>Feature sequence01 <1 1377 gene locus_tag LOCUS_00010 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000187233.1:restriction endonuclease subunit S 1411 1968 gene locus_tag LOCUS_00020 1411 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2012 2815 gene locus_tag LOCUS_00030 2012 2815 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680804.1 protein_id gnl|my_center|LOCUS_00030 4178 2859 gene locus_tag LOCUS_00040 4178 2859 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187233.1 protein_id gnl|my_center|LOCUS_00040 4552 4462 gene locus_tag LOCUS_t00010 4552 4462 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5387 4683 gene locus_tag LOCUS_00050 5387 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5908 5717 gene locus_tag LOCUS_00060 5908 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6237 7358 gene locus_tag LOCUS_00070 gene nagA 6237 7358 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722368.1 protein_id gnl|my_center|LOCUS_00070 7494 8717 gene locus_tag LOCUS_00080 7494 8717 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_00080 8693 9733 gene locus_tag LOCUS_00090 8693 9733 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_00090 9730 10863 gene locus_tag LOCUS_00100 9730 10863 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_00100 10869 12014 gene locus_tag LOCUS_00110 gene cap8G 10869 12014 CDS product type 8 capsular polysaccharide synthesis protein Cap8G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 protein_id gnl|my_center|LOCUS_00110 12011 13243 gene locus_tag LOCUS_00120 12011 13243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13982 13302 gene locus_tag LOCUS_00130 13982 13302 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_00130 14099 14473 gene locus_tag LOCUS_00140 14099 14473 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_00140 14909 15961 gene locus_tag LOCUS_00150 14909 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15951 16661 gene locus_tag LOCUS_00160 15951 16661 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_00160 16972 17145 gene locus_tag LOCUS_00170 16972 17145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17166 17363 gene locus_tag LOCUS_00180 17166 17363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17363 17581 gene locus_tag LOCUS_00190 17363 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17660 18589 gene locus_tag LOCUS_00200 gene metF 17660 18589 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_00200 18635 19405 gene locus_tag LOCUS_00210 18635 19405 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_00210 19462 20400 gene locus_tag LOCUS_00220 gene acsD 19462 20400 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432254.1 protein_id gnl|my_center|LOCUS_00220 20416 22680 gene locus_tag LOCUS_00230 20416 22680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22870 24993 gene locus_tag LOCUS_00240 gene acsB 22870 24993 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418359.1 protein_id gnl|my_center|LOCUS_00240 25081 26997 gene locus_tag LOCUS_00250 gene acsV 25081 26997 CDS product corrinoid activation/regeneration protein AcsV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436926.1 protein_id gnl|my_center|LOCUS_00250 27008 27643 gene locus_tag LOCUS_00260 27008 27643 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437313.1 protein_id gnl|my_center|LOCUS_00260 27996 28580 gene locus_tag LOCUS_00270 27996 28580 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869204.1 protein_id gnl|my_center|LOCUS_00270 28625 29899 gene locus_tag LOCUS_00280 28625 29899 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_00280 30063 31736 gene locus_tag LOCUS_00290 30063 31736 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_00290 31831 32451 gene locus_tag LOCUS_00300 31831 32451 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432265.1 protein_id gnl|my_center|LOCUS_00300 32469 33329 gene locus_tag LOCUS_00310 32469 33329 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_00310 33353 34174 gene locus_tag LOCUS_00320 33353 34174 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_00320 34164 34754 gene locus_tag LOCUS_00330 34164 34754 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_00330 34873 35685 gene locus_tag LOCUS_00340 34873 35685 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287979.1 protein_id gnl|my_center|LOCUS_00340 35963 36598 gene locus_tag LOCUS_00350 gene yqeC 35963 36598 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_00350 36624 37415 gene locus_tag LOCUS_00360 gene yqeB 36624 37415 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_00360 37419 38453 gene locus_tag LOCUS_00370 gene selD 37419 38453 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957237.1 protein_id gnl|my_center|LOCUS_00370 38710 39765 gene locus_tag LOCUS_00380 gene yedE 38710 39765 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_00380 39770 39979 gene locus_tag LOCUS_00390 39770 39979 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392950.1 protein_id gnl|my_center|LOCUS_00390 40413 40733 gene locus_tag LOCUS_00400 40413 40733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40780 41589 gene locus_tag LOCUS_00410 40780 41589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 41586 43301 gene locus_tag LOCUS_00420 41586 43301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43327 44205 gene locus_tag LOCUS_00430 43327 44205 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_00430 44178 45806 gene locus_tag LOCUS_00440 44178 45806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 45803 46489 gene locus_tag LOCUS_00450 45803 46489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 48105 46696 gene locus_tag LOCUS_00460 48105 46696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 49434 48220 gene locus_tag LOCUS_00470 49434 48220 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_00470 49778 49440 gene locus_tag LOCUS_00480 49778 49440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 49926 50540 gene locus_tag LOCUS_00490 49926 50540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 51256 50606 gene locus_tag LOCUS_00500 gene rpe 51256 50606 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_00500 52130 51249 gene locus_tag LOCUS_00510 gene rsgA 52130 51249 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_00510 54033 52135 gene locus_tag LOCUS_00520 gene pknB 54033 52135 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_00520 54764 54030 gene locus_tag LOCUS_00530 54764 54030 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830090.1 protein_id gnl|my_center|LOCUS_00530 55788 54748 gene locus_tag LOCUS_00540 gene rlmN 55788 54748 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_00540 57098 55779 gene locus_tag LOCUS_00550 gene rsmB 57098 55779 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232068.1 protein_id gnl|my_center|LOCUS_00550 58021 57095 gene locus_tag LOCUS_00560 gene fmt 58021 57095 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_00560 58512 58018 gene locus_tag LOCUS_00570 gene def 58512 58018 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_00570 58762 59790 gene locus_tag LOCUS_00580 58762 59790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 61938 60085 gene locus_tag LOCUS_00590 61938 60085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_00590 63761 61935 gene locus_tag LOCUS_00600 63761 61935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_00600 66047 63783 gene locus_tag LOCUS_00610 gene priA 66047 63783 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_00610 66391 66188 gene locus_tag LOCUS_00620 66391 66188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 67016 66393 gene locus_tag LOCUS_00630 gene gmk 67016 66393 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_00630 67313 67056 gene locus_tag LOCUS_00640 67313 67056 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_00640 68200 67325 gene locus_tag LOCUS_00650 68200 67325 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_00650 69215 68244 gene locus_tag LOCUS_00660 69215 68244 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_00660 71173 69212 gene locus_tag LOCUS_00670 gene ligA 71173 69212 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_00670 73425 71176 gene locus_tag LOCUS_00680 gene pcrA 73425 71176 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_00680 73585 74007 gene locus_tag LOCUS_00690 73585 74007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_00690 74034 75509 gene locus_tag LOCUS_00700 gene thrC 74034 75509 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_00700 75499 76677 gene locus_tag LOCUS_00710 75499 76677 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_00710 76706 77947 gene locus_tag LOCUS_00720 76706 77947 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_00720 78093 80165 gene locus_tag LOCUS_00730 gene fusA 78093 80165 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_00730 80651 82036 gene locus_tag LOCUS_00740 gene miaB 80651 82036 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_00740 82033 82416 gene locus_tag LOCUS_00750 82033 82416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 82452 85079 gene locus_tag LOCUS_00760 gene mutS 82452 85079 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_00760 85076 87025 gene locus_tag LOCUS_00770 gene mutL 85076 87025 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_00770 87025 87987 gene locus_tag LOCUS_00780 gene miaA 87025 87987 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_00780 87984 89225 gene locus_tag LOCUS_00790 87984 89225 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_00790 89897 89247 gene locus_tag LOCUS_00800 gene lexA 89897 89247 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_00800 91418 90363 gene locus_tag LOCUS_00810 91418 90363 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_00810 91622 91957 gene locus_tag LOCUS_00820 91622 91957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 92476 92844 gene locus_tag LOCUS_00830 92476 92844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 93090 92857 gene locus_tag LOCUS_00840 93090 92857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 94044 93532 gene locus_tag LOCUS_00850 gene rnhA 94044 93532 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_00850 94811 94017 gene locus_tag LOCUS_00860 gene proC 94811 94017 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_00860 95372 96091 gene locus_tag LOCUS_00870 95372 96091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 96067 96264 gene locus_tag LOCUS_00880 96067 96264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 96697 96569 gene locus_tag LOCUS_00890 96697 96569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 97024 96833 gene locus_tag LOCUS_00900 97024 96833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 97407 97334 gene locus_tag LOCUS_t00020 97407 97334 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 98375 97449 gene locus_tag LOCUS_00910 98375 97449 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_00910 99992 98451 gene locus_tag LOCUS_00920 gene rny 99992 98451 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_00920 104189 100155 gene locus_tag LOCUS_00930 104189 100155 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_00930 105288 104224 gene locus_tag LOCUS_00940 gene ispG 105288 104224 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902396.1 protein_id gnl|my_center|LOCUS_00940 106306 105296 gene locus_tag LOCUS_00950 gene rseP 106306 105296 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_00950 107491 106352 gene locus_tag LOCUS_00960 107491 106352 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_00960 108328 107513 gene locus_tag LOCUS_00970 108328 107513 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_00970 109062 108325 gene locus_tag LOCUS_00980 109062 108325 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_00980 109323 109123 gene locus_tag LOCUS_00990 109323 109123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 109877 109320 gene locus_tag LOCUS_01000 gene frr 109877 109320 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_01000 110636 109944 gene locus_tag LOCUS_01010 gene pyrH 110636 109944 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430597.1 protein_id gnl|my_center|LOCUS_01010 111581 110700 gene locus_tag LOCUS_01020 gene tsf 111581 110700 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965094.1 protein_id gnl|my_center|LOCUS_01020 112339 111602 gene locus_tag LOCUS_01030 gene rpsB 112339 111602 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_01030 112792 112511 gene locus_tag LOCUS_01040 112792 112511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 113241 112813 gene locus_tag LOCUS_01050 gene ruvX 113241 112813 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_01050 113501 113241 gene locus_tag LOCUS_01060 113501 113241 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_01060 113692 114690 gene locus_tag LOCUS_01070 113692 114690 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_01070 115127 114705 gene locus_tag LOCUS_01080 115127 114705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 115540 115229 gene locus_tag LOCUS_01090 gene yajC 115540 115229 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965579.1 protein_id gnl|my_center|LOCUS_01090 115893 115723 gene locus_tag LOCUS_01100 115893 115723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 116396 115992 gene locus_tag LOCUS_01110 gene nifU 116396 115992 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272433.1 protein_id gnl|my_center|LOCUS_01110 117568 116396 gene locus_tag LOCUS_01120 gene nifS 117568 116396 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_01120 118001 117549 gene locus_tag LOCUS_01130 118001 117549 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_01130 118487 118173 gene locus_tag LOCUS_01140 gene trxA 118487 118173 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_01140 118936 118487 gene locus_tag LOCUS_01150 118936 118487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 120723 118933 gene locus_tag LOCUS_01160 gene aspS 120723 118933 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048075.1 protein_id gnl|my_center|LOCUS_01160 121996 120725 gene locus_tag LOCUS_01170 gene hisS 121996 120725 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_01170 123734 122283 gene locus_tag LOCUS_01180 123734 122283 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_01180 124375 123731 gene locus_tag LOCUS_01190 124375 123731 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_01190 124821 124375 gene locus_tag LOCUS_01200 gene dtd 124821 124375 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_01200 127017 124840 gene locus_tag LOCUS_01210 127017 124840 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_01210 127640 127125 gene locus_tag LOCUS_01220 gene apt 127640 127125 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 protein_id gnl|my_center|LOCUS_01220 129730 127661 gene locus_tag LOCUS_01230 129730 127661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 131076 129865 gene locus_tag LOCUS_01240 131076 129865 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_01240 132089 131091 gene locus_tag LOCUS_01250 gene pta 132089 131091 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_01250 132223 133425 gene locus_tag LOCUS_01260 132223 133425 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081862.1 protein_id gnl|my_center|LOCUS_01260 134211 133429 gene locus_tag LOCUS_01270 134211 133429 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662583.1 protein_id gnl|my_center|LOCUS_01270 134739 135377 gene locus_tag LOCUS_01280 134739 135377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 135799 135503 gene locus_tag LOCUS_01290 135799 135503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 136272 136457 gene locus_tag LOCUS_01300 136272 136457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 >Feature sequence02 801 3410 gene locus_tag LOCUS_01310 801 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 3549 4265 gene locus_tag LOCUS_01320 3549 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 4763 6751 gene locus_tag LOCUS_01330 4763 6751 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_01330 7723 7172 gene locus_tag LOCUS_01340 7723 7172 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016701.1 protein_id gnl|my_center|LOCUS_01340 8420 7782 gene locus_tag LOCUS_01350 8420 7782 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433837.1 protein_id gnl|my_center|LOCUS_01350 9064 8417 gene locus_tag LOCUS_01360 9064 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 9785 9159 gene locus_tag LOCUS_01370 9785 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 10340 9927 gene locus_tag LOCUS_01380 10340 9927 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_01380 10617 10541 gene locus_tag LOCUS_t00030 10617 10541 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10693 10618 gene locus_tag LOCUS_t00040 10693 10618 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11133 10738 gene locus_tag LOCUS_01390 11133 10738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 13033 11384 gene locus_tag LOCUS_01400 13033 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 13166 13714 gene locus_tag LOCUS_01410 13166 13714 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461089.1 protein_id gnl|my_center|LOCUS_01410 14230 14886 gene locus_tag LOCUS_01420 gene deoC 14230 14886 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 protein_id gnl|my_center|LOCUS_01420 15148 16716 gene locus_tag LOCUS_01430 15148 16716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 16845 17672 gene locus_tag LOCUS_01440 16845 17672 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642522.1 protein_id gnl|my_center|LOCUS_01440 18270 17761 gene locus_tag LOCUS_01450 18270 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 19146 18373 gene locus_tag LOCUS_01460 19146 18373 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 protein_id gnl|my_center|LOCUS_01460 20028 19177 gene locus_tag LOCUS_01470 20028 19177 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896272.1 protein_id gnl|my_center|LOCUS_01470 22622 20061 gene locus_tag LOCUS_01480 22622 20061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 25146 22672 gene locus_tag LOCUS_01490 25146 22672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 25788 25225 gene locus_tag LOCUS_01500 25788 25225 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775250.1 protein_id gnl|my_center|LOCUS_01500 27446 26088 gene locus_tag LOCUS_01510 27446 26088 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_01510 27723 27448 gene locus_tag LOCUS_01520 27723 27448 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_01520 27904 28350 gene locus_tag LOCUS_01530 27904 28350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 28511 29845 gene locus_tag LOCUS_01540 28511 29845 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594556.1 protein_id gnl|my_center|LOCUS_01540 29898 30629 gene locus_tag LOCUS_01550 gene mtnP 29898 30629 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_01550 31482 30724 gene locus_tag LOCUS_01560 gene thyX 31482 30724 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_01560 31898 31479 gene locus_tag LOCUS_01570 31898 31479 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_01570 32067 32795 gene locus_tag LOCUS_01580 32067 32795 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_01580 32785 33168 gene locus_tag LOCUS_01590 32785 33168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 33856 33209 gene locus_tag LOCUS_01600 33856 33209 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453954.1 protein_id gnl|my_center|LOCUS_01600 34410 33871 gene locus_tag LOCUS_01610 34410 33871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 35612 34479 gene locus_tag LOCUS_01620 35612 34479 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_01620 36748 35738 gene locus_tag LOCUS_01630 36748 35738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 38683 36941 gene locus_tag LOCUS_01640 38683 36941 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_01640 39497 38673 gene locus_tag LOCUS_01650 39497 38673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 42377 39957 gene locus_tag LOCUS_01660 gene gyrA 42377 39957 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288365.1 protein_id gnl|my_center|LOCUS_01660 44359 42395 gene locus_tag LOCUS_01670 gene gyrB 44359 42395 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_01670 44621 44343 gene locus_tag LOCUS_01680 44621 44343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 44795 45241 gene locus_tag LOCUS_01690 gene mraZ 44795 45241 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565149.1 protein_id gnl|my_center|LOCUS_01690 45238 46173 gene locus_tag LOCUS_01700 gene rsmH 45238 46173 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_01700 46207 46806 gene locus_tag LOCUS_01710 46207 46806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 46845 49103 gene locus_tag LOCUS_01720 46845 49103 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_01720 49171 50613 gene locus_tag LOCUS_01730 49171 50613 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_01730 50620 51630 gene locus_tag LOCUS_01740 gene mraY 50620 51630 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_01740 51993 53345 gene locus_tag LOCUS_01750 gene murD 51993 53345 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_01750 53553 54725 gene locus_tag LOCUS_01760 gene spoVE 53553 54725 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_01760 54827 56122 gene locus_tag LOCUS_01770 gene murA 54827 56122 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_01770 56085 57677 gene locus_tag LOCUS_01780 56085 57677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 57985 59097 gene locus_tag LOCUS_01790 57985 59097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 59110 60360 gene locus_tag LOCUS_01800 59110 60360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 61355 60486 gene locus_tag LOCUS_01810 61355 60486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 61553 61852 gene locus_tag LOCUS_01820 61553 61852 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 protein_id gnl|my_center|LOCUS_01820 61888 62961 gene locus_tag LOCUS_01830 61888 62961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 63041 63697 gene locus_tag LOCUS_01840 63041 63697 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_01840 63930 64568 gene locus_tag LOCUS_01850 63930 64568 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085042.1 protein_id gnl|my_center|LOCUS_01850 64642 65028 gene locus_tag LOCUS_01860 64642 65028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 65222 65821 gene locus_tag LOCUS_01870 65222 65821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 66449 65991 gene locus_tag LOCUS_01880 66449 65991 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620148.1 protein_id gnl|my_center|LOCUS_01880 66721 67683 gene locus_tag LOCUS_01890 66721 67683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 67954 67760 gene locus_tag LOCUS_01900 67954 67760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 70512 68011 gene locus_tag LOCUS_01910 70512 68011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 70782 70558 gene locus_tag LOCUS_01920 70782 70558 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_01920 71030 70815 gene locus_tag LOCUS_01930 71030 70815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 71250 71618 gene locus_tag LOCUS_01940 71250 71618 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_01940 73442 71763 gene locus_tag LOCUS_01950 gene glgA 73442 71763 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_01950 74621 73497 gene locus_tag LOCUS_01960 gene glgD 74621 73497 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_01960 75841 74618 gene locus_tag LOCUS_01970 75841 74618 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_01970 77714 75846 gene locus_tag LOCUS_01980 gene glgB 77714 75846 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257047.1 protein_id gnl|my_center|LOCUS_01980 77996 78937 gene locus_tag LOCUS_01990 77996 78937 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898612.1 protein_id gnl|my_center|LOCUS_01990 78939 80150 gene locus_tag LOCUS_02000 78939 80150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 82267 80438 gene locus_tag LOCUS_02010 gene typA 82267 80438 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_02010 82925 82461 gene locus_tag LOCUS_02020 82925 82461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 83152 84051 gene locus_tag LOCUS_02030 83152 84051 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 protein_id gnl|my_center|LOCUS_02030 84070 84591 gene locus_tag LOCUS_02040 84070 84591 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_02040 84634 85365 gene locus_tag LOCUS_02050 84634 85365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 86091 85543 gene locus_tag LOCUS_02060 86091 85543 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107707.1 protein_id gnl|my_center|LOCUS_02060 86657 86088 gene locus_tag LOCUS_02070 86657 86088 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358515.1 protein_id gnl|my_center|LOCUS_02070 87151 86654 gene locus_tag LOCUS_02080 87151 86654 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706144.1 protein_id gnl|my_center|LOCUS_02080 87231 88391 gene locus_tag LOCUS_02090 gene ytvI 87231 88391 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_02090 88458 89156 gene locus_tag LOCUS_02100 88458 89156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 89191 90360 gene locus_tag LOCUS_02110 89191 90360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 90447 91853 gene locus_tag LOCUS_02120 90447 91853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 92005 93411 gene locus_tag LOCUS_02130 92005 93411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 93455 94153 gene locus_tag LOCUS_02140 93455 94153 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721237.1 protein_id gnl|my_center|LOCUS_02140 94150 94893 gene locus_tag LOCUS_02150 94150 94893 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_02150 94977 95052 gene locus_tag LOCUS_t00050 94977 95052 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 95170 95628 gene locus_tag LOCUS_02160 95170 95628 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_02160 95693 96160 gene locus_tag LOCUS_02170 95693 96160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 96318 97736 gene locus_tag LOCUS_02180 96318 97736 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_02180 98912 97746 gene locus_tag LOCUS_02190 98912 97746 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054224.1 protein_id gnl|my_center|LOCUS_02190 99859 98918 gene locus_tag LOCUS_02200 99859 98918 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_02200 100014 101204 gene locus_tag LOCUS_02210 100014 101204 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_02210 102236 101310 gene locus_tag LOCUS_02220 102236 101310 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674286.1 protein_id gnl|my_center|LOCUS_02220 102869 102336 gene locus_tag LOCUS_02230 102869 102336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 103152 105701 gene locus_tag LOCUS_02240 103152 105701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 106259 105732 gene locus_tag LOCUS_02250 gene rplJ 106259 105732 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_02250 107147 106458 gene locus_tag LOCUS_02260 gene rplA 107147 106458 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_02260 107585 107160 gene locus_tag LOCUS_02270 gene rplK 107585 107160 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_02270 108291 107716 gene locus_tag LOCUS_02280 gene nusG 108291 107716 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_02280 108568 108296 gene locus_tag LOCUS_02290 108568 108296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 108742 108593 gene locus_tag LOCUS_02300 gene rpmG 108742 108593 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_02300 110227 108896 gene locus_tag LOCUS_02310 110227 108896 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_02310 111615 110224 gene locus_tag LOCUS_02320 111615 110224 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_02320 111783 113048 gene locus_tag LOCUS_02330 111783 113048 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081491.1 protein_id gnl|my_center|LOCUS_02330 113171 114286 gene locus_tag LOCUS_02340 113171 114286 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_02340 114955 114755 gene locus_tag LOCUS_02350 114955 114755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 116048 115035 gene locus_tag LOCUS_02360 116048 115035 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681885.1 protein_id gnl|my_center|LOCUS_02360 116924 116094 gene locus_tag LOCUS_02370 gene rsmI 116924 116094 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887281.1 protein_id gnl|my_center|LOCUS_02370 117838 116918 gene locus_tag LOCUS_02380 117838 116918 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_02380 119044 117845 gene locus_tag LOCUS_02390 119044 117845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 119748 119077 gene locus_tag LOCUS_02400 119748 119077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 119866 120912 gene locus_tag LOCUS_02410 gene spoIID 119866 120912 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432452.1 protein_id gnl|my_center|LOCUS_02410 121369 120839 gene locus_tag LOCUS_02420 gene eetB 121369 120839 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_02420 121706 121353 gene locus_tag LOCUS_02430 121706 121353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 122808 121978 gene locus_tag LOCUS_02440 122808 121978 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_02440 125378 122850 gene locus_tag LOCUS_02450 125378 122850 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_02450 125714 125412 gene locus_tag LOCUS_02460 125714 125412 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_02460 126198 127487 gene locus_tag LOCUS_02470 126198 127487 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222757.1 protein_id gnl|my_center|LOCUS_02470 128281 127514 gene locus_tag LOCUS_02480 128281 127514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 128505 128299 gene locus_tag LOCUS_02490 128505 128299 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_02490 129907 128786 gene locus_tag LOCUS_02500 129907 128786 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729265.1 protein_id gnl|my_center|LOCUS_02500 130277 131077 gene locus_tag LOCUS_02510 130277 131077 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_02510 131660 131127 gene locus_tag LOCUS_02520 131660 131127 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_02520 132310 131657 gene locus_tag LOCUS_02530 132310 131657 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460050.1 protein_id gnl|my_center|LOCUS_02530 <133231 132676 gene locus_tag LOCUS_02540 <133231 132676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172824490.1:glutamine-hydrolyzing GMP synthase >Feature sequence03 92 544 gene locus_tag LOCUS_02550 92 544 CDS product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202596.1 protein_id gnl|my_center|LOCUS_02550 1745 729 gene locus_tag LOCUS_02560 1745 729 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_02560 2412 1771 gene locus_tag LOCUS_02570 2412 1771 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_02570 2597 3709 gene locus_tag LOCUS_02580 gene mtnA 2597 3709 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_02580 3798 4169 gene locus_tag LOCUS_02590 3798 4169 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350529.1 protein_id gnl|my_center|LOCUS_02590 4327 6894 gene locus_tag LOCUS_02600 4327 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 7646 6969 gene locus_tag LOCUS_02610 7646 6969 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_02610 8807 7737 gene locus_tag LOCUS_02620 8807 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 9021 11417 gene locus_tag LOCUS_02630 9021 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 11679 12305 gene locus_tag LOCUS_02640 gene pnuC 11679 12305 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992863.1 protein_id gnl|my_center|LOCUS_02640 12429 13076 gene locus_tag LOCUS_02650 12429 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 13093 15681 gene locus_tag LOCUS_02660 gene clpB 13093 15681 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009165978.1 protein_id gnl|my_center|LOCUS_02660 16201 15827 gene locus_tag LOCUS_02670 16201 15827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 16457 16239 gene locus_tag LOCUS_02680 16457 16239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 17005 16589 gene locus_tag LOCUS_02690 17005 16589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 17653 17402 gene locus_tag LOCUS_02700 17653 17402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 17707 18603 gene locus_tag LOCUS_02710 17707 18603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 18719 19411 gene locus_tag LOCUS_02720 18719 19411 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_02720 19408 21165 gene locus_tag LOCUS_02730 19408 21165 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510924.1 protein_id gnl|my_center|LOCUS_02730 21295 22524 gene locus_tag LOCUS_02740 gene tyrS 21295 22524 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_02740 22521 23168 gene locus_tag LOCUS_02750 22521 23168 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_02750 23174 25375 gene locus_tag LOCUS_02760 23174 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 25368 26036 gene locus_tag LOCUS_02770 25368 26036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 27921 26020 gene locus_tag LOCUS_02780 27921 26020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 28027 28581 gene locus_tag LOCUS_02790 28027 28581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 28937 28665 gene locus_tag LOCUS_02800 28937 28665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 28957 30198 gene locus_tag LOCUS_02810 28957 30198 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_02810 30305 30865 gene locus_tag LOCUS_02820 gene rsmD 30305 30865 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_02820 30862 31350 gene locus_tag LOCUS_02830 gene coaD 30862 31350 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_02830 31347 32390 gene locus_tag LOCUS_02840 31347 32390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 33027 32461 gene locus_tag LOCUS_02850 33027 32461 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941742.1 protein_id gnl|my_center|LOCUS_02850 34113 33046 gene locus_tag LOCUS_02860 34113 33046 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_02860 34778 34110 gene locus_tag LOCUS_02870 gene modB 34778 34110 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190258.1 protein_id gnl|my_center|LOCUS_02870 35755 34853 gene locus_tag LOCUS_02880 gene modA 35755 34853 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_02880 36770 35841 gene locus_tag LOCUS_02890 36770 35841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 37734 36775 gene locus_tag LOCUS_02900 gene moaA 37734 36775 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986479.1 protein_id gnl|my_center|LOCUS_02900 38213 37731 gene locus_tag LOCUS_02910 gene moaC 38213 37731 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_02910 39240 38215 gene locus_tag LOCUS_02920 39240 38215 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_02920 40358 39411 gene locus_tag LOCUS_02930 40358 39411 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_02930 41276 40395 gene locus_tag LOCUS_02940 41276 40395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 42862 41273 gene locus_tag LOCUS_02950 42862 41273 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_02950 42924 44402 gene locus_tag LOCUS_02960 gene malQ 42924 44402 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_02960 44904 44416 gene locus_tag LOCUS_02970 44904 44416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 45540 45004 gene locus_tag LOCUS_02980 45540 45004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 46078 45602 gene locus_tag LOCUS_02990 46078 45602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 48478 46082 gene locus_tag LOCUS_03000 gene pheT 48478 46082 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860925.1 protein_id gnl|my_center|LOCUS_03000 49522 48494 gene locus_tag LOCUS_03010 gene pheS 49522 48494 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_03010 50805 49837 gene locus_tag LOCUS_03020 50805 49837 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813684.1 protein_id gnl|my_center|LOCUS_03020 50990 52009 gene locus_tag LOCUS_03030 50990 52009 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_03030 52119 53732 gene locus_tag LOCUS_03040 52119 53732 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_03040 53729 54421 gene locus_tag LOCUS_03050 53729 54421 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_03050 55375 54539 gene locus_tag LOCUS_03060 55375 54539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 56805 55378 gene locus_tag LOCUS_03070 56805 55378 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_03070 56880 57347 gene locus_tag LOCUS_03080 56880 57347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 58173 57352 gene locus_tag LOCUS_03090 58173 57352 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048205.1 protein_id gnl|my_center|LOCUS_03090 58235 59371 gene locus_tag LOCUS_03100 58235 59371 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_03100 59461 60933 gene locus_tag LOCUS_03110 59461 60933 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_03110 61593 61024 gene locus_tag LOCUS_03120 61593 61024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 62128 61601 gene locus_tag LOCUS_03130 62128 61601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 63561 62125 gene locus_tag LOCUS_03140 63561 62125 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_03140 64927 63632 gene locus_tag LOCUS_03150 64927 63632 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393140.1 protein_id gnl|my_center|LOCUS_03150 65142 65852 gene locus_tag LOCUS_03160 65142 65852 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_03160 65993 67528 gene locus_tag LOCUS_03170 65993 67528 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_03170 67719 67889 gene locus_tag LOCUS_03180 67719 67889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 67966 68433 gene locus_tag LOCUS_03190 67966 68433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 68620 69000 gene locus_tag LOCUS_03200 68620 69000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 69505 70419 gene locus_tag LOCUS_03210 69505 70419 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_03210 70416 71309 gene locus_tag LOCUS_03220 70416 71309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812722.1 protein_id gnl|my_center|LOCUS_03220 71562 73901 gene locus_tag LOCUS_03230 71562 73901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 74044 75186 gene locus_tag LOCUS_03240 74044 75186 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_03240 75258 75914 gene locus_tag LOCUS_03250 75258 75914 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965916.1 protein_id gnl|my_center|LOCUS_03250 75926 76723 gene locus_tag LOCUS_03260 75926 76723 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382313.1 protein_id gnl|my_center|LOCUS_03260 76730 77284 gene locus_tag LOCUS_03270 gene scpB 76730 77284 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_03270 79266 77410 gene locus_tag LOCUS_03280 gene uvrC 79266 77410 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_03280 79865 79263 gene locus_tag LOCUS_03290 79865 79263 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_03290 80623 79862 gene locus_tag LOCUS_03300 80623 79862 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_03300 80730 81413 gene locus_tag LOCUS_03310 80730 81413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 81415 82368 gene locus_tag LOCUS_03320 81415 82368 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_03320 82352 83113 gene locus_tag LOCUS_03330 82352 83113 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_03330 83100 83657 gene locus_tag LOCUS_03340 83100 83657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878142.1 protein_id gnl|my_center|LOCUS_03340 83791 84729 gene locus_tag LOCUS_03350 83791 84729 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_03350 84726 85394 gene locus_tag LOCUS_03360 gene nagB 84726 85394 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_03360 85568 86311 gene locus_tag LOCUS_03370 85568 86311 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965592.1 protein_id gnl|my_center|LOCUS_03370 86393 86746 gene locus_tag LOCUS_03380 86393 86746 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395974.1 protein_id gnl|my_center|LOCUS_03380 86783 88417 gene locus_tag LOCUS_03390 86783 88417 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_03390 88496 90502 gene locus_tag LOCUS_03400 gene recG 88496 90502 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_03400 90773 90964 gene locus_tag LOCUS_03410 90773 90964 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_03410 91005 91199 gene locus_tag LOCUS_03420 91005 91199 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_03420 91393 92568 gene locus_tag LOCUS_03430 91393 92568 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_03430 92640 94994 gene locus_tag LOCUS_03440 92640 94994 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_03440 95121 95798 gene locus_tag LOCUS_03450 95121 95798 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_03450 95811 97304 gene locus_tag LOCUS_03460 95811 97304 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_03460 97291 98673 gene locus_tag LOCUS_03470 97291 98673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 99654 98785 gene locus_tag LOCUS_03480 99654 98785 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_03480 99955 99665 gene locus_tag LOCUS_03490 99955 99665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 100347 100063 gene locus_tag LOCUS_03500 100347 100063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 100645 100349 gene locus_tag LOCUS_03510 100645 100349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 100917 102788 gene locus_tag LOCUS_03520 100917 102788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 102882 103079 gene locus_tag LOCUS_03530 gene rpmE 102882 103079 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_03530 103182 104210 gene locus_tag LOCUS_03540 103182 104210 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_03540 104207 105022 gene locus_tag LOCUS_03550 gene prmC 104207 105022 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_03550 105019 106395 gene locus_tag LOCUS_03560 105019 106395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 106380 107459 gene locus_tag LOCUS_03570 gene prfA 106380 107459 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_03570 107456 108496 gene locus_tag LOCUS_03580 107456 108496 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_03580 108522 108977 gene locus_tag LOCUS_03590 gene rpiB 108522 108977 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869538.1 protein_id gnl|my_center|LOCUS_03590 108977 109606 gene locus_tag LOCUS_03600 gene upp 108977 109606 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966163.1 protein_id gnl|my_center|LOCUS_03600 109625 109939 gene locus_tag LOCUS_03610 109625 109939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 109936 111861 gene locus_tag LOCUS_03620 109936 111861 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_03620 111891 112373 gene locus_tag LOCUS_03630 111891 112373 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_03630 112400 112981 gene locus_tag LOCUS_03640 112400 112981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 112997 113986 gene locus_tag LOCUS_03650 112997 113986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 113979 114296 gene locus_tag LOCUS_03660 113979 114296 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_03660 114316 116085 gene locus_tag LOCUS_03670 114316 116085 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_03670 116078 117454 gene locus_tag LOCUS_03680 116078 117454 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_03680 117458 118087 gene locus_tag LOCUS_03690 117458 118087 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_03690 118644 119306 gene locus_tag LOCUS_03700 gene sdaAB 118644 119306 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356598.1 protein_id gnl|my_center|LOCUS_03700 119318 120205 gene locus_tag LOCUS_03710 gene sdaAA 119318 120205 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489453.1 protein_id gnl|my_center|LOCUS_03710 120217 121086 gene locus_tag LOCUS_03720 120217 121086 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_03720 121856 121185 gene locus_tag LOCUS_03730 121856 121185 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229736.1 protein_id gnl|my_center|LOCUS_03730 123082 121862 gene locus_tag LOCUS_03740 123082 121862 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_03740 123315 125615 gene locus_tag LOCUS_03750 gene spoIIE 123315 125615 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123550.1 protein_id gnl|my_center|LOCUS_03750 125615 126583 gene locus_tag LOCUS_03760 125615 126583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 126543 127112 gene locus_tag LOCUS_03770 126543 127112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 127887 127120 gene locus_tag LOCUS_03780 gene sigG 127887 127120 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_03780 128719 128096 gene locus_tag LOCUS_03790 128719 128096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 129249 128734 gene locus_tag LOCUS_03800 129249 128734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence04 923 564 gene locus_tag LOCUS_03810 923 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 1306 1397 gene locus_tag LOCUS_t00060 1306 1397 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1847 2068 gene locus_tag LOCUS_03820 1847 2068 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_03820 2065 2382 gene locus_tag LOCUS_03830 2065 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 2366 4465 gene locus_tag LOCUS_03840 2366 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4472 7306 gene locus_tag LOCUS_03850 4472 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 7331 10909 gene locus_tag LOCUS_03860 7331 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 10912 12360 gene locus_tag LOCUS_03870 10912 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 12404 14320 gene locus_tag LOCUS_03880 12404 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 14355 15677 gene locus_tag LOCUS_03890 14355 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 16352 17395 gene locus_tag LOCUS_03900 16352 17395 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_03900 17518 18999 gene locus_tag LOCUS_03910 gene istA 17518 18999 CDS product IS21-like element ISBf2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203618.1 protein_id gnl|my_center|LOCUS_03910 18983 19663 gene locus_tag LOCUS_03920 18983 19663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 19961 20434 gene locus_tag LOCUS_03930 19961 20434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 21093 20665 gene locus_tag LOCUS_03940 21093 20665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03940 21263 21075 gene locus_tag LOCUS_03950 21263 21075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 21492 22262 gene locus_tag LOCUS_03960 21492 22262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 22320 22760 gene locus_tag LOCUS_03970 22320 22760 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 protein_id gnl|my_center|LOCUS_03970 22814 23404 gene locus_tag LOCUS_03980 22814 23404 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791447.1 protein_id gnl|my_center|LOCUS_03980 23435 24055 gene locus_tag LOCUS_03990 23435 24055 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_03990 24060 24866 gene locus_tag LOCUS_04000 24060 24866 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_04000 24847 25848 gene locus_tag LOCUS_04010 24847 25848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_04010 26412 26768 gene locus_tag LOCUS_04020 26412 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 26889 27773 gene locus_tag LOCUS_04030 26889 27773 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026644807.1 protein_id gnl|my_center|LOCUS_04030 27770 28492 gene locus_tag LOCUS_04040 27770 28492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948430.1 protein_id gnl|my_center|LOCUS_04040 28489 29229 gene locus_tag LOCUS_04050 28489 29229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061295975.1 protein_id gnl|my_center|LOCUS_04050 29449 29826 gene locus_tag LOCUS_04060 29449 29826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 29854 30633 gene locus_tag LOCUS_04070 29854 30633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 30692 31300 gene locus_tag LOCUS_04080 30692 31300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 31858 31553 gene locus_tag LOCUS_04090 31858 31553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 32458 36567 gene locus_tag LOCUS_04100 gene cas9 32458 36567 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681289.1 protein_id gnl|my_center|LOCUS_04100 36564 37433 gene locus_tag LOCUS_04110 gene cas1 36564 37433 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_04110 37445 37750 gene locus_tag LOCUS_04120 gene cas2 37445 37750 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_04120 37747 38412 gene locus_tag LOCUS_04130 37747 38412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 38521 39081 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgagagctgtgtaatttcagagggtact 39747 47318 gene locus_tag LOCUS_04140 39747 47318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 47315 48616 gene locus_tag LOCUS_04150 47315 48616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 48616 50304 gene locus_tag LOCUS_04160 48616 50304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 50320 53859 gene locus_tag LOCUS_04170 50320 53859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 53961 55079 gene locus_tag LOCUS_04180 53961 55079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 55100 55984 gene locus_tag LOCUS_04190 55100 55984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 56036 57946 gene locus_tag LOCUS_04200 56036 57946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 57952 58887 gene locus_tag LOCUS_04210 57952 58887 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_04210 58894 60033 gene locus_tag LOCUS_04220 58894 60033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 60055 62367 gene locus_tag LOCUS_04230 60055 62367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 63296 62436 gene locus_tag LOCUS_04240 63296 62436 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287072.1 protein_id gnl|my_center|LOCUS_04240 64927 63710 gene locus_tag LOCUS_04250 64927 63710 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_04250 66134 65208 gene locus_tag LOCUS_04260 66134 65208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 68130 66298 gene locus_tag LOCUS_04270 68130 66298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 70133 68211 gene locus_tag LOCUS_04280 70133 68211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 70315 71397 gene locus_tag LOCUS_04290 70315 71397 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_04290 71384 72409 gene locus_tag LOCUS_04300 71384 72409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 72422 72664 gene locus_tag LOCUS_04310 72422 72664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 73544 72960 gene locus_tag LOCUS_04320 73544 72960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 73461 73805 gene locus_tag LOCUS_04330 73461 73805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 74683 73799 gene locus_tag LOCUS_04340 74683 73799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 74863 75174 gene locus_tag LOCUS_04350 74863 75174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 75920 75294 gene locus_tag LOCUS_04360 75920 75294 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578704.1 protein_id gnl|my_center|LOCUS_04360 76881 76015 gene locus_tag LOCUS_04370 76881 76015 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_04370 77757 76909 gene locus_tag LOCUS_04380 77757 76909 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272204.1 protein_id gnl|my_center|LOCUS_04380 80630 77805 gene locus_tag LOCUS_04390 gene uvrA 80630 77805 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_04390 80968 82080 gene locus_tag LOCUS_04400 80968 82080 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_04400 84047 82167 gene locus_tag LOCUS_04410 84047 82167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_04410 85775 84048 gene locus_tag LOCUS_04420 85775 84048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_04420 86246 85776 gene locus_tag LOCUS_04430 86246 85776 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528223.1 protein_id gnl|my_center|LOCUS_04430 86378 88150 gene locus_tag LOCUS_04440 gene hflX 86378 88150 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965596.1 protein_id gnl|my_center|LOCUS_04440 88330 88818 gene locus_tag LOCUS_04450 88330 88818 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_04450 90596 88821 gene locus_tag LOCUS_04460 90596 88821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 90677 91597 gene locus_tag LOCUS_04470 90677 91597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 93174 91741 gene locus_tag LOCUS_04480 93174 91741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 93331 93993 gene locus_tag LOCUS_04490 93331 93993 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_04490 94198 93941 gene locus_tag LOCUS_04500 94198 93941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 95748 94543 gene locus_tag LOCUS_04510 95748 94543 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090011.1 protein_id gnl|my_center|LOCUS_04510 98422 96185 gene locus_tag LOCUS_04520 98422 96185 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099653.1 protein_id gnl|my_center|LOCUS_04520 99008 98451 gene locus_tag LOCUS_04530 99008 98451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 100038 99025 gene locus_tag LOCUS_04540 100038 99025 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_04540 100267 101133 gene locus_tag LOCUS_04550 100267 101133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 101146 101793 gene locus_tag LOCUS_04560 101146 101793 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_04560 102131 102337 gene locus_tag LOCUS_04570 102131 102337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 102488 102682 gene locus_tag LOCUS_04580 102488 102682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 103506 103027 gene locus_tag LOCUS_04590 103506 103027 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868950.1 protein_id gnl|my_center|LOCUS_04590 104372 103503 gene locus_tag LOCUS_04600 gene xdhB 104372 103503 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459192.1 protein_id gnl|my_center|LOCUS_04600 106679 104376 gene locus_tag LOCUS_04610 106679 104376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04610 108114 106999 gene locus_tag LOCUS_04620 108114 106999 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 protein_id gnl|my_center|LOCUS_04620 109185 108160 gene locus_tag LOCUS_04630 109185 108160 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_04630 109527 110837 gene locus_tag LOCUS_04640 gene codB 109527 110837 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986589.1 protein_id gnl|my_center|LOCUS_04640 112705 111467 gene locus_tag LOCUS_04650 112705 111467 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819167.1 protein_id gnl|my_center|LOCUS_04650 113085 113010 gene locus_tag LOCUS_t00070 113085 113010 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 114476 113187 gene locus_tag LOCUS_04660 114476 113187 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964316.1 protein_id gnl|my_center|LOCUS_04660 115848 114514 gene locus_tag LOCUS_04670 115848 114514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 116027 117058 gene locus_tag LOCUS_04680 116027 117058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 117120 117195 gene locus_tag LOCUS_t00080 117120 117195 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 117209 117285 gene locus_tag LOCUS_t00090 117209 117285 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 117291 117366 gene locus_tag LOCUS_t00100 117291 117366 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 117372 117447 gene locus_tag LOCUS_t00110 117372 117447 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 117452 117536 gene locus_tag LOCUS_t00120 117452 117536 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 119823 117634 gene locus_tag LOCUS_04690 gene gnpA 119823 117634 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_04690 121139 119835 gene locus_tag LOCUS_04700 121139 119835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 121542 121108 gene locus_tag LOCUS_04710 121542 121108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 121729 121929 gene locus_tag LOCUS_04720 121729 121929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 121911 122378 gene locus_tag LOCUS_04730 121911 122378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04730 123303 122461 gene locus_tag LOCUS_04740 123303 122461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 124855 123377 gene locus_tag LOCUS_04750 gene guaB 124855 123377 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264083.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence05 142 215 gene locus_tag LOCUS_t00130 142 215 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1724 456 gene locus_tag LOCUS_04760 1724 456 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434194.1 protein_id gnl|my_center|LOCUS_04760 1918 2373 gene locus_tag LOCUS_04770 1918 2373 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_04770 2456 4906 gene locus_tag LOCUS_04780 gene feoB 2456 4906 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_04780 5068 5847 gene locus_tag LOCUS_04790 gene surE 5068 5847 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939419.1 protein_id gnl|my_center|LOCUS_04790 5832 6704 gene locus_tag LOCUS_04800 5832 6704 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_04800 6701 7921 gene locus_tag LOCUS_04810 6701 7921 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_04810 7914 8600 gene locus_tag LOCUS_04820 gene cmk 7914 8600 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786468.1 protein_id gnl|my_center|LOCUS_04820 8606 9196 gene locus_tag LOCUS_04830 8606 9196 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_04830 9200 11536 gene locus_tag LOCUS_04840 9200 11536 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392842.1 protein_id gnl|my_center|LOCUS_04840 13314 11986 gene locus_tag LOCUS_04850 13314 11986 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_04850 13376 13816 gene locus_tag LOCUS_04860 13376 13816 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_04860 15723 13888 gene locus_tag LOCUS_04870 15723 13888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 15872 16333 gene locus_tag LOCUS_04880 gene trmL 15872 16333 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_04880 16432 16623 gene locus_tag LOCUS_04890 gene rpmB 16432 16623 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_04890 17291 16710 gene locus_tag LOCUS_04900 17291 16710 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322652.1 protein_id gnl|my_center|LOCUS_04900 17858 17322 gene locus_tag LOCUS_04910 17858 17322 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_04910 18628 17858 gene locus_tag LOCUS_04920 18628 17858 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246182.1 protein_id gnl|my_center|LOCUS_04920 18807 19532 gene locus_tag LOCUS_04930 18807 19532 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921670.1 protein_id gnl|my_center|LOCUS_04930 19865 20443 gene locus_tag LOCUS_04940 19865 20443 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430243.1 protein_id gnl|my_center|LOCUS_04940 20796 21038 gene locus_tag LOCUS_04950 20796 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 21213 21479 gene locus_tag LOCUS_04960 21213 21479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 21549 21947 gene locus_tag LOCUS_04970 21549 21947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 21978 22445 gene locus_tag LOCUS_04980 21978 22445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 22492 22749 gene locus_tag LOCUS_04990 22492 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 23476 23120 gene locus_tag LOCUS_05000 gene rplT 23476 23120 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_05000 23688 23491 gene locus_tag LOCUS_05010 gene rpmI 23688 23491 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_05010 24217 23723 gene locus_tag LOCUS_05020 gene infC 24217 23723 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_05020 24857 24459 gene locus_tag LOCUS_05030 24857 24459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 25764 24862 gene locus_tag LOCUS_05040 25764 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 27573 26017 gene locus_tag LOCUS_05050 27573 26017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 27680 28498 gene locus_tag LOCUS_05060 27680 28498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 28733 28488 gene locus_tag LOCUS_05070 28733 28488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 28819 29214 gene locus_tag LOCUS_05080 28819 29214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 29546 30085 gene locus_tag LOCUS_05090 gene raiA 29546 30085 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_05090 30331 31140 gene locus_tag LOCUS_05100 30331 31140 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_05100 31234 31920 gene locus_tag LOCUS_05110 31234 31920 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_05110 31907 32629 gene locus_tag LOCUS_05120 31907 32629 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_05120 32876 33295 gene locus_tag LOCUS_05130 32876 33295 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_05130 34189 33356 gene locus_tag LOCUS_05140 34189 33356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 34647 34333 gene locus_tag LOCUS_05150 34647 34333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05150 34842 34705 gene locus_tag LOCUS_05160 34842 34705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 34991 36664 gene locus_tag LOCUS_05170 34991 36664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 36677 37366 gene locus_tag LOCUS_05180 36677 37366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_05180 37363 38529 gene locus_tag LOCUS_05190 37363 38529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 protein_id gnl|my_center|LOCUS_05190 38688 40109 gene locus_tag LOCUS_05200 38688 40109 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_05200 42023 40182 gene locus_tag LOCUS_05210 42023 40182 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05210 42245 42027 gene locus_tag LOCUS_05220 42245 42027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 42601 42242 gene locus_tag LOCUS_05230 42601 42242 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918377.1 protein_id gnl|my_center|LOCUS_05230 42798 43304 gene locus_tag LOCUS_05240 42798 43304 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397668.1 protein_id gnl|my_center|LOCUS_05240 44866 43568 gene locus_tag LOCUS_05250 44866 43568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 45060 45491 gene locus_tag LOCUS_05260 gene iscR 45060 45491 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 protein_id gnl|my_center|LOCUS_05260 46516 45584 gene locus_tag LOCUS_05270 gene cysK 46516 45584 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_05270 46847 47572 gene locus_tag LOCUS_05280 46847 47572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 47760 49094 gene locus_tag LOCUS_05290 47760 49094 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388389.1 protein_id gnl|my_center|LOCUS_05290 49223 50575 gene locus_tag LOCUS_05300 49223 50575 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_05300 51299 50661 gene locus_tag LOCUS_05310 51299 50661 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398264.1 protein_id gnl|my_center|LOCUS_05310 52228 51389 gene locus_tag LOCUS_05320 52228 51389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 52447 52614 gene locus_tag LOCUS_05330 52447 52614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 54513 52825 gene locus_tag LOCUS_05340 54513 52825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 54697 55215 gene locus_tag LOCUS_05350 54697 55215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 55209 55595 gene locus_tag LOCUS_05360 gene acpS 55209 55595 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 protein_id gnl|my_center|LOCUS_05360 55579 57099 gene locus_tag LOCUS_05370 55579 57099 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_05370 58281 57166 gene locus_tag LOCUS_05380 gene alr 58281 57166 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_05380 59496 58330 gene locus_tag LOCUS_05390 59496 58330 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964358.1 protein_id gnl|my_center|LOCUS_05390 61704 59860 gene locus_tag LOCUS_05400 61704 59860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 63092 62259 gene locus_tag LOCUS_05410 63092 62259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 63725 63186 gene locus_tag LOCUS_05420 63725 63186 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434284.1 protein_id gnl|my_center|LOCUS_05420 64017 64748 gene locus_tag LOCUS_05430 gene rgbR 64017 64748 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_05430 64881 65699 gene locus_tag LOCUS_05440 64881 65699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 65760 66599 gene locus_tag LOCUS_05450 65760 66599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 67166 68239 gene locus_tag LOCUS_05460 67166 68239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 68254 69858 gene locus_tag LOCUS_05470 68254 69858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 69962 70681 gene locus_tag LOCUS_05480 69962 70681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 70695 71669 gene locus_tag LOCUS_05490 70695 71669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 71694 72824 gene locus_tag LOCUS_05500 71694 72824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 72914 74617 gene locus_tag LOCUS_05510 72914 74617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 75122 74697 gene locus_tag LOCUS_05520 75122 74697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 75108 75422 gene locus_tag LOCUS_05530 75108 75422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 75679 75603 gene locus_tag LOCUS_t00140 75679 75603 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 75864 78602 gene locus_tag LOCUS_05540 75864 78602 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393212.1 protein_id gnl|my_center|LOCUS_05540 78605 79264 gene locus_tag LOCUS_05550 gene udg 78605 79264 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_05550 79336 80016 gene locus_tag LOCUS_05560 79336 80016 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_05560 80023 81954 gene locus_tag LOCUS_05570 80023 81954 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510924.1 protein_id gnl|my_center|LOCUS_05570 82017 82298 gene locus_tag LOCUS_05580 82017 82298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 82761 82378 gene locus_tag LOCUS_05590 82761 82378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 83035 83205 gene locus_tag LOCUS_05600 83035 83205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 83202 84830 gene locus_tag LOCUS_05610 gene tndX 83202 84830 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_05610 86177 84840 gene locus_tag LOCUS_05620 86177 84840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 86427 86194 gene locus_tag LOCUS_05630 86427 86194 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_05630 86561 86983 gene locus_tag LOCUS_05640 86561 86983 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815079.1 protein_id gnl|my_center|LOCUS_05640 87185 89155 gene locus_tag LOCUS_05650 gene tkt 87185 89155 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_05650 89223 89780 gene locus_tag LOCUS_05660 89223 89780 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_05660 89899 91011 gene locus_tag LOCUS_05670 89899 91011 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_05670 91023 92198 gene locus_tag LOCUS_05680 91023 92198 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_05680 92637 93629 gene locus_tag LOCUS_05690 92637 93629 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_05690 93661 94566 gene locus_tag LOCUS_05700 93661 94566 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_05700 94554 95345 gene locus_tag LOCUS_05710 94554 95345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_05710 95572 95751 gene locus_tag LOCUS_05720 95572 95751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 96203 97453 gene locus_tag LOCUS_05730 96203 97453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 97578 98504 gene locus_tag LOCUS_05740 gene arcC 97578 98504 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986908.1 protein_id gnl|my_center|LOCUS_05740 99133 98564 gene locus_tag LOCUS_05750 99133 98564 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860666.1 protein_id gnl|my_center|LOCUS_05750 99705 99130 gene locus_tag LOCUS_05760 99705 99130 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_05760 100073 101305 gene locus_tag LOCUS_05770 100073 101305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 101420 104986 gene locus_tag LOCUS_05780 gene nifJ 101420 104986 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_05780 105113 106792 gene locus_tag LOCUS_05790 105113 106792 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_05790 107239 106862 gene locus_tag LOCUS_05800 107239 106862 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_05800 108109 107258 gene locus_tag LOCUS_05810 108109 107258 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_05810 109337 108252 gene locus_tag LOCUS_05820 109337 108252 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_05820 110209 109352 gene locus_tag LOCUS_05830 110209 109352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_05830 111018 110206 gene locus_tag LOCUS_05840 111018 110206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_05840 112415 111030 gene locus_tag LOCUS_05850 gene potA 112415 111030 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769055.1 protein_id gnl|my_center|LOCUS_05850 112985 112449 gene locus_tag LOCUS_05860 112985 112449 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_05860 113293 113562 gene locus_tag LOCUS_05870 113293 113562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 113540 114682 gene locus_tag LOCUS_05880 gene metK 113540 114682 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_05880 114814 115632 gene locus_tag LOCUS_05890 114814 115632 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_05890 115659 116798 gene locus_tag LOCUS_05900 115659 116798 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 protein_id gnl|my_center|LOCUS_05900 117338 119434 gene locus_tag LOCUS_05910 117338 119434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 119409 120725 gene locus_tag LOCUS_05920 119409 120725 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174705273.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence06 1211 384 gene locus_tag LOCUS_05930 1211 384 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_05930 2601 1240 gene locus_tag LOCUS_05940 gene murC 2601 1240 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_05940 3343 2687 gene locus_tag LOCUS_05950 3343 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 4649 3435 gene locus_tag LOCUS_05960 4649 3435 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_05960 6725 4662 gene locus_tag LOCUS_05970 6725 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 7023 6730 gene locus_tag LOCUS_05980 7023 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 7815 7057 gene locus_tag LOCUS_05990 7815 7057 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570132.1 protein_id gnl|my_center|LOCUS_05990 9980 7812 gene locus_tag LOCUS_06000 9980 7812 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966127.1 protein_id gnl|my_center|LOCUS_06000 10893 10030 gene locus_tag LOCUS_06010 10893 10030 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_06010 12011 10890 gene locus_tag LOCUS_06020 12011 10890 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_06020 12153 13190 gene locus_tag LOCUS_06030 12153 13190 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356149.1 protein_id gnl|my_center|LOCUS_06030 13408 15273 gene locus_tag LOCUS_06040 13408 15273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 15488 16672 gene locus_tag LOCUS_06050 15488 16672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 16693 17157 gene locus_tag LOCUS_06060 16693 17157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 18567 17440 gene locus_tag LOCUS_06070 gene zinU 18567 17440 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_06070 19123 18740 gene locus_tag LOCUS_06080 19123 18740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 19502 19158 gene locus_tag LOCUS_06090 19502 19158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 20988 20071 gene locus_tag LOCUS_06100 20988 20071 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_06100 21307 21158 gene locus_tag LOCUS_06110 21307 21158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 22869 21514 gene locus_tag LOCUS_06120 gene rlmD 22869 21514 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_06120 26318 22866 gene locus_tag LOCUS_06130 26318 22866 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_06130 27257 26328 gene locus_tag LOCUS_06140 gene whiA 27257 26328 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_06140 28197 27307 gene locus_tag LOCUS_06150 gene rapZ 28197 27307 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462179.1 protein_id gnl|my_center|LOCUS_06150 29115 28204 gene locus_tag LOCUS_06160 gene murB 29115 28204 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_06160 30208 29120 gene locus_tag LOCUS_06170 30208 29120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 30351 30656 gene locus_tag LOCUS_06180 gene spoIIAA 30351 30656 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_06180 30675 31109 gene locus_tag LOCUS_06190 gene spoIIAB 30675 31109 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_06190 31106 31909 gene locus_tag LOCUS_06200 gene sigF 31106 31909 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_06200 31923 33203 gene locus_tag LOCUS_06210 31923 33203 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_06210 34185 33295 gene locus_tag LOCUS_06220 34185 33295 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_06220 34449 35531 gene locus_tag LOCUS_06230 gene nahK 34449 35531 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_06230 35660 36739 gene locus_tag LOCUS_06240 35660 36739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 36755 37183 gene locus_tag LOCUS_06250 36755 37183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 37180 37491 gene locus_tag LOCUS_06260 37180 37491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 37710 38825 gene locus_tag LOCUS_06270 gene mglB 37710 38825 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881084.1 protein_id gnl|my_center|LOCUS_06270 39023 40522 gene locus_tag LOCUS_06280 gene mglA 39023 40522 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255039.1 protein_id gnl|my_center|LOCUS_06280 40538 41602 gene locus_tag LOCUS_06290 gene mglC 40538 41602 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016955.1 protein_id gnl|my_center|LOCUS_06290 41645 43303 gene locus_tag LOCUS_06300 41645 43303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 43325 45160 gene locus_tag LOCUS_06310 43325 45160 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_06310 45157 46101 gene locus_tag LOCUS_06320 45157 46101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 46128 47147 gene locus_tag LOCUS_06330 gene mglB 46128 47147 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215885.1 protein_id gnl|my_center|LOCUS_06330 47217 48500 gene locus_tag LOCUS_06340 gene galK 47217 48500 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049364.1 protein_id gnl|my_center|LOCUS_06340 48511 48642 gene locus_tag LOCUS_06350 48511 48642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 49118 50107 gene locus_tag LOCUS_06360 gene galE 49118 50107 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016045.1 protein_id gnl|my_center|LOCUS_06360 50111 51127 gene locus_tag LOCUS_06370 50111 51127 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225221.1 protein_id gnl|my_center|LOCUS_06370 51412 51789 gene locus_tag LOCUS_06380 51412 51789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 51764 51907 gene locus_tag LOCUS_06390 51764 51907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 52133 53380 gene locus_tag LOCUS_06400 52133 53380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 53444 53644 gene locus_tag LOCUS_06410 53444 53644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 53758 54033 gene locus_tag LOCUS_06420 53758 54033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06420 54386 54087 gene locus_tag LOCUS_06430 54386 54087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 55860 54586 gene locus_tag LOCUS_06440 55860 54586 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_06440 57590 55878 gene locus_tag LOCUS_06450 gene ptsP 57590 55878 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831740.1 protein_id gnl|my_center|LOCUS_06450 57954 57685 gene locus_tag LOCUS_06460 57954 57685 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_06460 59021 57984 gene locus_tag LOCUS_06470 59021 57984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06470 59363 59043 gene locus_tag LOCUS_06480 59363 59043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 59890 59417 gene locus_tag LOCUS_06490 59890 59417 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989459.1 protein_id gnl|my_center|LOCUS_06490 61159 59900 gene locus_tag LOCUS_06500 61159 59900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 61896 61234 gene locus_tag LOCUS_06510 61896 61234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 62676 61945 gene locus_tag LOCUS_06520 gene surE 62676 61945 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947013.1 protein_id gnl|my_center|LOCUS_06520 62936 63781 gene locus_tag LOCUS_06530 62936 63781 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 protein_id gnl|my_center|LOCUS_06530 63872 64855 gene locus_tag LOCUS_06540 gene dhaK1 63872 64855 CDS product dihydroxyacetone kinase subunit DhaK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930437.1 protein_id gnl|my_center|LOCUS_06540 64862 65500 gene locus_tag LOCUS_06550 gene dhaL 64862 65500 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259134.1 protein_id gnl|my_center|LOCUS_06550 65511 65999 gene locus_tag LOCUS_06560 65511 65999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 66003 66833 gene locus_tag LOCUS_06570 66003 66833 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924976.1 protein_id gnl|my_center|LOCUS_06570 66862 67221 gene locus_tag LOCUS_06580 66862 67221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 67835 67590 gene locus_tag LOCUS_06590 67835 67590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 67770 68396 gene locus_tag LOCUS_06600 67770 68396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 68417 69412 gene locus_tag LOCUS_06610 gene ydjG 68417 69412 CDS product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723698.1 protein_id gnl|my_center|LOCUS_06610 69623 70366 gene locus_tag LOCUS_06620 69623 70366 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_06620 70916 70410 gene locus_tag LOCUS_06630 70916 70410 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_06630 71897 71103 gene locus_tag LOCUS_06640 gene cysK 71897 71103 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06640 73272 71962 gene locus_tag LOCUS_06650 73272 71962 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_06650 73755 73591 gene locus_tag LOCUS_06660 73755 73591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 74401 73946 gene locus_tag LOCUS_06670 74401 73946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 74890 75315 gene locus_tag LOCUS_06680 74890 75315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 75326 76183 gene locus_tag LOCUS_06690 75326 76183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_06690 76241 77236 gene locus_tag LOCUS_06700 76241 77236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_06700 77236 78219 gene locus_tag LOCUS_06710 77236 78219 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_06710 78274 78729 gene locus_tag LOCUS_06720 78274 78729 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033059696.1 protein_id gnl|my_center|LOCUS_06720 78744 79928 gene locus_tag LOCUS_06730 78744 79928 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669899.1 protein_id gnl|my_center|LOCUS_06730 80864 80226 gene locus_tag LOCUS_06740 gene phoU 80864 80226 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_06740 81621 80866 gene locus_tag LOCUS_06750 gene pstB 81621 80866 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_06750 82481 81618 gene locus_tag LOCUS_06760 gene pstA 82481 81618 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049767.1 protein_id gnl|my_center|LOCUS_06760 83357 82488 gene locus_tag LOCUS_06770 gene pstC 83357 82488 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_06770 84197 83385 gene locus_tag LOCUS_06780 84197 83385 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_06780 85753 84350 gene locus_tag LOCUS_06790 85753 84350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 86375 85776 gene locus_tag LOCUS_06800 86375 85776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 87377 86382 gene locus_tag LOCUS_06810 gene floA 87377 86382 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_06810 87646 87419 gene locus_tag LOCUS_06820 87646 87419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 88174 87662 gene locus_tag LOCUS_06830 88174 87662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 88624 89361 gene locus_tag LOCUS_06840 gene cysE 88624 89361 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_06840 89389 90777 gene locus_tag LOCUS_06850 gene cysS 89389 90777 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_06850 90841 91344 gene locus_tag LOCUS_06860 90841 91344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 91374 92390 gene locus_tag LOCUS_06870 gene galE 91374 92390 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775237.1 protein_id gnl|my_center|LOCUS_06870 92344 92532 gene locus_tag LOCUS_06880 92344 92532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 92804 93367 gene locus_tag LOCUS_06890 92804 93367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 93444 95765 gene locus_tag LOCUS_06900 93444 95765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 96006 96995 gene locus_tag LOCUS_06910 96006 96995 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_06910 97013 99091 gene locus_tag LOCUS_06920 97013 99091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 99105 100286 gene locus_tag LOCUS_06930 99105 100286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861634.1 protein_id gnl|my_center|LOCUS_06930 100288 101385 gene locus_tag LOCUS_06940 100288 101385 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963504.1 protein_id gnl|my_center|LOCUS_06940 101342 101611 gene locus_tag LOCUS_06950 101342 101611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 102571 101771 gene locus_tag LOCUS_06960 102571 101771 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_06960 103286 102624 gene locus_tag LOCUS_06970 103286 102624 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817223.1 protein_id gnl|my_center|LOCUS_06970 104297 103290 gene locus_tag LOCUS_06980 104297 103290 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_06980 104769 105509 gene locus_tag LOCUS_06990 104769 105509 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_06990 105506 106381 gene locus_tag LOCUS_07000 105506 106381 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_07000 106406 106666 gene locus_tag LOCUS_07010 106406 106666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 107309 106788 gene locus_tag LOCUS_07020 107309 106788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 107889 107452 gene locus_tag LOCUS_07030 107889 107452 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245063.1 protein_id gnl|my_center|LOCUS_07030 108173 108517 gene locus_tag LOCUS_07040 108173 108517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 108762 110036 gene locus_tag LOCUS_07050 108762 110036 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_07050 110033 110272 gene locus_tag LOCUS_07060 110033 110272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 110311 112095 gene locus_tag LOCUS_07070 gene pepF 110311 112095 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944353.1 protein_id gnl|my_center|LOCUS_07070 112097 112417 gene locus_tag LOCUS_07080 112097 112417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 114306 112939 gene locus_tag LOCUS_07090 114306 112939 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_07090 114944 114543 gene locus_tag LOCUS_07100 114944 114543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 117724 115076 gene locus_tag LOCUS_07110 117724 115076 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909521.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence07 297 1151 gene locus_tag LOCUS_07120 297 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07120 1580 1488 gene locus_tag LOCUS_t00150 1580 1488 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1681 1593 gene locus_tag LOCUS_t00160 1681 1593 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1870 2475 gene locus_tag LOCUS_07130 1870 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2545 3339 gene locus_tag LOCUS_07140 2545 3339 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948434.1 protein_id gnl|my_center|LOCUS_07140 3336 3830 gene locus_tag LOCUS_07150 3336 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 3884 4006 gene locus_tag LOCUS_07160 3884 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 4212 4625 gene locus_tag LOCUS_07170 4212 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 5970 4765 gene locus_tag LOCUS_07180 5970 4765 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543120.1 protein_id gnl|my_center|LOCUS_07180 7501 5972 gene locus_tag LOCUS_07190 7501 5972 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926897.1 protein_id gnl|my_center|LOCUS_07190 9052 7580 gene locus_tag LOCUS_07200 9052 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 9744 9049 gene locus_tag LOCUS_07210 9744 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 11050 9725 gene locus_tag LOCUS_07220 11050 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 11666 11520 gene locus_tag LOCUS_07230 11666 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 11851 12024 gene locus_tag LOCUS_07240 11851 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 12347 12030 gene locus_tag LOCUS_07250 12347 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 14119 12425 gene locus_tag LOCUS_07260 14119 12425 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_07260 14185 14409 gene locus_tag LOCUS_07270 14185 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 15442 14468 gene locus_tag LOCUS_07280 15442 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 15983 15429 gene locus_tag LOCUS_07290 15983 15429 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931266.1 protein_id gnl|my_center|LOCUS_07290 17432 16731 gene locus_tag LOCUS_07300 17432 16731 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187213.1 protein_id gnl|my_center|LOCUS_07300 17658 17389 gene locus_tag LOCUS_07310 17658 17389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 18484 17816 gene locus_tag LOCUS_07320 18484 17816 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_07320 19316 18492 gene locus_tag LOCUS_07330 19316 18492 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_07330 20250 19330 gene locus_tag LOCUS_07340 20250 19330 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949070.1 protein_id gnl|my_center|LOCUS_07340 21329 20262 gene locus_tag LOCUS_07350 21329 20262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_07350 22790 21441 gene locus_tag LOCUS_07360 22790 21441 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081252.1 protein_id gnl|my_center|LOCUS_07360 23847 22942 gene locus_tag LOCUS_07370 23847 22942 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880380.1 protein_id gnl|my_center|LOCUS_07370 23982 24539 gene locus_tag LOCUS_07380 23982 24539 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_07380 24889 26199 gene locus_tag LOCUS_07390 24889 26199 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861962.1 protein_id gnl|my_center|LOCUS_07390 27336 26239 gene locus_tag LOCUS_07400 27336 26239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 27529 28536 gene locus_tag LOCUS_07410 27529 28536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 28533 29339 gene locus_tag LOCUS_07420 28533 29339 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980234.1 protein_id gnl|my_center|LOCUS_07420 29340 30314 gene locus_tag LOCUS_07430 gene rbsK 29340 30314 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419503.1 protein_id gnl|my_center|LOCUS_07430 30814 30738 gene locus_tag LOCUS_t00170 30814 30738 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32521 30947 gene locus_tag LOCUS_07440 gene radA 32521 30947 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_07440 32421 34112 gene locus_tag LOCUS_07450 32421 34112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 34139 34474 gene locus_tag LOCUS_07460 34139 34474 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359499.1 protein_id gnl|my_center|LOCUS_07460 34528 35127 gene locus_tag LOCUS_07470 gene recR 34528 35127 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_07470 35131 35982 gene locus_tag LOCUS_07480 35131 35982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 35979 36374 gene locus_tag LOCUS_07490 35979 36374 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165225.1 protein_id gnl|my_center|LOCUS_07490 36690 37766 gene locus_tag LOCUS_07500 36690 37766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 37791 38354 gene locus_tag LOCUS_07510 37791 38354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 38390 39490 gene locus_tag LOCUS_07520 38390 39490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 39487 40266 gene locus_tag LOCUS_07530 39487 40266 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_07530 40321 43665 gene locus_tag LOCUS_07540 40321 43665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 43728 44096 gene locus_tag LOCUS_07550 43728 44096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 44230 44727 gene locus_tag LOCUS_07560 gene ruvC 44230 44727 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_07560 44747 45331 gene locus_tag LOCUS_07570 gene ruvA 44747 45331 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460360.1 protein_id gnl|my_center|LOCUS_07570 45377 46396 gene locus_tag LOCUS_07580 gene ruvB 45377 46396 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_07580 46403 47188 gene locus_tag LOCUS_07590 46403 47188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 47181 48626 gene locus_tag LOCUS_07600 gene proS 47181 48626 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_07600 48733 49290 gene locus_tag LOCUS_07610 48733 49290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 49292 50008 gene locus_tag LOCUS_07620 49292 50008 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059917.1 protein_id gnl|my_center|LOCUS_07620 50078 51265 gene locus_tag LOCUS_07630 50078 51265 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_07630 51296 52042 gene locus_tag LOCUS_07640 gene tpiA 51296 52042 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_07640 52042 53586 gene locus_tag LOCUS_07650 gene gpmI 52042 53586 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_07650 53666 53905 gene locus_tag LOCUS_07660 53666 53905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 54071 54538 gene locus_tag LOCUS_07670 gene smpB 54071 54538 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_07670 54535 55782 gene locus_tag LOCUS_07680 gene lysA 54535 55782 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_07680 55840 56199 gene locus_tag LOCUS_tm00010 55840 56199 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 56498 56671 gene locus_tag LOCUS_07690 56498 56671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 57174 57392 gene locus_tag LOCUS_07700 57174 57392 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816704.1 protein_id gnl|my_center|LOCUS_07700 57373 57852 gene locus_tag LOCUS_07710 57373 57852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 58145 59431 gene locus_tag LOCUS_07720 58145 59431 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_07720 59495 60343 gene locus_tag LOCUS_07730 59495 60343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 60384 61808 gene locus_tag LOCUS_07740 60384 61808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 62769 62164 gene locus_tag LOCUS_07750 62769 62164 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869350.1 protein_id gnl|my_center|LOCUS_07750 62869 64002 gene locus_tag LOCUS_07760 62869 64002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 64024 65121 gene locus_tag LOCUS_07770 64024 65121 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392538.1 protein_id gnl|my_center|LOCUS_07770 65300 65926 gene locus_tag LOCUS_07780 65300 65926 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435286.1 protein_id gnl|my_center|LOCUS_07780 65868 66146 gene locus_tag LOCUS_07790 65868 66146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 66171 67151 gene locus_tag LOCUS_07800 66171 67151 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_07800 67328 67777 gene locus_tag LOCUS_07810 67328 67777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 67842 68678 gene locus_tag LOCUS_07820 67842 68678 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_07820 69567 68857 gene locus_tag LOCUS_07830 69567 68857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 69822 69747 gene locus_tag LOCUS_t00180 69822 69747 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 71192 69912 gene locus_tag LOCUS_07840 gene rmuC 71192 69912 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_07840 71869 71198 gene locus_tag LOCUS_07850 71869 71198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 72048 72740 gene locus_tag LOCUS_07860 72048 72740 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_07860 72753 73751 gene locus_tag LOCUS_07870 72753 73751 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_07870 73833 74330 gene locus_tag LOCUS_07880 73833 74330 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642092.1 protein_id gnl|my_center|LOCUS_07880 74327 74737 gene locus_tag LOCUS_07890 74327 74737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 74907 76235 gene locus_tag LOCUS_07900 74907 76235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 76274 76849 gene locus_tag LOCUS_07910 76274 76849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 76950 77894 gene locus_tag LOCUS_07920 76950 77894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 77976 78581 gene locus_tag LOCUS_07930 77976 78581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 78581 79615 gene locus_tag LOCUS_07940 gene rsgA 78581 79615 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861937.1 protein_id gnl|my_center|LOCUS_07940 79626 80342 gene locus_tag LOCUS_07950 79626 80342 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_07950 80537 82909 gene locus_tag LOCUS_07960 80537 82909 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_07960 83467 83024 gene locus_tag LOCUS_07970 83467 83024 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828945.1 protein_id gnl|my_center|LOCUS_07970 84007 83537 gene locus_tag LOCUS_07980 84007 83537 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_07980 84603 84004 gene locus_tag LOCUS_07990 84603 84004 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932644.1 protein_id gnl|my_center|LOCUS_07990 86321 84594 gene locus_tag LOCUS_08000 86321 84594 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_08000 86629 86315 gene locus_tag LOCUS_08010 86629 86315 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817220.1 protein_id gnl|my_center|LOCUS_08010 87123 86860 gene locus_tag LOCUS_08020 gene rpsT 87123 86860 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859343.1 protein_id gnl|my_center|LOCUS_08020 89448 87226 gene locus_tag LOCUS_08030 89448 87226 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836341.1 protein_id gnl|my_center|LOCUS_08030 89670 89954 gene locus_tag LOCUS_08040 gene groES 89670 89954 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_08040 89990 91615 gene locus_tag LOCUS_08050 gene groL 89990 91615 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 protein_id gnl|my_center|LOCUS_08050 91704 92609 gene locus_tag LOCUS_08060 91704 92609 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_08060 92928 92698 gene locus_tag LOCUS_08070 92928 92698 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071351.1 protein_id gnl|my_center|LOCUS_08070 93365 92925 gene locus_tag LOCUS_08080 93365 92925 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_08080 94648 93368 gene locus_tag LOCUS_08090 94648 93368 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680050.1 protein_id gnl|my_center|LOCUS_08090 94953 96197 gene locus_tag LOCUS_08100 94953 96197 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_08100 96199 97524 gene locus_tag LOCUS_08110 gene der 96199 97524 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_08110 97530 98141 gene locus_tag LOCUS_08120 gene plsY 97530 98141 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_08120 98157 99758 gene locus_tag LOCUS_08130 gene spoIVA 98157 99758 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_08130 99831 100733 gene locus_tag LOCUS_08140 gene gpr 99831 100733 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392443.1 protein_id gnl|my_center|LOCUS_08140 100761 101807 gene locus_tag LOCUS_08150 100761 101807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 103127 101913 gene locus_tag LOCUS_08160 103127 101913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 104014 103139 gene locus_tag LOCUS_08170 gene dapA 104014 103139 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_08170 105026 104019 gene locus_tag LOCUS_08180 105026 104019 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422061.1 protein_id gnl|my_center|LOCUS_08180 105250 106020 gene locus_tag LOCUS_08190 105250 106020 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_08190 106017 106931 gene locus_tag LOCUS_08200 gene hslO 106017 106931 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_08200 106912 108624 gene locus_tag LOCUS_08210 106912 108624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 108621 109736 gene locus_tag LOCUS_08220 108621 109736 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_08220 109733 110950 gene locus_tag LOCUS_08230 109733 110950 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_08230 111019 111101 gene locus_tag LOCUS_t00190 111019 111101 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence08 326 240 gene locus_tag LOCUS_t00200 326 240 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 411 327 gene locus_tag LOCUS_t00210 411 327 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 510 436 gene locus_tag LOCUS_t00220 510 436 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 597 521 gene locus_tag LOCUS_t00230 597 521 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 687 611 gene locus_tag LOCUS_t00240 687 611 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 775 701 gene locus_tag LOCUS_t00250 775 701 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 857 781 gene locus_tag LOCUS_t00260 857 781 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3677 1038 gene locus_tag LOCUS_08240 3677 1038 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_08240 5971 3992 gene locus_tag LOCUS_08250 5971 3992 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640139.1 protein_id gnl|my_center|LOCUS_08250 6903 5971 gene locus_tag LOCUS_08260 6903 5971 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_08260 7471 6893 gene locus_tag LOCUS_08270 7471 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 8121 7516 gene locus_tag LOCUS_08280 8121 7516 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438043.1 protein_id gnl|my_center|LOCUS_08280 8744 8118 gene locus_tag LOCUS_08290 gene coaE 8744 8118 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_08290 11319 8731 gene locus_tag LOCUS_08300 gene polA 11319 8731 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_08300 12638 11322 gene locus_tag LOCUS_08310 12638 11322 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_08310 13815 12676 gene locus_tag LOCUS_08320 13815 12676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 15737 13818 gene locus_tag LOCUS_08330 15737 13818 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_08330 15905 17332 gene locus_tag LOCUS_08340 15905 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 17334 18209 gene locus_tag LOCUS_08350 17334 18209 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_08350 19755 18556 gene locus_tag LOCUS_08360 19755 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 20818 19835 gene locus_tag LOCUS_08370 20818 19835 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315533.1 protein_id gnl|my_center|LOCUS_08370 21891 20815 gene locus_tag LOCUS_08380 21891 20815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969743.1 protein_id gnl|my_center|LOCUS_08380 23423 21888 gene locus_tag LOCUS_08390 23423 21888 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973785.1 protein_id gnl|my_center|LOCUS_08390 24814 23684 gene locus_tag LOCUS_08400 24814 23684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 26032 25088 gene locus_tag LOCUS_08410 26032 25088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 26647 26141 gene locus_tag LOCUS_08420 26647 26141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 27510 26605 gene locus_tag LOCUS_08430 27510 26605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 28961 27510 gene locus_tag LOCUS_08440 28961 27510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 29684 28980 gene locus_tag LOCUS_08450 29684 28980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 30649 29681 gene locus_tag LOCUS_08460 30649 29681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_08460 31752 30799 gene locus_tag LOCUS_08470 gene manA 31752 30799 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989899.1 protein_id gnl|my_center|LOCUS_08470 32660 31755 gene locus_tag LOCUS_08480 32660 31755 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388671.1 protein_id gnl|my_center|LOCUS_08480 34926 32653 gene locus_tag LOCUS_08490 34926 32653 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903701.1 protein_id gnl|my_center|LOCUS_08490 35677 34928 gene locus_tag LOCUS_08500 35677 34928 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930423.1 protein_id gnl|my_center|LOCUS_08500 36578 35820 gene locus_tag LOCUS_08510 36578 35820 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017152.1 protein_id gnl|my_center|LOCUS_08510 37594 36575 gene locus_tag LOCUS_08520 37594 36575 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964544.1 protein_id gnl|my_center|LOCUS_08520 38554 37604 gene locus_tag LOCUS_08530 38554 37604 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109361.1 protein_id gnl|my_center|LOCUS_08530 39497 38595 gene locus_tag LOCUS_08540 39497 38595 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970571.1 protein_id gnl|my_center|LOCUS_08540 40650 39541 gene locus_tag LOCUS_08550 40650 39541 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210025.1 protein_id gnl|my_center|LOCUS_08550 41455 40697 gene locus_tag LOCUS_08560 gene deoC 41455 40697 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228457.1 protein_id gnl|my_center|LOCUS_08560 41746 42891 gene locus_tag LOCUS_08570 41746 42891 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_08570 42903 43754 gene locus_tag LOCUS_08580 42903 43754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 43780 44700 gene locus_tag LOCUS_08590 43780 44700 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_08590 44725 45804 gene locus_tag LOCUS_08600 44725 45804 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_08600 45807 46526 gene locus_tag LOCUS_08610 45807 46526 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932350.1 protein_id gnl|my_center|LOCUS_08610 46716 47405 gene locus_tag LOCUS_08620 46716 47405 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_08620 47402 49057 gene locus_tag LOCUS_08630 47402 49057 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_08630 49201 50991 gene locus_tag LOCUS_08640 49201 50991 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_08640 52474 51119 gene locus_tag LOCUS_08650 52474 51119 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808893.1 protein_id gnl|my_center|LOCUS_08650 52655 53512 gene locus_tag LOCUS_08660 52655 53512 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_08660 53748 55100 gene locus_tag LOCUS_08670 53748 55100 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_08670 56852 55641 gene locus_tag LOCUS_08680 56852 55641 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_08680 57857 56940 gene locus_tag LOCUS_08690 57857 56940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 58212 59429 gene locus_tag LOCUS_08700 58212 59429 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890744.1 protein_id gnl|my_center|LOCUS_08700 60020 59502 gene locus_tag LOCUS_08710 60020 59502 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_08710 60647 60084 gene locus_tag LOCUS_08720 60647 60084 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_08720 60972 62624 gene locus_tag LOCUS_08730 60972 62624 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_08730 62666 62854 gene locus_tag LOCUS_08740 62666 62854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 63883 62996 gene locus_tag LOCUS_08750 63883 62996 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_08750 64010 64993 gene locus_tag LOCUS_08760 64010 64993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 65374 66348 gene locus_tag LOCUS_08770 65374 66348 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_08770 66905 66345 gene locus_tag LOCUS_08780 66905 66345 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080866.1 protein_id gnl|my_center|LOCUS_08780 67097 67546 gene locus_tag LOCUS_08790 67097 67546 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812737.1 protein_id gnl|my_center|LOCUS_08790 67635 68438 gene locus_tag LOCUS_08800 67635 68438 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_08800 68562 70445 gene locus_tag LOCUS_08810 gene htpG 68562 70445 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_08810 70971 70519 gene locus_tag LOCUS_08820 70971 70519 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_08820 71070 71146 gene locus_tag LOCUS_t00270 71070 71146 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 73517 71787 gene locus_tag LOCUS_08830 73517 71787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 74369 73521 gene locus_tag LOCUS_08840 74369 73521 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_08840 75246 74359 gene locus_tag LOCUS_08850 75246 74359 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_08850 76661 75333 gene locus_tag LOCUS_08860 76661 75333 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776454.1 protein_id gnl|my_center|LOCUS_08860 76826 78625 gene locus_tag LOCUS_08870 76826 78625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 78627 80117 gene locus_tag LOCUS_08880 78627 80117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 80121 81776 gene locus_tag LOCUS_08890 80121 81776 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641784.1 protein_id gnl|my_center|LOCUS_08890 83187 83588 gene locus_tag LOCUS_08900 83187 83588 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993516.1 protein_id gnl|my_center|LOCUS_08900 83840 84466 gene locus_tag LOCUS_08910 83840 84466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 84460 84912 gene locus_tag LOCUS_08920 84460 84912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 85016 85729 gene locus_tag LOCUS_08930 85016 85729 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_08930 85723 87321 gene locus_tag LOCUS_08940 85723 87321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_08940 87343 87558 gene locus_tag LOCUS_08950 87343 87558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 87507 88019 gene locus_tag LOCUS_08960 87507 88019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 88195 88665 gene locus_tag LOCUS_08970 88195 88665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 89332 88673 gene locus_tag LOCUS_08980 89332 88673 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_08980 89762 89349 gene locus_tag LOCUS_08990 89762 89349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 90082 89852 gene locus_tag LOCUS_09000 90082 89852 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_09000 90429 90148 gene locus_tag LOCUS_09010 90429 90148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 92595 90442 gene locus_tag LOCUS_09020 92595 90442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 92941 94086 gene locus_tag LOCUS_09030 92941 94086 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_09030 94097 95278 gene locus_tag LOCUS_09040 gene thiI 94097 95278 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence09 5490 244 gene locus_tag LOCUS_09050 5490 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 6500 5490 gene locus_tag LOCUS_09060 6500 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 9265 6500 gene locus_tag LOCUS_09070 9265 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 10836 9277 gene locus_tag LOCUS_09080 10836 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 11144 10926 gene locus_tag LOCUS_09090 11144 10926 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_09090 11453 11629 gene locus_tag LOCUS_09100 11453 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 12223 11678 gene locus_tag LOCUS_09110 12223 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 12615 12208 gene locus_tag LOCUS_09120 12615 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 13886 12735 gene locus_tag LOCUS_09130 gene mltG 13886 12735 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_09130 14259 13918 gene locus_tag LOCUS_09140 14259 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 15924 14275 gene locus_tag LOCUS_09150 15924 14275 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_09150 16878 15937 gene locus_tag LOCUS_09160 16878 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 18235 16850 gene locus_tag LOCUS_09170 gene hslU 18235 16850 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_09170 18772 18239 gene locus_tag LOCUS_09180 gene hslV 18772 18239 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724001.1 protein_id gnl|my_center|LOCUS_09180 20133 18841 gene locus_tag LOCUS_09190 gene trmFO 20133 18841 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_09190 22228 20126 gene locus_tag LOCUS_09200 gene topA 22228 20126 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_09200 23408 22251 gene locus_tag LOCUS_09210 gene dprA 23408 22251 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_09210 24939 23416 gene locus_tag LOCUS_09220 24939 23416 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_09220 25419 24946 gene locus_tag LOCUS_09230 25419 24946 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964330.1 protein_id gnl|my_center|LOCUS_09230 29245 25409 gene locus_tag LOCUS_09240 29245 25409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 29656 29306 gene locus_tag LOCUS_09250 29656 29306 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094547338.1 protein_id gnl|my_center|LOCUS_09250 30279 29653 gene locus_tag LOCUS_09260 30279 29653 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_09260 31165 30263 gene locus_tag LOCUS_09270 gene ylqF 31165 30263 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 protein_id gnl|my_center|LOCUS_09270 31593 31234 gene locus_tag LOCUS_09280 gene rplS 31593 31234 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_09280 32440 31754 gene locus_tag LOCUS_09290 gene trmD 32440 31754 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_09290 32948 32430 gene locus_tag LOCUS_09300 gene rimM 32948 32430 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_09300 33172 32945 gene locus_tag LOCUS_09310 33172 32945 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_09310 33423 33181 gene locus_tag LOCUS_09320 gene rpsP 33423 33181 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_09320 34831 33497 gene locus_tag LOCUS_09330 gene ffh 34831 33497 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_09330 35177 34821 gene locus_tag LOCUS_09340 35177 34821 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_09340 36269 35364 gene locus_tag LOCUS_09350 gene ftsY 36269 35364 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723863.1 protein_id gnl|my_center|LOCUS_09350 39833 36270 gene locus_tag LOCUS_09360 gene smc 39833 36270 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_09360 40559 39840 gene locus_tag LOCUS_09370 gene rnc 40559 39840 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_09370 40851 40627 gene locus_tag LOCUS_09380 gene acpP 40851 40627 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_09380 41935 40925 gene locus_tag LOCUS_09390 gene plsX 41935 40925 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_09390 42272 42072 gene locus_tag LOCUS_09400 gene rpmF 42272 42072 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362601.1 protein_id gnl|my_center|LOCUS_09400 42797 42291 gene locus_tag LOCUS_09410 42797 42291 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214224.1 protein_id gnl|my_center|LOCUS_09410 45227 42933 gene locus_tag LOCUS_09420 45227 42933 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393212.1 protein_id gnl|my_center|LOCUS_09420 45939 45319 gene locus_tag LOCUS_09430 45939 45319 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_09430 46762 45926 gene locus_tag LOCUS_09440 46762 45926 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_09440 47091 46933 gene locus_tag LOCUS_09450 47091 46933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 48294 47101 gene locus_tag LOCUS_09460 48294 47101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 49382 48276 gene locus_tag LOCUS_09470 49382 48276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 50986 49379 gene locus_tag LOCUS_09480 50986 49379 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_09480 51887 51219 gene locus_tag LOCUS_09490 51887 51219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 52180 51959 gene locus_tag LOCUS_09500 52180 51959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 53201 52182 gene locus_tag LOCUS_09510 53201 52182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 56036 53403 gene locus_tag LOCUS_09520 gene ppdK 56036 53403 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_09520 56954 56211 gene locus_tag LOCUS_09530 56954 56211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 57079 56960 gene locus_tag LOCUS_09540 57079 56960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 58057 57167 gene locus_tag LOCUS_09550 gene era 58057 57167 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_09550 58470 58054 gene locus_tag LOCUS_09560 58470 58054 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383839.1 protein_id gnl|my_center|LOCUS_09560 58907 58467 gene locus_tag LOCUS_09570 gene ybeY 58907 58467 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_09570 61099 58913 gene locus_tag LOCUS_09580 gene pgpH 61099 58913 CDS product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721972.1 protein_id gnl|my_center|LOCUS_09580 62060 61080 gene locus_tag LOCUS_09590 62060 61080 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_09590 63204 62041 gene locus_tag LOCUS_09600 63204 62041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 63503 63201 gene locus_tag LOCUS_09610 63503 63201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 63680 64075 gene locus_tag LOCUS_09620 63680 64075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 64079 64510 gene locus_tag LOCUS_09630 64079 64510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 65427 64603 gene locus_tag LOCUS_09640 65427 64603 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723600.1 protein_id gnl|my_center|LOCUS_09640 66606 65431 gene locus_tag LOCUS_09650 66606 65431 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_09650 67227 66655 gene locus_tag LOCUS_09660 67227 66655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 68044 67268 gene locus_tag LOCUS_09670 gene spo0A 68044 67268 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_09670 69301 68075 gene locus_tag LOCUS_09680 gene spoIVB 69301 68075 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 protein_id gnl|my_center|LOCUS_09680 71151 69451 gene locus_tag LOCUS_09690 gene recN 71151 69451 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 protein_id gnl|my_center|LOCUS_09690 71616 71167 gene locus_tag LOCUS_09700 71616 71167 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_09700 72463 71675 gene locus_tag LOCUS_09710 72463 71675 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_09710 73494 72682 gene locus_tag LOCUS_09720 73494 72682 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230264.1 protein_id gnl|my_center|LOCUS_09720 75392 73491 gene locus_tag LOCUS_09730 gene dxs 75392 73491 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_09730 76367 75519 gene locus_tag LOCUS_09740 76367 75519 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_09740 76566 76369 gene locus_tag LOCUS_09750 76566 76369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 77784 76570 gene locus_tag LOCUS_09760 gene xseA 77784 76570 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_09760 78728 77766 gene locus_tag LOCUS_09770 78728 77766 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_09770 79158 78742 gene locus_tag LOCUS_09780 gene nusB 79158 78742 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_09780 79382 79155 gene locus_tag LOCUS_09790 79382 79155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 79965 79396 gene locus_tag LOCUS_09800 79965 79396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 80603 80124 gene locus_tag LOCUS_09810 80603 80124 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_09810 80908 81123 gene locus_tag LOCUS_09820 80908 81123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 81144 82091 gene locus_tag LOCUS_09830 81144 82091 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_09830 82160 82621 gene locus_tag LOCUS_09840 82160 82621 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_09840 82618 82923 gene locus_tag LOCUS_09850 82618 82923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence10 648 169 gene locus_tag LOCUS_09860 gene tadA 648 169 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_09860 1415 645 gene locus_tag LOCUS_09870 gene truA 1415 645 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_09870 2221 1415 gene locus_tag LOCUS_09880 2221 1415 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_09880 3074 2226 gene locus_tag LOCUS_09890 3074 2226 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_09890 3880 3050 gene locus_tag LOCUS_09900 3880 3050 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_09900 4009 5394 gene locus_tag LOCUS_09910 4009 5394 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_09910 5399 5887 gene locus_tag LOCUS_09920 5399 5887 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_09920 5910 6860 gene locus_tag LOCUS_09930 5910 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6873 7421 gene locus_tag LOCUS_09940 6873 7421 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_09940 9039 7636 gene locus_tag LOCUS_09950 9039 7636 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986771.1 protein_id gnl|my_center|LOCUS_09950 9725 9036 gene locus_tag LOCUS_09960 9725 9036 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272297.1 protein_id gnl|my_center|LOCUS_09960 10333 9794 gene locus_tag LOCUS_09970 10333 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459532.1 protein_id gnl|my_center|LOCUS_09970 11357 10425 gene locus_tag LOCUS_09980 11357 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 12327 11449 gene locus_tag LOCUS_09990 12327 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 12731 12324 gene locus_tag LOCUS_10000 12731 12324 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581517.1 protein_id gnl|my_center|LOCUS_10000 12942 13493 gene locus_tag LOCUS_10010 12942 13493 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_10010 13561 13950 gene locus_tag LOCUS_10020 13561 13950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 15106 14039 gene locus_tag LOCUS_10030 15106 14039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 15315 16124 gene locus_tag LOCUS_10040 15315 16124 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_10040 16200 16844 gene locus_tag LOCUS_10050 16200 16844 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383057.1 protein_id gnl|my_center|LOCUS_10050 16848 17636 gene locus_tag LOCUS_10060 16848 17636 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_10060 18290 17718 gene locus_tag LOCUS_10070 gene dhaS 18290 17718 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204220.1 protein_id gnl|my_center|LOCUS_10070 18592 19089 gene locus_tag LOCUS_10080 gene crtO 18592 19089 CDS product glycosyl-4,4'-diaponeurosporenoate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 protein_id gnl|my_center|LOCUS_10080 19086 20255 gene locus_tag LOCUS_10090 19086 20255 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_10090 21072 20518 gene locus_tag LOCUS_10100 21072 20518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 22800 21088 gene locus_tag LOCUS_10110 22800 21088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 23554 22793 gene locus_tag LOCUS_10120 23554 22793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681851.1 protein_id gnl|my_center|LOCUS_10120 24720 23728 gene locus_tag LOCUS_10130 24720 23728 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_10130 25403 24717 gene locus_tag LOCUS_10140 25403 24717 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_10140 25960 25388 gene locus_tag LOCUS_10150 25960 25388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 26118 25960 gene locus_tag LOCUS_10160 26118 25960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 27054 26236 gene locus_tag LOCUS_10170 27054 26236 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254517.1 protein_id gnl|my_center|LOCUS_10170 28861 27269 gene locus_tag LOCUS_10180 28861 27269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 29405 28833 gene locus_tag LOCUS_10190 29405 28833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 30826 29621 gene locus_tag LOCUS_10200 gene ugpC 30826 29621 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_10200 32992 31247 gene locus_tag LOCUS_10210 32992 31247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_10210 34737 32992 gene locus_tag LOCUS_10220 34737 32992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_10220 34934 35668 gene locus_tag LOCUS_10230 34934 35668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 37258 35798 gene locus_tag LOCUS_10240 37258 35798 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_10240 38634 37273 gene locus_tag LOCUS_10250 gene trkA 38634 37273 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_10250 38983 39810 gene locus_tag LOCUS_10260 38983 39810 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024388.1 protein_id gnl|my_center|LOCUS_10260 39868 41097 gene locus_tag LOCUS_10270 39868 41097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 41414 41620 gene locus_tag LOCUS_10280 41414 41620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 41637 42359 gene locus_tag LOCUS_10290 41637 42359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 42436 42361 gene locus_tag LOCUS_t00280 42436 42361 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 42525 42452 gene locus_tag LOCUS_t00290 42525 42452 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 42607 42532 gene locus_tag LOCUS_t00300 42607 42532 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 42724 42640 gene locus_tag LOCUS_t00310 42724 42640 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 42819 42744 gene locus_tag LOCUS_t00320 42819 42744 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 42900 42825 gene locus_tag LOCUS_t00330 42900 42825 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 43003 42927 gene locus_tag LOCUS_t00340 43003 42927 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 43170 43094 gene locus_tag LOCUS_t00350 43170 43094 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 43759 43256 gene locus_tag LOCUS_10300 43759 43256 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_10300 44286 43798 gene locus_tag LOCUS_10310 gene rimI 44286 43798 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_10310 44917 44291 gene locus_tag LOCUS_10320 44917 44291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 45366 44914 gene locus_tag LOCUS_10330 gene tsaE 45366 44914 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_10330 46487 45363 gene locus_tag LOCUS_10340 gene tgt 46487 45363 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_10340 47534 46509 gene locus_tag LOCUS_10350 gene queA 47534 46509 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_10350 47696 48523 gene locus_tag LOCUS_10360 47696 48523 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_10360 50205 48772 gene locus_tag LOCUS_10370 50205 48772 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429773.1 protein_id gnl|my_center|LOCUS_10370 51594 50254 gene locus_tag LOCUS_10380 51594 50254 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861590.1 protein_id gnl|my_center|LOCUS_10380 52552 51605 gene locus_tag LOCUS_10390 52552 51605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 53302 52613 gene locus_tag LOCUS_10400 53302 52613 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_10400 53772 53323 gene locus_tag LOCUS_10410 53772 53323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 54956 53772 gene locus_tag LOCUS_10420 54956 53772 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_10420 56199 54982 gene locus_tag LOCUS_10430 56199 54982 CDS product 3-hydroxy-3-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814048.1 protein_id gnl|my_center|LOCUS_10430 56733 56272 gene locus_tag LOCUS_10440 56733 56272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 57212 56760 gene locus_tag LOCUS_10450 57212 56760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 58151 57261 gene locus_tag LOCUS_10460 58151 57261 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969293.1 protein_id gnl|my_center|LOCUS_10460 59262 58153 gene locus_tag LOCUS_10470 59262 58153 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969639.1 protein_id gnl|my_center|LOCUS_10470 60790 59252 gene locus_tag LOCUS_10480 60790 59252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_10480 62001 60919 gene locus_tag LOCUS_10490 62001 60919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 63703 62609 gene locus_tag LOCUS_10500 gene rpoD 63703 62609 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_10500 65498 63723 gene locus_tag LOCUS_10510 gene dnaG 65498 63723 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_10510 66563 65565 gene locus_tag LOCUS_10520 66563 65565 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_10520 67230 66781 gene locus_tag LOCUS_10530 67230 66781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_10530 67836 67279 gene locus_tag LOCUS_10540 gene efp 67836 67279 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_10540 68939 67872 gene locus_tag LOCUS_10550 68939 67872 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_10550 70444 68996 gene locus_tag LOCUS_10560 70444 68996 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_10560 70856 70506 gene locus_tag LOCUS_10570 70856 70506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 72594 70864 gene locus_tag LOCUS_10580 72594 70864 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861384.1 protein_id gnl|my_center|LOCUS_10580 73553 72738 gene locus_tag LOCUS_10590 73553 72738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 74122 73817 gene locus_tag LOCUS_10600 74122 73817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 74216 74079 gene locus_tag LOCUS_10610 74216 74079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 74367 74245 gene locus_tag LOCUS_10620 74367 74245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 74761 75564 gene locus_tag LOCUS_10630 74761 75564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence11 215 733 gene locus_tag LOCUS_10640 215 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 709 2112 gene locus_tag LOCUS_10650 709 2112 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_10650 2109 3059 gene locus_tag LOCUS_10660 gene holB 2109 3059 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_10660 3056 4354 gene locus_tag LOCUS_10670 3056 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 4563 4733 gene locus_tag LOCUS_10680 4563 4733 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_10680 6016 4973 gene locus_tag LOCUS_10690 6016 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 6640 6023 gene locus_tag LOCUS_10700 6640 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 7693 6644 gene locus_tag LOCUS_10710 7693 6644 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082991.1 protein_id gnl|my_center|LOCUS_10710 8447 7770 gene locus_tag LOCUS_10720 8447 7770 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_10720 10080 8677 gene locus_tag LOCUS_10730 10080 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 10312 11229 gene locus_tag LOCUS_10740 10312 11229 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_10740 11328 12455 gene locus_tag LOCUS_10750 11328 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 13050 12628 gene locus_tag LOCUS_10760 gene mscL 13050 12628 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_10760 13053 13223 gene locus_tag LOCUS_10770 13053 13223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 13983 13216 gene locus_tag LOCUS_10780 13983 13216 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_10780 14987 13980 gene locus_tag LOCUS_10790 gene ansA 14987 13980 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_10790 15487 14984 gene locus_tag LOCUS_10800 15487 14984 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 protein_id gnl|my_center|LOCUS_10800 16320 15598 gene locus_tag LOCUS_10810 16320 15598 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_10810 16642 17244 gene locus_tag LOCUS_10820 16642 17244 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419808.1 protein_id gnl|my_center|LOCUS_10820 17279 18991 gene locus_tag LOCUS_10830 17279 18991 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380507.1 protein_id gnl|my_center|LOCUS_10830 18984 19901 gene locus_tag LOCUS_10840 18984 19901 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462918.1 protein_id gnl|my_center|LOCUS_10840 20163 21002 gene locus_tag LOCUS_10850 20163 21002 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896272.1 protein_id gnl|my_center|LOCUS_10850 21012 21854 gene locus_tag LOCUS_10860 21012 21854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 21873 22730 gene locus_tag LOCUS_10870 21873 22730 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751612.1 protein_id gnl|my_center|LOCUS_10870 22745 23575 gene locus_tag LOCUS_10880 22745 23575 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931305.1 protein_id gnl|my_center|LOCUS_10880 23580 24080 gene locus_tag LOCUS_10890 23580 24080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 25904 24255 gene locus_tag LOCUS_10900 25904 24255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681065.1 protein_id gnl|my_center|LOCUS_10900 27737 25911 gene locus_tag LOCUS_10910 27737 25911 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681067.1 protein_id gnl|my_center|LOCUS_10910 27784 27948 gene locus_tag LOCUS_10920 27784 27948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 29348 27945 gene locus_tag LOCUS_10930 29348 27945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681074.1 protein_id gnl|my_center|LOCUS_10930 29558 30388 gene locus_tag LOCUS_10940 29558 30388 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379058.1 protein_id gnl|my_center|LOCUS_10940 30496 31530 gene locus_tag LOCUS_10950 30496 31530 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973976.1 protein_id gnl|my_center|LOCUS_10950 31539 33221 gene locus_tag LOCUS_10960 31539 33221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 33215 33967 gene locus_tag LOCUS_10970 33215 33967 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917245.1 protein_id gnl|my_center|LOCUS_10970 34037 34119 gene locus_tag LOCUS_t00360 34037 34119 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34366 34770 gene locus_tag LOCUS_10980 34366 34770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 34767 35921 gene locus_tag LOCUS_10990 34767 35921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 36176 37111 gene locus_tag LOCUS_11000 36176 37111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 38328 37183 gene locus_tag LOCUS_11010 38328 37183 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659298.1 protein_id gnl|my_center|LOCUS_11010 38574 39281 gene locus_tag LOCUS_11020 38574 39281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 40198 39446 gene locus_tag LOCUS_11030 40198 39446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 40815 40285 gene locus_tag LOCUS_11040 40815 40285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 41195 40950 gene locus_tag LOCUS_11050 41195 40950 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109531.1 protein_id gnl|my_center|LOCUS_11050 41313 41537 gene locus_tag LOCUS_11060 41313 41537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 41742 42686 gene locus_tag LOCUS_11070 41742 42686 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_11070 42719 43639 gene locus_tag LOCUS_11080 42719 43639 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_11080 44205 45245 gene locus_tag LOCUS_11090 44205 45245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 45380 46438 gene locus_tag LOCUS_11100 45380 46438 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969639.1 protein_id gnl|my_center|LOCUS_11100 46450 47376 gene locus_tag LOCUS_11110 46450 47376 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_11110 47389 48930 gene locus_tag LOCUS_11120 47389 48930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_11120 49145 50386 gene locus_tag LOCUS_11130 49145 50386 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986588.1 protein_id gnl|my_center|LOCUS_11130 50597 51439 gene locus_tag LOCUS_11140 50597 51439 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_11140 52724 52107 gene locus_tag LOCUS_11150 52724 52107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 53556 52747 gene locus_tag LOCUS_11160 53556 52747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 53673 54821 gene locus_tag LOCUS_11170 53673 54821 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_11170 54818 55192 gene locus_tag LOCUS_11180 54818 55192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 55350 55631 gene locus_tag LOCUS_11190 55350 55631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 55882 56931 gene locus_tag LOCUS_11200 55882 56931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 56961 57134 gene locus_tag LOCUS_11210 56961 57134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 58605 57310 gene locus_tag LOCUS_11220 58605 57310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 59866 58817 gene locus_tag LOCUS_11230 59866 58817 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 protein_id gnl|my_center|LOCUS_11230 60088 61419 gene locus_tag LOCUS_11240 gene codB 60088 61419 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803756.1 protein_id gnl|my_center|LOCUS_11240 61450 62388 gene locus_tag LOCUS_11250 61450 62388 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534771.1 protein_id gnl|my_center|LOCUS_11250 62385 62615 gene locus_tag LOCUS_11260 62385 62615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 <64038 62813 gene locus_tag LOCUS_11270 <64038 62813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966642.1:FAD-dependent oxidoreductase >Feature sequence12 100 357 gene locus_tag LOCUS_11280 100 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 350 610 gene locus_tag LOCUS_11290 350 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2264 1062 gene locus_tag LOCUS_11300 gene ygeW 2264 1062 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_11300 3836 2475 gene locus_tag LOCUS_11310 3836 2475 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 protein_id gnl|my_center|LOCUS_11310 4527 3895 gene locus_tag LOCUS_11320 4527 3895 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_11320 4925 5503 gene locus_tag LOCUS_11330 4925 5503 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404252.1 protein_id gnl|my_center|LOCUS_11330 5654 6454 gene locus_tag LOCUS_11340 5654 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 6814 7560 gene locus_tag LOCUS_11350 6814 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7630 7755 gene locus_tag LOCUS_11360 7630 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 8548 7853 gene locus_tag LOCUS_11370 8548 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 9035 8634 gene locus_tag LOCUS_11380 9035 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 10215 9655 gene locus_tag LOCUS_11390 10215 9655 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_11390 10562 10936 gene locus_tag LOCUS_11400 10562 10936 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_11400 10994 11533 gene locus_tag LOCUS_11410 10994 11533 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_11410 12000 13844 gene locus_tag LOCUS_11420 12000 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 14185 14547 gene locus_tag LOCUS_11430 14185 14547 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_11430 14544 14807 gene locus_tag LOCUS_11440 14544 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 15234 15007 gene locus_tag LOCUS_11450 15234 15007 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097013212.1 protein_id gnl|my_center|LOCUS_11450 15455 15240 gene locus_tag LOCUS_11460 15455 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 16373 15660 gene locus_tag LOCUS_11470 16373 15660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 16753 16376 gene locus_tag LOCUS_11480 16753 16376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 16957 17172 gene locus_tag LOCUS_11490 16957 17172 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_11490 17172 18998 gene locus_tag LOCUS_11500 17172 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 19001 20338 gene locus_tag LOCUS_11510 19001 20338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 20328 23279 gene locus_tag LOCUS_11520 20328 23279 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_11520 23448 23660 gene locus_tag LOCUS_11530 23448 23660 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890274.1 protein_id gnl|my_center|LOCUS_11530 23657 25243 gene locus_tag LOCUS_11540 23657 25243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 25865 26263 gene locus_tag LOCUS_11550 25865 26263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 26229 27815 gene locus_tag LOCUS_11560 26229 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 27899 28231 gene locus_tag LOCUS_11570 27899 28231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 28346 29992 gene locus_tag LOCUS_11580 28346 29992 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_11580 30182 31519 gene locus_tag LOCUS_11590 30182 31519 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_11590 31916 35035 gene locus_tag LOCUS_11600 gene ileS 31916 35035 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_11600 35153 35833 gene locus_tag LOCUS_11610 35153 35833 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_11610 35853 36665 gene locus_tag LOCUS_11620 35853 36665 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_11620 37487 36798 gene locus_tag LOCUS_11630 37487 36798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 37626 38495 gene locus_tag LOCUS_11640 37626 38495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_11640 38476 39126 gene locus_tag LOCUS_11650 38476 39126 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890774.1 protein_id gnl|my_center|LOCUS_11650 39123 39503 gene locus_tag LOCUS_11660 39123 39503 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167463.1 protein_id gnl|my_center|LOCUS_11660 40625 39747 gene locus_tag LOCUS_11670 40625 39747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 41179 40922 gene locus_tag LOCUS_11680 41179 40922 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_11680 42387 41182 gene locus_tag LOCUS_11690 42387 41182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 43853 42501 gene locus_tag LOCUS_11700 43853 42501 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861626.1 protein_id gnl|my_center|LOCUS_11700 44881 43850 gene locus_tag LOCUS_11710 44881 43850 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_11710 45033 46850 gene locus_tag LOCUS_11720 45033 46850 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860923.1 protein_id gnl|my_center|LOCUS_11720 46852 47565 gene locus_tag LOCUS_11730 46852 47565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 47595 48626 gene locus_tag LOCUS_11740 47595 48626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 48628 49287 gene locus_tag LOCUS_11750 48628 49287 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_11750 49371 49847 gene locus_tag LOCUS_11760 49371 49847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 50123 50851 gene locus_tag LOCUS_11770 50123 50851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 50887 52074 gene locus_tag LOCUS_11780 50887 52074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 52497 53366 gene locus_tag LOCUS_11790 52497 53366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 55717 53714 gene locus_tag LOCUS_11800 gene feoB 55717 53714 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_11800 55980 55714 gene locus_tag LOCUS_11810 55980 55714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 56855 56139 gene locus_tag LOCUS_11820 56855 56139 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_11820 57593 56937 gene locus_tag LOCUS_11830 57593 56937 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_11830 58297 57650 gene locus_tag LOCUS_11840 58297 57650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 58387 58734 gene locus_tag LOCUS_11850 58387 58734 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 protein_id gnl|my_center|LOCUS_11850 58759 59580 gene locus_tag LOCUS_11860 gene dapF 58759 59580 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_11860 59687 59762 gene locus_tag LOCUS_t00370 59687 59762 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 61572 60133 gene locus_tag LOCUS_11870 61572 60133 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_11870 62066 61632 gene locus_tag LOCUS_11880 62066 61632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 62343 62047 gene locus_tag LOCUS_11890 62343 62047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 63149 62499 gene locus_tag LOCUS_11900 63149 62499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence13 1948 761 gene locus_tag LOCUS_11910 1948 761 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582704.1 protein_id gnl|my_center|LOCUS_11910 2206 3642 gene locus_tag LOCUS_11920 2206 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3771 4271 gene locus_tag LOCUS_11930 3771 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4268 6133 gene locus_tag LOCUS_11940 4268 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 7073 6390 gene locus_tag LOCUS_11950 7073 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 8757 7528 gene locus_tag LOCUS_11960 8757 7528 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964735.1 protein_id gnl|my_center|LOCUS_11960 9059 10447 gene locus_tag LOCUS_11970 9059 10447 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_11970 10715 12124 gene locus_tag LOCUS_11980 10715 12124 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_11980 12211 13608 gene locus_tag LOCUS_11990 12211 13608 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_11990 13705 14520 gene locus_tag LOCUS_12000 13705 14520 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763805.1 protein_id gnl|my_center|LOCUS_12000 16216 14726 gene locus_tag LOCUS_12010 16216 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 16740 16213 gene locus_tag LOCUS_12020 16740 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 17638 16937 gene locus_tag LOCUS_12030 17638 16937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_12030 18473 17646 gene locus_tag LOCUS_12040 18473 17646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_12040 19546 18473 gene locus_tag LOCUS_12050 19546 18473 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_12050 20447 19560 gene locus_tag LOCUS_12060 20447 19560 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052441.1 protein_id gnl|my_center|LOCUS_12060 21738 20557 gene locus_tag LOCUS_12070 21738 20557 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_12070 23137 22151 gene locus_tag LOCUS_12080 23137 22151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 23037 23234 gene locus_tag LOCUS_12090 23037 23234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 23339 24556 gene locus_tag LOCUS_12100 gene arcA 23339 24556 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870198.1 protein_id gnl|my_center|LOCUS_12100 24562 25578 gene locus_tag LOCUS_12110 gene argF 24562 25578 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_12110 25614 26510 gene locus_tag LOCUS_12120 25614 26510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12120 26465 26656 gene locus_tag LOCUS_12130 26465 26656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 26781 28097 gene locus_tag LOCUS_12140 26781 28097 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_12140 28133 29455 gene locus_tag LOCUS_12150 28133 29455 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_12150 29654 29803 gene locus_tag LOCUS_12160 29654 29803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 29862 30611 gene locus_tag LOCUS_12170 29862 30611 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 protein_id gnl|my_center|LOCUS_12170 30963 30688 gene locus_tag LOCUS_12180 30963 30688 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_12180 31888 31316 gene locus_tag LOCUS_12190 31888 31316 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228042.1 protein_id gnl|my_center|LOCUS_12190 31956 32966 gene locus_tag LOCUS_12200 gene mutY 31956 32966 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 protein_id gnl|my_center|LOCUS_12200 32979 33848 gene locus_tag LOCUS_12210 32979 33848 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263652.1 protein_id gnl|my_center|LOCUS_12210 34097 36208 gene locus_tag LOCUS_12220 34097 36208 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_12220 36601 38727 gene locus_tag LOCUS_12230 36601 38727 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_12230 38753 39427 gene locus_tag LOCUS_12240 gene udk 38753 39427 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293736.1 protein_id gnl|my_center|LOCUS_12240 40561 39587 gene locus_tag LOCUS_12250 gene pfkA 40561 39587 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_12250 41026 41703 gene locus_tag LOCUS_12260 41026 41703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 41732 42928 gene locus_tag LOCUS_12270 41732 42928 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_12270 42942 43307 gene locus_tag LOCUS_12280 42942 43307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 43315 44253 gene locus_tag LOCUS_12290 43315 44253 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704655.1 protein_id gnl|my_center|LOCUS_12290 44216 45778 gene locus_tag LOCUS_12300 gene fdrA 44216 45778 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_12300 45792 47216 gene locus_tag LOCUS_12310 45792 47216 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_12310 47378 48187 gene locus_tag LOCUS_12320 47378 48187 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_12320 48453 48995 gene locus_tag LOCUS_12330 48453 48995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 49059 49892 gene locus_tag LOCUS_12340 49059 49892 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_12340 49911 50396 gene locus_tag LOCUS_12350 49911 50396 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393456.1 protein_id gnl|my_center|LOCUS_12350 50396 52744 gene locus_tag LOCUS_12360 50396 52744 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869170.1 protein_id gnl|my_center|LOCUS_12360 53053 54378 gene locus_tag LOCUS_12370 53053 54378 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080841.1 protein_id gnl|my_center|LOCUS_12370 54675 55844 gene locus_tag LOCUS_12380 54675 55844 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_12380 55855 57615 gene locus_tag LOCUS_12390 55855 57615 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_12390 57615 58289 gene locus_tag LOCUS_12400 57615 58289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 58620 59648 gene locus_tag LOCUS_12410 58620 59648 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_12410 59711 61054 gene locus_tag LOCUS_12420 59711 61054 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence14 1284 127 gene locus_tag LOCUS_12430 1284 127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_12430 2819 1281 gene locus_tag LOCUS_12440 2819 1281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_12440 4401 3130 gene locus_tag LOCUS_12450 4401 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 4644 4814 gene locus_tag LOCUS_12460 4644 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4976 5239 gene locus_tag LOCUS_12470 4976 5239 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236745.1 protein_id gnl|my_center|LOCUS_12470 5364 5819 gene locus_tag LOCUS_12480 gene nrdR 5364 5819 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_12480 5823 6689 gene locus_tag LOCUS_12490 gene pgeF 5823 6689 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_12490 6754 7872 gene locus_tag LOCUS_12500 6754 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 8037 8738 gene locus_tag LOCUS_12510 8037 8738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 protein_id gnl|my_center|LOCUS_12510 8771 11302 gene locus_tag LOCUS_12520 8771 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 11433 13106 gene locus_tag LOCUS_12530 11433 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 15072 13183 gene locus_tag LOCUS_12540 15072 13183 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_12540 15270 15473 gene locus_tag LOCUS_12550 15270 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 15521 16375 gene locus_tag LOCUS_12560 gene cdaA 15521 16375 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_12560 16362 17648 gene locus_tag LOCUS_12570 16362 17648 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966359.1 protein_id gnl|my_center|LOCUS_12570 17747 19357 gene locus_tag LOCUS_12580 17747 19357 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966358.1 protein_id gnl|my_center|LOCUS_12580 19539 21722 gene locus_tag LOCUS_12590 19539 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 21744 23582 gene locus_tag LOCUS_12600 21744 23582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 24543 23662 gene locus_tag LOCUS_12610 24543 23662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 24617 25327 gene locus_tag LOCUS_12620 24617 25327 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964829.1 protein_id gnl|my_center|LOCUS_12620 26505 25384 gene locus_tag LOCUS_12630 26505 25384 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_12630 27080 26541 gene locus_tag LOCUS_12640 27080 26541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 27553 27221 gene locus_tag LOCUS_12650 27553 27221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 28745 27804 gene locus_tag LOCUS_12660 28745 27804 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_12660 29028 30278 gene locus_tag LOCUS_12670 29028 30278 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_12670 30583 31323 gene locus_tag LOCUS_12680 gene surE 30583 31323 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948033.1 protein_id gnl|my_center|LOCUS_12680 31472 32593 gene locus_tag LOCUS_12690 31472 32593 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905271.1 protein_id gnl|my_center|LOCUS_12690 32684 33478 gene locus_tag LOCUS_12700 gene phnC 32684 33478 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 protein_id gnl|my_center|LOCUS_12700 33483 34337 gene locus_tag LOCUS_12710 gene phnE 33483 34337 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131699.1 protein_id gnl|my_center|LOCUS_12710 34352 35212 gene locus_tag LOCUS_12720 gene phnE 34352 35212 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905273.1 protein_id gnl|my_center|LOCUS_12720 35291 36802 gene locus_tag LOCUS_12730 35291 36802 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069266.1 protein_id gnl|my_center|LOCUS_12730 36829 37803 gene locus_tag LOCUS_12740 36829 37803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 39232 38351 gene locus_tag LOCUS_12750 39232 38351 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_12750 39521 39264 gene locus_tag LOCUS_12760 39521 39264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_12760 40159 39557 gene locus_tag LOCUS_12770 40159 39557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808298.1 protein_id gnl|my_center|LOCUS_12770 41071 40190 gene locus_tag LOCUS_12780 41071 40190 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 protein_id gnl|my_center|LOCUS_12780 41219 41821 gene locus_tag LOCUS_12790 41219 41821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 44632 42026 gene locus_tag LOCUS_12800 gene adhE 44632 42026 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_12800 44739 44957 gene locus_tag LOCUS_12810 44739 44957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 45248 45694 gene locus_tag LOCUS_12820 45248 45694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 45861 46118 gene locus_tag LOCUS_12830 45861 46118 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054876196.1 protein_id gnl|my_center|LOCUS_12830 46199 46387 gene locus_tag LOCUS_12840 46199 46387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 47090 46743 gene locus_tag LOCUS_12850 47090 46743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 47209 48609 gene locus_tag LOCUS_12860 47209 48609 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_12860 48694 49083 gene locus_tag LOCUS_12870 48694 49083 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_12870 49080 49589 gene locus_tag LOCUS_12880 49080 49589 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence15 487 1017 gene locus_tag LOCUS_12890 487 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1030 1605 gene locus_tag LOCUS_12900 1030 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 3294 1771 gene locus_tag LOCUS_12910 gene guaA 3294 1771 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965987.1 protein_id gnl|my_center|LOCUS_12910 3875 3291 gene locus_tag LOCUS_12920 3875 3291 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866485.1 protein_id gnl|my_center|LOCUS_12920 5131 4403 gene locus_tag LOCUS_12930 5131 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6128 5145 gene locus_tag LOCUS_12940 6128 5145 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_12940 6295 9129 gene locus_tag LOCUS_12950 6295 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 9126 10415 gene locus_tag LOCUS_12960 gene rimO 9126 10415 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_12960 10412 10951 gene locus_tag LOCUS_12970 gene pgsA 10412 10951 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_12970 10948 12204 gene locus_tag LOCUS_12980 10948 12204 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_12980 12248 13321 gene locus_tag LOCUS_12990 gene recA 12248 13321 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_12990 13921 13436 gene locus_tag LOCUS_13000 13921 13436 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481682.1 protein_id gnl|my_center|LOCUS_13000 14966 13938 gene locus_tag LOCUS_13010 14966 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 15994 15314 gene locus_tag LOCUS_13020 15994 15314 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_13020 16332 16036 gene locus_tag LOCUS_13030 16332 16036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 17087 16485 gene locus_tag LOCUS_13040 gene yihA 17087 16485 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_13040 19446 17068 gene locus_tag LOCUS_13050 gene lon 19446 17068 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_13050 21129 19486 gene locus_tag LOCUS_13060 gene lonB 21129 19486 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392067.1 protein_id gnl|my_center|LOCUS_13060 22096 21281 gene locus_tag LOCUS_13070 gene murI 22096 21281 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_13070 24301 22454 gene locus_tag LOCUS_13080 gene ftsH 24301 22454 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272613.1 protein_id gnl|my_center|LOCUS_13080 26068 24566 gene locus_tag LOCUS_13090 26068 24566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 26823 26317 gene locus_tag LOCUS_13100 gene rplQ 26823 26317 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331497.1 protein_id gnl|my_center|LOCUS_13100 27778 26837 gene locus_tag LOCUS_13110 27778 26837 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357472.1 protein_id gnl|my_center|LOCUS_13110 28455 27829 gene locus_tag LOCUS_13120 gene rpsD 28455 27829 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_13120 28878 28471 gene locus_tag LOCUS_13130 gene rpsK 28878 28471 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_13130 29261 28893 gene locus_tag LOCUS_13140 gene rpsM 29261 28893 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_13140 29724 29503 gene locus_tag LOCUS_13150 gene infA 29724 29503 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_13150 30019 29735 gene locus_tag LOCUS_13160 30019 29735 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966390.1 protein_id gnl|my_center|LOCUS_13160 30780 30016 gene locus_tag LOCUS_13170 gene map 30780 30016 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_13170 31394 30777 gene locus_tag LOCUS_13180 31394 30777 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_13180 32689 31409 gene locus_tag LOCUS_13190 gene secY 32689 31409 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_13190 33132 32689 gene locus_tag LOCUS_13200 gene rplO 33132 32689 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_13200 33333 33151 gene locus_tag LOCUS_13210 gene rpmD 33333 33151 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_13210 33853 33347 gene locus_tag LOCUS_13220 gene rpsE 33853 33347 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_13220 34234 33866 gene locus_tag LOCUS_13230 gene rplR 34234 33866 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705309.1 protein_id gnl|my_center|LOCUS_13230 34795 34256 gene locus_tag LOCUS_13240 gene rplF 34795 34256 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086558.1 protein_id gnl|my_center|LOCUS_13240 35231 34839 gene locus_tag LOCUS_13250 gene rpsH 35231 34839 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_13250 35431 35246 gene locus_tag LOCUS_13260 35431 35246 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_13260 36039 35446 gene locus_tag LOCUS_13270 gene rplE 36039 35446 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_13270 36407 36060 gene locus_tag LOCUS_13280 gene rplX 36407 36060 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258242.1 protein_id gnl|my_center|LOCUS_13280 36789 36421 gene locus_tag LOCUS_13290 gene rplN 36789 36421 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 protein_id gnl|my_center|LOCUS_13290 37065 36808 gene locus_tag LOCUS_13300 gene rpsQ 37065 36808 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_13300 37289 37086 gene locus_tag LOCUS_13310 gene rpmC 37289 37086 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720942.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence16 553 2349 gene locus_tag LOCUS_13320 553 2349 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_13320 2342 3091 gene locus_tag LOCUS_13330 2342 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 4642 3329 gene locus_tag LOCUS_13340 gene mnmE 4642 3329 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722170.1 protein_id gnl|my_center|LOCUS_13340 5533 4700 gene locus_tag LOCUS_13350 5533 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6543 5530 gene locus_tag LOCUS_13360 6543 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6807 6589 gene locus_tag LOCUS_13370 gene yidD 6807 6589 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667653.1 protein_id gnl|my_center|LOCUS_13370 7151 6795 gene locus_tag LOCUS_13380 gene rnpA 7151 6795 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726628.1 protein_id gnl|my_center|LOCUS_13380 8601 7540 gene locus_tag LOCUS_13390 8601 7540 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860623.1 protein_id gnl|my_center|LOCUS_13390 9123 8653 gene locus_tag LOCUS_13400 9123 8653 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_13400 10413 9394 gene locus_tag LOCUS_13410 10413 9394 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_13410 11170 10529 gene locus_tag LOCUS_13420 gene yunB 11170 10529 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_13420 12080 11199 gene locus_tag LOCUS_13430 12080 11199 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870266.1 protein_id gnl|my_center|LOCUS_13430 14180 12111 gene locus_tag LOCUS_13440 gene ftsH 14180 12111 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_13440 14813 14250 gene locus_tag LOCUS_13450 gene hpt 14813 14250 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_13450 16017 14779 gene locus_tag LOCUS_13460 gene tilS 16017 14779 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404456.1 protein_id gnl|my_center|LOCUS_13460 16332 17126 gene locus_tag LOCUS_13470 gene radC 16332 17126 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969427.1 protein_id gnl|my_center|LOCUS_13470 17819 17472 gene locus_tag LOCUS_13480 17819 17472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 17988 17912 gene locus_tag LOCUS_t00380 17988 17912 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18255 18581 gene locus_tag LOCUS_13490 gene darA 18255 18581 CDS product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 protein_id gnl|my_center|LOCUS_13490 18600 19961 gene locus_tag LOCUS_13500 18600 19961 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816666.1 protein_id gnl|my_center|LOCUS_13500 19999 20955 gene locus_tag LOCUS_13510 19999 20955 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_13510 21662 21135 gene locus_tag LOCUS_13520 21662 21135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13520 21934 21632 gene locus_tag LOCUS_13530 21934 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13530 23805 21979 gene locus_tag LOCUS_13540 23805 21979 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_13540 24285 24992 gene locus_tag LOCUS_13550 24285 24992 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_13550 25836 25090 gene locus_tag LOCUS_13560 25836 25090 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107878.1 protein_id gnl|my_center|LOCUS_13560 26375 26010 gene locus_tag LOCUS_13570 gene spoVAE 26375 26010 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_13570 27406 26378 gene locus_tag LOCUS_13580 gene spoVAD 27406 26378 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_13580 27540 27403 gene locus_tag LOCUS_13590 27540 27403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 29337 27715 gene locus_tag LOCUS_13600 29337 27715 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775553.1 protein_id gnl|my_center|LOCUS_13600 30949 29330 gene locus_tag LOCUS_13610 30949 29330 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_13610 32690 31029 gene locus_tag LOCUS_13620 32690 31029 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_13620 33089 32829 gene locus_tag LOCUS_13630 33089 32829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 33682 33491 gene locus_tag LOCUS_13640 33682 33491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 34073 33672 gene locus_tag LOCUS_13650 34073 33672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 35744 34425 gene locus_tag LOCUS_13660 35744 34425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence17 194 550 gene locus_tag LOCUS_13670 194 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2015 630 gene locus_tag LOCUS_13680 2015 630 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_13680 2363 2094 gene locus_tag LOCUS_13690 gene yhbY 2363 2094 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 protein_id gnl|my_center|LOCUS_13690 2781 2395 gene locus_tag LOCUS_13700 2781 2395 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_13700 4113 2839 gene locus_tag LOCUS_13710 gene obgE 4113 2839 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_13710 5867 4419 gene locus_tag LOCUS_13720 gene gltX 5867 4419 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_13720 7793 6156 gene locus_tag LOCUS_13730 7793 6156 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_13730 8407 7847 gene locus_tag LOCUS_13740 8407 7847 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118255.1 protein_id gnl|my_center|LOCUS_13740 10444 8732 gene locus_tag LOCUS_13750 10444 8732 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_13750 12329 10716 gene locus_tag LOCUS_13760 12329 10716 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_13760 13544 12489 gene locus_tag LOCUS_13770 gene tsaD 13544 12489 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_13770 14519 13599 gene locus_tag LOCUS_13780 14519 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 14853 14605 gene locus_tag LOCUS_13790 14853 14605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 15745 14813 gene locus_tag LOCUS_13800 15745 14813 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_13800 17819 15795 gene locus_tag LOCUS_13810 gene uvrB 17819 15795 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_13810 18524 17859 gene locus_tag LOCUS_13820 18524 17859 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678955.1 protein_id gnl|my_center|LOCUS_13820 18820 18521 gene locus_tag LOCUS_13830 18820 18521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 19882 18872 gene locus_tag LOCUS_13840 gene holA 19882 18872 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_13840 21131 19923 gene locus_tag LOCUS_13850 21131 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 21846 21193 gene locus_tag LOCUS_13860 21846 21193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 22719 22000 gene locus_tag LOCUS_13870 gene deoD 22719 22000 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 protein_id gnl|my_center|LOCUS_13870 22909 23916 gene locus_tag LOCUS_13880 gene asnA 22909 23916 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_13880 25501 24152 gene locus_tag LOCUS_13890 gene gdhA 25501 24152 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_13890 25719 27191 gene locus_tag LOCUS_13900 25719 27191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 27564 27319 gene locus_tag LOCUS_13910 27564 27319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 29216 27864 gene locus_tag LOCUS_13920 gene ypeB 29216 27864 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391745.1 protein_id gnl|my_center|LOCUS_13920 29916 29233 gene locus_tag LOCUS_13930 gene sleB 29916 29233 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_13930 30491 29913 gene locus_tag LOCUS_13940 30491 29913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 33342 30856 gene locus_tag LOCUS_13950 gene gyrA 33342 30856 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_13950 <35062 33420 gene locus_tag LOCUS_13960 <35062 33420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815132.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence18 841 512 gene locus_tag LOCUS_13970 841 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1098 838 gene locus_tag LOCUS_13980 1098 838 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_13980 2198 1101 gene locus_tag LOCUS_13990 gene nusA 2198 1101 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_13990 2699 2244 gene locus_tag LOCUS_14000 2699 2244 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_14000 3410 2850 gene locus_tag LOCUS_14010 3410 2850 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583479.1 protein_id gnl|my_center|LOCUS_14010 4816 3410 gene locus_tag LOCUS_14020 4816 3410 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_14020 6039 4843 gene locus_tag LOCUS_14030 6039 4843 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_14030 6405 6052 gene locus_tag LOCUS_14040 6405 6052 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_14040 6708 6427 gene locus_tag LOCUS_14050 6708 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 7648 6929 gene locus_tag LOCUS_14060 7648 6929 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640595.1 protein_id gnl|my_center|LOCUS_14060 8813 7689 gene locus_tag LOCUS_14070 8813 7689 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_14070 9244 8810 gene locus_tag LOCUS_14080 9244 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 9786 9247 gene locus_tag LOCUS_14090 9786 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 10571 9906 gene locus_tag LOCUS_14100 10571 9906 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 protein_id gnl|my_center|LOCUS_14100 11211 10675 gene locus_tag LOCUS_14110 11211 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 11845 11231 gene locus_tag LOCUS_14120 11845 11231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 12027 11848 gene locus_tag LOCUS_14130 12027 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 13229 12030 gene locus_tag LOCUS_14140 13229 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 13624 13226 gene locus_tag LOCUS_14150 gene spoIIIAD 13624 13226 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_14150 13831 13634 gene locus_tag LOCUS_14160 gene spoIIIAC 13831 13634 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393043.1 protein_id gnl|my_center|LOCUS_14160 14362 13847 gene locus_tag LOCUS_14170 14362 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 15303 14338 gene locus_tag LOCUS_14180 gene spoIIIAA 15303 14338 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272423.1 protein_id gnl|my_center|LOCUS_14180 15471 16124 gene locus_tag LOCUS_14190 15471 16124 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814961.1 protein_id gnl|my_center|LOCUS_14190 16144 17385 gene locus_tag LOCUS_14200 16144 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 17427 17906 gene locus_tag LOCUS_14210 17427 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 17910 18425 gene locus_tag LOCUS_14220 17910 18425 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704762.1 protein_id gnl|my_center|LOCUS_14220 19624 18500 gene locus_tag LOCUS_14230 gene dnaJ 19624 18500 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_14230 21562 19706 gene locus_tag LOCUS_14240 gene dnaK 21562 19706 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_14240 22211 21603 gene locus_tag LOCUS_14250 22211 21603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 23260 22214 gene locus_tag LOCUS_14260 gene hrcA 23260 22214 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_14260 24538 23381 gene locus_tag LOCUS_14270 gene hemW 24538 23381 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_14270 26340 24538 gene locus_tag LOCUS_14280 gene lepA 26340 24538 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_14280 26529 27542 gene locus_tag LOCUS_14290 26529 27542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 28255 27650 gene locus_tag LOCUS_14300 28255 27650 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476292.1 protein_id gnl|my_center|LOCUS_14300 29562 28552 gene locus_tag LOCUS_14310 gene gap 29562 28552 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_14310 29831 30655 gene locus_tag LOCUS_14320 29831 30655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 30666 31700 gene locus_tag LOCUS_14330 gene mnmA 30666 31700 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_14330 31997 32353 gene locus_tag LOCUS_14340 31997 32353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 32350 32532 gene locus_tag LOCUS_14350 32350 32532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence19 481 1851 gene locus_tag LOCUS_14360 481 1851 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_14360 2042 2833 gene locus_tag LOCUS_14370 2042 2833 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_14370 3722 2928 gene locus_tag LOCUS_14380 3722 2928 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_14380 4109 5005 gene locus_tag LOCUS_14390 4109 5005 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393277.1 protein_id gnl|my_center|LOCUS_14390 5008 6039 gene locus_tag LOCUS_14400 gene dmpG 5008 6039 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393276.1 protein_id gnl|my_center|LOCUS_14400 6073 7731 gene locus_tag LOCUS_14410 gene ilvD 6073 7731 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584102.1 protein_id gnl|my_center|LOCUS_14410 7811 8575 gene locus_tag LOCUS_14420 7811 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14420 8569 9180 gene locus_tag LOCUS_14430 8569 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14430 9295 10626 gene locus_tag LOCUS_14440 9295 10626 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861590.1 protein_id gnl|my_center|LOCUS_14440 10677 11480 gene locus_tag LOCUS_14450 10677 11480 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978819.1 protein_id gnl|my_center|LOCUS_14450 11477 12196 gene locus_tag LOCUS_14460 11477 12196 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402699.1 protein_id gnl|my_center|LOCUS_14460 15148 12596 gene locus_tag LOCUS_14470 gene xdh 15148 12596 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_14470 18264 15274 gene locus_tag LOCUS_14480 gene ygfK 18264 15274 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_14480 19635 18310 gene locus_tag LOCUS_14490 gene ssnA 19635 18310 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359625.1 protein_id gnl|my_center|LOCUS_14490 19866 21101 gene locus_tag LOCUS_14500 19866 21101 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_14500 21463 22731 gene locus_tag LOCUS_14510 21463 22731 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_14510 22927 24465 gene locus_tag LOCUS_14520 22927 24465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_14520 24458 25558 gene locus_tag LOCUS_14530 24458 25558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_14530 25563 26558 gene locus_tag LOCUS_14540 25563 26558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_14540 26769 27860 gene locus_tag LOCUS_14550 gene serC 26769 27860 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_14550 27880 28794 gene locus_tag LOCUS_14560 27880 28794 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948783.1 protein_id gnl|my_center|LOCUS_14560 29198 31294 gene locus_tag LOCUS_14570 29198 31294 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence20 694 110 gene locus_tag LOCUS_14580 694 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2052 790 gene locus_tag LOCUS_14590 2052 790 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963605.1 protein_id gnl|my_center|LOCUS_14590 2863 2270 gene locus_tag LOCUS_14600 2863 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4230 2860 gene locus_tag LOCUS_14610 gene hydA 4230 2860 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_14610 4404 6107 gene locus_tag LOCUS_14620 gene ade 4404 6107 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439445.1 protein_id gnl|my_center|LOCUS_14620 6135 8417 gene locus_tag LOCUS_14630 gene xdhA 6135 8417 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_14630 8437 9318 gene locus_tag LOCUS_14640 gene xdhB 8437 9318 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_14640 9318 9812 gene locus_tag LOCUS_14650 9318 9812 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948907.1 protein_id gnl|my_center|LOCUS_14650 10056 11327 gene locus_tag LOCUS_14660 10056 11327 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_14660 11435 12607 gene locus_tag LOCUS_14670 11435 12607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 13707 12697 gene locus_tag LOCUS_14680 gene trpS 13707 12697 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_14680 14848 14129 gene locus_tag LOCUS_14690 14848 14129 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047987.1 protein_id gnl|my_center|LOCUS_14690 15624 14860 gene locus_tag LOCUS_14700 15624 14860 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_14700 16355 15624 gene locus_tag LOCUS_14710 16355 15624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 17518 16418 gene locus_tag LOCUS_14720 gene mnmA 17518 16418 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282936.1 protein_id gnl|my_center|LOCUS_14720 17829 17605 gene locus_tag LOCUS_14730 17829 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 17993 19381 gene locus_tag LOCUS_14740 17993 19381 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_14740 19435 20283 gene locus_tag LOCUS_14750 19435 20283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 20291 22489 gene locus_tag LOCUS_14760 20291 22489 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_14760 22509 23159 gene locus_tag LOCUS_14770 22509 23159 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480036.1 protein_id gnl|my_center|LOCUS_14770 23409 23161 gene locus_tag LOCUS_14780 gene spoIIID 23409 23161 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966143.1 protein_id gnl|my_center|LOCUS_14780 23579 23791 gene locus_tag LOCUS_14790 23579 23791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 24521 23766 gene locus_tag LOCUS_14800 24521 23766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 26256 24658 gene locus_tag LOCUS_14810 26256 24658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 27128 26253 gene locus_tag LOCUS_14820 27128 26253 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_14820 28032 27142 gene locus_tag LOCUS_14830 28032 27142 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 protein_id gnl|my_center|LOCUS_14830 29145 28042 gene locus_tag LOCUS_14840 29145 28042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_14840 29433 29993 gene locus_tag LOCUS_14850 gene spoVT 29433 29993 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_14850 30353 30252 gene locus_tag LOCUS_r00010 30353 30252 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence21 870 148 gene locus_tag LOCUS_14860 870 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2494 1157 gene locus_tag LOCUS_14870 2494 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 4424 3045 gene locus_tag LOCUS_14880 4424 3045 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_14880 5603 4791 gene locus_tag LOCUS_14890 5603 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 10672 5702 gene locus_tag LOCUS_14900 10672 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 10784 11101 gene locus_tag LOCUS_14910 10784 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 12242 11430 gene locus_tag LOCUS_14920 12242 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 12486 12881 gene locus_tag LOCUS_14930 12486 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 12994 14223 gene locus_tag LOCUS_14940 12994 14223 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_14940 14238 15845 gene locus_tag LOCUS_14950 14238 15845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 15842 16273 gene locus_tag LOCUS_14960 15842 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 16300 17505 gene locus_tag LOCUS_14970 16300 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 17629 17907 gene locus_tag LOCUS_14980 17629 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 17919 18470 gene locus_tag LOCUS_14990 17919 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 18486 19922 gene locus_tag LOCUS_15000 18486 19922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 19935 20120 gene locus_tag LOCUS_15010 19935 20120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 20149 20949 gene locus_tag LOCUS_15020 20149 20949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 23282 21066 gene locus_tag LOCUS_15030 23282 21066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 24026 23334 gene locus_tag LOCUS_15040 24026 23334 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_15040 24212 25900 gene locus_tag LOCUS_15050 gene argS 24212 25900 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_15050 25905 27185 gene locus_tag LOCUS_15060 gene serS 25905 27185 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_15060 28718 27708 gene locus_tag LOCUS_15070 28718 27708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 29674 28715 gene locus_tag LOCUS_15080 29674 28715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence22 1756 1544 gene locus_tag LOCUS_15090 1756 1544 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_15090 2008 2904 gene locus_tag LOCUS_15100 2008 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 3135 3620 gene locus_tag LOCUS_15110 3135 3620 CDS product DUF3841 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459262.1 protein_id gnl|my_center|LOCUS_15110 5286 3820 gene locus_tag LOCUS_15120 5286 3820 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306203.1 protein_id gnl|my_center|LOCUS_15120 6421 5555 gene locus_tag LOCUS_15130 6421 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 7265 6600 gene locus_tag LOCUS_15140 7265 6600 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203326.1 protein_id gnl|my_center|LOCUS_15140 8202 7279 gene locus_tag LOCUS_15150 8202 7279 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_15150 8514 9008 gene locus_tag LOCUS_15160 8514 9008 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_15160 9075 9428 gene locus_tag LOCUS_15170 9075 9428 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_15170 9425 9850 gene locus_tag LOCUS_15180 9425 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 9867 11162 gene locus_tag LOCUS_15190 9867 11162 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_15190 11159 11485 gene locus_tag LOCUS_15200 11159 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 11482 12219 gene locus_tag LOCUS_15210 11482 12219 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869446.1 protein_id gnl|my_center|LOCUS_15210 12349 12894 gene locus_tag LOCUS_15220 12349 12894 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_15220 12969 13340 gene locus_tag LOCUS_15230 12969 13340 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_15230 13354 15150 gene locus_tag LOCUS_15240 gene nuoF 13354 15150 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_15240 15163 16926 gene locus_tag LOCUS_15250 15163 16926 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_15250 17639 17043 gene locus_tag LOCUS_15260 17639 17043 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_15260 19017 17650 gene locus_tag LOCUS_15270 gene brnQ 19017 17650 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032833879.1 protein_id gnl|my_center|LOCUS_15270 19705 19064 gene locus_tag LOCUS_15280 19705 19064 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_15280 20733 19699 gene locus_tag LOCUS_15290 20733 19699 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_15290 20923 21117 gene locus_tag LOCUS_15300 20923 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 21126 21533 gene locus_tag LOCUS_15310 21126 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 23577 21505 gene locus_tag LOCUS_15320 23577 21505 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_15320 24070 23570 gene locus_tag LOCUS_15330 24070 23570 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_15330 24268 24939 gene locus_tag LOCUS_15340 24268 24939 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_15340 25047 25865 gene locus_tag LOCUS_15350 25047 25865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 27580 26153 gene locus_tag LOCUS_15360 27580 26153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 28983 27667 gene locus_tag LOCUS_15370 gene nagZ 28983 27667 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_15370 29118 29193 gene locus_tag LOCUS_t00390 29118 29193 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 344 1204 gene locus_tag LOCUS_15380 344 1204 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_15380 1224 2708 gene locus_tag LOCUS_15390 gene malQ 1224 2708 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_15390 2841 3743 gene locus_tag LOCUS_15400 2841 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 3795 4727 gene locus_tag LOCUS_15410 gene cysK 3795 4727 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767706.1 protein_id gnl|my_center|LOCUS_15410 5085 6371 gene locus_tag LOCUS_15420 5085 6371 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948973.1 protein_id gnl|my_center|LOCUS_15420 6387 8000 gene locus_tag LOCUS_15430 6387 8000 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_15430 7997 9409 gene locus_tag LOCUS_15440 gene mazG 7997 9409 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099544.1 protein_id gnl|my_center|LOCUS_15440 9497 9769 gene locus_tag LOCUS_15450 9497 9769 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_15450 9956 10573 gene locus_tag LOCUS_15460 gene yedF 9956 10573 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462046.1 protein_id gnl|my_center|LOCUS_15460 10570 11715 gene locus_tag LOCUS_15470 10570 11715 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943290.1 protein_id gnl|my_center|LOCUS_15470 11712 11948 gene locus_tag LOCUS_15480 11712 11948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 12061 12438 gene locus_tag LOCUS_15490 12061 12438 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_15490 12438 13295 gene locus_tag LOCUS_15500 12438 13295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_15500 13292 13918 gene locus_tag LOCUS_15510 13292 13918 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_15510 14058 17204 gene locus_tag LOCUS_15520 14058 17204 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_15520 17231 17578 gene locus_tag LOCUS_15530 17231 17578 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_15530 17575 18327 gene locus_tag LOCUS_15540 17575 18327 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_15540 20025 18427 gene locus_tag LOCUS_15550 20025 18427 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_15550 21936 20107 gene locus_tag LOCUS_15560 gene glmS 21936 20107 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_15560 23311 22067 gene locus_tag LOCUS_15570 gene trpB 23311 22067 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_15570 24348 23779 gene locus_tag LOCUS_15580 24348 23779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 25450 24647 gene locus_tag LOCUS_15590 25450 24647 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_15590 26207 25440 gene locus_tag LOCUS_15600 26207 25440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_15600 26403 26606 gene locus_tag LOCUS_15610 26403 26606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 27000 26599 gene locus_tag LOCUS_15620 27000 26599 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012344.1 protein_id gnl|my_center|LOCUS_15620 27605 26997 gene locus_tag LOCUS_15630 27605 26997 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073032.1 protein_id gnl|my_center|LOCUS_15630 <28473 27607 gene locus_tag LOCUS_15640 <28473 27607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459548.1:ABC transporter permease >Feature sequence24 726 52 gene locus_tag LOCUS_15650 726 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1890 874 gene locus_tag LOCUS_15660 gene gap 1890 874 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_15660 2937 2008 gene locus_tag LOCUS_15670 2937 2008 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_15670 3056 4003 gene locus_tag LOCUS_15680 gene fba 3056 4003 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_15680 5701 4265 gene locus_tag LOCUS_15690 5701 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 6050 5844 gene locus_tag LOCUS_15700 6050 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6378 6196 gene locus_tag LOCUS_15710 6378 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 7459 6371 gene locus_tag LOCUS_15720 7459 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 7813 7523 gene locus_tag LOCUS_15730 gene rpmA 7813 7523 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_15730 8146 7817 gene locus_tag LOCUS_15740 8146 7817 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392095.1 protein_id gnl|my_center|LOCUS_15740 8458 8153 gene locus_tag LOCUS_15750 gene rplU 8458 8153 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_15750 10092 8581 gene locus_tag LOCUS_15760 10092 8581 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_15760 10784 10107 gene locus_tag LOCUS_15770 10784 10107 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_15770 12600 10765 gene locus_tag LOCUS_15780 12600 10765 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_15780 13511 12627 gene locus_tag LOCUS_15790 13511 12627 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392086.1 protein_id gnl|my_center|LOCUS_15790 14196 13513 gene locus_tag LOCUS_15800 14196 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 15354 14254 gene locus_tag LOCUS_15810 15354 14254 CDS product endonuclease subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387048.1 protein_id gnl|my_center|LOCUS_15810 16591 15527 gene locus_tag LOCUS_15820 16591 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 18237 16744 gene locus_tag LOCUS_15830 gene glpK 18237 16744 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_15830 20236 18428 gene locus_tag LOCUS_15840 20236 18428 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_15840 21363 20377 gene locus_tag LOCUS_15850 21363 20377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_15850 22397 21360 gene locus_tag LOCUS_15860 22397 21360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_15860 23476 22415 gene locus_tag LOCUS_15870 23476 22415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_15870 24408 23491 gene locus_tag LOCUS_15880 24408 23491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_15880 25732 24884 gene locus_tag LOCUS_15890 25732 24884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 25914 25839 gene locus_tag LOCUS_t00400 25914 25839 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 27280 25955 gene locus_tag LOCUS_15900 27280 25955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 28035 27364 gene locus_tag LOCUS_15910 28035 27364 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence25 942 259 gene locus_tag LOCUS_15920 gene rsmG 942 259 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_15920 2833 962 gene locus_tag LOCUS_15930 gene mnmG 2833 962 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_15930 4341 2857 gene locus_tag LOCUS_15940 4341 2857 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_15940 5061 4399 gene locus_tag LOCUS_15950 5061 4399 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_15950 5777 5058 gene locus_tag LOCUS_15960 gene nagB 5777 5058 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987104.1 protein_id gnl|my_center|LOCUS_15960 7193 5859 gene locus_tag LOCUS_15970 gene dnaB 7193 5859 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_15970 7648 7205 gene locus_tag LOCUS_15980 gene rplI 7648 7205 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_15980 9603 7645 gene locus_tag LOCUS_15990 9603 7645 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_15990 10625 9600 gene locus_tag LOCUS_16000 10625 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 11004 11867 gene locus_tag LOCUS_16010 11004 11867 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_16010 11864 14041 gene locus_tag LOCUS_16020 11864 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 14022 16115 gene locus_tag LOCUS_16030 14022 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 16144 17175 gene locus_tag LOCUS_16040 16144 17175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 17285 18580 gene locus_tag LOCUS_16050 17285 18580 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_16050 18624 19628 gene locus_tag LOCUS_16060 18624 19628 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_16060 19625 20245 gene locus_tag LOCUS_16070 19625 20245 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836866.1 protein_id gnl|my_center|LOCUS_16070 20762 21634 gene locus_tag LOCUS_16080 20762 21634 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_16080 21634 23031 gene locus_tag LOCUS_16090 gene gltA 21634 23031 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_16090 23405 24406 gene locus_tag LOCUS_16100 23405 24406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 25784 24672 gene locus_tag LOCUS_16110 gene ispD 25784 24672 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_16110 26044 25781 gene locus_tag LOCUS_16120 26044 25781 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722745.1 protein_id gnl|my_center|LOCUS_16120 26515 27174 gene locus_tag LOCUS_16130 26515 27174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence26 854 195 gene locus_tag LOCUS_16140 854 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1976 876 gene locus_tag LOCUS_16150 gene dnaN 1976 876 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_16150 3931 2621 gene locus_tag LOCUS_16160 gene dnaA 3931 2621 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_16160 4154 5146 gene locus_tag LOCUS_16170 4154 5146 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228858.1 protein_id gnl|my_center|LOCUS_16170 5143 5346 gene locus_tag LOCUS_16180 5143 5346 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355974.1 protein_id gnl|my_center|LOCUS_16180 5346 5960 gene locus_tag LOCUS_16190 gene lepB 5346 5960 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_16190 5957 6517 gene locus_tag LOCUS_16200 gene lepB 5957 6517 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965934.1 protein_id gnl|my_center|LOCUS_16200 6895 7857 gene locus_tag LOCUS_16210 gene prmA 6895 7857 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_16210 7854 8567 gene locus_tag LOCUS_16220 7854 8567 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_16220 8564 9859 gene locus_tag LOCUS_16230 gene mtaB 8564 9859 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_16230 9856 10197 gene locus_tag LOCUS_16240 9856 10197 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_16240 10267 11172 gene locus_tag LOCUS_16250 10267 11172 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_16250 11169 11852 gene locus_tag LOCUS_16260 11169 11852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 12476 13396 gene locus_tag LOCUS_16270 gene trxB 12476 13396 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_16270 13535 14893 gene locus_tag LOCUS_16280 gene glmM 13535 14893 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_16280 14890 15543 gene locus_tag LOCUS_16290 gene nth 14890 15543 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_16290 15604 16692 gene locus_tag LOCUS_16300 gene ychF 15604 16692 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_16300 16963 18357 gene locus_tag LOCUS_16310 16963 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 18894 21659 gene locus_tag LOCUS_16320 gene pbpC 18894 21659 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246590.1 protein_id gnl|my_center|LOCUS_16320 21812 22912 gene locus_tag LOCUS_16330 gene murG 21812 22912 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724779.1 protein_id gnl|my_center|LOCUS_16330 22905 24425 gene locus_tag LOCUS_16340 22905 24425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 25327 24497 gene locus_tag LOCUS_16350 gene noc 25327 24497 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_16350 25951 25454 gene locus_tag LOCUS_16360 25951 25454 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946311.1 protein_id gnl|my_center|LOCUS_16360 26577 25948 gene locus_tag LOCUS_16370 26577 25948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence27 1645 1241 gene locus_tag LOCUS_16380 1645 1241 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984124.1 protein_id gnl|my_center|LOCUS_16380 1918 1673 gene locus_tag LOCUS_16390 1918 1673 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_16390 3117 2620 gene locus_tag LOCUS_16400 3117 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3965 3192 gene locus_tag LOCUS_16410 3965 3192 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_16410 4255 4713 gene locus_tag LOCUS_16420 4255 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 4722 5447 gene locus_tag LOCUS_16430 4722 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 8840 5700 gene locus_tag LOCUS_16440 8840 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10221 8866 gene locus_tag LOCUS_16450 10221 8866 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257949.1 protein_id gnl|my_center|LOCUS_16450 10986 10231 gene locus_tag LOCUS_16460 10986 10231 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868662.1 protein_id gnl|my_center|LOCUS_16460 11981 10983 gene locus_tag LOCUS_16470 11981 10983 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030497.1 protein_id gnl|my_center|LOCUS_16470 13287 11986 gene locus_tag LOCUS_16480 gene celF 13287 11986 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145750.1 protein_id gnl|my_center|LOCUS_16480 13552 14700 gene locus_tag LOCUS_16490 13552 14700 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975954.1 protein_id gnl|my_center|LOCUS_16490 16317 15001 gene locus_tag LOCUS_16500 16317 15001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 16601 17410 gene locus_tag LOCUS_16510 16601 17410 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_16510 17996 17739 gene locus_tag LOCUS_16520 17996 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 18431 17997 gene locus_tag LOCUS_16530 18431 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643513.1 protein_id gnl|my_center|LOCUS_16530 20383 18431 gene locus_tag LOCUS_16540 20383 18431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 21317 20493 gene locus_tag LOCUS_16550 gene ispE 21317 20493 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458917.1 protein_id gnl|my_center|LOCUS_16550 21584 22939 gene locus_tag LOCUS_16560 21584 22939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 24453 23125 gene locus_tag LOCUS_16570 24453 23125 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_16570 24622 25761 gene locus_tag LOCUS_16580 24622 25761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 25758 26384 gene locus_tag LOCUS_16590 25758 26384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence28 1349 138 gene locus_tag LOCUS_16600 gene tuf 1349 138 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_16600 3451 1370 gene locus_tag LOCUS_16610 gene fusA 3451 1370 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_16610 3933 3463 gene locus_tag LOCUS_16620 gene rpsG 3933 3463 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699701.1 protein_id gnl|my_center|LOCUS_16620 4320 3946 gene locus_tag LOCUS_16630 gene rpsL 4320 3946 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357676.1 protein_id gnl|my_center|LOCUS_16630 4712 4359 gene locus_tag LOCUS_16640 4712 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 5440 4709 gene locus_tag LOCUS_16650 5440 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 9070 5543 gene locus_tag LOCUS_16660 gene rpoC 9070 5543 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_16660 12791 9111 gene locus_tag LOCUS_16670 gene rpoB 12791 9111 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_16670 13169 13723 gene locus_tag LOCUS_16680 13169 13723 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_16680 14631 14182 gene locus_tag LOCUS_16690 14631 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 15458 14628 gene locus_tag LOCUS_16700 15458 14628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 15611 16438 gene locus_tag LOCUS_16710 15611 16438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 17250 16525 gene locus_tag LOCUS_16720 17250 16525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 17722 17255 gene locus_tag LOCUS_16730 17722 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 17863 18519 gene locus_tag LOCUS_16740 17863 18519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 19980 18625 gene locus_tag LOCUS_16750 19980 18625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 21671 19977 gene locus_tag LOCUS_16760 21671 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 21863 22744 gene locus_tag LOCUS_16770 21863 22744 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812010.1 protein_id gnl|my_center|LOCUS_16770 22757 24103 gene locus_tag LOCUS_16780 gene pepV 22757 24103 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459801.1 protein_id gnl|my_center|LOCUS_16780 24222 24509 gene locus_tag LOCUS_16790 gene rpsF 24222 24509 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462318.1 protein_id gnl|my_center|LOCUS_16790 24547 24966 gene locus_tag LOCUS_16800 gene ssb 24547 24966 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981966.1 protein_id gnl|my_center|LOCUS_16800 24994 25236 gene locus_tag LOCUS_16810 gene rpsR 24994 25236 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence29 1719 289 gene locus_tag LOCUS_16820 1719 289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682073.1 protein_id gnl|my_center|LOCUS_16820 2348 2521 gene locus_tag LOCUS_16830 2348 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3447 2692 gene locus_tag LOCUS_16840 3447 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 3520 3825 gene locus_tag LOCUS_16850 3520 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 3949 4149 gene locus_tag LOCUS_16860 3949 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 4415 4194 gene locus_tag LOCUS_16870 4415 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 4771 4953 gene locus_tag LOCUS_16880 4771 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 6777 5383 gene locus_tag LOCUS_16890 6777 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 10267 6815 gene locus_tag LOCUS_16900 gene mfd 10267 6815 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_16900 11201 10629 gene locus_tag LOCUS_16910 gene pth 11201 10629 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_16910 11786 13816 gene locus_tag LOCUS_16920 gene metG 11786 13816 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_16920 13819 14352 gene locus_tag LOCUS_16930 13819 14352 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895379.1 protein_id gnl|my_center|LOCUS_16930 14364 15146 gene locus_tag LOCUS_16940 14364 15146 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_16940 16303 15446 gene locus_tag LOCUS_16950 16303 15446 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462326.1 protein_id gnl|my_center|LOCUS_16950 17072 16305 gene locus_tag LOCUS_16960 17072 16305 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 protein_id gnl|my_center|LOCUS_16960 17460 18275 gene locus_tag LOCUS_16970 17460 18275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 18902 21313 gene locus_tag LOCUS_16980 gene leuS 18902 21313 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_16980 22008 21595 gene locus_tag LOCUS_16990 22008 21595 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272202.1 protein_id gnl|my_center|LOCUS_16990 22129 22677 gene locus_tag LOCUS_17000 22129 22677 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_17000 22697 23281 gene locus_tag LOCUS_17010 22697 23281 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948225.1 protein_id gnl|my_center|LOCUS_17010 23390 24142 gene locus_tag LOCUS_17020 23390 24142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence30 1531 155 gene locus_tag LOCUS_17030 gene asnS 1531 155 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_17030 1654 2610 gene locus_tag LOCUS_17040 1654 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 4316 2727 gene locus_tag LOCUS_17050 gene pckA 4316 2727 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_17050 5145 8225 gene locus_tag LOCUS_17060 5145 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 8236 8949 gene locus_tag LOCUS_17070 8236 8949 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_17070 9042 9701 gene locus_tag LOCUS_17080 9042 9701 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_17080 10178 11401 gene locus_tag LOCUS_17090 10178 11401 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_17090 11406 11951 gene locus_tag LOCUS_17100 11406 11951 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_17100 12066 13241 gene locus_tag LOCUS_17110 12066 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 14368 13439 gene locus_tag LOCUS_17120 14368 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 14553 15104 gene locus_tag LOCUS_17130 14553 15104 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485423.1 protein_id gnl|my_center|LOCUS_17130 15478 16797 gene locus_tag LOCUS_17140 gene rsxC 15478 16797 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_17140 16807 17736 gene locus_tag LOCUS_17150 16807 17736 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_17150 17729 18292 gene locus_tag LOCUS_17160 17729 18292 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_17160 18294 18926 gene locus_tag LOCUS_17170 18294 18926 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_17170 18919 19530 gene locus_tag LOCUS_17180 gene rsxA 18919 19530 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_17180 19544 20356 gene locus_tag LOCUS_17190 19544 20356 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355995.1 protein_id gnl|my_center|LOCUS_17190 20678 22018 gene locus_tag LOCUS_17200 gene mgtE 20678 22018 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_17200 22205 22585 gene locus_tag LOCUS_17210 22205 22585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 22595 23533 gene locus_tag LOCUS_17220 22595 23533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence31 1940 66 gene locus_tag LOCUS_17230 1940 66 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_17230 2740 1937 gene locus_tag LOCUS_17240 2740 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3338 2817 gene locus_tag LOCUS_17250 3338 2817 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_17250 4089 3397 gene locus_tag LOCUS_17260 4089 3397 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_17260 5300 4086 gene locus_tag LOCUS_17270 5300 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 5658 5293 gene locus_tag LOCUS_17280 5658 5293 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284098.1 protein_id gnl|my_center|LOCUS_17280 6957 5695 gene locus_tag LOCUS_17290 6957 5695 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_17290 7669 6968 gene locus_tag LOCUS_17300 7669 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 9888 7789 gene locus_tag LOCUS_17310 gene pnp 9888 7789 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_17310 10259 10005 gene locus_tag LOCUS_17320 gene rpsO 10259 10005 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_17320 11288 10401 gene locus_tag LOCUS_17330 11288 10401 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_17330 12170 11298 gene locus_tag LOCUS_17340 gene truB 12170 11298 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399352.1 protein_id gnl|my_center|LOCUS_17340 13138 12170 gene locus_tag LOCUS_17350 13138 12170 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_17350 13537 13151 gene locus_tag LOCUS_17360 gene rbfA 13537 13151 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_17360 15649 13550 gene locus_tag LOCUS_17370 15649 13550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 15641 16801 gene locus_tag LOCUS_17380 15641 16801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 16978 17811 gene locus_tag LOCUS_17390 16978 17811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 17808 19154 gene locus_tag LOCUS_17400 gene mnmE 17808 19154 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295261.1 protein_id gnl|my_center|LOCUS_17400 19439 19200 gene locus_tag LOCUS_17410 19439 19200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 19504 20085 gene locus_tag LOCUS_17420 19504 20085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 20623 20132 gene locus_tag LOCUS_17430 20623 20132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 20928 20707 gene locus_tag LOCUS_17440 20928 20707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 21608 20925 gene locus_tag LOCUS_17450 21608 20925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence32 1792 536 gene locus_tag LOCUS_17460 1792 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2000 1773 gene locus_tag LOCUS_17470 2000 1773 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_17470 2491 2012 gene locus_tag LOCUS_17480 2491 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3522 2692 gene locus_tag LOCUS_17490 3522 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4655 3555 gene locus_tag LOCUS_17500 gene prfB 4655 3555 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010959142.1 protein_id gnl|my_center|LOCUS_17500 7419 4669 gene locus_tag LOCUS_17510 gene secA 7419 4669 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_17510 7578 8675 gene locus_tag LOCUS_17520 7578 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462288.1 protein_id gnl|my_center|LOCUS_17520 9224 8784 gene locus_tag LOCUS_17530 9224 8784 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146581.1 protein_id gnl|my_center|LOCUS_17530 10747 9416 gene locus_tag LOCUS_17540 gene gdhA 10747 9416 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_17540 13003 11096 gene locus_tag LOCUS_17550 gene thrS 13003 11096 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965659.1 protein_id gnl|my_center|LOCUS_17550 13390 14694 gene locus_tag LOCUS_17560 gene tig 13390 14694 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_17560 14731 15315 gene locus_tag LOCUS_17570 gene clpP 14731 15315 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461047.1 protein_id gnl|my_center|LOCUS_17570 15361 16665 gene locus_tag LOCUS_17580 gene clpX 15361 16665 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_17580 16857 17798 gene locus_tag LOCUS_17590 16857 17798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 18122 18448 gene locus_tag LOCUS_17600 18122 18448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 18511 18996 gene locus_tag LOCUS_17610 18511 18996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 19504 19428 gene locus_tag LOCUS_t00410 19504 19428 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence33 2023 203 gene locus_tag LOCUS_17620 2023 203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814508.1 protein_id gnl|my_center|LOCUS_17620 2756 2118 gene locus_tag LOCUS_17630 2756 2118 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_17630 3758 2787 gene locus_tag LOCUS_17640 3758 2787 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_17640 5295 4114 gene locus_tag LOCUS_17650 5295 4114 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_17650 6031 9774 gene locus_tag LOCUS_17660 6031 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 10904 10203 gene locus_tag LOCUS_17670 10904 10203 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130060.1 protein_id gnl|my_center|LOCUS_17670 12394 10961 gene locus_tag LOCUS_17680 12394 10961 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_17680 13580 12408 gene locus_tag LOCUS_17690 13580 12408 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_17690 15288 13573 gene locus_tag LOCUS_17700 15288 13573 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_17700 15533 15285 gene locus_tag LOCUS_17710 15533 15285 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_17710 16331 15816 gene locus_tag LOCUS_17720 16331 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence34 212 139 gene locus_tag LOCUS_t00420 212 139 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 794 309 gene locus_tag LOCUS_17730 794 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1426 770 gene locus_tag LOCUS_17740 1426 770 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_17740 2654 1452 gene locus_tag LOCUS_17750 2654 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3242 2805 gene locus_tag LOCUS_17760 3242 2805 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_17760 5318 3585 gene locus_tag LOCUS_17770 5318 3585 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_17770 6735 5353 gene locus_tag LOCUS_17780 6735 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 7639 6779 gene locus_tag LOCUS_17790 7639 6779 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_17790 8720 7659 gene locus_tag LOCUS_17800 8720 7659 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_17800 8917 10560 gene locus_tag LOCUS_17810 8917 10560 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_17810 10600 11433 gene locus_tag LOCUS_17820 gene rsmA 10600 11433 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 protein_id gnl|my_center|LOCUS_17820 11557 13119 gene locus_tag LOCUS_17830 11557 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 13531 13316 gene locus_tag LOCUS_17840 13531 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 14357 13554 gene locus_tag LOCUS_17850 14357 13554 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_17850 15552 14377 gene locus_tag LOCUS_17860 15552 14377 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_17860 16319 15687 gene locus_tag LOCUS_17870 16319 15687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 16479 16566 gene locus_tag LOCUS_t00430 16479 16566 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence35 644 2362 gene locus_tag LOCUS_17880 644 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2453 2680 gene locus_tag LOCUS_17890 2453 2680 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434206.1 protein_id gnl|my_center|LOCUS_17890 2686 3627 gene locus_tag LOCUS_17900 2686 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3781 4908 gene locus_tag LOCUS_17910 3781 4908 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263229.1 protein_id gnl|my_center|LOCUS_17910 4924 5064 gene locus_tag LOCUS_17920 4924 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 5910 5344 gene locus_tag LOCUS_17930 5910 5344 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390032.1 protein_id gnl|my_center|LOCUS_17930 6226 8097 gene locus_tag LOCUS_17940 6226 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 8094 8783 gene locus_tag LOCUS_17950 8094 8783 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence36 6247 2951 gene locus_tag LOCUS_17960 gene addB 6247 2951 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_17960 6768 6244 gene locus_tag LOCUS_17970 gene thpR 6768 6244 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_17970 8030 7248 gene locus_tag LOCUS_17980 gene spo0A 8030 7248 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence37 706 1122 gene locus_tag LOCUS_17990 706 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1140 1910 gene locus_tag LOCUS_18000 1140 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1952 2281 gene locus_tag LOCUS_18010 1952 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2338 2994 gene locus_tag LOCUS_18020 2338 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3104 5005 gene locus_tag LOCUS_18030 3104 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 5102 5974 gene locus_tag LOCUS_18040 5102 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 6153 7409 gene locus_tag LOCUS_18050 6153 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 7779 7931 gene locus_tag LOCUS_18060 7779 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence38 751 458 gene locus_tag LOCUS_18070 751 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1980 883 gene locus_tag LOCUS_18080 gene recF 1980 883 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_18080 2157 2777 gene locus_tag LOCUS_18090 2157 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3399 2839 gene locus_tag LOCUS_18100 3399 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 3703 3488 gene locus_tag LOCUS_18110 3703 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 4650 4198 gene locus_tag LOCUS_18120 4650 4198 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_18120 4817 5191 gene locus_tag LOCUS_18130 4817 5191 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365398.1 protein_id gnl|my_center|LOCUS_18130 5304 5993 gene locus_tag LOCUS_18140 5304 5993 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583790.1 protein_id gnl|my_center|LOCUS_18140 6086 6253 gene locus_tag LOCUS_18150 6086 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence39 3322 440 gene locus_tag LOCUS_18160 3322 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 3588 3319 gene locus_tag LOCUS_18170 3588 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 5003 3915 gene locus_tag LOCUS_18180 5003 3915 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262047.1 protein_id gnl|my_center|LOCUS_18180 5146 5994 gene locus_tag LOCUS_18190 5146 5994 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262046.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence40 108 329 gene locus_tag LOCUS_18200 108 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 326 613 gene locus_tag LOCUS_18210 326 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 691 2427 gene locus_tag LOCUS_18220 691 2427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_18220 3004 3309 gene locus_tag LOCUS_18230 gene rpsJ 3004 3309 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290443.1 protein_id gnl|my_center|LOCUS_18230 3329 3955 gene locus_tag LOCUS_18240 gene rplC 3329 3955 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_18240 3973 4593 gene locus_tag LOCUS_18250 gene rplD 3973 4593 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_18250 4593 4889 gene locus_tag LOCUS_18260 gene rplW 4593 4889 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence41 2208 265 gene locus_tag LOCUS_18270 gene lysS 2208 265 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966473.1 protein_id gnl|my_center|LOCUS_18270 2764 2294 gene locus_tag LOCUS_18280 gene greA 2764 2294 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_18280 3745 2783 gene locus_tag LOCUS_18290 gene dusB 3745 2783 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_18290 4462 3812 gene locus_tag LOCUS_18300 4462 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300