOCUS_21510 99 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 811 1269 gene locus_tag LOCUS_21520 811 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2280 1285 gene locus_tag LOCUS_21530 2280 1285 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920869.1 protein_id gnl|my_center|LOCUS_21530 2684 3034 gene locus_tag LOCUS_21540 2684 3034 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869719.1 protein_id gnl|my_center|LOCUS_21540 3031 4626 gene locus_tag LOCUS_21550 3031 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21550 4643 4975 gene locus_tag LOCUS_21560 4643 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 4965 6131 gene locus_tag LOCUS_21570 4965 6131 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267598.1 protein_id gnl|my_center|LOCUS_21570 6191 7318 gene locus_tag LOCUS_21580 6191 7318 CDS product tyramine oxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014462.1 protein_id gnl|my_center|LOCUS_21580 7499 8368 gene locus_tag LOCUS_21590 7499 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 8471 8818 gene locus_tag LOCUS_21600 8471 8818 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_21600 8827 10239 gene locus_tag LOCUS_21610 gene proY 8827 10239 CDS product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445555.1 protein_id gnl|my_center|LOCUS_21610 10532 10353 gene locus_tag LOCUS_21620 10532 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 10738 10556 gene locus_tag LOCUS_21630 10738 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 11668 10832 gene locus_tag LOCUS_21640 11668 10832 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_21640 11873 12829 gene locus_tag LOCUS_21650 gene arcC 11873 12829 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074357.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence065 80 155 gene locus_tag LOCUS_t00430 80 155 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 576 313 gene locus_tag LOCUS_21660 576 313 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681864.1 protein_id gnl|my_center|LOCUS_21660 846 580 gene locus_tag LOCUS_21670 846 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1132 1887 gene locus_tag LOCUS_21680 gene rph 1132 1887 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369149.1 protein_id gnl|my_center|LOCUS_21680 1890 2522 gene locus_tag LOCUS_21690 1890 2522 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_21690 2694 3428 gene locus_tag LOCUS_21700 gene nagB 2694 3428 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_21700 4281 3541 gene locus_tag LOCUS_21710 4281 3541 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_21710 4495 5826 gene locus_tag LOCUS_21720 4495 5826 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948070.1 protein_id gnl|my_center|LOCUS_21720 5891 7339 gene locus_tag LOCUS_21730 5891 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 7437 8912 gene locus_tag LOCUS_21740 7437 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 10183 9107 gene locus_tag LOCUS_21750 10183 9107 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426912.1 protein_id gnl|my_center|LOCUS_21750 10391 10681 gene locus_tag LOCUS_21760 10391 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 10778 11683 gene locus_tag LOCUS_21770 10778 11683 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532835.1 protein_id gnl|my_center|LOCUS_21770 11699 11775 gene locus_tag LOCUS_t00440 11699 11775 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12410 11871 gene locus_tag LOCUS_21780 12410 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 12928 12665 gene locus_tag LOCUS_21790 12928 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence066 341 51 gene locus_tag LOCUS_21800 341 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 654 818 gene locus_tag LOCUS_21810 654 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 853 1197 gene locus_tag LOCUS_21820 853 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1397 1837 gene locus_tag LOCUS_21830 1397 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 3058 1859 gene locus_tag LOCUS_21840 3058 1859 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817234.1 protein_id gnl|my_center|LOCUS_21840 3679 3071 gene locus_tag LOCUS_21850 3679 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3873 4751 gene locus_tag LOCUS_21860 3873 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 4908 5405 gene locus_tag LOCUS_21870 4908 5405 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582520.1 protein_id gnl|my_center|LOCUS_21870 5573 7243 gene locus_tag LOCUS_21880 5573 7243 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068197.1 protein_id gnl|my_center|LOCUS_21880 8092 7352 gene locus_tag LOCUS_21890 8092 7352 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_21890 9617 8526 gene locus_tag LOCUS_21900 9617 8526 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258689.1 protein_id gnl|my_center|LOCUS_21900 9848 9773 gene locus_tag LOCUS_t00450 9848 9773 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10189 11715 gene locus_tag LOCUS_21910 10189 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence067 762 262 gene locus_tag LOCUS_21920 762 262 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775404.1 protein_id gnl|my_center|LOCUS_21920 3341 798 gene locus_tag LOCUS_21930 3341 798 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 protein_id gnl|my_center|LOCUS_21930 3939 3577 gene locus_tag LOCUS_21940 3939 3577 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134124.1 protein_id gnl|my_center|LOCUS_21940 4237 3932 gene locus_tag LOCUS_21950 4237 3932 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003741107.1 protein_id gnl|my_center|LOCUS_21950 5851 4418 gene locus_tag LOCUS_21960 5851 4418 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097450.1 protein_id gnl|my_center|LOCUS_21960 7263 5863 gene locus_tag LOCUS_21970 7263 5863 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355921.1 protein_id gnl|my_center|LOCUS_21970 7573 8292 gene locus_tag LOCUS_21980 7573 8292 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723222.1 protein_id gnl|my_center|LOCUS_21980 9363 8374 gene locus_tag LOCUS_21990 9363 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21990 9855 10091 gene locus_tag LOCUS_22000 9855 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 11215 10382 gene locus_tag LOCUS_22010 11215 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence068 <1 1985 gene locus_tag LOCUS_22020 <1 1985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287463.1:glycoside hydrolase family 73 protein 3166 2087 gene locus_tag LOCUS_22030 3166 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 3384 3175 gene locus_tag LOCUS_22040 3384 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 6337 3713 gene locus_tag LOCUS_22050 6337 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 8602 6629 gene locus_tag LOCUS_22060 8602 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002398588.1 protein_id gnl|my_center|LOCUS_22060 8561 8803 gene locus_tag LOCUS_22070 8561 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 9225 8995 gene locus_tag LOCUS_22080 9225 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 9458 10288 gene locus_tag LOCUS_22090 9458 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 10448 10224 gene locus_tag LOCUS_22100 10448 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence069 346 44 gene locus_tag LOCUS_22110 346 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 918 616 gene locus_tag LOCUS_22120 918 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 841 1098 gene locus_tag LOCUS_22130 841 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1867 1088 gene locus_tag LOCUS_22140 1867 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2502 1948 gene locus_tag LOCUS_22150 2502 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3302 2643 gene locus_tag LOCUS_22160 3302 2643 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390357.1 protein_id gnl|my_center|LOCUS_22160 4732 3569 gene locus_tag LOCUS_22170 4732 3569 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_22170 6606 4912 gene locus_tag LOCUS_22180 gene pgi 6606 4912 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389549.1 protein_id gnl|my_center|LOCUS_22180 7511 6963 gene locus_tag LOCUS_22190 7511 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 7683 8000 gene locus_tag LOCUS_22200 gene trxA 7683 8000 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966364.1 protein_id gnl|my_center|LOCUS_22200 8073 8762 gene locus_tag LOCUS_22210 8073 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 8740 8946 gene locus_tag LOCUS_22220 8740 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence070 1704 175 gene locus_tag LOCUS_22230 1704 175 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_22230 2254 1919 gene locus_tag LOCUS_22240 2254 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2811 2239 gene locus_tag LOCUS_22250 2811 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22250 4573 3230 gene locus_tag LOCUS_22260 4573 3230 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_22260 5288 4560 gene locus_tag LOCUS_22270 5288 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 7441 5291 gene locus_tag LOCUS_22280 7441 5291 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 protein_id gnl|my_center|LOCUS_22280 8888 7611 gene locus_tag LOCUS_22290 8888 7611 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978237.1 protein_id gnl|my_center|LOCUS_22290 9211 9867 gene locus_tag LOCUS_22300 9211 9867 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence071 630 49 gene locus_tag LOCUS_22310 630 49 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_22310 815 2044 gene locus_tag LOCUS_22320 815 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3023 2148 gene locus_tag LOCUS_22330 3023 2148 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729459.1 protein_id gnl|my_center|LOCUS_22330 3576 4367 gene locus_tag LOCUS_22340 3576 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 4452 4622 gene locus_tag LOCUS_22350 4452 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 5980 4619 gene locus_tag LOCUS_22360 5980 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22360 6247 6011 gene locus_tag LOCUS_22370 6247 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6298 6519 gene locus_tag LOCUS_22380 6298 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 7569 6787 gene locus_tag LOCUS_22390 7569 6787 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727863.1 protein_id gnl|my_center|LOCUS_22390 8140 8457 gene locus_tag LOCUS_22400 8140 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 8420 9889 gene locus_tag LOCUS_22410 8420 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence072 596 342 gene locus_tag LOCUS_22420 596 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22420 2566 956 gene locus_tag LOCUS_22430 2566 956 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416108.1 protein_id gnl|my_center|LOCUS_22430 3098 2655 gene locus_tag LOCUS_22440 3098 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 6445 3101 gene locus_tag LOCUS_22450 6445 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 8503 6551 gene locus_tag LOCUS_22460 8503 6551 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_22460 8985 9278 gene locus_tag LOCUS_22470 8985 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence073 492 151 gene locus_tag LOCUS_22480 492 151 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132230.1 protein_id gnl|my_center|LOCUS_22480 1070 585 gene locus_tag LOCUS_22490 1070 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1409 1903 gene locus_tag LOCUS_22500 1409 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 1893 3677 gene locus_tag LOCUS_22510 1893 3677 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_22510 3679 5487 gene locus_tag LOCUS_22520 3679 5487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_22520 7492 5543 gene locus_tag LOCUS_22530 7492 5543 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_22530 7999 8235 gene locus_tag LOCUS_22540 7999 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 8242 9495 gene locus_tag LOCUS_22550 8242 9495 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084785.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence074 98 340 gene locus_tag LOCUS_22560 98 340 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_22560 467 3136 gene locus_tag LOCUS_22570 467 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3295 4323 gene locus_tag LOCUS_22580 3295 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4533 5510 gene locus_tag LOCUS_22590 gene manA 4533 5510 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454782.1 protein_id gnl|my_center|LOCUS_22590 5691 6098 gene locus_tag LOCUS_22600 5691 6098 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_22600 6301 6444 gene locus_tag LOCUS_22610 6301 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 7253 6609 gene locus_tag LOCUS_22620 7253 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 7177 7380 gene locus_tag LOCUS_22630 7177 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 7377 7733 gene locus_tag LOCUS_22640 7377 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 8010 7831 gene locus_tag LOCUS_22650 8010 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence075 281 844 gene locus_tag LOCUS_22660 281 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 854 1000 gene locus_tag LOCUS_22670 854 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 1894 1130 gene locus_tag LOCUS_22680 gene gpmA 1894 1130 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670958.1 protein_id gnl|my_center|LOCUS_22680 2027 2254 gene locus_tag LOCUS_22690 2027 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2485 3843 gene locus_tag LOCUS_22700 gene glnA 2485 3843 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582594.1 protein_id gnl|my_center|LOCUS_22700 4273 5115 gene locus_tag LOCUS_22710 4273 5115 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_22710 5192 6631 gene locus_tag LOCUS_22720 5192 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 6624 7481 gene locus_tag LOCUS_22730 6624 7481 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144055.1 protein_id gnl|my_center|LOCUS_22730 7509 8354 gene locus_tag LOCUS_22740 gene glnH 7509 8354 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811110.1 protein_id gnl|my_center|LOCUS_22740 8540 9214 gene locus_tag LOCUS_22750 8540 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 9534 9280 gene locus_tag LOCUS_22760 9534 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence076 551 1594 gene locus_tag LOCUS_22770 551 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1992 5996 gene locus_tag LOCUS_22780 1992 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 6326 7609 gene locus_tag LOCUS_22790 6326 7609 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_22790 8739 7696 gene locus_tag LOCUS_22800 8739 7696 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_22800 9090 9386 gene locus_tag LOCUS_22810 9090 9386 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004133089.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence077 210 1175 gene locus_tag LOCUS_22820 210 1175 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878701.1 protein_id gnl|my_center|LOCUS_22820 1715 1251 gene locus_tag LOCUS_22830 1715 1251 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_22830 2704 1793 gene locus_tag LOCUS_22840 gene hslO 2704 1793 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148598.1 protein_id gnl|my_center|LOCUS_22840 3103 2798 gene locus_tag LOCUS_22850 3103 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3718 4611 gene locus_tag LOCUS_22860 3718 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 4653 5066 gene locus_tag LOCUS_22870 4653 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 5374 5697 gene locus_tag LOCUS_22880 5374 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22880 5694 5969 gene locus_tag LOCUS_22890 5694 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 5997 6587 gene locus_tag LOCUS_22900 5997 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 6651 7928 gene locus_tag LOCUS_22910 6651 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 9447 7873 gene locus_tag LOCUS_22920 9447 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence078 130 1290 gene locus_tag LOCUS_22930 130 1290 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966572.1 protein_id gnl|my_center|LOCUS_22930 1788 2177 gene locus_tag LOCUS_22940 1788 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3418 5580 gene locus_tag LOCUS_22950 3418 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 5583 6242 gene locus_tag LOCUS_22960 5583 6242 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571333.1 protein_id gnl|my_center|LOCUS_22960 6828 6367 gene locus_tag LOCUS_22970 6828 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 6830 7165 gene locus_tag LOCUS_22980 6830 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 7499 7771 gene locus_tag LOCUS_22990 7499 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 7771 7953 gene locus_tag LOCUS_23000 7771 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 8487 8209 gene locus_tag LOCUS_23010 8487 8209 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642340.1 protein_id gnl|my_center|LOCUS_23010 9106 8489 gene locus_tag LOCUS_23020 9106 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence079 237 1451 gene locus_tag LOCUS_23030 237 1451 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_23030 1636 1968 gene locus_tag LOCUS_23040 1636 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2060 4651 gene locus_tag LOCUS_23050 2060 4651 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_23050 5215 4745 gene locus_tag LOCUS_23060 5215 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 6596 5337 gene locus_tag LOCUS_23070 6596 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 6777 8963 gene locus_tag LOCUS_23080 gene ligA 6777 8963 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence080 289 813 gene locus_tag LOCUS_23090 289 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 1817 915 gene locus_tag LOCUS_23100 1817 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 2049 3113 gene locus_tag LOCUS_23110 2049 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 3837 3148 gene locus_tag LOCUS_23120 3837 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3966 5330 gene locus_tag LOCUS_23130 3966 5330 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803746.1 protein_id gnl|my_center|LOCUS_23130 5918 5400 gene locus_tag LOCUS_23140 5918 5400 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083201.1 protein_id gnl|my_center|LOCUS_23140 6005 6931 gene locus_tag LOCUS_23150 6005 6931 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 protein_id gnl|my_center|LOCUS_23150 7019 8158 gene locus_tag LOCUS_23160 7019 8158 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882793.1 protein_id gnl|my_center|LOCUS_23160 8813 8238 gene locus_tag LOCUS_23170 8813 8238 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898317.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence081 1748 735 gene locus_tag LOCUS_23180 1748 735 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229196.1 protein_id gnl|my_center|LOCUS_23180 2123 1821 gene locus_tag LOCUS_23190 2123 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2478 2756 gene locus_tag LOCUS_23200 2478 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3669 2878 gene locus_tag LOCUS_23210 3669 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 4274 3744 gene locus_tag LOCUS_23220 4274 3744 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_23220 7462 4445 gene locus_tag LOCUS_23230 7462 4445 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_23230 7708 8409 gene locus_tag LOCUS_23240 gene rgaR 7708 8409 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_23240 8411 8725 gene locus_tag LOCUS_23250 8411 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence082 205 1833 gene locus_tag LOCUS_23260 205 1833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_23260 1936 2952 gene locus_tag LOCUS_23270 1936 2952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810095.1 protein_id gnl|my_center|LOCUS_23270 2949 3857 gene locus_tag LOCUS_23280 2949 3857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810093.1 protein_id gnl|my_center|LOCUS_23280 3854 4843 gene locus_tag LOCUS_23290 3854 4843 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345583.1 protein_id gnl|my_center|LOCUS_23290 4846 5958 gene locus_tag LOCUS_23300 4846 5958 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459112.1 protein_id gnl|my_center|LOCUS_23300 6523 6083 gene locus_tag LOCUS_23310 6523 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 6569 7408 gene locus_tag LOCUS_23320 6569 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23320 7383 7775 gene locus_tag LOCUS_23330 7383 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23330 8647 7691 gene locus_tag LOCUS_23340 gene bsh 8647 7691 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052221.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence083 995 276 gene locus_tag LOCUS_23350 995 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 1266 2618 gene locus_tag LOCUS_23360 1266 2618 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676360.1 protein_id gnl|my_center|LOCUS_23360 2879 2700 gene locus_tag LOCUS_23370 2879 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 3160 2855 gene locus_tag LOCUS_23380 3160 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3672 3157 gene locus_tag LOCUS_23390 3672 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 3794 4849 gene locus_tag LOCUS_23400 gene galE 3794 4849 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_23400 4856 5899 gene locus_tag LOCUS_23410 gene idsA 4856 5899 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_23410 6019 6933 gene locus_tag LOCUS_23420 6019 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 6984 7058 gene locus_tag LOCUS_t00460 6984 7058 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8136 7210 gene locus_tag LOCUS_23430 8136 7210 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence084 1279 59 gene locus_tag LOCUS_23440 1279 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 1366 2265 gene locus_tag LOCUS_23450 gene rfbA 1366 2265 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_23450 2317 3336 gene locus_tag LOCUS_23460 gene rfbB 2317 3336 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389344.1 protein_id gnl|my_center|LOCUS_23460 3346 4803 gene locus_tag LOCUS_23470 3346 4803 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068371.1 protein_id gnl|my_center|LOCUS_23470 5058 6932 gene locus_tag LOCUS_23480 5058 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 8125 7268 gene locus_tag LOCUS_23490 8125 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence085 1343 1050 gene locus_tag LOCUS_23500 1343 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2881 1418 gene locus_tag LOCUS_23510 2881 1418 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_23510 7528 2885 gene locus_tag LOCUS_23520 gene gltB 7528 2885 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence086 335 559 gene locus_tag LOCUS_23530 335 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 788 1996 gene locus_tag LOCUS_23540 788 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2178 2321 gene locus_tag LOCUS_23550 2178 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 5797 2372 gene locus_tag LOCUS_23560 5797 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 6860 6264 gene locus_tag LOCUS_23570 6860 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23570 7128 7736 gene locus_tag LOCUS_23580 7128 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence087 1221 415 gene locus_tag LOCUS_23590 1221 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_23590 3210 1459 gene locus_tag LOCUS_23600 3210 1459 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_23600 4112 3285 gene locus_tag LOCUS_23610 4112 3285 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251908.1 protein_id gnl|my_center|LOCUS_23610 4599 4192 gene locus_tag LOCUS_23620 4599 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 4898 4623 gene locus_tag LOCUS_23630 4898 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23630 5522 4920 gene locus_tag LOCUS_23640 5522 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23640 6118 5522 gene locus_tag LOCUS_23650 6118 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23650 6098 6553 gene locus_tag LOCUS_23660 6098 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 6916 6542 gene locus_tag LOCUS_23670 6916 6542 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964767.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23670 7252 6938 gene locus_tag LOCUS_23680 7252 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence088 1101 64 gene locus_tag LOCUS_23690 1101 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 3773 1101 gene locus_tag LOCUS_23700 3773 1101 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227576.1 protein_id gnl|my_center|LOCUS_23700 5266 3770 gene locus_tag LOCUS_23710 5266 3770 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_23710 5333 6607 gene locus_tag LOCUS_23720 5333 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 <7637 6724 gene locus_tag LOCUS_23730 <7637 6724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682348.1:NAD(P)-dependent oxidoreductase >Feature sequence089 499 2634 gene locus_tag LOCUS_23740 499 2634 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350638.1 protein_id gnl|my_center|LOCUS_23740 2800 2946 gene locus_tag LOCUS_23750 2800 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 4449 3151 gene locus_tag LOCUS_23760 4449 3151 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090422545.1 protein_id gnl|my_center|LOCUS_23760 4763 4539 gene locus_tag LOCUS_23770 4763 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 4911 5135 gene locus_tag LOCUS_23780 4911 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 5132 5353 gene locus_tag LOCUS_23790 5132 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 5346 6035 gene locus_tag LOCUS_23800 5346 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 6339 7475 gene locus_tag LOCUS_23810 6339 7475 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029666.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence090 1884 940 gene locus_tag LOCUS_23820 1884 940 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723338.1 protein_id gnl|my_center|LOCUS_23820 1930 2538 gene locus_tag LOCUS_23830 1930 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2710 3594 gene locus_tag LOCUS_23840 2710 3594 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048407.1 protein_id gnl|my_center|LOCUS_23840 3750 5585 gene locus_tag LOCUS_23850 gene ade 3750 5585 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948084.1 protein_id gnl|my_center|LOCUS_23850 6355 5582 gene locus_tag LOCUS_23860 6355 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 7152 6364 gene locus_tag LOCUS_23870 7152 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence091 229 804 gene locus_tag LOCUS_23880 229 804 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_23880 915 1448 gene locus_tag LOCUS_23890 915 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1612 2745 gene locus_tag LOCUS_23900 1612 2745 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095789.1 protein_id gnl|my_center|LOCUS_23900 2863 3405 gene locus_tag LOCUS_23910 2863 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3690 4850 gene locus_tag LOCUS_23920 3690 4850 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_23920 5044 7134 gene locus_tag LOCUS_23930 5044 7134 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence092 376 2094 gene locus_tag LOCUS_23940 376 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352237.1 protein_id gnl|my_center|LOCUS_23940 2517 2137 gene locus_tag LOCUS_23950 2517 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23950 3133 2411 gene locus_tag LOCUS_23960 3133 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23960 3269 3775 gene locus_tag LOCUS_23970 3269 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 4035 5075 gene locus_tag LOCUS_23980 gene asrA 4035 5075 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964821.1 protein_id gnl|my_center|LOCUS_23980 5068 5901 gene locus_tag LOCUS_23990 gene asrB 5068 5901 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964822.1 protein_id gnl|my_center|LOCUS_23990 5912 6901 gene locus_tag LOCUS_24000 gene asrC 5912 6901 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964823.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence093 800 39 gene locus_tag LOCUS_24010 800 39 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674147.1 protein_id gnl|my_center|LOCUS_24010 1080 2414 gene locus_tag LOCUS_24020 1080 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2543 4219 gene locus_tag LOCUS_24030 2543 4219 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_24030 5457 4342 gene locus_tag LOCUS_24040 5457 4342 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287014.1 protein_id gnl|my_center|LOCUS_24040 6719 5631 gene locus_tag LOCUS_24050 6719 5631 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027115.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence094 1656 403 gene locus_tag LOCUS_24060 gene istA 1656 403 CDS product IS21-like element ISSme2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970474.1 protein_id gnl|my_center|LOCUS_24060 2616 1771 gene locus_tag LOCUS_24070 2616 1771 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084879622.1 protein_id gnl|my_center|LOCUS_24070 2956 3219 gene locus_tag LOCUS_24080 2956 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 3793 4047 gene locus_tag LOCUS_24090 3793 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 4080 6236 gene locus_tag LOCUS_24100 4080 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 6220 6570 gene locus_tag LOCUS_24110 6220 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 6695 6847 gene locus_tag LOCUS_24120 6695 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence095 408 1286 gene locus_tag LOCUS_24130 408 1286 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_24130 2500 1766 gene locus_tag LOCUS_24140 2500 1766 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_24140 2754 2545 gene locus_tag LOCUS_24150 2754 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 3571 2990 gene locus_tag LOCUS_24160 3571 2990 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906151.1 protein_id gnl|my_center|LOCUS_24160 5285 3651 gene locus_tag LOCUS_24170 gene hcp 5285 3651 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681572.1 protein_id gnl|my_center|LOCUS_24170 5533 6120 gene locus_tag LOCUS_24180 5533 6120 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_24180 6296 6550 gene locus_tag LOCUS_24190 6296 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence096 <1 637 gene locus_tag LOCUS_24200 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964914.1:DUF434 domain-containing protein 2281 701 gene locus_tag LOCUS_24210 2281 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2986 2399 gene locus_tag LOCUS_24220 2986 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 3736 3002 gene locus_tag LOCUS_24230 3736 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 3902 4744 gene locus_tag LOCUS_24240 3902 4744 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_24240 4775 4975 gene locus_tag LOCUS_24250 4775 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 5748 4969 gene locus_tag LOCUS_24260 gene yaaA 5748 4969 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100877.1 protein_id gnl|my_center|LOCUS_24260 5829 6449 gene locus_tag LOCUS_24270 gene trmL 5829 6449 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356826.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence097 554 108 gene locus_tag LOCUS_24280 554 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1672 797 gene locus_tag LOCUS_24290 1672 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1706 1921 gene locus_tag LOCUS_24300 1706 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 5128 2168 gene locus_tag LOCUS_24310 5128 2168 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_24310 5325 5137 gene locus_tag LOCUS_24320 5325 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24320 5529 5377 gene locus_tag LOCUS_24330 5529 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24330 6156 5677 gene locus_tag LOCUS_24340 6156 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence098 2257 701 gene locus_tag LOCUS_24350 2257 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2963 2688 gene locus_tag LOCUS_24360 2963 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 3283 2960 gene locus_tag LOCUS_24370 3283 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24370 4004 3591 gene locus_tag LOCUS_24380 4004 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 4361 4053 gene locus_tag LOCUS_24390 4361 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 4354 4866 gene locus_tag LOCUS_24400 4354 4866 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213035039.1 protein_id gnl|my_center|LOCUS_24400 5622 5281 gene locus_tag LOCUS_24410 5622 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 5989 5636 gene locus_tag LOCUS_24420 5989 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 6211 6020 gene locus_tag LOCUS_24430 6211 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence099 277 1425 gene locus_tag LOCUS_24440 277 1425 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706477.1 protein_id gnl|my_center|LOCUS_24440 1520 2218 gene locus_tag LOCUS_24450 1520 2218 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454365.1 protein_id gnl|my_center|LOCUS_24450 2995 2279 gene locus_tag LOCUS_24460 2995 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 3228 3677 gene locus_tag LOCUS_24470 3228 3677 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041894.1 protein_id gnl|my_center|LOCUS_24470 4741 3719 gene locus_tag LOCUS_24480 4741 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 4895 5242 gene locus_tag LOCUS_24490 4895 5242 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943204.1 protein_id gnl|my_center|LOCUS_24490 5268 6116 gene locus_tag LOCUS_24500 5268 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence100 42 662 gene locus_tag LOCUS_24510 42 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 677 949 gene locus_tag LOCUS_24520 gene ptsH 677 949 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874410.1 protein_id gnl|my_center|LOCUS_24520 1298 1104 gene locus_tag LOCUS_24530 1298 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2688 1354 gene locus_tag LOCUS_24540 gene brnQ 2688 1354 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771670.1 protein_id gnl|my_center|LOCUS_24540 2870 3634 gene locus_tag LOCUS_24550 2870 3634 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_24550 4533 3901 gene locus_tag LOCUS_24560 4533 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24560 6046 5180 gene locus_tag LOCUS_24570 6046 5180 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence101 1162 77 gene locus_tag LOCUS_24580 gene uxuA 1162 77 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906067.1 protein_id gnl|my_center|LOCUS_24580 3009 1273 gene locus_tag LOCUS_24590 3009 1273 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_24590 4448 3030 gene locus_tag LOCUS_24600 4448 3030 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264948.1 protein_id gnl|my_center|LOCUS_24600 5704 4526 gene locus_tag LOCUS_24610 5704 4526 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287584.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24610 >Feature sequence102 69 506 gene locus_tag LOCUS_24620 69 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 702 1460 gene locus_tag LOCUS_24630 702 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 1447 2763 gene locus_tag LOCUS_24640 1447 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2910 4199 gene locus_tag LOCUS_24650 2910 4199 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085150668.1 protein_id gnl|my_center|LOCUS_24650 5187 4618 gene locus_tag LOCUS_24660 5187 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence103 1691 123 gene locus_tag LOCUS_24670 1691 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1875 2972 gene locus_tag LOCUS_24680 1875 2972 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476154.1 protein_id gnl|my_center|LOCUS_24680 3622 3023 gene locus_tag LOCUS_24690 3622 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 3761 4609 gene locus_tag LOCUS_24700 3761 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4651 4953 gene locus_tag LOCUS_24710 4651 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 4973 5563 gene locus_tag LOCUS_24720 4973 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence104 499 2757 gene locus_tag LOCUS_24730 gene glgP 499 2757 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_24730 3959 2964 gene locus_tag LOCUS_24740 3959 2964 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 protein_id gnl|my_center|LOCUS_24740 5368 3959 gene locus_tag LOCUS_24750 gene glmU 5368 3959 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931068.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence105 1083 85 gene locus_tag LOCUS_24760 1083 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24760 1328 1014 gene locus_tag LOCUS_24770 1328 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24770 5133 1576 gene locus_tag LOCUS_24780 gene nifJ 5133 1576 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence106 220 1908 gene locus_tag LOCUS_24790 220 1908 CDS product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235628.1 protein_id gnl|my_center|LOCUS_24790 1908 3569 gene locus_tag LOCUS_24800 1908 3569 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706258.1 protein_id gnl|my_center|LOCUS_24800 3664 4779 gene locus_tag LOCUS_24810 3664 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence107 2215 332 gene locus_tag LOCUS_24820 2215 332 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_24820 3974 2220 gene locus_tag LOCUS_24830 3974 2220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813950.1 protein_id gnl|my_center|LOCUS_24830 4459 3971 gene locus_tag LOCUS_24840 4459 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence108 170 1201 gene locus_tag LOCUS_24850 170 1201 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674809.1 protein_id gnl|my_center|LOCUS_24850 1581 4310 gene locus_tag LOCUS_24860 gene mgtA 1581 4310 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861942.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence109 320 78 gene locus_tag LOCUS_24870 320 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1081 317 gene locus_tag LOCUS_24880 1081 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1509 3335 gene locus_tag LOCUS_24890 1509 3335 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209314.1 protein_id gnl|my_center|LOCUS_24890 3384 4184 gene locus_tag LOCUS_24900 3384 4184 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence110 <1 524 gene locus_tag LOCUS_24910 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003644021.1:ChbG/HpnK family deacetylase 1603 842 gene locus_tag LOCUS_24920 1603 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 1912 1712 gene locus_tag LOCUS_24930 1912 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 2501 2037 gene locus_tag LOCUS_24940 2501 2037 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830812.1 protein_id gnl|my_center|LOCUS_24940 3407 2568 gene locus_tag LOCUS_24950 3407 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24950 3820 3596 gene locus_tag LOCUS_24960 3820 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24960 4064 3858 gene locus_tag LOCUS_24970 4064 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence111 802 1080 gene locus_tag LOCUS_24980 802 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 1158 2240 gene locus_tag LOCUS_24990 1158 2240 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921803.1 protein_id gnl|my_center|LOCUS_24990 2339 3154 gene locus_tag LOCUS_25000 2339 3154 CDS product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921804.1 protein_id gnl|my_center|LOCUS_25000 3165 3656 gene locus_tag LOCUS_25010 3165 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence112 1295 189 gene locus_tag LOCUS_25020 1295 189 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705577.1 protein_id gnl|my_center|LOCUS_25020 2364 1396 gene locus_tag LOCUS_25030 2364 1396 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727988.1 protein_id gnl|my_center|LOCUS_25030 2616 2467 gene locus_tag LOCUS_25040 2616 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25040 3453 2797 gene locus_tag LOCUS_25050 gene azlC 3453 2797 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence113 1047 274 gene locus_tag LOCUS_25060 gene istB 1047 274 CDS product IS21-like element IS100kyp family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214079.1 protein_id gnl|my_center|LOCUS_25060 2351 1047 gene locus_tag LOCUS_25070 2351 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3013 2456 gene locus_tag LOCUS_25080 3013 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3177 2998 gene locus_tag LOCUS_25090 3177 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence114 399 94 gene locus_tag LOCUS_25100 399 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 1408 404 gene locus_tag LOCUS_25110 1408 404 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_25110 2340 1405 gene locus_tag LOCUS_25120 2340 1405 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_25120 <3170 2337 gene locus_tag LOCUS_25130 <3170 2337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149764772.1:site-specific integrase >Feature sequence115 112 606 gene locus_tag LOCUS_25140 112 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 655 2391 gene locus_tag LOCUS_25150 655 2391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012914013.1 protein_id gnl|my_center|LOCUS_25150 2495 3047 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctcaacgaaggggctagcaatctcttgctagccag >Feature sequence116 105 323 gene locus_tag LOCUS_25160 105 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1744 407 gene locus_tag LOCUS_25170 gene glmM 1744 407 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521427.1 protein_id gnl|my_center|LOCUS_25170 1925 2248 gene locus_tag LOCUS_25180 1925 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2273 3034 gene locus_tag LOCUS_25190 2273 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence117 188 1684 gene locus_tag LOCUS_25200 188 1684 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994262.1 protein_id gnl|my_center|LOCUS_25200 1955 2449 gene locus_tag LOCUS_25210 1955 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence118 427 11 gene locus_tag LOCUS_25220 427 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25220 562 729 gene locus_tag LOCUS_25230 562 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 726 1103 gene locus_tag LOCUS_25240 726 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25240 2547 1222 gene locus_tag LOCUS_25250 2547 1222 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815310.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence119 1689 469 gene locus_tag LOCUS_25260 1689 469 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976770.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence120 981 166 gene locus_tag LOCUS_25270 gene istB 981 166 CDS product IS21-like element IS100kyp family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317493.1 protein_id gnl|my_center|LOCUS_25270 2296 983 gene locus_tag LOCUS_25280 2296 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence121 916 668 gene locus_tag LOCUS_25290 916 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 1870 1025 gene locus_tag LOCUS_25300 1870 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence122 81 365 gene locus_tag LOCUS_25310 81 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1632 1456 gene locus_tag LOCUS_25320 1632 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 >Feature sequence123 743 228 gene locus_tag LOCUS_25330 743 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 1403 1086 gene locus_tag LOCUS_25340 1403 1086 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_25340 1797 1408 gene locus_tag LOCUS_25350 1797 1408 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462027.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence124 1753 155 gene locus_tag LOCUS_25360 1753 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 1965 1750 gene locus_tag LOCUS_25370 1965 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence125 1196 651 gene locus_tag LOCUS_25380 1196 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence126 539 60 gene locus_tag LOCUS_25390 539 60 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_25390 1081 662 gene locus_tag LOCUS_25400 1081 662 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056959.1 protein_id gnl|my_center|LOCUS_25400 1516 1115 gene locus_tag LOCUS_25410 1516 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence127 1004 33 gene locus_tag LOCUS_25420 1004 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence128 113 1030 gene locus_tag LOCUS_25430 113 1030 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_25430